Porcine epidemic diarrhea virus monoclonal neutralizing antibody
By developing the porcine epidemic diarrhea virus monoclonal neutralizing antibody PEDV-4C4F6, the problem of poor immunization effect of PEDV vaccines in existing technologies has been solved, achieving broad-spectrum neutralizing efficacy and large-scale production, and providing an efficient means of virus prevention and control.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING BORUTING BIOTECHNOLOGY CO LTD
- Filing Date
- 2025-11-13
- Publication Date
- 2026-06-16
AI Technical Summary
The lack of effective neutralizing antibodies against porcine epidemic diarrhea virus (PEDV) in existing technologies leads to poor vaccine immunization efficacy and makes it difficult to control the spread and infection of PEDV, especially after the emergence of new variant circulating strains, there is a lack of early detection and effective treatment methods.
To develop a monoclonal neutralizing antibody against porcine epidemic diarrhea virus (PEDV-4C4F6), by clearly disclosing the amino acid sequences and complementarity-determining region (CDR) sequences of its heavy and light chain variable regions and providing the corresponding coding DNA sequences, to support recombinant expression and large-scale production in mammalian cells.
We have obtained a genetically well-defined monoclonal antibody with broad-spectrum neutralizing efficacy, suitable for the prevention and treatment of porcine epidemic diarrhea virus. It can neutralize a variety of representative strains in vitro, providing a highly stable and specific neutralizing antibody preparation that supports large-scale production and quality control traceability.
Smart Images

Figure CN121293334B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of immunology and biotechnology, specifically to a monoclonal neutralizing antibody against porcine epidemic diarrhea virus. Background Technology
[0002] Porcine epidemic diarrhea (PED) is an intestinal infectious disease caused by porcine epidemic diarrhea virus (PEDV), primarily causing symptoms such as vomiting, watery diarrhea, and dehydration in suckling piglets. PEDV can infect pigs of all ages; adult pigs mainly exhibit symptoms such as weight loss and malnutrition, but the mortality rate in suckling piglets under one week old is as high as 80-100%. Since its discovery in the 1970s, PED has seriously affected the healthy development of the global pig industry and is one of the key viral diseases that pig farms must guard against. However, after 2010, PEDV experienced a full-scale outbreak in China, with its virulence and pathogenicity significantly increasing. Between 2010 and 2011, researchers collected more than 600 pig tissue and fecal samples from nine provinces in South China, East China, and Central China, finding a PEDV positivity rate as high as 58.32%.
[0003] The complex infection mechanism of PEDV hinders effective prevention and control. Furthermore, PEDV strain mutations and immunization failure contribute to its persistently high infection rate, especially with the emergence of new circulating variants, making disease prevention and control urgent. Currently, there are no effective drugs for PED prevention and treatment; vaccination is the primary method. However, methods for evaluating the efficacy of PEDV vaccines and for rapidly detecting PEDV antibody levels are still inadequate. Identifying a strong, reactive antigen-antibody pair is crucial for early detection, early treatment, and improved prognosis of related diseases.
[0004] Therefore, developing a neutralizing antibody with high titer, good specificity, and good stability is of great significance for the treatment, vaccine detection, and virus identification of PEDV. Neutralizing antibodies are antibodies produced when pathogenic microorganisms invade the body, playing a crucial role in clearing viruses and preventing disease. The production of neutralizing antibodies is a vital step in the body's clearance of pathogens. Monoclonal antibodies also form the basis for establishing viral serological detection methods. Currently, there is considerable research on PEDV monoclonal antibodies, such as the invention patents "CN110564696A A Monoclonal Antibody with PEDV Neutralizing Activity" and "CN115261331A A Monoclonal Antibody Against PEDV S Protein and Its Application." Although researchers have conducted extensive and in-depth research on PEDV in recent years and adopted various prevention and control measures, there is still no effective means to completely eradicate or prevent the disease.
[0005] To address these issues, this invention proposes a monoclonal neutralizing antibody against porcine epidemic diarrhea virus. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides a monoclonal neutralizing antibody against porcine epidemic diarrhea virus, thereby resolving the problems mentioned in the background section.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] One example is a monoclonal neutralizing antibody against porcine epidemic diarrhea virus (PEDV) named PEDV-4C4F6; wherein the antibody comprises a heavy chain and a light chain, the amino acid sequence of the variable region of the heavy chain is SEQ ID NO:3, and the amino acid sequence of the variable region of the light chain is SEQ ID NO:4.
[0009] The heavy chain variable region includes the following three complementary determination regions: CDR1=GYTFANYW, CDR2=IFPGSGNT, and CDR3=TRTGAFAY.
[0010] The light chain variable region includes the following three complementary determinant regions: CDR1=ENVGTY, CDR2=YGASK, and CDR3=GQSFTYPLT.
[0011] On the other hand, a DNA sequence encoding the antibody PEDV-4C4F6 includes a DNA sequence SEQ ID NO:1 encoding the heavy chain variable region and a DNA sequence SEQ ID NO:2 encoding the light chain variable region.
[0012] The heavy chain variable region encoding DNA sequence is SEQ ID NO:1, wherein the heavy chain variable region DNA contains nucleotide sequences encoding the following CDRs:
[0013] CDR1=GGCTACACATTCGCCAACTACTGG,
[0014] CDR2=ATTTTTCCTGGTAGTGGAAATACT,
[0015] CDR3=ACAAGAACTGGGGCTTTTGCTTAC.
[0016] The light chain variable region encodes a DNA sequence of SEQ ID NO:2; wherein the light chain variable region DNA contains nucleotide sequences encoding the following CDRs:
[0017] CDR1=GAGAATGTGGGAACTTAT,
[0018] CDR2=TACGGGGCATCCAAG,
[0019] CDR3=GGACAGAGTTTCACCTATCCGCTCACG.
[0020] This invention provides a monoclonal neutralizing antibody against porcine epidemic diarrhea virus. It has the following beneficial effects:
[0021] 1. By clearly disclosing the amino acid sequence of the VH / VL variable region and three CDR sequences, a genetically defined monoclonal antibody is obtained, ensuring reproducible preparation and clear claims boundaries.
[0022] 2. By providing the corresponding encoded nucleic acid (SEQ ID NO:1 / 2), a template that can be directly used for cloning and recombinant expression in mammalian cells is obtained, supporting large-scale and consistent production and quality control traceability.
[0023] 3. Through in vitro neutralization experiments on three strains, CV777, AJ1102, and ZL29, the broad-spectrum neutralizing efficacy supported by functional data was obtained, which serves to prove the effectiveness of practical application.
[0024] 4. Through cross-validation between ascites fluid and 293S recombinant sources, antibody preparations with consistent activity from different sources were obtained, demonstrating sequence correctness and process reproducibility, and reducing R&D risks. Attached Figure Description
[0025] Figure 1 The image shows the A280 curve and segmented SDS-PAGE of CHO-expressed PEDV S protein purified by nickel column affinity chromatography.
[0026] Figure 2 Protein affinity chromatography elution curves and fractional SDS-PAGE identification of the PEDV-4C4F6 recombinant antibody;
[0027] Figure 3 The standard curve prepared for antibody concentration determination in Example 3;
[0028] Figure 4 The results of the PEDV-4C4F6 light chain obtained from sequencing were compared with the mouse genome database.
[0029] Figure 5 The results of the PEDV-4C4F6 heavy chain obtained from sequencing were compared with the mouse genome database.
[0030] Figure 6 Protein A affinity chromatography elution curve and segmented SDS-PAGE of the recombinant antibody expressing PEDV-4C4F6 in 293S. Detailed Implementation
[0031] To enable those skilled in the art to understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.
[0032] The anti-PEDV S1 mouse ascites and TMB substrate chromogenic solution used in the embodiments were prepared and preserved in our laboratory. HRP-labeled goat anti-mouse IgG was preserved in our laboratory. PEDV CV777 strain, ZL29 strain, and AJ1102 strain were obtained from commercial suppliers. Unless otherwise specified, the experimental methods described in this invention are conventional methods; the biological materials described, unless otherwise specified, can all be obtained commercially.
[0033] The present invention will now be described in detail with reference to the accompanying drawings:
[0034] Example 1 (refer to) Figure 1 This embodiment provides a screening process for anti-PEDV mouse ascites, and the specific implementation method is as follows:
[0035] 1. Construction, expression, and purification of PEDV S protein recombinant plasmid
[0036] The PEDV S gene sequence was optimized using DNAStar Lasergene v7.1, removing the transmembrane region and secretory peptides to obtain the optimized PEDV S gene. The gene was then synthesized by Suzhou Junji Gene Technology Co., Ltd. and inserted into the pcDNA3.1 vector to obtain the PEDV S recombinant expression plasmid.
[0037] The constructed PEDVS recombinant expression plasmid was transfected into CHO cells, and high-expression cell lines were screened and fermented. The supernatant was purified by nickel column affinity chromatography, and the purified product was collected and identified by SDS-PAGE. Figure 1 As shown, the purified protein that was identified as positive was aliquoted and stored at -80℃ to obtain purified PEDV S recombinant protein.
[0038] 2. Animal Immunization and Hybridoma Cell Preparation
[0039] Purified PEDV S protein was mixed 1:1 with Freund's adjuvant (Merck) and injected intramuscularly into the thigh of 6-week-old female BALB / c mice at a dose of 50 μg / mouse to immunize the mice and induce the production of polyclonal antibodies against PEDV S. A second immunization was performed 2 weeks after the first immunization. Tail blood was collected on day 7 after the second immunization for indirect ELISA to determine antibody titers. After 5 immunizations, spleen lymphocytes from immunized mice were fused with mouse myeloma cells SP2 / 0. The fused cells were seeded in 96-well cell culture plates and cultured in HAT selective medium at 37°C in a 5% CO2 incubator for 14 days. The supernatant of the cells cultured in the 96-well cell culture plates was detected by a PEDV S protein-coated ELISA plate to identify positive wells. Hybridoma cells from positive wells were cultured using a limiting dilution method to achieve monoclonalization. After 14 days of culture, the supernatant from the monoclonal hybridoma cells was analyzed again using a PEDVS-coated ELISA plate to screen for OD. 450 Positive clones with a titer >1.3 were obtained and expanded for cell cryopreservation and preparation of mouse ascites fluid, serving to obtain hybridoma clones that stably express specific antibodies and high-titer ascites fluid samples.
[0040] OD 450 Positive clones with a density >1.3 were inoculated into mice to obtain mouse ascites rich in PEDV-4C4F6 antibody.
[0041] 3. Initial screening of anti-PEDV mouse ascites
[0042] The initial screening of mouse ascites fluid was performed using an indirect ELISA method, as follows:
[0043] (1) The wells of the enzyme-labeled plate were coated with recombinant PEDV S protein and CV777 strain antigen, respectively;
[0044] (2) The ascites fluid of the mice to be tested was diluted at a volume ratio of 1:3000 and added to the coated wells;
[0045] (3) Add HRP-labeled goat anti-mouse IgG diluted 1:5000 as a secondary antibody;
[0046] (4) Use TMB as the chromogenic substrate for color development, and terminate the reaction with 1 M HCl;
[0047] (5) Measure OD using an enzyme-linked immunosorbent assay (ELISA) reader. 450 Value, and in OD 450 A value >0.2 indicates positive ascites in mice.
[0048] The ELISA screening was performed simultaneously in wells coated with recombinant PEDV S protein and wells coated with CV777 viral antigen to determine the binding of the recombinant protein to the natural viral antigen in mouse ascites fluid, thus serving as a preliminary screening for samples with binding activity of polyclonal antibodies. The positive mouse ascites fluid is anti-PEDV mouse ascites fluid.
[0049] Example 2 provides an affinity purification and fractionation collection process for antibodies derived from mouse ascites fluid. The specific implementation method is as follows:
[0050] The AKTA purification system and 1 ml MabSelect purification column (Cytiva) were used, with solution A as the binding buffer and solution B as the elution buffer. Solution A consisted of 50 mM Tris, 300 mM NaCl, and pH 7.2; solution B consisted of 0.1 M glycine, 200 mM NaCl, and pH 3.0. Monoclonal antibodies were purified from the anti-PEDV mouse ascites fluid screened in Example 1. The specific steps are as follows:
[0051] (1) Sample pretreatment: Take 2 ml of mouse ascites fluid, centrifuge at 12000 rpm for 20 min and take the supernatant. Dilute the ascites fluid to 10 ml with solution A, and then filter it with a 0.22 μm filter membrane. After filtration, continue to dilute the ascites fluid to 40 ml with solution A and place it on ice for later use.
[0052] (2) Preparation of AKTA: Turn on the computer host and turn on the AKTA switch. Remove the A and B pipes from the 20% ethanol, rinse the pipes with a wash bottle, and place them in H2O. Set the column pressure and flow rate.
[0053] Column pressure: Manual→1 Pump…→Alarms&Mon→Alarm_Pressure→HighAlarm, input 0.3MPa.
[0054] Flow rate: Pump→Flow→FlowRate, input 1 ml / min.
[0055] (3) Column installation: First, unscrew the nut at the head of the column, let it drip with liquid, and connect it to the machine. Then, unscrew the nut at the tail of the column and connect it to the machine.
[0056] (4) H2O washes AB pump and column.
[0057] Wash AB pumps: Pump → PumpWashBasic → Pump A ON, Pump B ON.
[0058] Column washing: Set to 50%B, then change to 0%B after the column washing is complete.
[0059] (5) Place pipe A into solution A and pipe B into solution B. First, wash pumps A and B with solutions A and B respectively, and then wash the column with solution A. After all parameters have stabilized, perform UV adjustment.
[0060] UV adjustment 0: Alarms&Mon→AutoZero UV.
[0061] (6) Loading: Place the prepared mouse ascites sample on ice and load until the UV drops below 20.
[0062] (7) A liquid wash: A liquid wash A pump, A liquid wash column, and A liquid wash F2 pipeline respectively.
[0063] (8) Washing
[0064] First, set the percentage of solution B: Pump→Gradient→Target→100%B, insert and execute.
[0065] The second step is to prepare to start the collection: Frac→Fraction_900→FracSize 1.3ml, insert it first, and then execute it after UV>20mAu.
[0066] The third step is to prepare to stop collection: Frac → Fraction_Stop_900, insert first, and then execute after UV < 10mAu.
[0067] (9) Continue washing the column with solution B until all parameters are stable; then wash the column with solution A until all parameters are stable; finally wash the AB pump and column with H2O until all parameters are stable.
[0068] (10) Wash pumps A and B and the column with 20% ethanol, then adjust the flow rate to 1 ml / min to collect the column and store the column at 4°C.
[0069] To reassemble the column: Disconnect the lower part of the column from the machine, fill the nut with liquid, and tighten the nut. Then disconnect the upper part of the column from the machine, fill it with liquid, and tighten the nut.
[0070] Example 3, referring to Figure 2 , Figure 3 This embodiment provides the identification of the purified antibody and the determination of its in vitro neutralizing activity in Example 2. The specific implementation method is as follows:
[0071] Verify that the purified antibody in Example 2 is PEDV-4C4F6.
[0072] 1. SDS-PAGE verification
[0073] After purification, the collected flow-through and gradient-eluted filtrate were subjected to SDS-PAGE verification based on the peak patterns obtained from the AKTA protein purification instrument. (Refer to...) Figure 2 The specific steps are as follows:
[0074] (1) Sample preparation: Samples were taken from the beginning, peak and end of the protein peak in the collected flow-through liquid and the gradient elution filtrate. The above samples are the protein samples. 30 μL of protein sample was added to 15 μL of 4×Loading Buffer, mixed well and boiled in a metal bath at 100℃ for 10 min.
[0075] (2) Electrophoresis: Select a 10% separating gel according to the size of the target protein, and load the protein sample at a volume of 5 μL; the stacking gel voltage is 90 V and the separating gel voltage is 120 V for electrophoresis.
[0076] (3) Coomassie brilliant blue staining: Place the protein gel obtained by electrophoresis into Coomassie brilliant blue staining solution and shake slowly on a shaker at room temperature for 30 min.
[0077] (4) Decolorization: Place the stained protein gel into the decolorization solution and shake it slowly on a shaker at room temperature until the target band can be clearly seen and the background is clean.
[0078] The results showed that the purified antibody in Example 2 was PEDV-4C4F6.
[0079] 2. Identification of neutralizing antibody types and subclasses
[0080] The antibody subtypes were identified using the Pierce Rapid ELISA Mouse mAb Isotyping Kit and in accordance with the instructions.
[0081] The results are shown in the table below:
[0082]
[0083] Note: + indicates a positive reaction, and + indicates a negative reaction.
[0084] As shown in the table, the heavy chain subtype of antibody PEDV-4C4F6 is IgG2a, and the light chain type is kappa.
[0085] 3. Antibody concentration determination
[0086] The concentration of the concentrated monoclonal antibody was determined according to the Bradford Protein Quantitative Reagent Kit instructions. The antibody was aliquoted into 1 ml tubes and stored at -20°C for later use. The specific steps are as follows:
[0087] (1) Sample pretreatment: The protein sample to be tested was serially diluted using solution A until the concentration of the diluted sample was within the linear range of the standard curve of the quantitative reagent kit. The dilution of the protein sample to be tested was determined as follows: 5 μL of 0.5 mg / ml BSA standard and the diluted sample were respectively stained with 100 μL of Bradford dye. The result was blue. The appropriate dilution of the protein sample to be tested was determined when the color of the diluted sample was lighter than that of the 0.5 mg / ml BSA standard. Solution A was the same as Solution A in Example 2 above.
[0088] (2) Preparation of standard: Take out the BSA standard from -20℃, let it melt and mix it well for later use.
[0089] (3) Preparation of dye: Take 1 part of Bradford dye and 4 parts of ddH2O, mix them well and set aside.
[0090] (4) Standard curve: Take 10 μL of standard and 200 μL of dye, add to a 96-well microplate or cell plate, and mix well. Use 10 μL of ddH2O as a blank control.
[0091] (5) Sample to be tested: Take 10 μL of sample and 200 μL of dye, add to a 96-well microplate or cell plate, and mix well.
[0092] (6) After 10 minutes at 37℃, OD 570 nm reading.
[0093] (7) Data processing: Using Excel with OD 570 A scatter plot is created with nm values on the x-axis and concentration in mg / ml on the y-axis, as shown below. Figure 3 Add a trend line, using R² greater than or equal to 0.99 as the criterion, to obtain a linear equation. Then, measure the OD of the sample. 570 Substitute the nm value into the equation to calculate the concentration, and then multiply by the dilution factor to obtain the actual concentration of the sample to be tested.
[0094] The results are shown in the table below:
[0095]
[0096] 4. Determination of antibody neutralizing activity
[0097] The neutralizing activity of 32 purified antibodies was detected by in vitro neutralization activity assays. First, the purified antibodies were serially diluted twofold with PBS. Then, the diluted antibodies were incubated with 500 TCID50 of different PEDV strains at 37°C for 1 hour. The resulting virus was then inoculated into Vero cells prepared one day in advance. The lesioning of Vero cells was examined at 24 and 48 hours after inoculation. The neutralizing activity of the antibodies was calculated by statistically analyzing the extent to which different dilutions blocked PEDV infection. The PEDV viruses used included classic strains, vaccine strains, and currently prevalent representative strains: PEDV CV777, vaccine strain AJ1102, and ZL29. The results showed that for all three representative strains, the neutralizing titer of antibody strain PEDV-4C4F6 was greater than 1:512, indicating that antibody strain PEDV-4C4F6 possesses good and broad-spectrum neutralizing activity.
[0098] The results are shown in the table below:
[0099]
[0100] Example 4 (refer to) Figure 4 , Figure 5 This embodiment provides the amplification, cloning, and sequencing of the variable region of the neutralizing antibody PEDV-4C4F6VH and VL. The specific implementation method is as follows:
[0101] Based on the results of the neutralization experiment, hybridoma cells corresponding to monoclonal antibodies with PEDV neutralization titers were selected. Total mRNA from hybridoma cells was retrieved, and cRNA from hybridoma cells was obtained by reverse transcription using reverse transcriptase. The VH and VL variable regions were amplified using PCR enzyme and primers for amplifying the VH and VL variable regions of the antibody. The T vector was ligated using a T vector kit and then sequenced.
[0102] 1. Regulation of total mRNA in tumor cells
[0103] Total mRNA was extracted from hybridoma cells according to the instructions of the RNA extraction kit (NEB: T2010S). The specific steps are as follows:
[0104] (1) Sample pretreatment: Lysis buffer RZ was added directly to the monolayer cell culture plate to lyse the cells, with 1 ml of RZ added per 10 cm2 area. The sample was pumped several times until the solution became clear.
[0105] (2) Place the homogenized sample at room temperature for 5 min to allow the nucleic acid protein complex to be completely separated.
[0106] (3) Centrifuge at 12,000 rpm for 5 min at 4℃, take the supernatant and transfer it into a new RNase-free centrifuge tube.
[0107] (4) Add 200 μl of chloroform, cover the tube, shake vigorously for 15 seconds, and let stand at room temperature for 3 minutes.
[0108] (5) Centrifuge at 12,000 rpm for 10 min at 4℃. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is mainly in the aqueous phase, and the volume of the aqueous phase is 50% of the RZ lysis buffer used. Transfer the aqueous phase to a new tube for the next step.
[0109] (6) Add 0.5 times the volume of anhydrous ethanol and mix well. Transfer the resulting solution and precipitate together into the adsorption column CR3 and centrifuge at 12,000 rpm for 30 sec at 4℃. Add the mixture into the adsorption column CR3 in two batches and centrifuge at 12,000 rpm (~13,400×g) for 30 sec at 4℃. Discard the waste liquid in the collection tube.
[0110] (7) Add 500 μl of protein-removing solution RD with added ethanol to the adsorption column CR3, centrifuge at 12,000 rpm for 30 sec at 4℃, discard the waste liquid, and put CR3 into the collection tube.
[0111] (8) Add 500 μl of ethanol-added wash solution RW to the adsorption column CR3, let stand at room temperature for 2 min, centrifuge at 12,000 rpm for 30 sec at 4℃, and discard the waste liquid.
[0112] (9) Repeat step (8).
[0113] (10) Place the adsorption column into a 2 ml collection tube and centrifuge at 12,000 rpm for 2 min at 4℃ to remove residual liquid.
[0114] (11) Transfer the adsorption column CR3 into a new 1.5 ml centrifuge tube, add 30-100 μl of RNase-Free ddH2O, incubate at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min at 4℃. The elution buffer volume should not be less than 30 μl; too small a volume will affect the recovery efficiency. The eluted solution is the extracted target mRNA.
[0115] 2. Obtaining cDNA
[0116] Following the instructions of the reverse transcription kit, the extracted mRNA was used as a template for reverse transcription. The specific steps are as follows:
[0117] (1) Reverse transcription reaction system:
[0118]
[0119] (2) Reverse transcription reaction procedure: 50℃ for 15 min; 85℃ for 5 s.
[0120] 3. Amplification of the H / L variable region of monoclonal antibody
[0121] Following the PCR enzyme instructions, using cDNA as a template, universal primers were used to amplify the VH and VL variable regions of the antibody. The specific steps are as follows:
[0122] PCR primers:
[0123] VL-F1:GGTGATATCGTGATRACMCARGATGAACTCTC
[0124] VL-F2:GGTGATATCWTGMTGACCCAAWCTCCACTCTC
[0125] VL-F3:GGTGATATCGTKCTCACYCARTCTCCAGCAAT
[0126] VL-R:GGGAAGATGGATCCAGTTGGTGCAGCATCAGC
[0127] VH-F1:GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG
[0128] VH-F2:AGGTSMAACTGCAGSAGTCWGG
[0129] VH-F3:AGGTSMAGCTGCAGSAGTCWGG
[0130] VH-R1:CCAGGGGCCAGTGGATAGACAAGCTTGGGTGTCGTTTT
[0131] Degenerate bases: R:(A,G), M(A,C), S(G,C), W(A,T)
[0132] PCR system:
[0133]
[0134] PCR reaction program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s; 52℃ annealing for 15 s; 72℃ extension for 8 s; 32 cycles in total; 72℃ final extension for 5 min.
[0135] 4. Nucleic acid electrophoresis and gel extraction
[0136] After PCR amplification, nucleic acid electrophoresis was performed using a 1% agarose gel. Finally, the target band was excised using a gel imaging system, and the gel was recovered using a gel recovery kit according to the instructions. The DNA concentration was measured using a NanoDrop micro spectrophotometer.
[0137] 5. Connecting the T-vector and transformation
[0138] After concentration determination, the target fragment was ligated into the T vector according to the T vector kit instructions, and the ligation product was transferred into DH5 competent cells. The specific steps are as follows:
[0139] The target fragment was ligated to the T vector:
[0140] (1) System:
[0141]
[0142] (2) Program: 22℃ for 5 min.
[0143] Transformation:
[0144] (1) Take one 100 μL of DH5a competent cells and place on ice for 5-10 min.
[0145] (2) Add 5 μL of the ligation product to the competent cells and incubate on ice for 30 min. At the same time, set the water bath temperature to 42 °C.
[0146] (3) 42℃ 90s.
[0147] (4) Place on ice for 2-3 minutes. Add 500 μL of antibiotic-free LB and shake at 37°C for 1 hour.
[0148] (5) 5000r for 5min, discard the LB supernatant, resuspend the bacterial cells in the residual liquid, spread them on a solid LB plate containing the antibiotic ampicillin using glass beads, invert the plate, and incubate overnight at 37°C.
[0149] 6. Colony PCR identification and bacterial culture sequencing
[0150] Positive clones in bacterial plates were screened using colony PCR, and the bacterial cultures corresponding to the positive clones were then sent for sequencing. The specific steps are as follows:
[0151] (1) Bacterial PCR system:
[0152]
[0153] (2) Bacterial PCR program: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s; 52℃ annealing for 30 s; 72℃ extension for 30 s; a total of 32 cycles; 72℃ complete extension for 5 min.
[0154] The sequencing results were analyzed to obtain the DNA sequence encoding the variable region of the light and heavy chains of PEDV-4C4F6.
[0155] Sequencing analysis of multiple independent colony clones cloned and selected using the T-vector in this embodiment revealed that the nucleotide sequences of the heavy chain variable region (VH) and the light chain variable region (VL) were completely identical. Figure 4 , Figure 5 As shown, the translated amino acid sequences correspond to SEQ ID NO:3 and SEQ ID NO:4, respectively. The sequencing results indicate that the obtained antibody consists of a single VH and VL pair. Combined with the monoclonal recording of the hybridoma and the evidence of functional consistency in the examples, it can be confirmed that the antibody is the monoclonal neutralizing antibody PEDV-4C4F6 described in this invention.
[0156] Example 5 (refer to) Figure 6 This embodiment provides verification of the DNA sequence of the light and heavy chain variable regions of the monoclonal neutralizing antibody PEDV-4C4F6 and verification of its recombinant expression. The specific implementation method is as follows:
[0157] To verify the correctness of the PEDV-4C4F6 light and heavy chain variable region DNA sequence obtained from sequencing, this study inserted the obtained VL and VH genes into the Kappa chain constant region and γ chain constant region of mice, respectively. Complete light and heavy chain encoding DNA was obtained through gene synthesis, and then the light and heavy chain encoding genes were cloned into the eukaryotic expression vector pcDNA3.1. Recombinant plasmids were extracted and co-transfected into 293S cells. Five days after transfection, the cell culture supernatant was collected, and the recombinant antibody in the supernatant was purified using a Mabselect column. Figure 6 The purified recombinant antibody was subjected to concentration determination and neutralizing activity assay against PEDV virus, using the same purification and neutralizing activity assay methods as before. The test results were consistent with the concentration and neutralizing activity in Example 3.
[0158] Through the systematic implementation of Examples 1–5 above, this invention obtained and validated a monoclonal neutralizing antibody against porcine epidemic diarrhea virus (PEDV) PEDV-4C4F6. This antibody, after in vitro characterization, exhibits the following features and advantages:
[0159] High-titer mouse ascites was obtained by immunizing recombinant PEDV S protein, screening with hybridomas, and amplifying in vivo; high-purity antibodies were obtained by purifying the ascites supernatant using a MabSelect affinity column.
[0160] Subclass identification and molecular sequencing confirmed that the heavy chain subtype of PEDV-4C4F6 is mouse IgG2a and the light chain type is κ (kappa). The variable region amino acid sequences of the heavy chain and light chain are recorded as SEQ ID NO:3 and SEQ ID NO:4, respectively, and the corresponding encoding DNA is recorded as SEQ ID NO:1 and SEQ ID NO:2, respectively.
[0161] In vitro neutralization experiments showed that PEDV-4C4F6 had significant neutralizing activity against the representative PEDV strains tested, including the classic strain CV777, the vaccine strain AJ1102, and the currently prevalent representative strain ZL29. The antibody neutralizing titers were all ≥1:512 under the experimental conditions, indicating that this antibody has good broad-spectrum neutralizing efficacy.
[0162] The antibody can be obtained by amplification through in vivo ascites method or expressed and purified in mammalian cells through recombinant molecular cloning, and is suitable for preventing and controlling passive immunization in pig herds.
[0163] In summary, this invention demonstrates through examples that PEDV-4C4F6 is a monoclonal antibody with a well-defined molecular sequence and functional neutralizing activity.
[0164] It should be particularly noted that the various embodiments listed in this specification and accompanying drawings are intended to illustrate the technical solutions and advantages of the present invention, and not to limit the scope of protection of the present invention. Without departing from the core ideas and technical effects of the present invention, those skilled in the art can make any form of improvement, substitution, combination, or modification to the structural arrangement, process parameters, material selection, control logic, etc., of the described embodiments; any obvious changes based on the same concept should be considered equivalent solutions of the present invention and should be included within the scope of protection defined by the claims of the present invention. The actual scope of protection of the present invention is determined by the appended claims and should be correctly understood in conjunction with the specification and accompanying drawings.
Claims
1. A monoclonal neutralizing antibody against porcine epidemic diarrhea virus, characterized in that... The porcine epidemic diarrhea virus monoclonal neutralizing antibody is PEDV-4C4F6; wherein the antibody comprises a heavy chain and a light chain, the amino acid sequence of the variable region of the heavy chain is SEQ ID NO:3, and the amino acid sequence of the variable region of the light chain is SEQ ID NO:
4.
2. The porcine epidemic diarrhea virus monoclonal neutralizing antibody according to claim 1, characterized in that, The heavy chain variable region contains the following three complementarity-determining regions: the amino acid sequence of CDR1 is GYTFANYW, the amino acid sequence of CDR2 is IFPGSGNT, and the amino acid sequence of CDR3 is TRTGAFAY.
3. The porcine epidemic diarrhea virus monoclonal neutralizing antibody according to claim 1, characterized in that: The light chain variable region contains the following three complementary determinant regions: the amino acid sequence of CDR1 is ENVGTY, the amino acid sequence of CDR2 is YGASK, and the amino acid sequence of CDR3 is GQSFTYPLT.
4. A DNA sequence encoding antibody PEDV-4C4F6, characterized in that, The DNA sequence SEQ ID NO:1 encodes the heavy chain variable region and the DNA sequence SEQ ID NO:2 encodes the light chain variable region.
5. The DNA sequence encoding antibody PEDV-4C4F6 according to claim 4, characterized in that, The heavy chain variable region encodes a DNA sequence as SEQ ID NO:1, wherein the heavy chain variable region DNA contains nucleotide sequences encoding the following CDRs: The nucleotide sequence of CDR1 is GGCTACACATTCGCCAACTACTGG. The nucleotide sequence of CDR2 is ATTTTTCCTGGTAGTGGAAATACT. The nucleotide sequence of CDR3 is ACAAGAACTGGGGCTTTTGCTTAC.
6. The DNA sequence encoding antibody PEDV-4C4F6 according to claim 4, characterized in that, The light chain variable region encodes a DNA sequence of SEQ ID NO:2; wherein the light chain variable region DNA contains nucleotide sequences encoding the following CDRs: The nucleotide sequence of CDR1 is GAGAATGGGAACTTAT. The nucleotide sequence of CDR2 is TACGGGGCATCCAAG. The nucleotide sequence of CDR3 is GGACAGAGTTTCACCTATCCGCTCACG.