High-efficiency sgRNA targeting mouse ifngr1 gene and application thereof

Abstract

The application discloses an sgRNA for efficiently targeting a mouse IFNGR1 gene and application thereof, and belongs to the technical field of biotechnology, and particularly relates to an sgRNA for efficiently targeting a mouse IFNGR1 gene and application thereof. IFNGR1 The nucleotide sequence of the coding gene is Gene ID: 15979, and the update date is September 30, 2025; and the product is a molecule containing an expressible SEQ ID No: 1. The sgRNA developed in the application can target the IFNGR1 coding gene to improve the mutation efficiency of mouse cells.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a highly efficient sgRNA targeting the mouse IFNGR1 gene and its applications. Background Technology

[0002] The CRISPR / Cas9 system is a genome-directed editing technology developed in recent years. This system consists of three parts: the Cas9 endonuclease, CRISPR RNA (crRNA, identical to the target sequence in the genome), and trans-activating CRISPR RNA (tracrRNA). The crRNA and tracrRNA can be fused to simplify into a single-stranded guide RNA (sgRNA). Guided by the sgRNA, the Cas9 protein scans the PAM sequence (5'-NGG-3') in the genome, recognizes and cuts DNA single strands that are identical to or complementary to the crRNA sequence, thereby inducing DNA double-strand breaks at the target site. This activates two repair mechanisms: non-homologous end joining (NHEJ) and homology-directed repair (HDR), enabling precise editing of the target gene. The CRISPR / Cas9 system is characterized by its ease of operation and high efficiency, and is widely used in research in biology, medicine, and agriculture. In mouse research, the main applications of the CRISPR / Cas9 system are to efficiently construct mouse models of gene modifications (knockout, knock-in, conditional editing) and diseases (single-gene genetic diseases, tumors, etc.), conduct functional genomics research (in vivo gene screening, cell fate regulation), and assist in the validation of drug efficacy.

[0003] IFNGR1, the core α subunit of the type II interferon (IFN-γ) receptor, is a recognized "central hub for cellular immune defense and immune homeostasis regulation." IFNGR1 activates the JAK1 / JAK2-STAT1 signaling pathway by forming a heterodimer with IFNGR2, regulating the transcription of numerous immune-related target genes. Its classic functions include activating the antibacterial activity of macrophages, enhancing the antitumor killing effect of cytotoxic T cells, and mediating the clearance of intracellular pathogens (such as Mycobacterium tuberculosis and Listeria). In addition, IFNGR1 also plays important non-classical roles in tissue repair (such as the regenerative regulation of liver injury), cellular metabolic reprogramming (such as regulating the balance between glycolysis and oxidative phosphorylation in macrophages), maintaining inflammatory homeostasis (such as inhibiting the release of excessive pro-inflammatory factors), and the differentiation of immune cell lineages during embryonic development. IFNGR1 is a key molecule for maintaining the body's normal immune defense. Its gene defects can lead to severe primary immunodeficiency diseases, and patients are significantly more susceptible to intracellular pathogens. In cancer, downregulation of IFNGR1 expression or inactivation of IFNGR1 in tumor cells or the tumor microenvironment can weaken IFN-γ-mediated anti-tumor immunity and promote tumor immune escape. In some autoimmune diseases, abnormal enhancement of IFNGR1 signaling may exacerbate immune-mediated tissue damage, making it an important target in immune-related disease research.

[0004] Created based on the CRISPR / Cas9 system IFNGR1 Mutant gene-editing cell and animal models are powerful tools for clinical research. With the continuous maturation and improvement of CRISPR gene-editing technology, gene-editing efficiency is gradually increasing. However, considering the long creation cycle and high cost of gene-edited animals, further screening for genes with higher targeting efficiency is still necessary. IFNGR1 Gene sgRNA can be prepared more quickly, efficiently, and at a lower cost. IFNGR1 Gene mutation immunodeficient mouse models still have important research value. Summary of the Invention

[0005] The main problem to be solved by this invention is to improve IFNGR1 Gene editing efficiency.

[0006] To address the aforementioned problems, this invention provides an application of a substance that regulates the activity or content of IFNGR1.

[0007] This invention first provides the application of substances that regulate the activity or content of IFNGR1 in the preparation of products that improve cell mutation efficiency. IFNGR1 The nucleotide sequence encoding the gene is Gene ID: 15979, updated on September 30, 2025; the product is a molecule containing the expression SEQ ID No:1.

[0008] In the above applications, regulating the activity or content of IFNGR1 means downregulating, inhibiting, or reducing the activity or content of IFNGR1.

[0009] In the above applications, the substance that regulates the activity or content of IFNGR1 contains the substance shown in g1) or g2) below:

[0010] g1) A single-stranded RNA molecule with the nucleotide sequence of SEQ ID No:1;

[0011] g2) A double-stranded DNA molecule consisting of nucleotide sequences SEQ ID No:4 and SEQ ID No:5.

[0012] In the above applications, improving cell mutation efficiency refers to improving the efficiency of mutations in mouse neuroma cells. IFNGR1 Gene mutation efficiency.

[0013] The single-stranded RNA molecules described above also fall within the scope of protection claimed in this invention.

[0014] The present invention also provides a biomaterial, which may be any of the following:

[0015] 1) A recombinant vector containing the expression of the single-stranded RNA molecule described above;

[0016] 2) Recombinant microorganisms containing the recombinant vector described in 1);

[0017] 3) Recombinant cells containing the recombinant vector described in 1);

[0018] 4) Animal cell lines containing the recombinant vector described in 1);

[0019] 5) Animal tissue containing the recombinant vector described in 1);

[0020] 6) Animal organs containing the recombinant vector described in 1).

[0021] In one specific embodiment, 1) the recombinant vector may be pX459-IFNGR1 sgRNA1, pX459-IFNGR1 sgRNA2 and pX459-IFNGR1 sgRNA3.

[0022] The structure of the pX459-IFNGR1 sgRNA1 vector is described as follows: It is a recombinant vector obtained by inserting a Mix sticky end sequence fragment with sequences SEQ ID No:4 and SEQ ID No:5 after annealing between the BbsI restriction sites of the starting vector pX459, while keeping other sequences of the vector pX459 unchanged.

[0023] Furthermore, pX459-IFNGR1 sgRNA1 contains an sgRNA1 gene expression cassette with the nucleotide sequence 5'-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGAGGATCCTGAGCCTCCCTCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttt-3' (SEQ ID No:10). The sgRNA1 gene is shown in nucleotides 251-346 of SEQ ID No:10. Nucleotides 1-241 are the promoter that initiates transcription of the sgRNA1 gene, and nucleotides 347-352 are the termination sequence that terminates transcription of the sgRNA1 gene.

[0024] The structure of the pX459-IFNGR1 sgRNA2 vector is described as follows: It is a recombinant vector obtained by inserting the sequences SEQ ID No:6 and SEQ ID No:7 after annealing between the BbsI restriction sites of the starting vector pX459 and keeping the other sequences of the vector pX459 unchanged.

[0025] Furthermore, pX459-IFNGR1 sgRNA2 contains an sgRNA2 gene expression cassette with the nucleotide sequence 5'-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgATTTTTACTGTACAGGTAAAgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttt-3' (SEQ ID No:11). The sgRNA2 gene is shown in nucleotides 251-346 of SEQ ID No:11. Nucleotides 1-241 are the promoter that initiates transcription of the sgRNA1 gene, and nucleotides 347-352 are the termination sequence that terminates transcription of the sgRNA1 gene.

[0026] The structure of the pX459-IFNGR1 sgRNA3 vector is described as follows: It is a recombinant vector obtained by inserting a mixed sticky end sequence, consisting of SEQ ID No:8 and SEQ ID No:9, between the BbsI restriction sites of the starting vector pX459, after annealing, while keeping other sequences of the vector pX459 unchanged.

[0027] Furthermore, pX459-IFNGR1 sgRNA3 contains an sgRNA3 gene expression cassette with the nucleotide sequence 5'-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGATGTATCTGCCTGGGCCAGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttt-3' (SEQ ID No:12). The sgRNA3 gene is shown in nucleotides 251-346 of SEQ ID No:12. Nucleotides 1-241 are the promoter that initiates transcription of the sgRNA1 gene, and nucleotides 347-352 are the termination sequence that terminates transcription of the sgRNA1 gene.

[0028] In this invention, the cell may be a monoclonal cell.

[0029] The biomaterials mentioned above enhance the cell's... IFNGR1 Applications in gene mutation efficiency also fall within the scope of protection claimed in this invention.

[0030] Furthermore, the cells may be mouse neuroma cells.

[0031] This invention also provides a product for improving cell mutation efficiency, said product containing the following g1) or g2):

[0032] g1) A single-stranded RNA molecule with the nucleotide sequence of SEQ ID No:1;

[0033] g2) A double-stranded DNA molecule consisting of nucleotide sequences SEQ ID No:4 and SEQ ID No:5.

[0034] This study targets IFNGR1 Three sgRNA / crRNAs (with largely overlapping sequences at each target site) were designed in the CDS region of the gene. The gene knockout efficiency of the Cas9 gene editing system was tested at the mouse cell level, and the results were detected by PCR and Sanger sequencing at the monoclonal cell level. IFNGR1 The gene mutation efficiency is as high as 100%. Mice were targeted using the sgRNA provided by this invention. IFNGR1 The gene provides technical support for the efficient creation of IFNGR1 gene-edited mice (immunodeficient mice). Attached Figure Description

[0035] Figure 1 For mice IFNGR1 Schematic diagram of gene structure, crRNA target, and PCR detection.

[0036] Figure 2 for IFNGR1 Diagram of gene base and amino acid mutation types. Detailed Implementation

[0037] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0039] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0040] The mouse neuroma cells used in the following examples were purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd. (Catalog No. CS0050).

[0041] The following examples use statistical software to process the data, and the experimental results are expressed as mean ± standard deviation.

[0042] Example 1, Mice IFNGR1 Efficient Gene Knockout Target Design

[0043] 1. Log in to the NCBI database (www.ncbi.nlm.nih.gov), search for and download the mouse. IFNGR1 Gene sequence (Gene ID: 15979, updated September 30, 2025). Mouse IFNGR1 The gene is approximately 18281 bp in length and consists of 7 exons and 6 introns. Figure 1 ).

[0044] Based on the sgRNA design principles of "general length 20nt; GC content preferably between 40-60%, avoiding endings with more than 4 Ts; if constructing a U6 promoter-driven sgRNA expression vector, the 5' base of the sgRNA should be G or GG to improve its transcription efficiency; and it should be designed on independent exons, as close as possible to the N-terminus of the protein," three Cas9-based crRNAs were designed for the IFNGR1 gene, targeting its first, second, and third exons respectively. The specific sequence information is as follows:

[0045] crRNA1: 5'-GAGGAUCCUGAGCCUCCCUC-3' (SEQ ID No: 1), corresponding to the target sequence (5'-GAGGATCCTGAGCCTCCCTC-3') located at IFNGR1 Positions 227-247 of the gene;

[0046] crRNA2: 5'-UUUACCUGUACAGUAAAAAU-3' (SEQ ID No: 2), corresponding to the target sequence (5'-TTTACCTGTACAGTAAAAAT-3') located at IFNGR1 Positions 5553-5573 of the gene;

[0047] crRNA3:5'-CUGGCCCAGGCAGAUACAUC-3' (SEQ ID No:3), corresponding to the target sequence (5'-CTGGCCCAGGCAGATACATC-3') located at IFNGR1 Positions 9444-9464 of the gene ( Figure 1 ).

[0048] 2. The company synthesized and constructed three primer pairs for pX458-IFNGR1 sgRNA1, pX459-IFNGR1 sgRNA2, and pX458-IFNGR1 sgRNA3:

[0049] crRNA1-F: 5'-caccgGAGGATCCTGAGCCTCCCTC-3' (SEQ ID No: 4), crRNA1-R: 5'-aaacGAGGGAGGCTCAGGATCCTCc-3' (SEQ ID No: 5);

[0050] crRNA2-F: 5'-caccgATTTTTACTGTACAGGTAAA -3' (SEQ ID No: 6), crRNA2-R: 5'-aaacTTTACCTGTACAGTAAAAATc -3' (SEQ ID No: 7);

[0051] crRNA3-F: 5'-caccgGATGTATCTGCCTGGGCCAG-3' (SEQ ID No: 8), crRNA3-R: 5'-aaacCTGGCCCAGGCAGATACATCc-3' (SEQ ID No: 9).

[0052] After synthesizing the above primers, the three pairs of primers were first phosphorylated separately. The 10 μl system consisted of: 1 μl upstream primer (100 μM), 1 μl downstream primer (100 μM), 1 μl T4 ligation buffer (10 ×), 1 μl T4 PNK, and 6 μl lddH2O.

[0053] Annealing was then performed under the following conditions: 37℃ for 30 min, followed by cooling from 95℃ to 25℃ at a rate of 5℃ / min to obtain the Mix viscous end sequence.

[0054] Subsequently, the commercially available empty pX459 plasmid (Addgene plasmid #48138) was digested with BBSI. After gel purification and recovery, the phosphorylated and annealed three pairs of upstream and downstream primers, along with the gel-recovered pX459 empty plasmid, were ligated using T4 ligase under the following conditions: 1 μl annealing mix, 1 μl pX459 digestion product, 1 μl T4 ligation buffer (10 ×), 1 μl T4 ligation, 6 μl ddH2O, and overnight in a 16°C metal bath. Finally, both ligation products were transformed into DH5α competent cells. After plating for 12 hours, single clones were picked, plasmids were extracted, and sent to the company for sequencing verification to confirm correct ligation.

[0055] The structure of the pX459-IFNGR1 sgRNA1 vector is described as follows: It is a recombinant vector obtained by inserting a mixed sticky-end sequence fragment with sequences SEQ ID No:4 and SEQ ID No:5 after annealing between the BbsI restriction sites of the starting vector pX459, while keeping other sequences of the vector pX459 unchanged.

[0056] pX459-IFNGR1 The sgRNA1 contains a nucleotide sequence of 5'-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatg gactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGAGGATCCTGAGCCTCCCTCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaaagtggcaccgagtcggtgctttttt-3' (SEQ ID No:10) sgRNA1 gene expression cassette. The sgRNA1 gene is shown in nucleotides 251-346 of SEQ ID No:10. Nucleotides 1-241 are the promoter that initiates transcription of the sgRNA1 gene, and nucleotides 347-352 are the termination sequence that terminates transcription of the sgRNA1 gene.

[0057] The structure of the pX459-IFNGR1 sgRNA2 vector is described as follows: It is a recombinant vector obtained by inserting the sequences SEQ ID No:6 and SEQ ID No:7, which are annealed, between the BbsI restriction sites of the starting vector pX459 and forming a mixed sticky end sequence, while keeping other sequences of the vector pX459 unchanged.

[0058] pX459-IFNGR1 The sgRNA2 contains a nucleotide sequence of 5'-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatg gactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgATTTTTACTGTACAGGTAAAgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt-3' (SEQ ID No:11) sgRNA2 gene expression cassette. The sgRNA2 gene is shown in nucleotides 251-346 of SEQ ID No:11. Nucleotides 1-241 are the promoter that initiates transcription of the sgRNA1 gene, and nucleotides 347-352 are the termination sequence that terminates transcription of the sgRNA1 gene.

[0059] The structure of the pX459-IFNGR1 sgRNA3 vector is described as follows: It is a recombinant vector obtained by inserting the sequences SEQ ID No:8 and SEQ ID No:9, which are annealed, between the BbsI restriction sites of the starting vector pX459 into a mixed sticky end sequence, while keeping other sequences of the vector pX459 unchanged.

[0060] pX459-IFNGR1 sgRNA3 contains the nucleotide sequence pX459-IFNGR1 The nucleotide sequence contained in sgRNA3 is 5'-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatg gactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGATGTATCTGCCTGGGCCAGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaaagtggcaccgagtcggtgctttttt-3' (SEQ ID The sgRNA3 gene expression cassette (SEQ ID No:12) is shown in nucleotides 251-346 of SEQ ID No:12. Nucleotides 1-241 are the promoter that initiates transcription of the sgRNA1 gene, and nucleotides 347-352 are the termination sequence that terminates transcription of the sgRNA1 gene.

[0061] 3. Use the Tiangen plasmid extraction kit to extract the constructed plasmids pX459-IFNGR1 sgRNA1, pX459-IFNGR1 sgRNA2 and pX459-IFNGR1 sgRNA3. The concentration must be above 1000 ng / μl to be considered acceptable.

[0062] Example 2, Mice IFNGR1 Gene knockout vector transfected cells

[0063] Using Invitrogen's Lip3000 transfection reagent and the accompanying Opti-MEM serum-free medium, 2.5 μg of the target plasmid per well was transfected into N2a mouse neuroma cells in logarithmic growth phase (6-well plate). 6–24 hours post-transfection, the medium was replaced with serum-containing complete medium (DMEM, Beijing Saizhenbo Technology Co., Ltd., catalog number: 11995065, containing 10% FBS, antibiotic-free), and the cells were incubated at 37°C in a 5% CO2 incubator. 48 hours post-transfection, 5000 ng / μL of purine (Beijing Saizhenbo Technology Co., Ltd., catalog number: A1113803) was added to screen for successfully transfected plasmids.

[0064] After transfection, cells were collected, and genomic DNA was extracted from cultured cells using a genomic DNA extraction kit (e.g., DP304) from Tiangen Biotech, along with accompanying cell lysis buffer, proteinase K, binding buffer, washing buffer, and elution buffer. The procedure was as follows: cells in logarithmic growth phase were collected, centrifuged, and the supernatant was discarded. Lysis buffer and proteinase K were added, and the cells were incubated at 56°C until complete lysis. Binding buffer was added and mixed thoroughly. The mixture was transferred to an adsorption column, and centrifuged to adsorb DNA onto the column membrane. The adsorption column was washed sequentially with washing buffer I and washing buffer II to remove impurities, and the remaining liquid was removed by centrifugation. Finally, preheated elution buffer was added to the adsorption column, and after standing, the elution buffer was collected by centrifugation, yielding the genomic DNA. The DNA concentration was measured using a spectrophotometer after extraction.

[0065] Design the following three sets of PCR identification primers:

[0066] PCR-F1: 5'-ccggcaggccgcttgcggacttg-3', PCR-R1: 5'-tgccaaacgctgccgtggaaact-3';

[0067] PCR-F2: 5'-tgtggtccattttgtttctgaat-3', PCR-R2: 5'-tagtcgtgtttctccacttcact-3';

[0068] PCR-F3: 5'-ataatatgggacagcatgcatct-3', PCR-R3: 5'-acacactcactgaaaagttactt-3', were sent to the company for synthesis.

[0069] The amplification lysis buffer was prepared using PrimeSTAR Max DNA Polymerase (Takara). The lysis buffer composition was as follows: 25 μl PrimeSTAR Max Premix (2 ×), 1 μl PCR-F, 1 μl PCR-R, 1 μl lysis buffer, and 22 μl ddH2O. The amplification program was as follows: 94℃ for 2 min 30 s; 94℃ for 10 s, 59℃ for 15 s, and 72℃ for 10 s (35 cycles); 72℃ for 15 s and 4℃ to infinity. After amplification, gel electrophoresis was performed to observe whether the bands were clear and uniform. The remaining PCR products were sent to the company for Sanger sequencing analysis. Figure 2 ).

[0070] The formula for calculating the knockout efficiency is: Gene knockout efficiency (%) = (Number of clones verified to be mutated by sequencing ÷ Total number of randomly selected clones that were successfully sequenced) × 100%.

[0071] The results showed that 50 out of 50 monoclonal cell lines experienced [a specific event / condition]. IFNGR1 Editing the first target site of the gene. IFNGR1 The efficiency of preparing neuroma cells from gene-mutated mice is as high as 100% (Table 1).

[0072] Table 1. Cas9 / sgRNA knockout efficiency in N2a mouse neuroma cells Statistical table

[0073]

[0074] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of substances that regulate IFNGR1 activity in the preparation of products that improve cell mutation efficiency, characterized in that, The nucleotide sequence of the gene encoding IFNGR1 is Gene ID: 15979, updated on September 30, 2025; the substance regulating IFNGR1 activity is an RNA molecule containing the nucleotide sequence SEQ ID No:1, wherein SEQ ID No:1 is crRNA.

2. The application according to claim 1, characterized in that, The substance regulating IFNGR1 activity also contains a double-stranded DNA molecule composed of nucleotide sequences SEQ ID No:4 and SEQ ID No:

5.

3. The application according to claim 1 or 2, characterized in that, The improvement in cell mutation efficiency refers to increasing the efficiency of cell mutation in mouse neuroma cells. IFNGR1 Gene mutation efficiency.

4. An sgRNA molecule, characterized in that, The nucleotide sequence of the sgRNA molecule is SEQ ID No:

10.

5. A biomaterial, characterized in that, The biomaterial is any one of the following: 1) A recombinant vector containing the sgRNA molecule of claim 4; 2) Recombinant microorganisms containing the recombinant vector described in 1); 3) Recombinant cells containing the recombinant vector described in 1); 4) Animal cell lines containing the recombinant vector described in 1).

6. The biomaterial of claim 5 in enhancing the effect of cells IFNGR1 Applications in gene mutation efficiency.

7. The application according to claim 6, characterized in that, The cells in question are mouse neuroma cells.

8. A product that improves cell mutation efficiency, characterized in that, The product contains an sgRNA molecule with the nucleotide sequence shown in SEQ ID No:10.

Images