TRIM50 mutant gene of Jingmen green-shell laying hens and application of TRIM50 mutant gene in regulation and control of cell growth
By identifying the TRIM50 mutant gene in Jingmen green-shelled chickens and constructing a recombinant vector, the shortcomings of existing technologies in poultry research on the TRIM50 gene were addressed. This enabled the construction of a high-viability cell model, promoting cell proliferation and inhibiting apoptosis, thereby enhancing the identification of animal growth performance and molecular breeding capabilities.
Patent Information
- Application Number
- CN202511741797.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-25
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2045-11-25
AI Technical Summary
In existing technologies, the application of the TRIM50 gene of Jingmen green-shelled chicken in poultry research is limited, lacking regulatory effects on cell growth and molecular markers, which affects the progress of molecular-assisted breeding and biomedical research.
The TRIM50 mutant gene was identified in the Jingmen green-shelled chicken population, and recombinant vectors and recombinant microorganisms were constructed. Through transfection of cell models, cell proliferation was significantly promoted and cell apoptosis was inhibited, thus constructing a high-viability cell model.
It provides a highly viable and rapidly proliferating cell model, offering stable, efficient, and reliable biomaterials for the preparation of poultry vaccines and recombinant proteins, reducing costs, increasing yield and quality, and providing new genetic resources for the identification of animal growth performance and molecular-assisted breeding.
Smart Images

Figure CN121344014A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, in particular to a Jingmen green-shelled laying hen TRIM50 mutant gene and application thereof in regulating cell growth. BACKGROUND
[0002] Jingmen green-shelled laying hens have the characteristics of compact body size, moderate size, and various feather colors, but mainly black or mottled, with the characteristics of "five blacks and one green", namely black feathers, black skin, black meat, black bones, black internal organs and green eggshells. Genetic improvement and high-value trait excavation are important directions of current breeding research. The TRIM family is a family related to ubiquitination that is attracting more and more attention. So far, more than 100 different TRIM proteins have been found. Most of the proteins have E3 ubiquitin ligase activity and play various functions in intracellular signal transduction, development, apoptosis, innate immunity, antiviral, autophagy and carcinogenesis. TRIM50 belongs to the three-part motif (TRIM) protein family members and is related to the pathogenesis of various cancers, plays a tumor suppressor role, and can directly induce NLRP3 oligomerization to promote NLRP3 inflammasome activation, participate in NLRP3-related pathogenesis in vivo, and is a potential therapeutic target for related inflammatory diseases. However, the gene is less studied in poultry.
[0003] Therefore, in-depth research on Jingmen green-shelled laying hen TRIM50 gene, research on the regulation of TRIM50 gene on poultry growth, and excavation of potential molecular markers can provide new tools and resources for poultry molecular marker assisted breeding and biomedical research. SUMMARY
[0004] The purpose of the present application is to provide a Jingmen green-shelled laying hen TRIM50 mutant gene and application thereof in regulating cell growth, so as to solve the problems existing in the prior art. A TRIM50 mutant gene is identified in a Jingmen green-shelled laying hen population. Compared with the chicken TRIM50 wild-type gene in NCBI, the mutant gene has no significant effect on cell morphology and protein localization. However, the mutant gene can significantly promote cell proliferation, improve cell viability, and inhibit cell apoptosis. The present application provides a theoretical basis for the mechanism research of Jingmen green-shelled laying hen cell proliferation and apoptosis, technical support for the construction of high-viability cell models, and new genetic resources for the identification of animal growth performance and molecular assisted breeding.
[0005] To achieve the above purpose, the present application provides the following solutions.
[0006] The present application provides a Jingmen green-shelled laying hen TRIM50 mutant gene, wherein the TRIM50 mutant gene is a TRIM50 wild-type gene with the following site variation:
[0007] g.834327 C>T, g.834403 G>A, g.835400 T>C, g.836285 G>A, g.836417 A>T, g.836840 C>A, g.838008 C>T, g.838047 C>T.
[0008] Furthermore, the nucleotide sequence of the TRIM50 mutant gene is shown in SEQ ID NO.4.
[0009] The present invention also provides a recombinant vector containing the above-mentioned TRIM50 mutant gene.
[0010] The present invention also provides a recombinant microorganism comprising the above-described recombinant vector.
[0011] The present invention also provides the use of the above-mentioned TRIM50 mutant gene, the above-mentioned recombinant vector, or the above-mentioned recombinant microorganism in the preparation of products that improve cell viability.
[0012] The present invention also provides the use of the above-mentioned TRIM50 mutant gene, the above-mentioned recombinant vector, or the above-mentioned recombinant microorganism in the preparation of products that enhance cell proliferation capacity.
[0013] The present invention also provides the use of the above-mentioned TRIM50 mutant gene, the above-mentioned recombinant vector, or the above-mentioned recombinant microorganism in the preparation of products that inhibit cell apoptosis.
[0014] The present invention also provides the application of the above-mentioned TRIM50 mutant gene, the above-mentioned recombinant vector, or the above-mentioned recombinant microorganism in the preparation of high-viability cell models.
[0015] Optionally, the cells include chicken fibroblasts.
[0016] The present invention also provides a method for constructing a high-viability cell model, including the step of transferring the above-mentioned TRIM50 mutant gene into the cell model and making it stably expressed in order to improve the viability of the cell model;
[0017] The cell model includes chicken fibroblasts used for virus culture, vaccine development, and cancer research.
[0018] The present invention also provides a product for improving cell viability, wherein the product contains the above-mentioned TRIM50 mutant gene, the above-mentioned recombinant vector, or the above-mentioned recombinant microorganism.
[0019] The present invention discloses the following technical effects:
[0020] This invention identified a TRIM50 mutant gene in a Jingmen green-shelled egg-laying chicken population. Experiments including gene cloning, recombinant plasmid construction, and cell transfection verified that, compared to the wild-type chicken TRIM50 gene in NCBI, this mutant gene had no significant impact on cell morphology or protein localization; however, it significantly promoted cell proliferation, increased cell viability, and inhibited apoptosis. Using this TRIM50 mutant gene, cell models with higher viability and faster proliferation rates can be constructed, providing more stable, efficient, and reliable biological materials for the preparation of poultry vaccines and recombinant proteins, as well as virus culture, thereby improving yield and quality while reducing costs. This invention is of great significance to the field of gene mutation research, providing a theoretical basis for studying the mechanisms of cell proliferation and apoptosis in Jingmen green-shelled egg-laying chickens, providing technical support for the construction of high-viability cell models, and offering new genetic resources for the identification of animal growth performance and molecular-assisted breeding. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 Image showing the location information of the mutation sites g.834327 C>T, g.834403 G>A, g.835400 T>C, and g.836285 G>A in the TRIM50 gene of Jingmen green-shelled chickens;
[0023] Figure 2 Image showing the location information of the mutation sites g.836417 A>T, g.836840 C>A, g.838008 C>T, and g.838047 C>T in the TRIM50 gene of Jingmen green-shelled chickens;
[0024] Figure 3 The graph shows the results of the hydrophilicity / hydrophobicity analysis of TRIM50 wild-type and mutant proteins; where A represents the TRIM50 wild-type protein and B represents the TRIM50 mutant protein.
[0025] Figure 4 Figure 1 shows the results of transmembrane domain analysis of TRIM50 wild-type and mutant proteins; where A represents the TRIM50 wild-type protein and B represents the TRIM50 mutant protein.
[0026] Figure 5 The graph shows the signal peptide analysis results of TRIM50 wild-type and mutant proteins; where A represents TRIM50 wild-type protein and B represents TRIM50 mutant protein.
[0027] Figure 6 Figure showing the subcellular localization results of TRIM50 wild-type and mutant proteins;
[0028] Figure 7 Figure 1 shows the results of secondary domain analysis of TRIM50 wild-type and mutant proteins; where A represents the TRIM50 wild-type protein and B represents the TRIM50 mutant protein.
[0029] Figure 8 Map of TRIM50-WT-pcDNA3.1, a wild-type recombinant plasmid of TRIM50;
[0030] Figure 9 Map of the TRIM50 mutant recombinant plasmid TRIM50-MUT-pcDNA3.1;
[0031] Figure 10 The image shows the results of double enzyme digestion detection of TRIM50 wild-type recombinant plasmid and mutant recombinant plasmid; where A represents the detection result of TRIM50 wild-type recombinant plasmid; B represents the detection result of TRIM50 mutant recombinant plasmid; lane M is the marker, lane 1 is the recombinant plasmid, and lane 2 is the empty vector plasmid.
[0032] Figure 11 The image shows the PCR identification results of TRIM50 wild-type and mutant bacterial suspensions; where A represents the detection results of TRIM50 wild-type bacterial suspension; B represents the detection results of TRIM50 mutant bacterial suspension; lane M is the marker, and lanes 1-5 are positive bacterial suspensions;
[0033] Figure 12 The image shows the PCR identification results of the wild-type and mutant TRIM50 plasmids extracted from the bacterial culture; where A represents the detection results of the wild-type TRIM50 plasmid; B represents the detection results of the mutant TRIM50 plasmid; lane M is the marker, and lane 1 is the wild-type plasmid / mutant plasmid.
[0034] Figure 13 The images show the identification results of plasmid-transfected cells; where A represents the detection results of TRIM50 wild-type / mutant gene expression levels in each group of cells; B represents the Western blot identification results of TRIM50 wild-type / mutant protein in each group of cells; and C represents the detection results of TRIM50 wild-type / mutant protein expression levels in each group of cells.
[0035] Figure 14 The images show the morphology of cells in each group after plasmid transfection; the scale bar is 100 μm.
[0036] Figure 15The graph shows the effects of wild-type and mutant TRIM50 genes on cell proliferation; where A is a bar chart of cell viability assay results; and B is a line chart of cell viability assay results.
[0037] Figure 16 The figure shows the effects of wild-type and mutant TRIM50 genes on apoptosis. Detailed Implementation
[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0039] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0040] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0041] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0042] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.
[0044] Example 1: Obtaining the TRIM50 gene mutation site in Jingmen green-shelled chickens
[0045] Blood samples were collected from 50 Jingmen green-shelled chickens from farms in Hubei Province for testing and recording. The whole genome DNA of the Jingmen green-shelled chickens was extracted using a kit.
[0046] DNA resequencing was performed on 50 Jingmen green-shelled laying hens. The sequencing data were compared with the original chicken TRIM50 gene sequence in NCBI, revealing eight mutation sites in the Jingmen green-shelled laying hen TRIM50 gene: g.834327 C>T, g.834403 G>A, g.835400 T>C, g.836285 G>A, g.836417 A>T, g.836840 C>A, g.838008 C>T, and g.838047 C>T. These mutation sites are all located in exon regions of the gene, resulting in changes in amino acids (see...). Figure 1 and Figure 2 ).
[0047] Example 2: Bioinformatics Analysis of Wild-Type and Mutant TRIM50 Genes in Jingmen Green-Shelled Chickens
[0048] Bioinformatics analysis of the wild-type and mutant TRIM50 gene in Jingmen green-shelled chickens was performed using bioinformatics software such as ProtParam, ProtScale, TMHMM-1.0, SignalP-6.0, PSORT II, SOPMA, SWISS-MODEL, Predicting Antigenic Peptides, and IEDB. The results are as follows:
[0049] 1. Physicochemical property analysis results of TRIM50 wild-type (WT) and mutant (MUT) proteins
[0050] The molecular formula of TRIM50-WT protein is C 2479 H 3916 N 676 O 729 S 27 The relative molecular mass is 55720.08. The TRIM50-WT protein consists of 492 amino acids, including 20 different amino acid types. Its theoretical isoelectric point is 6.58, and its instability index is 47.05, indicating that the TRIM50-WT protein is an unstable protein.
[0051] The molecular formula of TRIM50-MUT protein is C 2486 H 3917 N 669 O 730 S 27The relative molecular mass is 55723.11. The TRIM50-MUT protein is composed of 492 amino acids, including 20 different amino acid types. Its theoretical isoelectric point is 6.33, and its instability index is 47.22, indicating that the TRIM50-MUT protein is an unstable protein.
[0052] 2. Predicted hydrophilicity and hydrophobicity of TRIM50 wild-type and mutant proteins
[0053] Throughout the entire amino acid peptide chain, the average hydrophilicity index of the TRIM50-WT protein is -0.347, and that of the TRIM50-MUT protein is -0.355. Furthermore, both the wild-type and mutant proteins have more hydrophilic amino acid regions than hydrophobic amino acid regions, suggesting that both are predicted to be hydrophilic proteins (see...). Figure 3 ).
[0054] 3. Prediction results of transmembrane domains and signal peptides of TRIM50 wild-type and mutant proteins
[0055] Both TRIM50-WT and TRIM50-MUT proteins are located within the membrane and lack transmembrane structures, making them proteins without transmembrane regions. Furthermore, neither TRIM50-WT nor TRIM50-MUT proteins contain a signal peptide, thus they are non-secretory proteins (see...). Figure 4 and Figure 5 ).
[0056] 4. Subcellular localization results of TRIM50 wild-type and mutant proteins
[0057] Both wild-type and mutant TRIM50 proteins are located 47.8% in the nucleus, 26.1% in the mitochondria, 17.4% in the cytoplasm, and 8.7% in the cytoskeleton (see [link to article]). Figure 6 ).
[0058] 5. TRIM50 wild-type and mutant protein antigenic determinant prediction results
[0059] The TRIM50-WT protein contains 20 potential antigenic determinants, while the TRIM50-MUT protein contains 22 potential antigenic determinants, of which 19 are shared by both.
[0060] 6. TRIM50 prediction results of secondary structure of wild-type and mutant proteins
[0061] Both TRIM50-WT and TRIM50-MUT proteins contain corresponding amino acid compositions: α-helix, random coil, and β-turn of the extended chain (see Table 1 and...). Figure 7 ).
[0062] Table 1. Secondary structure composition ratio of TRIM50 wild-type and mutant proteins (%)
[0063]
[0064] In summary, using various bioinformatics analysis software, this embodiment identified the bioinformatic differences between wild-type (WT) and mutant (MUT) TRIM50 proteins. Bioinformatics analysis showed that the TRIM50 mutant maintained overall structural stability relative to the wild-type, but subtle changes occurred in key local areas. These changes may be the structural root of its subsequent functional alterations. In terms of protein physicochemical properties, the slight differences in molecular formula and molecular weight directly confirmed that an amino acid substitution did occur. Both the wild-type and mutant were classified as unstable proteins, meaning that the mutation did not alter their inherent characteristics of rapid intracellular turnover. Regarding hydrophilicity / hydrophobicity, transmembrane structure, and signal peptide, both are hydrophilic proteins and lack transmembrane structures and signal peptides. These three points indicate that the mutation did not change the protein's fundamental properties and transport fate. It remains a soluble protein that functions in the cytoplasm, not a membrane receptor or secretory factor. The mutation did not alter the cellular localization of the TRIM50 protein; subcellular localization remained consistent. However, key differences existed between the wild-type and mutant in antigenic determinants and secondary structures. Antigenic determinants suggest that mutations alter the local structure of the protein surface, thereby creating new potential antibody-binding epitopes. This indicates that the mutated amino acid is likely located on the protein surface and causes sufficient conformational change. Secondary structure implies that the mutation causes changes in the local way the peptide chain folds, potentially affecting the protein's flexibility, stability, or interfaces with other molecules.
[0065] Example 3: Functional Verification of the Wild-Type and Mutant TRIM50 Genes in Jingmen Green-Shelled Chickens
[0066] 1. Construction of plasmid vectors
[0067] (1) Primer design and validation
[0068] (a) Based on the wild-type TRIM50 gene in chicken from NCBI and the mutant TRIM50 gene sequence obtained by high-throughput sequencing, primers for cloning the wild-type and mutant TRIM50 gene were designed using the NCBI-Primer BLAST program. The expected amplification fragment is 1479 bp. The primers were synthesized by Wuhan Qingke Biotechnology Co., Ltd.
[0069] The primer sequences are as follows:
[0070] F: 5'-TACTGCCGGATGAAGGAGGA-3'; SEQ ID NO.1;
[0071] R: 5'-TCGATGTACCTGTGCAGCTC-3'; SEQ ID NO. 2.
[0072] (b) Using cDNA obtained by reverse transcription of RNA extracted from blood samples of Jingmen green-shelled chickens as a template, the target sequence was cloned using the above-mentioned cloning primers F / R. The reaction system was as follows: 2 μL cDNA template, 0.5 μL each of forward and reverse primers, 10 μL dNTP mixture, and ddH2O to a final volume of 20 μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, for a total of 35 cycles; 72℃ extension for 5 min. The product was temporarily stored at 4℃.
[0073] (c) The PCR products were detected by 1.5% agarose gel electrophoresis. After the electrophoresis was completed, the bands that matched the size of the target gene were selected, cut into gels, and placed in 1.5 mL centrifuge tubes.
[0074] (d) Add 300 μL of Binding Buffer to a centrifuge tube and melt it in a 65°C water bath.
[0075] (e) Once the gel has completely dissolved, transfer it to a centrifuge column, centrifuge at 12000 r / min for 1 min, and discard the filtrate.
[0076] (f) Then add 300 μL Binding Buffer, centrifuge at 15000 r / min for 1 min, and discard the filtrate.
[0077] (g) Add 700 μL Wash Buffer, centrifuge at 12000 r / min for 1 min, and discard the filtrate.
[0078] (h) Repeat the above steps once.
[0079] (i) Centrifuge the centrifuge tubes at 12000 r / min for 2 min to completely remove the Wash Buffer.
[0080] (j) Place the centrifuge column in a new centrifuge tube, add 30 μL of EB elution buffer, and let it stand at room temperature for 5 min (EB elution buffer was incubated in a 65°C water bath for 20 min beforehand).
[0081] (k) Centrifuge the centrifuge tubes at 15,000 rpm for 2 min, recover the product, and store it at -20℃ for later use.
[0082] (2) Carrier connection
[0083] The recovered DNA fragment was ligated into the His vector. The recovered target gene fragment and the vector plasmid were digested with restriction endonucleases NheI and XbaI. The target gene was then cloned into the pcDNA3.1 plasmid vector and ligated overnight at 16°C to construct the recombinant plasmid TRIM50-WT-pcDNA3.1 (plasmid map shown). Figure 8 ) and TRIM50-MUT-pcDNA3.1 (plasmid map see Figure 9 The ligation product should be temporarily stored at -20°C.
[0084] (3) Cloning transformation
[0085] (a) Remove competent E. coli cells and thaw them on ice. Use a pipette to transfer 50 μL of the mixture into a 200 μL PCR tube. Take 20 μL of recombinant plasmids TRIM50-WT-pcDNA3.1 and TRIM50-MUT-pcDNA3.1 and place them into the PCR tube containing competent cells. Gently pipette to mix and incubate on ice for 30 min.
[0086] (b) The competent cells were placed in a 42 °C constant temperature water bath for 45 s for heat shock. Afterwards, the competent cells were quickly placed in an ice bath to complete the transformation process.
[0087] (c) Add 300-500 μL of ampicillin-free LB liquid medium to competent cells and revive the bacterial culture for 1-2 h at 37 ℃ on a constant temperature shaker at 200 rpm.
[0088] (d) Centrifuge the cultured sample at 5000 rpm for 3 min at room temperature to allow the cells to settle at the bottom of the centrifuge tube. Remove excess culture medium and gently pipette to mix the remaining culture medium with the cells. Spread the mixture onto an LB agar plate containing ampicillin. Invert the plate and incubate at 37 °C for 16 h until a complete single colony appears on the plate.
[0089] (4) PCR verification of bacterial culture
[0090] Select plump, single colonies using a 10 μL sterile pipette tip and place them in 1 mL of LB liquid medium containing ampicillin resistance. Incubate at 200 rpm for 4–6 h. Use this bacterial culture as a template for PCR amplification. Detect the PCR products by 1.0% agarose gel electrophoresis. Select positive bacterial culture samples and send them to Wuhan Qingke Biotechnology Co., Ltd. for sequencing.
[0091] The recombinant plasmid was identified by double enzyme digestion, and the positive bacterial culture was identified by PCR. The plasmid extracted from the positive bacterial culture was also identified by PCR. The results showed that the wild-type and mutant recombinant plasmids of the TRIM50 gene were successfully constructed (see...). Figure 10- Figure 12 ).
[0092] The nucleotide sequence (SEQ ID NO.3) of the TRIM50 wild-type gene (TRIM50-WT) is as follows:
[0093]
[0094] The nucleotide sequence (SEQ ID NO.4) of the TRIM50 mutant gene (TRIM50-MUT) is as follows:
[0095] ATGGCTCGGAAGATGAGCATTGACAATCTGGAGGACCAGCTGCTCTGCCCCATCTGCTTGGAGGTCTTCAAGGAGCCCCTGATGCTGCAGTGTGGGCATTCCTACTGCAAGTCCTGTGTACTGTCACTGTCTGGAGAGCTGGATGAGCAGTTACTGTGCCCTGTGTGCCGTAAATCTGTGGACTGCAGTGCTTCACCACCCAACGTCACGCTGGCCCGTATCATTGAGGCACTGCAGAGC T GGGGCGAGACAGAGCCCACCCCAGAATCCTGCCCAACGCACGACAATCCACTGAGCCTCTTCTGCGAGGCTGACC A AGAGGTGATCTGTGGGCTGTGCGGCACAATTGGCAACCACAAGCAGCACAAGATCACCCCTATTTCTACCGCATACTGCCGGATGAAGGAGGAGCTGTCTGTGCTGCTAACCGATGTCCACCGGTGCAAGAGGAACCTGGATGAACTGTTCAGCAAGCTCATCAACAACAAAA C CCGCATTGCGAATGAGGCAGATGTCTTCAAGTGGGTGATCC A GAAGGAGTTTGAGGAGCTGCACAGGTACATCGATGAGGAGAAGGCCACCTTCCTGGAGAGCGTGGAGGGGAAGGCAGCCCAGCTCATCACCTCCATTGAGTCTCAGGTCAAGCAGACATCAGACACCCTGC T GAGGCTGAAGGAGATGCAGAGCATTCTGGAGACACTCGGCAACGAAAGTCAGCTTGATTTCATCCGTAAATACAGCTCCTAC AAGTTCAGGTCAGAGCTTCCTAGCCTACACCCAGGTGATACCATCTTCAGTCCCGTATCCTTCAAGCCTTGTTTCCACCAAGATGACATCAAGATGACTGTGTGGAAGCGGCTGCACCGCCACGTCCTGCCAGCTCCAGAGATGCTGAAACTGGACCCGGTGACAGCACATCCCCTGCTGGAACTCTTCAAGGGTGACACGGTGGTGCAGTGCGGGCTGTACCAGCGCCGGGACAGCAACCCCAAGCGTTTTGACTCCAGCAACTGCATCCTCACCTGCAAGGGCTTCTCCTGCGGCCAGCACTACTGGGAGGTGATCGTGGGCACCAGGAACCACTGGCGCGTGGGCATCATCAAGGGCACAGTCAGCCGCAAAGGGAAGCTCAGCAAGTCTCCCGAGAACGGCGTGTGGCTCATCGGCCTCAAGGAAGGGAAAGTCTATGAGGCCTTCAGCACCCCACGGGCCACGCTGCCGCTGACCGCCCGGCCGCAGCGCATCGGGATCTACCTGCACTACGAGAAGGGCGAGCTGACCTTTTACAACGCCGACAGCCCCGACGAGCTCAGCCCCATCTACACCTTCCAGGCGGAGTTCCAGGGCCAGCTCTACCCCATCGTGGACCTGTGCTGGCCGGAGCGAGGGCCCTTCTCCCCTCCCATCATCCTGCCCG T GCCCGCTGCCGGCCGGCACTCCCAGGGGCCCCCCGCGG T GGAGGAGCCCACCAAGCTGTAG (The bold underlined position is the mutation site).
[0096] 2. Effect of plasmid on cell growth
[0097] Chicken embryo fibroblasts (DF-1 cells) were cultured in 6-well plates and placed in cell crawling slides. When the cell density reached 70%-80%, plasmids were transfected using Lipofectamine 3000. The extracted wild-type TRIM50 gene plasmid TRIM50-WT-pcDNA3.1, the mutant recombinant plasmid TRIM50-MUT-pcDNA3.1, and the empty vector pcDNA3.1 were transfected into DF-1 cells to obtain control cells (pcDNA3.1), wild-type cells (WT-TRIM50-pc), and mutant cells (MUT-TRIM50-pc). qPCR and Western blot analysis showed that both wild-type and mutant TRIM50 plasmids were successfully expressed in the cells, confirming successful plasmid transfection (see [link to qPCR]). Figure 13 ).
[0098] Morphological observation of cells transfected with the recombinant plasmid under a microscope showed that control, wild-type, and mutant DF-1 cells were all spindle-shaped, with no significant difference in cell length or morphology. This demonstrates that gene mutation has no significant effect on cell morphology (see...). Figure 14 ).
[0099] To investigate the effects of wild-type and mutant TRIM50 genes from Jingmen green-shelled chickens on cell growth, cell viability was measured. Using the CCK-8 assay, CCK-8 reagent was added to cell wells transfected with plasmid at different time points (6 h, 12 h, 24 h, 48 h, 72 h). After incubation for 2 h, the absorbance (OD value) at 450 nm was measured using a microplate reader. A blank control group (without plasmid transfection) was also included for comparison. The results showed that, at different time points, the cell viability of mutant cells was consistently higher than that of wild-type cells (see...). Figure 15 This indicates that the TRIM50 mutant gene can promote cell proliferation.
[0100] To further investigate the effects of wild-type and mutant TRIM50 genes from Jingmen green-shelled chickens on cell apoptosis, total RNA was extracted from cells 24 h after plasmid transfection and reverse transcribed into cDNA. The mRNA expression levels of apoptosis-related genes Caspase-3 and Bax / Bcl-2 were detected using SYBR Green qPCR. The results showed that BCL2 expression was significantly higher in mutant cells than in wild-type and control cells; Caspase-3 expression was lower in mutant cells than in wild-type cells, but not significantly different from the control cells; and BAX expression was significantly lower in mutant cells than in wild-type and control cells (see [link to relevant documentation]). Figure 16 This indicates that the TRIM50 mutant gene can inhibit apoptosis.
[0101] In summary, this invention identified a TRIM50 mutant gene from the Jingmen green-shelled chicken population and verified its function in regulating cell proliferation and apoptosis using DF-1 cells as the experimental subject. DF-1 cells are a passageable chicken fibroblast cell line widely used in animal virus research, vaccine development, and cancer research, serving as an important biomaterial for virus transfection and culture. Enhancing the growth performance of DF-1 cells and reducing their apoptosis factor expression helps create a more stable, efficient, and reliable biomanufacturing and research platform. In the production of poultry vaccines and recombinant proteins, highly viable cells are beneficial for increasing yield and quality while reducing costs, improving cell survival and stability under stress conditions such as passage, transfection, and viral infection, extending the production window, and ensuring smooth experiments. Therefore, this invention not only provides theoretical support for studying cell proliferation and apoptosis mechanisms but also provides technical support for constructing high-viability cell models and offers new genetic resources for identifying animal growth performance and molecular-assisted breeding.
[0102] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A Jingmen green shell laying chicken TRIM50 mutant gene, characterized in that, The TRIM50 mutant gene is a variation of the following sites of the chicken TRIM50 wild-type gene in NCBI: g.834327 C>T, g.834403 G>A, g.835400 T>C, g.836285 G>A, g.836417 A>T, g.836840 C>A, g.838008 C>T, g.838047 C>T.
2. The TRIM50 mutant gene according to claim 1, characterized in that, The nucleotide sequence of the TRIM50 mutant gene is shown in SEQ ID NO.
4.
3. A recombinant vector comprising the TRIM50 mutant gene of claim 1 or 2.
4. A recombinant microorganism comprising the recombinant vector of claim 3.
5. Use of the TRIM50 mutant gene of claim 1 or 2, the recombinant vector of claim 3, or the recombinant microorganism of claim 4 in the preparation of a product for improving cell viability.
6. Use of the TRIM50 mutant gene of claim 1 or 2, the recombinant vector of claim 3, or the recombinant microorganism of claim 4 in the preparation of a product for enhancing cell proliferation.
7. Use of the TRIM50 mutant gene of claim 1 or 2, the recombinant vector of claim 3, or the recombinant microorganism of claim 4 in the preparation of a product for inhibiting cell apoptosis.
8. Use of the TRIM50 mutant gene of claim 1 or 2, the recombinant vector of claim 3, or the recombinant microorganism of claim 4 in the preparation of a high-viability cell model.
9. A method of constructing a high-activity cell model, characterized by, comprising introducing the TRIM50 mutant gene of claim 1 or 2 into a cell model for stable expression to improve the viability of the cell model; The cell model includes chicken fibroblasts for virus culture, vaccine development, and cancer research.
10. A product for increasing the viability of cells, characterized in that, The product comprises the TRIM50 mutant gene of claim 1 or 2, the recombinant vector of claim 3, or the recombinant microorganism of claim 4.
Citation Information
Patent Citations
Application of TRIM50 in diagnosis and treatment of esophageal squamous cell carcinoma
CN106011293A
Production of viruses in avian eggs
WO2017088017A1