Highly skin-permeable recombinant humanized collagen type 17 and application thereof

By designing highly transdermal recombinant humanized type 17 collagen, and utilizing membrane-penetrating peptides and specific nucleic acid molecules, highly efficient transdermal absorption of collagen was achieved, solving the problem of low transdermal efficiency of recombinant humanized type 17 collagen and improving the effects of cosmetics and skin repair.

CN121471377BActive Publication Date: 2026-05-08SHANDONG FREDA PHARMA GRP CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610018117.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-05-08
Estimated Expiration
2046-01-08

AI Technical Summary

Technical Problem

Recombinant human type 17 collagen has extremely low transdermal absorption efficiency and cannot effectively reach the basal layer of the epidermis, limiting its application in cosmetics and skin repair.

Method used

A highly transdermal recombinant humanized type 17 collagen protein was designed, consisting of a membrane-penetrating peptide segment and a collagen segment. The membrane-penetrating peptide segment is SPACE, TAT, or ANTP. It achieves efficient transdermal absorption by mediating the adhesion and migration of keratinocytes and binding to specific nucleic acid molecules and recombinant vectors.

Benefits of technology

It achieves highly efficient transdermal absorption of recombinant humanized type 17 collagen, which can effectively penetrate the stratum corneum of the skin and reach the basal layer of the epidermis, thereby enhancing the product's repair and anti-aging effects. It is suitable for cosmetics and pharmaceuticals.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121471377B_ABST
    Figure CN121471377B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and relates to a high-skin-permeability recombinant humanized collagen type 17 and application. The high-skin-permeability recombinant humanized collagen type 17 is composed of a transmembrane peptide segment and a collagen segment, the collagen segment is an amino acid sequence as shown in SEQ ID NO: 1, and the transmembrane peptide segment is a transmembrane peptide SPACE, TAT or ANTP. The high-skin-permeability recombinant humanized collagen type 17 provided by the application not only has a high skin permeation efficiency, but also has various biological functions such as barrier repair, firming and anti-wrinkle, and is beneficial to efficient application in the fields of cosmetics, medicine and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to a highly transdermal recombinant humanized type 17 (XVII) collagen and its applications. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Type 17 (XVII) collagen (COL17) is a core functional protein found in the basal layer of the epidermis. COL17 is a key component in maintaining the "anchoring connection" between the epidermis and dermis, crucial for stabilizing the basement membrane and preventing epidermal shedding. Simultaneously, COL17 also regulates the activity of epidermal stem cells, promoting orderly epidermal cell turnover and maintaining the skin barrier's continuous repair capacity. Therefore, COL17 is considered a "guardian of the integrity of the skin's basement membrane" and a "key target for anti-aging." However, with age (e.g., after age 30, the rate of COL17 synthesis decreases by 1%-2% annually), ultraviolet radiation (UVB can induce a 3-5 fold increase in COL17-degrading enzyme activity), environmental pollution, and unhealthy lifestyle habits, the content of COL17 in the skin gradually decreases, and its function significantly declines. On the one hand, the anchoring structure of the basement membrane loosens, leading to a widening gap between the epidermis and dermis, decreased skin elasticity, and sagging. On the other hand, the efficiency of epidermal stem cell renewal decreases, weakening the skin barrier's repair capacity, resulting in the appearance of aging characteristics such as dryness, sensitivity, and wrinkles.

[0004] To address skin aging, exogenous COL17 supplementation has become a core research direction in the fields of cosmetics and dermatological repair. Compared to animal-derived COL17, recombinant human type 17 collagen has significant advantages such as low immunogenicity, high biocompatibility, and clear functional targeting, making it an ideal material to replace traditional collagen. However, the core technological bottleneck currently limiting the application of recombinant human type 17 collagen is its extremely low transdermal absorption efficiency. This is because recombinant proteins generally have high molecular weights (far exceeding the 500 Da permeability threshold of the stratum corneum) and exhibit a linear, rigid conformation, making it difficult for them to penetrate the structural barrier of the stratum corneum. Transdermal absorption is less than 5%, with most active ingredients remaining only on the skin surface and unable to effectively reach the target sites in the epidermal basal layer to exert their repair and anti-aging effects. Therefore, it is necessary to develop efficient and safe technologies that can promote COL17 transdermal absorption, thereby facilitating the efficient application of COL17 in cosmetics and pharmaceuticals. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the purpose of this invention is to provide a highly transdermal recombinant humanized type 17 collagen and its applications. The highly transdermal recombinant humanized type 17 collagen provided by this invention not only has high skin penetration efficiency, but also possesses multiple biological functions such as barrier repair, firming and anti-wrinkle effects, which is beneficial for its efficient application in cosmetics, pharmaceuticals and other fields.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows:

[0007] In a first aspect, a highly transdermal recombinant humanized type 17 collagen protein is composed of a membrane-penetrating peptide segment and a collagen segment, wherein the collagen segment has an amino acid sequence as shown in SEQ ID NO: 1, and the membrane-penetrating peptide segment is a membrane-penetrating peptide SPACE, TAT, or ANTP.

[0008] The collagen provided by this invention incorporates multiple KGD active motifs in its collagen segments through amino acid sequence design. These motifs mediate keratinocyte adhesion and migration, and are directly related to hair follicle stem cell stability and skin basement membrane repair. The design of the collagen segments balances structural integrity, expression efficiency, and subsequent delivery feasibility: excessively short functional domains make it difficult to form a stable triple helix structure and sufficient active sites, resulting in weaker biological function; while excessively long sequences may increase the difficulty of gene synthesis and expression, and affect the efficiency of transmembrane peptide-mediated delivery due to molecular conformational crowding. Therefore, this invention achieves an optimal balance between biological activity and delivery efficiency.

[0009] Secondly, a nucleic acid molecule is used to encode the highly transdermal recombinant humanized type 17 collagen described in the first aspect of the present invention.

[0010] Thirdly, a recombinant vector comprising the nucleic acid molecule described in the second aspect of the present invention.

[0011] Fourthly, a recombinant cell, which is a host cell containing the nucleic acid molecule described in the second aspect of the present invention or the recombinant vector described in the third aspect of the present invention.

[0012] Fifthly, a method for preparing the highly transdermal recombinant humanized type 17 collagen as described in the first aspect of the present invention, comprising the steps of: culturing the recombinant cells as described in the fourth aspect of the present invention to express the highly transdermal recombinant humanized type 17 collagen; and isolating the highly transdermal recombinant humanized type 17 collagen.

[0013] Sixthly, the use of a highly transdermal recombinant humanized type 17 collagen as described in the first aspect of the present invention, or a nucleic acid molecule as described in the second aspect of the present invention, or a recombinant vector as described in the third aspect of the present invention, or a recombinant cell as described in the fourth aspect of the present invention, in the preparation of products for improving skin aging or skin repair.

[0014] The beneficial effects of this invention are as follows:

[0015] 1. This invention designs and modifies humanized type 17 collagen with specific transmembrane peptides, resulting in recombinant humanized type 17 collagen with extremely strong transdermal absorption capabilities. Through efficient transdermal absorption, the collagen of this invention can effectively penetrate the structural barrier of the stratum corneum of the skin, reaching the epidermal basal layer, which serves as a physiological functional target site, thereby achieving its repair and anti-aging bioactivity and greatly improving the efficacy and application efficiency of the product. It can be widely used in high-end functional skincare products, medical repair dressings, wound healing materials, and other biomedical materials, meeting the market's urgent demand for efficient, targeted anti-aging and skin repair technologies.

[0016] 2. The recombinant humanized type 17 collagen provided by this invention can be stably and efficiently expressed in recombinant cells, especially recombinant bacterial strains. This characteristic enables the collagen provided by this invention to be suitable for large-scale industrial production, effectively solving the problems of high cost, limited yield, and poor batch stability associated with natural extraction or mammalian cell expression. This lays a solid foundation for its widespread application in biomaterials, medical devices, and skincare products. Attached Figure Description

[0017] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0018] Figure 1This is a sampling and detection graph of COL1502, SP1502, TA1502, and AN1502 at different fermentation times in Example 3 of the present invention; a represents TA1502 and COL1502, M: Marker, lane 1 represents TA1502 fermentation for 0 h, lane 2 represents TA1502 fermentation for 12 h, lane 3 represents TA1502 fermentation for 24 h, lane 4 represents TA1502 fermentation for 36 h, lane 5 represents TA1502 fermentation for 48 h, lane 6 represents COL1502 fermentation for 0 h, lane 7 represents COL1502 fermentation for 12 h, lane 8 represents COL1502 fermentation for 24 h, and lane 9 represents COL1502 fermentation for 24 h. Lane 10 was fermented with COL1502 for 48 hours after fermentation for 36 hours; lane b was AN1502 and SP1502, M: Marker. Lane 1 was fermented with AN1502 for 0 hours, lane 2 with AN1502 for 12 hours, lane 3 with AN1502 for 24 hours, lane 4 with AN1502 for 36 hours, lane 5 with AN1502 for 48 hours, lane 6 with SP1502 for 0 hours, lane 7 with SP1502 for 12 hours, lane 8 with SP1502 for 24 hours, lane 9 with SP1502 for 36 hours, and lane 10 with SP1502 for 48 hours.

[0019] Figure 2 The image shows the electrophoresis results of COL1502, SP1502, TA1502, and AN1502 after purification in Example 4 of this invention.

[0020] Figure 3 This is a diagram showing the results of a transdermal experiment in Example 5 of the present invention.

[0021] Figure 4 The image shows the repair efficacy results of recombinant type XVII collagen TA1502 in Example 6 of this invention. Compared with the BC group, P<0.05(#), P<0.01(##), P<0.001(###), and P<0.0001(####) were considered to be significantly different. Compared with the NC group, P<0.05 (*), P<0.01 (**), P<0.001(***), and P<0.0001 (****) were considered to be significantly different.

[0022] Figure 5Figure 7 shows the results of the firming and anti-wrinkle efficacy of recombinant type XVII collagen TA1502 in Example 7 of this invention; a represents the content of COL-I; compared with group BC, P<0.05(#), P<0.01(##), P<0.001(###), and P<0.0001(####) were considered to be significantly different; compared with group NC, P<0.05(*), P<0.01(**), P<0.001(***), and P<0.0001(****) were considered to be significantly different; b represents the content of ELN; compared with group BC, P<0.05(#), P<0.01(##), P<0.001(###), and P<0.0001(####) were considered to be significantly different; compared with group NC, P<0.05(*), P<0.01(**), P<0.001(***), and P<0.0001(****) were considered to be significantly different; compared with group NC, P<0.05(*), P<0.01(**), and P<0.0001(****) were considered to be significantly different. P<0.01, P<0.001, and P<0.0001 were considered to be significant. Detailed Implementation

[0023] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0024] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0025] Given that human type 17 collagen has extremely low transdermal absorption efficiency, which limits its application in cosmetics and skin repair, this invention proposes a highly transdermal recombinant humanized type 17 collagen and its applications.

[0026] A typical embodiment of the present invention provides a highly transdermal recombinant humanized type 17 collagen protein, which is composed of a membrane-penetrating peptide segment and a collagen segment. The collagen segment has an amino acid sequence as shown in SEQ ID NO: 1, and the membrane-penetrating peptide segment is a membrane-penetrating peptide SPACE, TAT, or ANTP.

[0027] In some embodiments, the transmembrane peptide segment is modified at the N-terminus of the collagen segment.

[0028] In some embodiments, the amino acid sequence of the membrane-penetrating peptide SPACE is shown in SEQ ID NO: 2.

[0029] In some embodiments, the amino acid sequence of the transmembrane peptide TAT is shown in SEQ ID NO: 3.

[0030] In some embodiments, the amino acid sequence of the transmembrane peptide ANTP is shown in SEQ ID NO: 4.

[0031] In some embodiments, the amino acid sequence of the highly transdermal recombinant humanized type 17 collagen is shown in SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7. Studies have shown that, compared with the other two, the highly transdermal recombinant humanized type 17 collagen with the amino acid sequence shown in SEQ ID NO: 5 has a higher skin penetration efficiency.

[0032] In another embodiment of the present invention, a nucleic acid molecule is provided for encoding the above-mentioned highly transdermal recombinant humanized type 17 collagen.

[0033] In some embodiments, the DNA sequence of the nucleic acid molecule is shown in SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.

[0034] A third embodiment of the present invention provides a recombinant vector comprising the above-mentioned nucleic acid molecules.

[0035] The recombinant vector described in this invention uses any one of pPIC9, pPIC9K, pHIL-S1, pPICZα A, pYAM75P, pGAPZα A, pGAPZ A, and their modified forms. In some embodiments, the recombinant vector uses pPIC9K.

[0036] A fourth embodiment of the present invention provides a recombinant cell, which is a host cell containing the above-mentioned nucleic acid molecules or the above-mentioned recombinant vector.

[0037] The recombinant strains used in this invention are any one or more of bacterial cells, fungal cells, or plant cells. Specifically, the bacterial cells can be Escherichia coli (e.g., *Escherichia coli*), Bacillus (e.g., *Bacillus subtilis*), etc. Specifically, the fungal cells can be yeast, etc.

[0038] A fifth embodiment of the present invention provides a method for preparing highly transdermal recombinant humanized type 17 collagen, comprising the steps of: culturing the above-mentioned recombinant cells to express the highly transdermal recombinant humanized type 17 collagen; and isolating the highly transdermal recombinant humanized type 17 collagen.

[0039] In some embodiments, the following steps are included:

[0040] (1) Activate the above-mentioned recombinant engineered bacteria;

[0041] (2) When the activated cells are fermented to a wet cell count of 250-400 g / L, stop feeding and add methanol in stages for 48-96 h to induce fermentation broth.

[0042] (3) The obtained collagen was purified using multimode weak cation exchange chromatography packing material to obtain highly transdermal recombinant humanized type XVII collagen.

[0043] Specifically, the activation method in step (1) is as follows: a single colony of the recombinant engineered bacteria is picked and inoculated into a primary seed culture medium and cultured overnight. Then, it is transferred to a secondary seed culture medium at a volume ratio of 1.5-2.5% to activate it until the OD600 is 6.0-10.0. More specifically, both the primary and secondary seed cultures used in the activation process are YPD liquid culture medium. More specifically, the culture conditions during the activation process are: temperature 28-32 ℃, rotation speed 200-250 rpm.

[0044] Specifically, the fermentation process in step (2) is as follows: the activated cells from step (1) are inoculated into the fermentation medium at a volume ratio of 9-11% for fermentation. The initial culture temperature is 28-32℃, the rotation speed is 280-320 rpm, and the aeration is 0.8-1.2 vvm. The pH is adjusted to 4.8-5.2 using 45-55% ammonia water. The dissolved oxygen-correlated stirring speed is adjusted to maintain the DO value in the fermenter above 20%. When the fermentation culture reaches the point where the glycerol is consumed, dissolved oxygen feedback-correlated stirring is used. When the DO value is greater than 30%, glycerol is fed at a feeding rate of 0.8-1.2 mL / min. When the wet cell volume is 250-400 g / L, feeding is stopped, and the rotation speed is increased to 850-950 rpm. After the DO value recovers and stabilizes, methanol feed solution is added for induction. The induction temperature is 20-30℃. For the first 3.5-4.5 h, the flow rate of the methanol feed solution is 0.05-0.07. mL / min; after induction for 3.5-4.5 h, stop feeding. After the DO value starts to rise, set the dissolved oxygen feedback condition and start adding the remaining methanol feed solution. Feed at a feeding rate of 0.11-0.13 mL / min, while coordinating with dissolved oxygen. Control the DO value to above 30% and start feeding. Continue induction for 48-96 h.

[0045] More specifically, the fermentation medium is BSM medium. The BSM medium formula is as follows: 26-27 mL / L 85% phosphate, 0.9-1.0 g / L calcium sulfate, 18-19 g / L potassium sulfate, 14-15 g / L magnesium sulfate, 4.1-4.2 g / L potassium hydroxide, 35-45 g / L glycerol, and water as solvent; sterilize at 120-125℃ for 10-30 min, and after cooling to room temperature, add PTM1 trace element stock solution at 4.3-4.4 mL / L, and adjust the pH to 5.0 with 45-55% ammonia water (v / v).

[0046] More specifically, the formula for the feed solution during the glycerol feeding process is as follows: 45-55% glycerol by mass, sterilized at 120-125 ℃ for 10-30 min, and after the temperature drops to room temperature, add PTM1 trace element stock solution at 11-13 mL / L and mix well.

[0047] More specifically, the formula for the methanol feed solution is: 100% methanol, added to PTM1 trace element mother liquor at a rate of 11-13 mL / L, and mixed well.

[0048] The formula for the PTM1 trace element mother liquor of this invention is as follows: copper sulfate 5.5-6.5 g / L, sodium iodide 0.07-0.09 g / L, manganese sulfate 2.5-3.5 g / L, sodium molybdate 14.5-15.0 g / L, boric acid 0.01-0.03 g / L, cobalt chloride 0.4-0.6 g / L, zinc chloride 18-22 g / L, ferrous sulfate heptahydrate 60-70 g / L, biotin 0.1-0.3 g / L, sulfuric acid 4.5-5.5 mL / L, and water as solvent; it is filtered and sterilized using a filter membrane (0.22 μm is acceptable) and stored at 3-5 °C for later use.

[0049] The sixth embodiment of the present invention provides the application of the above-mentioned highly transdermal recombinant humanized type 17 collagen, or the above-mentioned nucleic acid molecule, or the above-mentioned recombinant carrier, or the above-mentioned recombinant cell in the preparation of products that improve skin aging or skin repair.

[0050] The products described in this invention can be cosmetics, medical devices (such as medical dressings), or pharmaceuticals.

[0051] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0052] Unless otherwise specified in the examples, all procedures were performed using conventional techniques in the art; experimental materials and reagents not specified in detail were all commercially available products. Specifically, Pichia pastoris GS115 was purchased from Beyotime Biotechnology Co., Ltd., and the pPIC9K vector and Escherichia coli DH5α were provided by Beijing Liuhe BGI Genomics Co., Ltd., and are all commercially available products.

[0053] Example 1: Sequence selection and codon optimization of recombinant humanized type XVII collagen SP1502, TA1502, and AN1502

[0054] (1) Based on the full-length sequence of human type XVII collagen in Genbank (Genbank accession number: Q9UMD9.3), amino acids 644-673 of the 15th collagen region were extracted as repeat units. After splicing the repeat units 10 times, the collagen segment with a total of 300 amino acids was obtained.

[0055] The amino acid sequence of the collagen segment is as follows:

[0056] GERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGE RGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSP, such as SEQ ID NO: 1 is shown.

[0057] (2) The N-terminus of the collagen segment obtained in step (1) is modified by adding a membrane-penetrating peptide. The amino acid sequence of the SPACE membrane-penetrating peptide is ACTGSTQHQCG, as shown in SEQ ID NO: 2; the amino acid sequence of the TAT membrane-penetrating peptide is RKKKRRQRRR, as shown in SEQ ID NO: 3; and the amino acid sequence of the ANTP membrane-penetrating peptide is RQIKIYFQNRRMKWKK, as shown in SEQ ID NO: 4.

[0058] Among them, SPACE membrane-penetrating peptide is derived from a modified sequence of skin-penetrating natural peptides. This sequence contains two cysteine ​​residues, which can form disulfide bonds and have an amphiphilic structure. It can specifically penetrate the cell membranes of skin stratum corneum cells or tumor cells, and has low cytotoxicity.

[0059] TAT transmembrane peptide is derived from the 47th-57th amino acid segment of the TAT protein, the transcription activator of HIV-1 virus. It contains 6 positively charged arginine / lysine residues and is a typical cationic transmembrane peptide. It can efficiently penetrate the cell membrane without receptor mediation, and its transmembrane efficiency can reach more than 85% within 1 hour at 37°C.

[0060] ANTP transmembrane peptide is derived from the amino acid fragment at positions 43-58 of the protein encoded by the Drosophila antennae control gene. It contains five positively charged amino acids and can transmembrane via interaction with the cell membrane phospholipid bilayer. Its penetration rate through the nuclear membrane is superior to that of TAT transmembrane peptide.

[0061] In addition, the two ends of the collagen segment were modified respectively. A start codon sequence and a membrane-penetrating peptide sequence were added to the amino terminus, and a DNA sequence encoding a stop codon was added to the carboxyl terminus to form the amino acid sequences encoding SP1502, TA1502 and AN1502 proteins. The modified amino acid sequences are shown below, with the underlined part being the membrane-penetrating peptide sequence.

[0062] The amino acid sequence of TA1502 is as follows:

[0063] M ACTGSTQHQCG GERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGE RGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSP, such as SEQ ID NO: 5 is shown.

[0064] The amino acid sequence of AN1502 is as follows:

[0065] M RKKKRRQRRRGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGE RGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSP, such as SEQ ID NO: 6.

[0066] The amino acid sequence of SP1502 is as follows:

[0067] M RQIKIYFQNRRMKWKK GERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGE RGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSPGERGAAGEPGPHGPPGVPGSVGPKGSSGSP, such as SEQ ID NO: 7 is shown.

[0068] (3) GenScript was commissioned to optimize the codons of the above amino acids for the Pichia pastoris expression system and synthesize them, and then cloned them into the pPIC9K vector. EcoR I, Not Between the I restriction sites.

[0069] The DNA sequences encoding the proteins SP1502, TA1502, and AN1502 are shown below:

[0070] The DNA sequence encoding the SP1502 protein is as follows: ATGAGACAGATTAAAATCTACTTCCAAAACCGTAGGATGAAATGGAAAAAGGGAGAGAGAGGTGCCGCTGGAGAGCCTGGACCACATGGTCCACCAGGAGTCCCAGGTTCAGTTGGACCTAAAGGTTCTTCTGGTTCCCCCGGCGAGAGAGGAGCTGCTGGTGAACCTGGCCCACACGGTCCACCAGGTGTTCCTGGCTCAGTAGGACCTAAAGGTTCTTCCGGAAGTCCTGGTGAAAGAGGAGCCGCCGGTGAACCTGGCCCCCATGGCCCTCCAGGTGTCCCAGGTTCAGTAGGACCAAAGGGATCCTCTGGATCTCCTGGAGAAAGGGGAGCTGCCGGAGAGCCAGGACCACACGGACCACCTGGTGTTCCAGGATCAGTCGGACCTAAAGGATCTAGTGGAAGTCCTGGAGAAAGAGGCGCTGCTGGTGAACCTGGTCCTCACGGACCCCCTGGTGTTCCTGGAAGTGTGGGACCAAAGGGATCATCCGGTTCTCCAGGTGAGAGAGGAGCAGCTGGCGAGCCCGGACCCCATGGTCCCCCTGGAGTCCCTGGCTCCGTCGGCCCTAAGGGTTCATCAGGATCTCCTGGAGAGCGTGGAGCTGCTGGTGAGCCAGGACCTCATGGACCACCTGGCGTACCAGGCAGTGTGGGACCTAAGGGCTCCTCAGGTTCTCCAGGCGAGAGAGGTGCCGCAGGCGAACCTGGTCCACATGGTCCACCTGGAGTTCCTGGTTCAGTTGGTCCTAAGGGATCATCTGGTTCTCCTGGTGAAAGGGGTGCCGCTGGTGAGCCCGGACCACACGGACCCCCAGGAGTTCCAGGTTCAGTTGGACCAAAGGGTTCTTCAGGTTCCCCTGGCGAAAGAGGTGCTGCCGGTGAACCTGGACCACATGGACCTCCTGGTGTTCCAGGTTCTGTTGGACCTAAGGGCTCATCCGGATCTCCA, as shown in SEQ ID NO: 8.

[0071] The DNA sequence encoding the TA1502 protein is: ATGGCTTGCACTGGTTCTACTCAGCATCAATGTGGAGGTGAAAGAGGAGCAGCTGGTGAACCTGGTCCCCACGGACCACCCGGTGTTCCTGGAAGTGTTGGACCTAAGGGTTCTTCCGGCAGTCCAGGTGAGAGAGGTGCAGCTGGTGAGCCCGGTCCTCACGGTCCCCCAGGTGTACCAGGTTCTGTCGGCCCTAAGGGTTCAAGTGGATCTCCAGGCGAGAGAGGCGCCGCTGGTGAACCCGGACCACATGGTCCTCCAGGTGTTCCTGGATCTGTTGGCCCAAAAGGTTCTTCAGGATCTCCAGGTGAGAGAGGAGCTGCTGGTGAACCTGGTCCTCATGGTCCACCCGGTGTGCCTGGTTCTGTTGGTCCCAAAGGATCATCAGGTTCCCCTGGAGAGCGTGGTGCTGCTGGTGAACCTGGACCTCACGGTCCACCCGGAGTTCCAGGTTCAGTTGGTCCAAAGGGTTCCTCAGGTAGTCCTGGAGAGAGAGGTGCCGCAGGTGAGCCAGGTCCTCATGGTCCTCCAGGTGTGCCAGGATCCGTAGGACCCAAAGGTTCTTCCGGATCTCCAGGAGAGAGGGGTGCCGCAGGTGAACCTGGTCCACACGGTCCACCTGGTGTTCCTGGCTCAGTCGGTCCAAAAGGTTCATCCGGTAGTCCAGGTGAAAGAGGTGCCGCCGGCGAACCAGGTCCTCATGGACCTCCTGGTGTGCCAGGTTCTGTTGGCCCAAAGGGTTCTAGTGGTAGTCCAGGAGAAAGGGGTGCTGCTGGAGAACCAGGTCCACACGGACCCCCAGGAGTGCCAGGTTCCGTAGGACCTAAGGGAAGTTCAGGAAGTCCTGGAGAAAGAGGAGCAGCCGGAGAGCCTGGCCCACATGGTCCTCCTGGAGTTCCAGGTTCTGTTGGACCTAAGGGATCCTCTGGTAGTCCC, as shown in SEQ ID NO: 9.

[0072] The DNA sequence encoding the AN1502 protein is: ATGAGGAAAAAAAAGAGACGTCAAAGAAGAAGAGGTGAAAGAGGCGCTGCTGGAGAACCAGGTCCACACGGACCTCCAGGTGTACCTGGTTCCGTCGGCCCTAAAGGCAGTAGTGGAAGTCCTGGTGAAAGAGGTGCAGCAGGAGAACCTGGTCCCCATGGACCCCCAGGAGTTCCTGGTTCCGTTGGTCCAAAGGGTTCTTCTGGAAGTCCAGGAGAAAGAGGAGCTGCTGGTGAGCCTGGACCACATGGACCCCCTGGTGTTCCTGGTTCCGTTGGACCAAAGGGCTCCTCTGGTTCACCCGGTGAAAGAGGTGCTGCTGGTGAACCAGGCCCTCACGGTCCACCTGGCGTCCCCGGTTCTGTAGGACCCAAGGGATCATCTGGCAGTCCAGGCGAACGAGGTGCTGCAGGAGAACCTGGTCCTCACGGTCCTCCCGGAGTGCCTGGTTCCGTAGGTCCTAAAGGAAGTAGTGGTTCTCCTGGTGAACGTGGTGCCGCTGGAGAACCAGGACCTCATGGCCCCCCTGGTGTCCCAGGATCCGTCGGACCTAAGGGATCCTCAGGATCCCCAGGCGAGAGAGGAGCAGCTGGTGAGCCAGGTCCACATGGTCCACCCGGTGTTCCCGGAAGTGTTGGACCAAAAGGTAGTTCCGGTAGTCCAGGAGAGAGAGGTGCAGCTGGCGAGCCTGGACCACACGGACCACCTGGTGTTCCAGGTTCAGTGGGCCCAAAAGGATCCAGTGGATCTCCAGGTGAGAGAGGCGCCGCCGGTGAACCAGGTCCTCACGGTCCTCCTGGAGTCCCTGGTTCAGTAGGTCCTAAAGGTAGTTCTGGTTCTCCTGGTGAGAGGGGTGCTGCAGGTGAACCAGGACCACACGGACCTCCTGGCGTTCCAGGATCTGTAGGTCCCAAGGGCAGTTCTGGCTCTCCA, as shown in SEQ ID NO: 10.

[0073] Example 2: Construction and screening of recombinant humanized type XVII collagen expression strains with high transdermal permeability (SP1502, TA1502, AN1502).

[0074] (1) The recombinant vector constructed above was verified by DNA sequencing. The recombinant expression vector pPIC9K- sp1502, pPIC9K- ta1502 pPIC9K- an1502 Construction complete.

[0075] (2) Extract and verify the correct recombinant plasmid. Take 10 μg of plasmid and digest it with sal I fast digestion enzyme (the reagent was purchased from TaKaRa, and the specific operation was performed according to the kit instructions) at 37℃ for 10 min. Then use the PCR product purification kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.) to recover the linearized product. The elution volume is 10 μL.

[0076] (3) Preparation of Pichia pastoris GS115 competent cells: Pick a single colony of Pichia pastoris GS115 into YPD liquid medium, culture overnight at 30℃ and 220 rpm, then transfer it to YPD liquid medium at a volume ratio of 1% and culture until OD. 600 The concentration is 1.3-1.5. Take 50 mL of bacterial culture, incubate on ice for 10 min, centrifuge at 4000 rpm at 4℃ to collect the bacterial cells, wash twice with pre-cooled 1 M D-sorbitol, add 5 mL of 1 M D-sorbitol, mix well and dispense into 100 μL / vial.

[0077] The above YPD liquid culture medium formula is: yeast extract 10g / L, peptone 20g / L, glucose 20g / L, and water as the solvent.

[0078] (4) Electroporation: Take one Pichia pastoris GS115 competent cell, add 10 μL of linearized recovery product, select the PIC program in the electroporator (purchased from Bio-Rad) for one electroporation, quickly remove and add 1 mL of pre-cooled 1M D-sorbitol, mix well and then culture statically for 2-3 h, centrifuge at 4000 rpm and remove part of the supernatant, mix the remaining liquid by pipetting and spread it on MD plates, and culture at 30℃ for 2-4 days until a single colony grows.

[0079] The above MD medium formulation is as follows: amino-free yeast nitrogen source (YNB) 13.4 g / L, glucose 10 g / L, agar 2 g / L, biotin 4 × 10⁻⁶ -4 g / L, solvent: water.

[0080] (5) G418 screening: Prepare G418 YPD solid medium with a concentration of 4 g / L, draw 1cm*1cm grids and number them, transfer the above single colony points to the screening medium, and incubate at 30℃ for 2-4 days until the colony size is significantly different.

[0081] (6) Select the single colony with the largest diameter for shake flask culture, extract the genome and perform PCR verification, and preserve the verified strain.

[0082] (7) The above-verified strain was inoculated into YPD medium and cultured overnight at 30°C and 220 rpm. It was then inoculated into 50 mL BMGY medium at a volume ratio of 2% and cultured at 30°C and 220 rpm for 24 h. The cultured bacterial solution was placed in a centrifuge tube, centrifuged at 5000 rpm for 5 min, washed once with sterile water, resuspended in 5 mL BMMY medium, and inoculated into 100 mL BMMY medium. The culture was induced at 25°C. 1% methanol was added every 24 h and samples were taken and stored at -20°C until the induction ended after 96 h.

[0083] The BMGY medium formulation is as follows: yeast extract 10 g / L, peptone 20 g / L, 100 mM potassium phosphate buffer (pH 6.0), YNB 13.4 g / L, biotin 4 × 10⁻⁶. -4 g / L, glycerol 10 g / L, solvent is water.

[0084] The BMMY medium formulation is as follows: yeast extract 10 g / L, peptone 20 g / L, 100 mM potassium phosphate buffer (pH 6.0), YNB 13.4 g / L, biotin 4 × 10⁻⁶ -4 g / L, methanol 5 g / L, solvent is water.

[0085] Example 3: Fermentation preparation and analysis of highly transdermal recombinant humanized type XVII collagen SP1502, TA1502, and AN1502

[0086] Recombinant engineered bacteria Pichia.pastoris GS115 sp1502 , Pichia.pastoris GS115 ta1502 , Pichia.pastoris GS115 an1502 Inoculate into YPD liquid medium and culture overnight at 30 °C and 220 rpm to obtain primary seed culture. Transfer to secondary seed culture flasks at a volume ratio of 1% and culture at 30 °C and 220 rpm until OD. 600The pH range was 8.0-12.0. Fermentation was conducted using BSM fermentation medium, with successfully activated secondary seed culture inoculated into the fermenter at a 10% (v / v) inoculum. The initial culture temperature was 30 °C, the agitator speed was 200 rpm, and aeration was 1 vvm. The pH was adjusted to 5.0 using 28% ammonia. As the cells grew, dissolved oxygen gradually decreased. When dissolved oxygen dropped to 20%, the dissolved oxygen (DO) in the fermenter was maintained above 20% by adjusting the dissolved oxygen-correlated agitation speed. After 18-20 h of fermentation, the glycerol in the medium was depleted, and the DO began to rise. Dissolved oxygen feedback agitation was used, and when the DO exceeded 30%, glycerol was fed at a rate of 1.0 mL / min. Feeding was stopped when the wet cell volume reached 250-400 g / L, and the agitator speed was increased to 900 rpm. Once the DO stabilized, methanol was added to induce induction. The induction temperature was 25 ℃. For the first 4 hours of induction, the methanol feed solution was fed at a rate of 0.06 mL / min to promote the cell adaptation to the carbon source and conversion to methanol. Feeding was stopped after 4 hours of induction. Once the dissolved oxygen (DO) value began to rise, indicating that the methanol in the fermenter had been consumed, the remaining methanol feed solution was added under dissolved oxygen feedback conditions at a rate of 0.12 mL / min. Simultaneously, dissolved oxygen was monitored, and feeding was initiated when the DO value was maintained above 30%. Induction continued for 48 hours to obtain the fermentation broth. Samples were taken every 12 hours during the induction period for subsequent analysis and detection.

[0087] SDS-PAGE analysis was performed on samples taken at each time point, and the results are as follows: Figure 1 As shown in figures a and b, after 12 hours of induced fermentation, the characteristic band corresponding to the target protein began to appear clearly. With the induction time extended to 48 hours, the grayscale value of the target protein band continued to increase, and no significant degradation bands were produced. Grayscale analysis of the gel image of the sample induced for 48 hours using ImageJ software showed that the target protein band accounted for ≥80% of the total protein bands. These results indicate that the recombinant protein described in this embodiment can be stably expressed without significant degradation during 48 hours of continuous fermentation induction, demonstrating good expression stability.

[0088] The above BSM fermentation medium formula is as follows: phosphate (85%) 26.7 mL / L, calcium sulfate 0.93 g / L, potassium sulfate 18.2 g / L, magnesium sulfate 14.9 g / L, potassium hydroxide 4.13 g / L, glycerol 40 g / L, with water as the solvent; after sterilization at 121 ℃ for 20 min, PTM1 trace element stock solution is added at 4.35 mL / L after the temperature drops to room temperature, and the pH is adjusted to 5.0 with 50% (v / v) ammonia water.

[0089] The above glycerol feed solution formula is as follows: 50% (mass ratio) glycerol, sterilized at 121 ℃ for 20 min, and after the temperature drops to room temperature, add PTM1 trace element stock solution at 12 mL / L and mix well;

[0090] The above methanol feed solution formula is: 100% methanol, added to PTM1 trace element mother liquor at a rate of 12 mL / L, and mixed well;

[0091] The formula for the above-mentioned trace element mother liquor PTM1 is as follows: copper sulfate 6 g / L, sodium iodide 0.08 g / L, manganese sulfate 3 g / L, sodium molybdate 14.9 g / L, boric acid 0.02 g / L, cobalt chloride 0.5 g / L, zinc chloride 20 g / L, ferrous sulfate heptahydrate 65 g / L, biotin 0.2 g / L, sulfuric acid 5 mL / L, with water as the solvent; it is sterilized by filtration through a 0.22 μm filter membrane and stored at 4 ℃ for later use.

[0092] Example 4: Purification of highly transdermal recombinant humanized type XVII collagen SP1502, TA1502, and AN1502

[0093] (1) Sample processing: Take the fermentation supernatant collected in Example 3, centrifuge at 8000 rpm for 10 min at 4 ℃, discard the precipitate, collect the supernatant, and filter it with a 0.45 μm filter membrane to obtain filtrate. Adjust the pH of the filtrate to 5.0 with diluted acetic acid and adjust the conductivity to below 10 mS / cm. Place it on ice for later use.

[0094] (2) Column equilibration: Multimode weak cation exchange chromatography packing material was selected. The packing material was Diamond MMC Maxtang (purchased from BorgLone (Shanghai) Biotechnology Co., Ltd.). Buffer A was used as the equilibration solution. Five column volumes were equilibrated until the pH and conductivity of the flow solution were stable and consistent with Buffer A.

[0095] (3) Loading and elution: Load the filtrate from step (1) onto the equilibrated chromatography column. After loading, rinse with buffer A until the baseline is flat, and then rinse for 3 column volumes. To improve the purity of the target protein, wash with 10% B washing buffer for 4 column volumes. Then elute with 40% B. Collect after the OD220 peak appears, and collect for 4 column volumes.

[0096] (4) Regeneration and preservation of the chromatography column: The chromatography column was regenerated with 3 column volumes of buffer C solution, then deionized water was introduced to rinse until the conductivity of the effluent was stable and the pH was 7.0±0.2. Then 3 column volumes of 20% ethanol were introduced to preserve the column and stored at 4℃.

[0097] (5) Desalting and freeze-drying: The purified elution solution was concentrated and desalted using a membrane with a molecular weight cutoff of 10 kDa. The concentration was concentrated to 10-20 g / L, and then desalted with pure water until the conductivity was ≤50 μS / cm. The resulting solution was freeze-dried to obtain freeze-dried powder.

[0098] (6) Product purity was determined by HPLC. The chromatographic column was BioCore SEC-150, the mobile phase was 50 mM phosphate buffer (pH 6.8) containing 300 mM sodium chloride, isocratic elution, the flow rate was 0.5 mL / min, the injection volume was 2 μL, the column temperature was 30 ℃, the lyophilized powder was diluted to 1 mg / mL for injection, and the sample was detected at 220 nm. The chromatogram is shown below. Figure 2 As shown, the purity is 97.58%.

[0099] The above Buffer A formula is: 50 mmol / L sodium acetate, with the pH adjusted to 5.0 using acetic acid;

[0100] The above Buffer B formula is: 50 mmol / L sodium acetate, 1 mol / L NaCl, with the pH adjusted to 5.0 using acetic acid;

[0101] The formula for Buffer C above is: 1 mol / L NaOH.

[0102] Example 5: Transdermal Performance Test of Recombinant Protein

[0103] To verify the skin penetration properties of the recombinant humanized type XVII collagen SP1502, TA1502, and AN1502 modified with membrane-penetrating peptides described in this invention, the following experiments were conducted:

[0104] (1) Experimental materials

[0105] Control group: Recombinant humanized type XVII collagen COL1502 (fluorescently labeled, consistent with the collagen segment of the experimental group, purity ≥95%).

[0106] Experimental group 1: Recombinant humanized type XVII collagen SP1502 (fluorescently labeled, purity ≥95%).

[0107] Experimental group 2: Recombinant humanized type XVII collagen TA1502 (fluorescently labeled, purity ≥95%);

[0108] Experimental group 3: Recombinant humanized type XVII collagen AN1502 (fluorescently labeled, purity ≥95%).

[0109] All samples were prepared to a concentration of 10 mg / mL using PBS buffer at pH 7.4.

[0110] Ex vivo skin: Take skin from the back of 3-5 day old piglets, remove subcutaneous fat, cut into 2 cm × 2 cm pieces, disinfect with 0.2% glutaraldehyde, rinse with PBS and set aside.

[0111] (2) Experimental methods

[0112] Diffusion chamber preparation: Add PBS buffer (containing 0.02% sodium azide) preheated to 37 ℃ to the receiving chamber, stir magnetically at 300 rpm, and maintain the temperature at 37±0.5 ℃; fix the piglet skin with the keratinized layer facing upwards between the two chambers of the diffusion chamber, with an effective diffusion area of ​​1.77 cm². 2 .

[0113] Sample administration: Add 5 mL of fluorescently labeled test sample to the supply chamber and slowly inject it into the supply pool. Start timing and collect 200 μL of buffer from the receiving chamber at 0 h, 4 h and 8 h respectively. At the same time, quickly replenish an equal amount of fresh PBS buffer preheated to 37°C.

[0114] Quantitative fluorescence analysis: The samples collected at each time point were placed in centrifuge tubes, centrifuged at 4 ℃ and 5000 rpm for 10 min, and 180 μL of the supernatant was added to a 96-well fluorescent plate and tested in the dark.

[0115] Instruments and parameters: The Thermo Scientific Varioskan LUX microplate reader was used, with the excitation wavelength set to 488 nm, the emission wavelength to 525 nm, the sensitivity setting to "high", and the detection temperature to 37 ± 0.5 ℃ (consistent with the diffusion cell temperature).

[0116] Detection procedure: Each sample is set up in 3 replicates, and a blank control (receiving chamber buffer without sample) is also set up; the microplate reader reads the relative fluorescence units (RFU) of each well, and after taking the average value of the replicates, the RFU value of the blank control is subtracted to obtain the net fluorescence intensity of the receiving chamber sample at each time point;

[0117] (3) Experimental results: The test results are as follows Figure 3 As shown:

[0118] Time trend: The cumulative fluorescence of all four groups of samples increased significantly with the extension of penetration time (P<0.01), indicating that they all have transdermal ability and the penetration amount is positively correlated with time.

[0119] Intergroup comparison: At the same time point, the fluorescence intensity of experimental group 2 (TA1502) was significantly higher than that of the control group and other experimental groups. Taking 8 h of infiltration as an example, the fluorescence intensity of experimental group 2 was 2.2 times that of the control group, 1.5 times that of experimental group 1 (P<0.001), and 1.2 times that of experimental group 3 (P<0.001).

[0120] Example 6: Barrier Repair Performance Test of Recombinant Protein TA1502

[0121] Filagrin (FLG) is an important component of the keratinized capsule, ensuring the integrity of the skin barrier. FLG deficiency leads to disordered lipid bilayer structure and delayed maturation, while also causing reduced keratinocyte density, increased intercellular permeability, and decreased photoprotective function, ultimately resulting in skin barrier damage.

[0122] Immortalized human keratinocytes (HaCaT cells) were collected, and a cell suspension was prepared using high-glucose DMEM cell culture medium. 2 mL of the cell suspension was added to each well of a 6-well plate, resulting in a cell count of 2.6 × 10⁶ cells. 5 / well. The experiment included a blank control group (BC), a bovine serum albumin (BSA) negative control group (NC), a commercially available recombinant collagen positive control group (PC), and the recombinant collagen TA1502 group prepared in this invention (experimental group), with three replicates for each group. The 6-well plates were incubated in a cell culture incubator (5% CO2, 37℃) for 24 h. When the cell confluence reached 50%-60%, the culture medium was discarded. 2 mL of high-glucose DMEM cell culture medium was added to each well of the blank control group; 2 mL of high-glucose DMEM cell culture medium containing the corresponding protein was added to each of the other three groups. The concentration of each protein in the high-glucose DMEM cell culture medium was 2.5 mg / mL. After incubating the 6-well plates in an incubator (37℃, 5% CO2) for 24 h, the cells in each well were washed twice with 2 mL of PBS buffer. RNA extraction, reverse transcription, and quantitative real-time PCR were performed according to the Total RNA Extraction Kit instructions to detect the relative mRNA expression level of the barrier-related protein FLG. A 2... -△△CT The method is used for calculation.

[0123] Different collagen proteins promote the expression of FLG mRNA in HaCaT cells, such as Figure 4 As shown, compared with the BC group, FLG expression in the NC group was significantly reduced, indicating that the stimulation conditions in this experiment were effective; compared with the NC group, FLG expression in the PC group was significantly increased, indicating that the positive control group was effective; compared with the NC group, FLG expression of recombinant collagen TA1502 at a concentration of 2.5 mg / mL was significantly increased. In conclusion, recombinant collagen TA1502 at a concentration of 2.5 mg / mL can significantly promote FLG gene expression in UVB-induced immortalized human keratinocytes (HaCaT), demonstrating a repair effect.

[0124] Example 7: Performance Test of Recombinant Protein's Firming and Anti-wrinkle Efficacy

[0125] Collagen is the main component of dermal collagen fibers, primarily maintaining skin tension. Type I collagen (COL-I) accounts for 80-85% of the collagen composition in adult skin. Elastin (ELN) is the main component of skin elastic fibers, forming a three-dimensional fiber network structure with collagen, giving the skin elasticity and resilience. Together, they maintain skin firmness and smoothness, reducing wrinkles. Based on a UVA-induced human primary dermal fibroblast (HSF) aging model, the firming and anti-wrinkle effects of the analyte were evaluated by detecting changes in COL-I and ELN levels after treatment.

[0126] Remove the HSF cell cryopreservation tubes from the liquid nitrogen tank and thaw them rapidly in a 37°C water bath (1-2 min). Add 9 mL of preheated complete culture medium, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend the cells in 5 mL of complete culture medium, and seed them into T25 culture flasks. Incubate at 37°C with 5% CO2 until the cell confluence reaches 80%-90%, then passage. For passage, discard the old culture medium from the flask, wash twice with PBS (pH 7.4), add 0.25% trypsin-EDTA, and incubate at 37°C for 3-4 min. Once the cells become rounded, add 5 mL of complete culture medium to stop digestion, pipette to prepare a single-cell suspension, count the cells, and adjust the concentration to 1.3 × 10⁻⁶ cells / mL. 5 cells / mL, add 2 mL of cell suspension to each well of a 6-well plate (2.6 × 10⁶ cells / mL). 5 HSF cells (uniformly distributed spindle-shaped cells) were incubated at 37 ℃ and 5% CO2 for 24 h. When the confluence rate of HSF cells reached 50%-60% under an inverted microscope, they were divided into groups with 3 replicates per group. The blank control group (BC) was given 2 mL of fresh complete culture medium after discarding the old culture medium. The negative control group (NC) was given 2 mL of complete culture medium containing 2.5 mg / mL BSA. The positive control group (PC) was given 2 mL of complete culture medium containing 2.5 mg / mL commercially available recombinant collagen. The experimental group (TA1502 group) was given 2 mL of complete culture medium containing 2.5 mg / mL recombinant collagen TA1502. The cells were then returned to the incubator for another 24 h (error < 15 min). After incubation, the supernatant of each well was carefully aspirated and placed in a 1.5 mL centrifuge tube. The tube was centrifuged at 4 ℃ and 12000 r / min for 10 min to remove cell debris. The supernatant was then collected and ELISA was performed strictly according to the instructions of the COL-Ⅰ ELISA kit and ELNELISA kit.

[0127] like Figure 5As shown in a, compared with the BC group, the COL-I content in the NC group was significantly lower, indicating that the stimulation conditions in this experiment were effective; compared with the NC group, the COL-I content in the PC group was significantly higher, indicating that the positive control group was effective; compared with the NC group, the COL-I content of recombinant collagen TA1502 at a concentration of 2.5 mg / mL was significantly higher. Compared with the BC group, the ELN content in the NC group was significantly lower, as shown in a diagram. Figure 5 As shown in b, this indicates that the stimulation conditions in this experiment were effective. Compared with the NC group, the ELN content in the PC group was significantly increased. Compared with the NC group, the ELN content of recombinant collagen TA1502 at a concentration of 2.5 mg / mL was significantly increased. In conclusion, recombinant collagen TA1502 at a concentration of 2.5 mg / mL can significantly promote the increase of COL-I and ELN content in UVA-induced human primary skin fibroblasts (HSF), and has a firming and anti-wrinkle effect.

[0128] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A highly transdermal recombinant humanized type 17 collagen, characterized in that, It is composed of a membrane-penetrating peptide segment and a collagen segment, wherein the collagen segment has the amino acid sequence shown in SEQ ID NO: 1, and the membrane-penetrating peptide segment is the membrane-penetrating peptide TAT; the amino acid sequence of the membrane-penetrating peptide TAT is shown in SEQ ID NO: 3; The membrane-penetrating peptide segment is modified at the N-terminus of the collagen segment; Alternatively, the amino acid sequence of the highly transdermal recombinant humanized type 17 collagen is shown in SEQ ID NO:

5.

2. A nucleic acid molecule characterized by, Used to encode the highly transdermal recombinant humanized type 17 collagen as described in claim 1.

3. The nucleic acid molecule as described in claim 2, characterized in that, The DNA sequence of the nucleic acid molecule is shown in SEQ ID NO:

9.

4. A recombinant vector, characterized in that, Includes the nucleic acid molecules described in claim 2 or 3.

5. The recombinant vector as described in claim 4, characterized in that, The recombinant vector used is pPIC9K.

6. A recombinant engineered bacterium, characterized in that, It is a recombinant engineered bacterium containing the nucleic acid molecule as described in claim 2 or 3 or the recombinant vector as described in claim 4 or 5.

7. A method for preparing highly transdermal recombinant humanized type 17 collagen, characterized in that, The steps include: culturing the recombinant engineered bacteria as described in claim 6 to express the highly transdermal recombinant humanized type 17 collagen; and isolating the highly transdermal recombinant humanized type 17 collagen.

8. The method of claim 7, characterized in that it includes... The following steps are required: (1) Activate the above-mentioned recombinant engineered bacteria; (2) When the activated cells are fermented to a wet cell count of 250-400 g / L, stop feeding and add methanol in stages for 48-96 h to induce fermentation broth. (3) The obtained collagen was purified using multimode weak cation exchange chromatography packing material to obtain highly transdermal recombinant humanized type XVII collagen.

9. The use of the highly transdermal recombinant humanized type 17 collagen of claim 1, or the nucleic acid molecule of claim 2 or 3, or the recombinant vector of claim 4 or 5, or the recombinant engineered bacteria of claim 6 in the preparation of products for improving skin aging or skin repair.

Citation Information

Patent Citations

  • Recombinant transdermal collagen as well as preparation method and application thereof

    CN118359703A

  • High-stability recombinant XVII type collagen as well as construction method and application thereof

    CN119751646A