Composition for detecting liver cancer and application thereof

Abstract

The invention provides a composition for detecting liver cancer and application thereof, the composition comprises nucleic acid for detecting the methylation state of a target gene, and the target gene is one or more than two of a CHFR gene, an SPINT2 gene, an RNF135 gene, a CHST2 gene, an SPDYA gene, a PAX5 gene, a VASH2 gene, a TSPYL5 gene and an EMX1 gene. The invention also provides a kit comprising the composition, and application of the composition in preparation of a kit for in-vitro detection of liver cancer.

Description

Technical Field

[0001] This application belongs to the field of molecular biology and relates to gene detection, specifically to a nucleic acid composition for detecting methylation of liver cancer-related genes, as well as the corresponding kit and its uses. Background Technology

[0002] Liver cancer is a highly malignant cancer. A significant factor contributing to its high mortality rate is the low rate of early-stage diagnosis. The cure rate for early-stage liver cancer is far higher than that for mid-to-late-stage cancer; however, due to the lack of obvious and specific symptoms in early-stage liver cancer, most patients are diagnosed at an advanced stage. Clinical studies have found that the process from the formation of a lesion to the appearance of clinical symptoms takes an average of several years; this provides an effective window for detecting early-stage liver cancer and improving its diagnostic rate. Fully utilizing this window can potentially improve the effectiveness of liver cancer treatment and reduce its mortality rate.

[0003] Currently, the main technologies used in clinical practice for the early diagnosis and screening of liver cancer are imaging techniques, including chest X-rays and low-dose spiral CT (LD-CT). However, large-scale clinical data analysis has found that chest X-rays have no significant effect on reducing liver cancer mortality; while LD-CT has a significant effect on reducing liver cancer mortality, it has an extremely high false positive rate (90%), thus posing a risk of overdiagnosis leading to overtreatment. Furthermore, limitations in equipment cost, operational techniques, and radiation exposure associated with imaging examinations also hinder their widespread adoption as liver cancer screening technologies.

[0004] Traditional serum tumor markers (such as Cyfra21-SCC and CEA) have low sensitivity for detecting liver cancer, especially early-stage liver cancer, and cannot fully meet the screening requirements for early-stage cancer.

[0005] Recent studies have shown that epigenetics plays a crucial role in the occurrence and development of cancer. As an important mechanism of epigenetics, the regulation of DNA methylation in various cancers has been extensively studied. Research data shows that the regulation of gene methylation is related to biological mechanisms such as chromatin structure and gene expression regulation; changes in cellular gene methylation occur in the early stages of tumor formation and continue throughout the occurrence and development of cancer; and the methylation of tumor suppressor genes is a key molecular mechanism for the transformation of precancerous lesions into malignant tumor cells. However, there is currently a lack of detection technologies, methods, and products specifically for detecting methylation genes in liver cancer. Therefore, there is a current demand for methylation gene markers with high sensitivity and specificity for liver cancer detection. Summary of the Invention

[0006] In view of the problems existing in the current liver cancer detection, the purpose of this application is to provide a composition, a kit for in vitro detection of liver cancer, the use thereof, a method for performing the detection based on the kit, and the use for detecting liver cancer.

[0007] The specific technical solution of this application is as follows:

[0008] 1. A composition for in vitro detection of liver cancer, the composition comprising:

[0009] Nucleic acid used to detect the methylation status of a target gene.

[0010] The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene.

[0011] The target gene is one or more of the following genes: CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene, and EMX1 gene.

[0012] 2. The composition according to claim 1, wherein the target sequence of the CHFR gene is as shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4, or the target sequence of the CHFR gene includes the sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4.

[0013] 3. The composition according to claim 1, wherein the target sequence of the SPINT2 gene is as shown in SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8, or the target sequence of the SPINT2 gene includes the sequence shown in SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8.

[0014] 4. The composition according to claim 1, wherein the target sequence of the RNF135 is as shown in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12, or the target sequence of the RNF135 includes the sequence shown in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12.

[0015] 5. The composition according to claim 1, wherein the target sequence of the CHST2 gene is as shown in SEQ ID NO:13 or SEQ ID NO:14 or SEQ ID NO:15 or SEQ ID NO:16, or the target sequence of the CHST2 gene includes the sequence shown in SEQ ID NO:13 or SEQ ID NO:14 or SEQ ID NO:15 or SEQ ID NO:16.

[0016] 6. The composition according to claim 1, wherein the target sequence of the SPDYA gene is as shown in SEQ ID NO:17 or SEQ ID NO:18 or SEQ ID NO:19 or SEQ ID NO:20, or the target sequence of the SPDYA gene includes the sequence shown in SEQ ID NO:17 or SEQ ID NO:18 or SEQ ID NO:19 or SEQ ID NO:20.

[0017] 7. The composition according to claim 1, wherein the target sequence of the PAX5 gene is as shown in SEQ ID NO:21 or SEQ ID NO:22 or SEQ ID NO:23 or SEQ ID NO:24, or the target sequence of the PAX5 gene includes the sequence shown in SEQ ID NO:21 or SEQ ID NO:22 or SEQ ID NO:23 or SEQ ID NO:24.

[0018] 8. The composition according to claim 1, wherein the target sequence of the VASH2 gene is as shown in SEQ ID NO:25 or SEQ ID NO:26 or SEQ ID NO:27 or SEQ ID NO:28, or the target sequence of the VASH2 gene includes the sequence shown in SEQ ID NO:25 or SEQ ID NO:26 or SEQ ID NO:27 or SEQ ID NO:28.

[0019] 9. The composition according to claim 1, wherein the target sequence of the TSPYL5 gene is as shown in SEQ ID NO:29 or SEQ ID NO:30 or SEQ ID NO:31 or SEQ ID NO:32, or the target sequence of the TSPYL5 gene includes the sequence shown in SEQ ID NO:29 or SEQ ID NO:30 or SEQ ID NO:31 or SEQ ID NO:32.

[0020] 10. The composition according to claim 1, wherein the target sequence of the EMX1 gene is as shown in SEQ ID NO:33 or SEQ ID NO:34 or SEQ ID NO:35 or SEQ ID NO:36, or the target sequence of the EMX1 gene includes the sequence shown in SEQ ID NO:33 or SEQ ID NO:34 or SEQ ID NO:35 or SEQ ID NO:36.

[0021] 11. The composition according to any one of claims 1 to 10, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0022] Primers, wherein the primers are fragments of at least 9 nucleotides in the target sequence of the target gene, the fragments containing at least one CpG dinucleotide sequence.

[0023] 12. The composition according to any one of claims 1 to 11, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0024] The probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately or strictly controlled conditions.

[0025] The fragment contains at least one CpG dinucleotide sequence.

[0026] 13. The composition according to any one of items 1 to 12, further comprising:

[0027] A reagent that converts the 5th unmethylated cytosine base of the target sequence of a target gene into uracil.

[0028] 14. The composition according to any one of claims 1 to 13, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:

[0029] Blockers that preferentially bind to target sequences in an unmethylated state.

[0030] 15. The composition according to claim 14, wherein,

[0031] The fragment of at least 9 nucleotides is a sequence of SEQ ID NO:37 and SEQ ID NO:38, or a sequence of SEQ ID NO:40 and SEQ ID NO:41, or a sequence of SEQ ID NO:43 and SEQ ID NO:44, or a sequence of SEQ ID NO:46 and SEQ ID NO:47, or a sequence of SEQ ID NO:49 and SEQ ID NO:50, or a sequence of SEQ ID NO:52 and SEQ ID NO:53, a sequence of SEQ ID NO:55 and SEQ ID NO:56, or a sequence of SEQ ID NO:58 and SEQ ID NO:59, or a sequence of SEQ ID NO:61 and SEQ ID NO:62;

[0032] The fragment of at least 15 nucleotides is the sequence of SEQ ID NO:39, or the sequence of SEQ ID NO:42, or the sequence of SEQ ID NO:45, or the sequence of SEQ ID NO:48, or the sequence of SEQ ID NO:51, or the sequence of SEQ ID NO:54, or the sequence of SEQ ID NO:57, or the sequence of SEQ ID NO:60, or the sequence of SEQ ID NO:63.

[0033] 16. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0034] The fragment comprising at least nine nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0035] The fragment comprising at least nine nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0036] The fragment comprising at least 9 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0037] The fragment comprising at least nine nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0038] A fragment comprising at least nine nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0039] A fragment comprising at least nine nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0040] A fragment comprising at least nine nucleotides of SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0041] A fragment comprising at least nine nucleotides of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0042] The fragment comprising at least nine nucleotides of SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36 or their complementary sequence and containing at least one CpG dinucleotide sequence.

[0043] 17. The oligonucleotide according to claim 10, further comprising:

[0044] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0045] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0046] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences under moderately or strictly controlled conditions, and contains at least one CpG dinucleotide sequence; and / or

[0047] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0048] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0049] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0050] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0051] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0052] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.

[0053] 18. The oligonucleotide according to claim 17, further comprising:

[0054] Blockers that preferentially bind to target sequences in an unmethylated state.

[0055] 19. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0056] The sequences of SEQ ID NO:37 and SEQ ID NO:38.

[0057] 20. The oligonucleotide according to claim 19, further comprising:

[0058] The sequence of SEQ ID NO:39.

[0059] 21. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0060] The sequences of SEQ ID NO:40 and SEQ ID NO:41.

[0061] 22. The oligonucleotide according to item 21, further comprising:

[0062] The sequence of SEQ ID NO:42.

[0063] 23. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0064] The sequences of SEQ ID NO:43 and SEQ ID NO:44.

[0065] 24. The oligonucleotide according to item 23, further comprising:

[0066] The sequence of SEQ ID NO:45.

[0067] 25. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0068] The sequences of SEQ ID NO:46 and SEQ ID NO:47.

[0069] 26. The oligonucleotide according to claim 25, further comprising:

[0070] The sequence of SEQ ID NO:48.

[0071] 27. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0072] The sequences of SEQ ID NO:49 and SEQ ID NO:50.

[0073] 28. The oligonucleotide according to claim 27, further comprising:

[0074] The sequence of SEQ ID NO:51.

[0075] 29. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0076] The sequences of SEQ ID NO:52 and SEQ ID NO:53.

[0077] 30. The oligonucleotide according to claim 29, further comprising:

[0078] The sequence of SEQ ID NO:54.

[0079] 31. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0080] The sequences of SEQ ID NO:55 and SEQ ID NO:56.

[0081] 32. The oligonucleotide according to claim 31, further comprising:

[0082] The sequence of SEQ ID NO:57.

[0083] 33. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0084] The sequences of SEQ ID NO:58 and SEQ ID NO:59.

[0085] 34. The oligonucleotide according to claim 33, further comprising:

[0086] The sequence of SEQ ID NO:60.

[0087] 35. An oligonucleotide for in vitro detection of liver cancer, comprising:

[0088] The sequences of SEQ ID NO:61 and SEQ ID NO:62.

[0089] 36. The oligonucleotide according to claim 35, further comprising:

[0090] The sequence of SEQ ID NO:63.

[0091] 37. A kit comprising the composition of any one of items 1 to 15 or the oligonucleotide of any one of items 16 to 36.

[0092] 38. The kit according to claim 37, further comprising at least one other component selected from:

[0093] Nucleoside triphosphate, DNA polymerase, and buffer solution required for the function of the DNA polymerase.

[0094] 39. The kit according to claim 37 or 38, wherein the samples for which the kit is used to detect include: cell lines, histological sections, tissue biopsy / paraffin-embedded tissue, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.

[0095] 40. The kit according to any one of items 37 to 39, further comprising: instructions for use.

[0096] 41. Use of the composition according to any one of items 1 to 15 or the oligonucleotide according to any one of items 16 to 36 in the preparation of a kit for in vitro detection of liver cancer.

[0097] 42. The use according to item 41, wherein the kit for in vitro detection of liver cancer detects liver cancer by means of a method comprising the following steps:

[0098] 1) Isolate DNA samples containing the target sequence or fragments of the target gene from the biological sample to be tested;

[0099] 2) Determine the methylation status of the target sequence of the target gene;

[0100] 3) The state of the biological sample is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of liver cancer.

[0101] 43. The use according to item 42, wherein the method comprises the following steps:

[0102] Extract genomic DNA from the biological sample to be tested;

[0103] The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases.

[0104] The reagent-treated DNA sample is contacted with DNA polymerase and primers containing the target sequence of the target gene to carry out a DNA polymerization reaction;

[0105] Detection of amplification products using probes; and

[0106] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.

[0107] 44. The use according to item 43, wherein the reagent is a bisulfite reagent.

[0108] 45. A method for detecting liver cancer, comprising the following steps:

[0109] Isolate DNA samples containing the target sequence or fragments of the target gene from biological samples to be tested;

[0110] Determine the methylation status of the target sequence of the target gene; and

[0111] The state of a biological sample is determined by detecting the methylation status of the target sequence of the target gene, thereby enabling in vitro detection of liver cancer.

[0112] 46. ​​A method for detecting liver cancer, comprising the following steps:

[0113] Extract genomic DNA from the biological sample to be tested;

[0114] The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases.

[0115] The reagent-treated DNA sample is contacted with DNA polymerase and primers containing the target sequence of the target gene to carry out a DNA polymerization reaction;

[0116] Detection of amplification products using probes; and

[0117] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.

[0118] 47. The method according to item 45 or 46, wherein,

[0119] The target gene is one or more of the following genes: CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5, and EMX1.

[0120] 48. The method according to item 47, wherein the target sequence of the CHFR gene is as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

[0121] 49. The method according to item 47, wherein the target sequence of the SPINT2 gene is shown in SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8.

[0122] 50. The method according to item 47, wherein the target sequence of the RNF135 gene is as shown in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12.

[0123] 51. The method according to item 47, wherein the target sequence of the CHST2 gene is as shown in SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16.

[0124] 52. The method according to item 47, wherein the target sequence of the SPDYA gene is as shown in SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20.

[0125] 53. The method according to item 47, wherein the target sequence of the PAX5 gene is as shown in SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24.

[0126] 54. The method according to item 47, wherein the target sequence of the VASH2 gene is as shown in SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28.

[0127] 55. The method according to item 47, wherein the target sequence of the TSPYL5 gene is as shown in SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32.

[0128] 56. The method according to item 47, wherein the target sequence of the EMX1 gene is as shown in SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36.

[0129] 57. The method according to item 46, wherein the reagent is a bisulfite reagent.

[0130] 58. The method according to item 46, wherein the primer is:

[0131] The fragment comprising at least nine nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0132] The fragment comprising at least nine nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0133] The fragment comprising at least 9 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0134] The fragment comprising at least nine nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0135] A fragment comprising at least nine nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0136] A fragment comprising at least nine nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0137] A fragment comprising at least nine nucleotides of SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0138] A fragment comprising at least nine nucleotides of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0139] The fragment comprising at least nine nucleotides of SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36 or their complementary sequence and containing at least one CpG dinucleotide sequence.

[0140] 59. The method according to item 46, wherein the probe is:

[0141] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0142] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0143] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences under moderately or strictly controlled conditions, and contains at least one CpG dinucleotide sequence; and / or

[0144] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0145] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0146] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0147] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0148] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32 or their complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or

[0149] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36 or their complementary sequences under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.

[0150] 60. The method according to claim 58, wherein the primers are sequences of SEQ ID NO:37 and SEQ ID NO:38, or sequences of SEQ ID NO:40 and SEQ ID NO:41, or sequences of SEQ ID NO:43 and SEQ ID NO:44, or sequences of SEQ ID NO:46 and SEQ ID NO:47, or sequences of SEQ ID NO:49 and SEQ ID NO:50, or sequences of SEQ ID NO:52 and SEQ ID NO:53, sequences of SEQ ID NO:55 and SEQ ID NO:56, or sequences of SEQ ID NO:58 and SEQ ID NO:59, or sequences of SEQ ID NO:61 and SEQ ID NO:62.

[0151] 61. The method according to claim 59, wherein the probe is the sequence of SEQ ID NO:39, or the sequence of SEQ ID NO:42, or the sequence of SEQ ID NO:45, or the sequence of SEQ ID NO:48, or the sequence of SEQ ID NO:51, or the sequence of SEQ ID NO:54, or the sequence of SEQ ID NO:57, or the sequence of SEQ ID NO:60, or the sequence of SEQ ID NO:63.

[0152] This application has the following beneficial effects:

[0153] This application screened nine biomarkers capable of sensitively and specifically detecting liver cancer and identified the methylation regions of these biomarkers. By detecting the target sequences of methylated genes such as CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5, or EMX1, the methylation status of these genes can be sensitively and specifically detected, thus enabling the detection of cell-free DNA in peripheral blood. Testing of peripheral blood samples from liver cancer patients and healthy controls showed that the composition and detection method described in this application can sensitively and specifically detect liver cancer, ensuring the accuracy and reliability of the results. Therefore, this application provides a composition, kit, and detection method for in vitro detection of liver cancer, which can conveniently, rapidly, and effectively detect liver cancer and has significant clinical application value.

[0154] This application utilizes epigenomics and bioinformatics techniques to analyze genomic methylation data of liver cancer, identify multiple methylation genes associated with liver cancer, and determine the target sequences for abnormal methylation of liver cancer methylation genes. Furthermore, by using the target sequences of these methylation genes, the methylation status of the genes can be detected sensitively and specifically, which can then be used for the detection of cell-free DNA in peripheral blood.

[0155] The composition described in this application is used in a non-invasive manner for screening asymptomatic individuals, reducing the harm caused by invasive testing. The composition has higher sensitivity and accuracy, enabling real-time monitoring. Detailed Implementation

[0156] The present application will now be described in detail. While specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0157] Unless otherwise stated, the implementation of this application will employ conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and genetics techniques, all of which fall within the scope of conventional techniques in the art. Such techniques are described in detail in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (MJ Gait, 1984); *Animal Cell Culture* (RI Freshney, 1987); *Methods in Enzymology* (Academic Publishing, Inc.); *Current Protocols in Molecular Biology* (FMAusubel et al., 1987, and regularly updated); and *PCR: The Polymerase Chain Reaction* (Mullis et al., 1994). The primers, probes, blocking agents, and kits used in this application can be prepared using standard techniques known in the art.

[0158] Unless otherwise defined, the technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0159] definition

[0160] In this application, "precancerous" refers to cells that are in the early stages of transforming into cancer cells or that are prone to transforming into cancer cells. Such cells may exhibit one or more phenotypic traits characteristic of cancer cells.

[0161] In this application, "stringent hybridization conditions" and "highly stringent" refer to the conditions under which the probe hybridizes with its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary under different environments. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, Biochemistry and Molecular Biology Techniques – Nucleic Acid Probe Hybridization, “A Review of Hybridization Principles and Nucleic Acid Assay Strategies.” Typically, stringent conditions are approximately 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength and pH. At Tm (at the defined ionic strength, pH, and nucleic acid concentration), 50% of the probe complementary to the target sequence hybridizes uniformly with the target sequence. Stringent conditions can also be achieved by adding a destabilizing agent. For selective or specific hybridization, the positive signal is twice, preferably ten times, the background hybridization. Exemplary stringent hybridization conditions are as follows: hybridization at 42°C in a solution of 50% formamide, 5x SSC and 1% SDS, or hybridization at 65°C in a solution of 5x SSC and 1% SDS, followed by washing at 65°C in a solution of 0.2x SSC and 0.1% SDS.

[0162] Furthermore, if the peptides encoded by the nucleic acids are substantially similar, the nucleic acids that cannot hybridize under stringent conditions are still substantially similar. In this case, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. As an example, “moderately stringent hybridization conditions” include hybridization at 37°C in a solution of 40% formamide, 1M sodium chloride, and 1% SDS, followed by washing at 45°C in a solution of 1xSSC. Those skilled in the art will readily obtain guidance in the prior art for achieving conditions with the same stringency. For PCR, temperatures around 36°C are typically suitable for low-stringency amplification, while annealing temperatures range from 32°C to 48°C depending on primer length. For highly stringent PCR amplification, it is generally at 62°C, while annealing temperatures for highly stringent hybridization range from 50°C to 65°C depending on primer length and specificity. Typical cycling conditions for both high-strict and low-strict amplification include: a sustained denaturation phase of 30 seconds to 2 minutes at 90–95°C, a sustained annealing phase of 30 seconds to 2 minutes, and a sustained expansion phase of 1 to 2 minutes at approximately 72°C. Tools and instructions for low- and high-strict amplification reactions are available in the prior art.

[0163] In this application, "oligonucleotide" refers to a molecule composed of two or more nucleotides, preferably three or more nucleotides. Its precise size can depend on many factors, which in turn are determined by the final function and use of the oligonucleotide. In some embodiments, the oligonucleotide may comprise a length of 10 to 100 nucleotides. In some embodiments, the oligonucleotide may comprise a length of 10 to 30 nucleotides, or may have a length of 20 or 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.

[0164] In this application, "primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of a primer extension complementary to a nucleic acid strand—namely, in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at suitable temperature and pH—can serve as a starting point for synthesis, whether it is naturally occurring in purified restriction digests or synthetically produced. Primers can be single-stranded or double-stranded and must be long enough to initiate the synthesis of the desired extension in the presence of an inducer. The exact length of a primer depends on a variety of factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least or more than about 9, 10, 15, 20, or 25 or more nucleotides, depending on the complexity of the target sequence, but they may contain fewer or more nucleotides. Factors involved in determining the appropriate primer length are well known to those skilled in the art.

[0165] In this application, "primer pair" refers to a primer pair that hybridizes with the opposite strand of the target DNA molecule or with a target DNA region flanking the nucleotide sequence to be amplified.

[0166] In this application, "primer site" refers to the region of the target DNA or other nucleic acid to which the primer hybridizes.

[0167] In this application, the term "probe," when referring to a nucleic acid sequence, is used in its usual sense to mean a selected nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. Those skilled in the art will understand that, in certain circumstances, a probe can also be used as a primer, and a primer can be used as a probe.

[0168] In this application, "DNA methylation" refers to the addition of a methyl group to the 5th position of cytosine (C), which is typically (but not necessarily) in the case of a CpG (cytosine followed by guanine) dinucleotide. As used herein, "increased degree of methylation" or "significant degree of methylation" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancer cell or tissue sample, or a DNA sample treated for methylation of DNA residues) is unmethylated. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.

[0169] In the implementation scheme, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using Southern or polymerase chain reaction (PCR) analysis, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high-resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation-specific single-strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high-performance liquid chromatography (MS-DHPLC), and methylation-specific microarrays (MSO). These assays can be PCR analysis, quantitative analysis using fluorescent labels, or Southern blot analysis.

[0170] In this application, "methylation assay" refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.

[0171] In this application, "detection" refers to any process of observing a biomarker or biomarker alteration (e.g., a change in the methylation state of a biomarker or the expression level of a nucleic acid or protein sequence) in a biological sample, regardless of whether the biomarker or biomarker alteration is actually detected. In other words, the act of probing a biomarker or biomarker alteration in a sample is "detection," even if the biomarker is determined to be absent or below a sensitivity level. Detection can be a quantitative, semi-quantitative, or non-quantitative observation and can be based on comparison with one or more control samples. It should be understood that detecting liver cancer as disclosed herein includes detecting precancerous cells that have begun to develop into liver cancer cells or are about to develop into liver cancer cells, or have an increased tendency to develop into liver cancer cells. Detection of liver cancer may also include detecting the probability of possible death or the possible prognosis of the disease condition.

[0172] In this application, "homology," "identity," and "similarity" refer to the sequence similarity between two nucleic acid molecules. Homology, identity, or similarity can be determined by comparing positions in each sequence, and the sequences can be aligned for comparison purposes. When equivalent positions in the compared sequences are occupied by the same bases, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid residues (e.g., similar in spatial or electrical properties), the molecules can be considered homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the number of identical or similar amino acids at shared positions in the compared sequences. "Irrelevant" or "non-homologous" sequences share less than 40% identity with the sequences of this application, preferably less than 25%. The absence or presence of extra residues (amino acids or nucleic acids) also reduces identity and homology / similarity when comparing two sequences. In specific implementations, for two or more sequences or subsequences, determined by using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection provided online, for example, by the National Center for Biotechnology Information (NCBI), if their sequences exhibit approximately 60% identity in the specified region, or approximately 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher, when compared and aligned for maximum correspondence within a comparison window or specified region, they can be considered substantially or significantly homologous, similar, or identical. This definition also relates to or can be used to test sequence complements. Therefore, to the extent permitted by the context of this paper, for example, if a nucleotide sequence can be predicted to be naturally present in a DNA duplex, or can be naturally present as one or both of the complementary strands, then a nucleotide sequence complementary to the specified target sequence or a variant thereof is itself considered "similar" to the target sequence, and when "similar" nucleic acid sequences are involved, this includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Similarity must be limited to analyses of single nucleic acid strand sequences, which may include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In the implementation scheme, identity or similarity may be in regions of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides, or in regions of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more nucleotides.

[0173] In this application, "amplification" refers to the process of obtaining multiple copies of a nucleic acid from a specific locus, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known methods, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0174] This application's "fluorescence-based real-time PCR" describes a method that involves adding a fluorescent group to the PCR reaction system, using the accumulation of fluorescence signals to monitor the entire PCR process in real time, and finally performing quantitative analysis of unknown templates using a standard curve. A crucial concept in this PCR technique is the cycle threshold, also known as the Ct value. C stands for Cycle, and t stands for threshold. The Ct value represents the number of cycles required for the fluorescence signal in each reaction tube to reach a set threshold. For example, the fluorescence threshold can be set as follows: the fluorescence signal from the first 15 cycles of the PCR reaction is used as the fluorescence background signal, and the default setting for the fluorescence threshold is 10 times the standard deviation of the fluorescence signal from 3 to 15 cycles.

[0175] The "cut-off value" of real-time PCR in this application refers to a critical Ct value for determining the positivity or positivity of a sample for a specific biomarker. According to certain specific real-time methods in this application, "the critical Ct value (Cut-off value) is obtained based on a certain number of sample data and statistical processing," and this critical Ct value can vary depending on the required sensitivity or specificity.

[0176] In this application, "sensitivity" refers to the proportion of cancer detected in a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancers / all cancers), while "specificity" refers to the proportion of normal samples detected in a certain normal sample, and its calculation formula is: Specificity = (detected negatives / total negatives).

[0177] The “label” or “detectable part” in this application refers to a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxigenin, or haptens, and proteins that can be prepared as detectable proteins, for example, by incorporating radiolabels into peptides or antibodies for detecting peptide-specific reactions.

[0178] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blotting, Northern blotting, or in situ hybridization). Specifically, oligonucleotides capable of amplifying target nucleic acids (e.g., oligonucleotide primers) can be used in PCR reactions. PCR methods typically include the following steps: obtaining a sample, isolating nucleic acids (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acids with one or more oligonucleotide primers that specifically hybridize with the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is generated. The conditions for nucleic acid amplification and detection of the amplification product are known to those skilled in the art. Various improvements to basic PCR techniques have been developed, including but not limited to anchored PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). In the amplification reaction, the primer pair must anneal to the opposite strands of the template nucleic acid and should be kept at an appropriate distance from each other so that the polymerase can efficiently polymerize across regions and so that the amplification product can be easily detected, for example, by electrophoresis. For example, computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to facilitate the design of primers with similar melting temperatures. Typically, oligonucleotide primers are 9–30, 40, or 50 nucleotides in length (e.g., lengths of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides), but oligonucleotide primers can be longer or shorter, provided appropriate amplification conditions are used.

[0179] Detection of amplification products or hybridization complexes is typically achieved using detectable labels. The term "label," when referring to nucleic acids, is intended to include both direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, and indirect labeling of nucleic acids by reacting with another reagent that has directly labeled the detectable substance. Detectable substances include a variety of enzymes, prosthetic groups, fluorescent materials, cryoluminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include avidin / streptin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, luciferin, luciferin isothiocyanate, rhodamine, dichlorotriazineamine luciferin, dansyl chloride, or phycoerythrin; examples of cryoluminescent materials include luminol; and examples of bioluminescent materials include luciferase, insect luciferin, and jellyfish protein. Examples of indirect labeling include end-labeling of nucleic acids with biotin, making the nucleic acid detectable using fluorescently labeled avidin streptavidin.

[0180] Overview

[0181] On one hand, this application provides a composition for in vitro detection of liver cancer, the composition comprising nucleic acid for detecting the methylation status of a target sequence of a target gene, wherein the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is one or more of the following: CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene, and EMX1 gene.

[0182] This application provides a set of target sequences for genes that emit abnormal methylation in liver cancer, including target sequences for one or more of the following genes: CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene, and EMX1 gene. The target sequences for the CHFR gene are shown in any one of SEQ ID NO:1-4 or include any one of the sequences shown in SEQ ID NO:1-4; the target sequences for the SPINT2 gene are shown in any one of SEQ ID NO:5-8 or include any one of the sequences shown in SEQ ID NO:5-8; the target sequences for the RNF135 gene are shown in any one of SEQ ID NO:9-12 or include any one of the sequences shown in SEQ ID NO:9-12; the target sequences for the CHST2 gene are shown in any one of SEQ ID NO:13-16 or include any one of the sequences shown in SEQ ID NO:13-16; and the target sequences for the SPDYA gene are shown in SEQ ID NO:1-1-16. The target sequences of the PAX5 gene are shown or included in any one of SEQ ID NO:17-20, the target sequences of the VASH2 gene are shown or included in any one of SEQ ID NO:25-28, the target sequences of the TSPYL5 gene are shown or included in any one of SEQ ID NO:29-32, and the target sequences of the EMX1 gene are shown or included in any one of SEQ ID NO:33-36.

[0183] Those skilled in the art will also understand that the target sequences of the CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene, and EMX1 gene are not limited to the specific sequences listed above. The target sequence of the CHFR gene should encompass sequences that, compared to any of the sequences shown in SEQ ID NO:1-4, contain one, two, or more nucleotide mutations but are substantially functionally identical; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:1-4; and sequences that, based on the nucleotide sequence shown in any of SEQ ID NO:1-4, have one or more nucleotides deleted, one or more nucleotides added, or one or more nucleotides replaced, but have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleotide sequence shown in any of SEQ ID NO:1-4. The target sequence of the SPINT2 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:5-8, but are still substantially functionally identical to the sequences shown in SEQ ID NO:5-8; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:5-8; and sequences that have one or more nucleotides deleted, one or more nucleotides added, or one or more nucleotides replaced based on any of the nucleotide sequences shown in SEQ ID NO:5-8, but have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the nucleotide sequences shown in SEQ ID NO:5-8. The target sequence of the RNF135 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:9-12, but are still substantially functionally identical to the sequences shown in SEQ ID NO:9-12; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:9-12; and sequences that have one or more nucleotides deleted, one or more nucleotides added, or one or more nucleotides replaced based on any of the nucleotide sequences shown in SEQ ID NO:9-12, but have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the nucleotide sequences shown in SEQ ID NO:9-12.The target sequence of the CHST2 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:13-16, but are substantially functionally identical to the sequences shown in SEQ ID NO:13-16; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:13-16; and sequences that have one or more nucleotides deleted, one or more nucleotides added, or one or more nucleotides replaced based on any of the nucleotide sequences shown in SEQ ID NO:13-16, but have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the nucleotide sequences shown in SEQ ID NO:13-16. The target sequence of the SPDYA gene should include sequences that contain one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:17-20, but are still substantially functionally identical to the sequences shown in SEQ ID NO:17-20; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:17-20; and sequences that have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the nucleotide sequences shown in SEQ ID NO:17-20, based on the deletion of one or more nucleotides, the addition of one or more nucleotides, or the substitution of one or more nucleotides. The target sequence of the PAX5 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:21-24, but are substantially functionally identical to the sequences shown in SEQ ID NO:21-24; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:21-24; and sequences that have one or more nucleotides deleted, one or more nucleotides added, or one or more nucleotides replaced based on any of the nucleotide sequences shown in SEQ ID NO:21-24, but have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the nucleotide sequences shown in SEQ ID NO:21-24.The target sequence of the VASH2 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:25-28, but are substantially functionally identical to the sequences shown in SEQ ID NO:25-28; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:25-28; and sequences that have one or more nucleotides deleted, one or more nucleotides added, or one or more nucleotides replaced based on any of the nucleotide sequences shown in SEQ ID NO:25-28, but have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the nucleotide sequences shown in SEQ ID NO:25-28. The target sequence of the TSPYL5 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:29-32, but are still substantially functionally identical to the sequences shown in SEQ ID NO:29-32; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:29-32; and sequences that have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the nucleotide sequences shown in SEQ ID NO:29-32, based on the deletion of one or more nucleotides, the addition of one or more nucleotides, or the substitution of one or more nucleotides. The target sequence of the EMX1 gene should include sequences that contain one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:33-36, but are still substantially functionally identical to the sequences shown in SEQ ID NO:33-36; sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:33-36; and sequences that have one or more nucleotides deleted, one or more nucleotides added, or one or more nucleotides replaced based on any of the nucleotide sequences shown in SEQ ID NO:33-36, but have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the nucleotide sequences shown in SEQ ID NO:33-36.

[0184] The target sequence (5'-3') of the CHFR gene is as follows:

[0185] AGAGGGGCGGGTCGGGGCGGAGAGCCGCGCCCAAAGGCAATGGGAGCCGCACGCTGCTAGGCAACATGCTGTCTCCCGGCAACGTAGAGGCGGGGAATTCGCCAACGTGTCTGAAACAGACAACAATTTTAGCCAACGGCTGCGTGGGCCTTGGGCGTCCTGGCCAATGGGAATAGTGAGGGGCCTGTCACTAAGAAACCTGTCCCTGAGCAACGCATAGGAGGGGTGGAACCCAGCAGCGCTGACTGAGCCGCCGCGAAGTGCCGGAACGTATTACCTGGGAGCCAAATTTCAGAGCGTCGTTTGTCTTCCCAAGCCCACCAGCTTTCAGCGTTCTCCAGCCTCGCCACACCCCCGCCTCGGGCCGTCCCCGCCCAGACGCTTGTCCCCGCGAGAAGCTGAGCGCACTGAAGTGAGCCCGGCGGCTGCCGCCGGAGGAGGAGCCCGGCTCTGGACACGGCCGTCA(SEQ ID NO:1)

[0186] The sequence (5'-3') of the target sequence of the CHFR gene after bisulfite treatment is as follows:

[0187] AGAGGGGCGGGTCGGGGCGGAGAGTCGCGTTTAAAGGTAATGGGAGTCGTACGTTGTTAGGTAATATGTTGTTTTTCGGTAACGTAGAGGCGGGGAATTCGTTAACGTGTTTGAAATAGATAATAATTTTAGTTAACGGTTGCGTGGGTTTTGGGCGTTTTGGTTAATGGGAATAGTGAGGGGTTTGTTATTAAGAAATTTGTTTTTGAGTAACGTATAGGAGGGGTGGAATTTAGTAGCGTTGATTGAGTCGTCGCGAAGTGTCGGAACGTATTATTTGGGAGTTAAATTTTAGAGCGTCGTTTGTTTTTTTAAGTTTATTAGTTTTTAGCGTTTTTTAGTTTCGTTATATTTTCGTTTCGGGTCGTTTTCGTTTAGACGTTTGTTTTCGCGAGAAGTTGAGCGTATTGAAGTGAGTTCGGCGGTTGTCGTCGGAGGAGGAGTTCGGTTTTGGATACGGTCGTTA(SEQ ID NO:2)

[0188] The complementary sequence (5'-3') of the target sequence of the CHFR gene is as follows:

[0189] TGACGGCCGTGTCCAGAGCCGGGCTCCTCCTCCGGCGGCAGCCGCCGGGCTCACTTCAGTGCGCTCAGCTTCTCGCGGGGACAAGCGTCTGGGCGGGGACGGCCCGAGGCGGGGGTGTGGCGAGGCTGGAGAACGCTGAAAGCTGGTGGGCTTGGGAAGACAAACGACGCTCTGAAATTTGGCTCCCAGGTAATACGTTCCGGCACTTCGCGGCGGCTCAGTCAGCGCTGCTGGGTTCCACCCCTCCTATGCGTTGCTCAGGGACAGGTTTCTTAGTGACAGGCCCCTCACTATTCCCATTGGCCAGGACGCCCAAGGCCCACGCAGCCGTTGGCTAAAATTGTTGTCTGTTTCAGACACGTTGGCGAATTCCCCGCCTCTACGTTGCCGGGAGACAGCATGTTGCCTAGCAGCGTGCGGCTCCCATTGCCTTTGGGCGCGGCTCTCCGCCCCGACCCGCCCCTCT(SEQ ID NO:3)

[0190] The complementary sequence of the target sequence of the CHFR gene after bisulfite treatment (5'-3') is as follows:

[0191] TGACGGTCGTGTTTAGAGTCGGGTTTTTTTTTCGGCGGTAGTCGTCGGGTTTATTTTAGTGCGTTTAGTTTTTCGCGGGGATAAGCGTTTGGGCGGGGACGGTTCGAGGCGGGGGTGTGGCGAGGTTGGAGAACGTTGAAAGTTGGTGGGTTTGGGAAGATAAACGACGTTTTGAAATTTGGTTTTTAGGTAATACGTTTCGGTATTTCGCGGCGGTTTAGTTAGCGTTGTTGGGTTTTATTTTTTTTATGCGTTGTTTAGGGATAGGTTTTTTAGTGATAGGTTTTTTATTATTTTTATTGGTTAGGACGTTTAAGGTTTACGTAGTCGTTGGTTAAAATTGTTGTTTGTTTTAGATACGTTGGCGAATTTTTCGTTTTTACGTTGTCGGGAGATAGTATGTTGTTTAGTAGCGTGCGGTTTTTATTGTTTTTGGGCGCGGTTTTTCGTTTCGATTCGTTTTTTT(SEQ ID NO:4)

[0192] The target sequence (5'-3') of the SPINT2 gene is as follows:

[0193] CGCCCCGCCCCGCCAGGTTCTGTTGGGGGCGAGGCCCGCGCAAGCCCCGCCTCTTCCCCGGCACCAGGGGCGGGCCCAGGTGCGCCCAGGGCCGGGGAGCGGCCGCGCAGGTGCCTGCCCTTTGCGCCTGCGCCCAGCTCGCCCTGCCTAGCCAGGTGCGCCCCGCCCCCTGCCTGCCCGGCCACCTTCGGGAGCCGCTTCCAATAGGCGTTCGCCATTGGCTCTGGCGACCTCCGCGCGTTGGGAGGTGTAGCGCGGCTCTGAACGCGCTGAGGGCCGTTGAGTGTCGCAGGCGGCGAGGGCGCGAGTGAGGAGCAGACCCAGGCATCGCGCGCCGAGAAGGCCGGGCGTCCCCACACTGAAGGTCCGGAAAGGCGACTTCCGGGGGCTTTGGCACCTGGCGGACCCTCCCGGAGCGTCGGCACCTGAACGCGAGGCGCTCCATTGCGCGTGCGCGTTGAGGGGCT(SEQ ID NO:5)

[0194] The sequence (5'-3') of the target sequence of the SPINT2 gene after bisulfite treatment is as follows:

[0195] CGTTTCGTTTCGTTAGGTTTTGTTGGGGGCGAGGTTCGCGTAAGTTTCGTTTTTTTTTCGGTATTAGGGGCGGGTTTAGGTGCGTTTAGGGTCGGGGAGCGGTCGCGTAGGTGTTTGTTTTTTGCGTTTGCGTTTAGTTCGTTTTGTTTAGTTAGGTGCGTTTCGTTTTTTGTTTGTTCGGTTATTTTCGGGAGTCGTTTTTAATAGGCGTTCGTTATTGGTTTTGGCGATTTTCGCGCGTTGGGAGGTGTAGCGCGGTTTTGAACGCGTTGAGGGTCGTTGAGTGTCGTAGGCGGCGAGGGCGCGAGTGAGGAGTAGATTTAGGTATCGCGCGTCGAGAAGGTCGGGCGTTTTTATATTGAAGGTTCGGAAAGGCGATTTTCGGGGGTTTTGGTATTTGGCGGATTTTTTCGGAGCGTCGGTATTTGAACGCGAGGCGTTTTATTGCGCGTGCGCGTTGAGGGGTT(SEQ ID NO:6)

[0196] The complementary sequence (5'-3') of the target sequence of the SPINT2 gene is as follows:

[0197] AGCCCCTCAACGCGCACGCGCAATGGAGCGCCTCGCGTTCAGGTGCCGACGCTCCGGGAGGGTCCGCCAGGTGCCAAAGCCCCCGGAAGTCGCCTTTCCGGACCTTCAGTGTGGGGACGCCCGGCCTTCTCGGCGCGCGATGCCTGGGTCTGCTCCTCACTCGCGCCCTCGCCGCCTGCGACACTCAACGGCCCTCAGCGCGTTCAGAGCCGCGCTACACCTCCCAACGCGCGGAGGTCGCCAGAGCCAATGGCGAACGCCTATTGGAAGCGGCTCCCGAAGGTGGCCGGGCAGGCAGGGGGCGGGGCGCACCTGGCTAGGCAGGGCGAGCTGGGCGCAGGCGCAAAGGGCAGGCACCTGCGCGGCCGCTCCCCGGCCCTGGGCGCACCTGGGCCCGCCCCTGGTGCCGGGGAAGAGGCGGGGCTTGCGCGGGCCTCGCCCCCAACAGAACCTGGCGGGGCGGGGCG(SEQ ID NO:7)

[0198] The complementary sequence of the target sequence of the SPINT2 gene after bisulfite treatment (5'-3') is as follows:

[0199] AGTTTTTTAACGCGTACGCGTAATGGAGCGTTTCGCGTTTAGGTGTCGACGTTTCGGGAGGGTTCGTTAGGTGTTAAAGTTTTCGGAAGTCGTTTTTTCGGATTTTTAGTGTGGGGACGTTCGGTTTTTTCGGCGCGCGATGTTTGGGTTTGTTTTTTATTCGCGTTTTCGTCGTTTGCGATATTTAACGGTTTTTAGCGCGTTTAGAGTCGCGTTATATTTTTTAACGCGCGGAGGTCGTTAGAGTTAATGGCGAACGTTTATTGGAAGCGGTTTTCGAAGGTGGTCGGGTAGGTAGGGGGCGGGGCGTATTTGGTTAGGTAGGGCGAGTTGGGCGTAGGCGTAAAGGGTAGGTATTTGCGCGGTCGTTTTTCGGTTTTGGGCGTATTTGGGTTCGTTTTTGGTGTCGGGGAAGAGGCGGGGTTTGCGCGGGTTTCGTTTTTAATAGAATTTGGCGGGGCGGGGCG(SEQ ID NO:8)

[0200] The target sequence (5'-3') of the RNF135 gene is as follows

[0201] TGGTTTCCCAGGGCAAGAGGCCGCCACTGAAGGTCAGCTCTGTCTTTCCAGCTGGGCACTGGAGGCTCTAAGTCTGTTTTCAGCAGGATCGGAGGAAGGAGACGGGGTGGCGCCAAGGAAGGAGGAGAAAAGGCGGCCGAGAAAAGGAGGAGGGCAAGGGGAAGAGGAAGGGCGAGGGAGGAGCCTGAGGAGACTCGCCCGGCTCAACCCCGACGTCCGCGCCCCGGCCGCCTGTTGGCCATGGCGGGCCTGGGCCTGGGCTCCGCCGTTCCCGTGTGGCTGGCCGAGGACGACCTCGGCTGCATCATCTGCCAGGGGCTGCTGGACTGGCCCGCCACGCTGCCCTGCGGCCACAGCTTCTGCCGCCACTGCCTGGAGGCCCTGTGGGGCGCCCGCGACGCCCGCCGCTGGGCCTGCCCCACTTGCCGCCAGGGCGCCGCGCAGCAGCCGCACCTGCGGAAGAACACGCTACTGCAGGACCTGGCCGACAAGTACCGCCGCGCCGCACGCGAGATACAGGCGGGCTCCGACCCTGCCCACTGCCCCTGCCCGGGCTCCAGTTCCCTCTCCAGCG(SEQ ID NO:9)

[0202] The sequence (5'-3') of the target sequence of the RNF135 gene after bisulfite treatment is as follows:

[0203] TGGTTTTTTAGGGTAAGAGGTCGTTATTGAAGGTTAGTTTTGTTTTTTTAGTTGGGTATTGGAGGTTTTAAGTTTGTTTTTAGTAGGATCGGAGGAAGGAGACGGGGTGGCGTTAAGGAAGGAGGAGAAAAGGCGGTCGAGAAAAGGAGGAGGGTAAGGGGAAGAGGAAGGGCGAGGGAGGAGTTTGAGGAGATTCGTTCGGTTTAATTTCGACGTTCGCGTTTCGGTCGTTTGTTGGTTATGGCGGGTTTGGGTTTGGGTTTCGTCGTTTTCGTGTGGTTGGTCGAGGACGATTTCGGTTGTATTATTTGTTAGGGGTTGTTGGATTGGTTCGTTACGTTGTTTTGCGGTTATAGTTTTTGTCGTTATTGTTTGGAGGTTTTGTGGGGCGTTCGCGACGTTCGTCGTTGGGTTTGTTTTATTTGTCGTTAGGGCGTCGCGTAGTAGTCGTATTTGCGGAAGAATACGTTATTGTAGGATTTGGTCGATAAGTATCGTCGCGTCGTACGCGAGATATAGGCGGGTTTCGATTTTGTTTATTGTTTTTGTTCGGGTTTTAGTTTTTTTTTTAGCG(SEQ ID NO:10)

[0204] The complementary sequence (5'-3') of the target sequence of the RNF135 gene is as follows:

[0205] CGCTGGAGAGGGAACTGGAGCCCGGGCAGGGGCAGTGGGCAGGGTCGGAGCCCGCCTGTATCTCGCGTGCGGCGCGGCGGTACTTGTCGGCCAGGTCCTGCAGTAGCGTGTTCTTCCGCAGGTGCGGCTGCTGCGCGGCGCCCTGGCGGCAAGTGGGGCAGGCCCAGCGGCGGGCGTCGCGGGCGCCCCACAGGGCCTCCAGGCAGTGGCGGCAGAAGCTGTGGCCGCAGGGCAGCGTGGCGGGCCAGTCCAGCAGCCCCTGGCAGATGATGCAGCCGAGGTCGTCCTCGGCCAGCCACACGGGAACGGCGGAGCCCAGGCCCAGGCCCGCCATGGCCAACAGGCGGCCGGGGCGCGGACGTCGGGGTTGAGCCGGGCGAGTCTCCTCAGGCTCCTCCCTCGCCCTTCCTCTTCCCCTTGCCCTCCTCCTTTTCTCGGCCGCCTTTTCTCCTCCTTCCTTGGCGCCACCCCGTCTCCTTCCTCCGATCCTGCTGAAAACAGACTTAGAGCCTCCAGTGCCCAGCTGGAAAGACAGAGCTGACCTTCAGTGGCGGCCTCTTGCCCTGGGAAACCA(SEQ ID NO:11)

[0206] The complementary sequence of the target sequence of the RNF135 gene after bisulfite treatment (5'-3') is as follows:

[0207] CGTTGGAGAGGGAATTGGAGTTCGGGTAGGGGTAGTGGGTAGGGTCGGAGTTCGTTTGTATTTCGCGTGCGGCGCGGCGGTATTTGTCGGTTAGGTTTTGTAGTAGCGTGTTTTTTCGTAGGTGCGGTTGTTGCGCGGCGTTTTGGCGGTAAGTGGGGTAGGTTTAGCGGCGGGCGTCGCGGGCGTTTTATAGGGTTTTTAGGTAGTGGCGGTAGAAGTTGTGGTCGTAGGGTAGCGTGGCGGGTTAGTTTAGTAGTTTTTGGTAGATGATGTAGTCGAGGTCGTTTTCGGTTAGTTATACGGGAACGGCGGAGTTTAGGTTTAGGTTCGTTATGGTTAATAGGCGGTCGGGGCGCGGACGTCGGGGTTGAGTCGGGCGAGTTTTTTTAGGTTTTTTTTTCGTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTCGGTCGTTTTTTTTTTTTTTTTTTTGGCGTTATTTCGTTTTTTTTTTTCGATTTTGTTGAAAATAGATTTAGAGTTTTTAGTGTTTAGTTGGAAAGATAGAGTTGATTTTTAGTGGCGGTTTTTTGTTTTGGGAAATTA(SEQ ID NO:12)

[0208] The target sequence (5'-3') of the CHST2 gene is as follows:

[0209] CAAGTATTTTTCTGCAAATTAGAACGGGGCGTTCCCCTCCCCCATCACCCCAATTCCAGAGGACGTCAATCACAGTGGACGCAGCACCGCGAGCGGAAATGCGGAGAGCATCGGGGCTCCGCATGTGGGGCACAATGAAACAAGAGCAGCCCCGGCCAGAGGTCCAGTAAAGCGGAAAGACGGTCCCGCCCGCACACCCCTCCGGAAAACTGAAGCGTCTCCTCTGACCCCCAAGGTCAGAAAGATTTATTACTTCCTTCGAGAGGGCGCAGCCACAGACCCACTAGAGAGGGCGGGCAGGGTGTCGGAAGCCAGAGAACGGCGCTCCGCGTCCTCCCACCGCTCCAGGGCGCAG(SEQ ID NO:13)

[0210] The sequence of the target sequence of the CHST2 gene after bisulfite treatment (5'-3') is as follows:

[0211] TAAGTATTTTTTTGTAAATTAGAACGGGGCGTTTTTTTTTTTTATTATTTTAATTTTAGAGGACGTTAATTATAGTGGACGTAGTATCGCGAGCGGAAATGCGGAGAGTATCGGGGTTTCGTATGTGGGGTATAATGAAATAAGAGTAGTTTCGGTTAGAGGTTTAGTAAAGCGGAAAGACGGTTTCGTTCGTATATTTTTTCGGAAAATTGAAGCGTTTTTTTTGATTTTTAAGGTTAGAAAGATTTATTATTTTTTTCGAGAGGGCGTAGTTATAGATTTATTAGAGAGGGCGGGTAGGGTGTCGGAAGTTAGAGAACGGCGTTTCGCGTTTTTTTATCGTTTTAGGGCGTAG(SEQ ID NO:14)

[0212] The complementary sequence of the target sequence of the CHST2 gene (5'-3') is as follows:

[0213] CTGCGCCCTGGAGCGGTGGGAGGACGCGGAGCGCCGTTCTCTGGCTTCCGACACCCTGCCCGCCCTCTCTAGTGGGTCTGTGGCTGCGCCCTCTCGAAGGAAGTAATAAATCTTTCTGACCTTGGGGGTCAGAGGAGACGCTTCAGTTTTCCGGAGGGGTGTGCGGGCGGGACCGTCTTTCCGCTTTACTGGACCTCTGGCCGGGGCTGCTCTTGTTTCATTGTGCCCCACATGCGGAGCCCCGATGCTCTCCGCATTTCCGCTCGCGGTGCTGCGTCCACTGTGATTGACGTCCTCTGGAATTGGGGTGATGGGGGAGGGGAACGCCCCGTTCTAATTTGCAGAAAAATACTTG(SEQ ID NO:15)

[0214] The complementary sequence of the target sequence of the CHST2 gene after bisulfite treatment (5'-3') is as follows:

[0215] TTGCGTTTTGGAGCGGTGGGAGGACGCGGAGCGTCGTTTTTTGGTTTTCGATATTTTGTTCGTTTTTTTTAGTGGGTTTGTGGTTGCGTTTTTTCGAAGGAAGTAATAAATTTTTTTGATTTTGGGGGTTAGAGGAGACGTTTTAGTTTTTCGGAGGGGTGTGCGGGCGGGATCGTTTTTTCGTTTTATTGGATTTTTGGTCGGGGTTGTTTTTGTTTTATTGTGTTTTATATGCGGAGTTTCGATGTTTTTCGTATTTTCGTTCGCGGTGTTGCGTTTATTGTGATTGACGTTTTTTGGAATTGGGGTGATGGGGGAGGGGAACGTTTCGTTTTAATTTGTAGAAAAATATTTG(SEQ ID NO:16)

[0216] The target sequence of the SPDYA gene (5'-3') is as follows:

[0217] AAGGGAAGTAAACGGCCCCAACGCAAGCCTGACTGCGAGACGTGCCCAAGGGAGGTAGGTCGAATGAAGAGGGTTGTGTGAGTTTTGCGCGGGCAGGCGGGATAACGGAGGAGGGAGGCCCGCGGCCGAGGCTCGGGCGGGCGGGGGGCAGGGAGGGGCGGGGTTCGCCGGCGCGCACTCCCAGGCAGGCCCCGCCCCCTCGGCCGGCTGTGCGCGCTGATTGGCCCCTGCCGGCCTCGCGCTCCCTCGCTCCGGGTTGGCGGGAGACCTTAGAGCGGGTACCGCTGCTGGCTAGCGACCGACGAGCAACCGTCTGAGGCCAGGAGCGCTGCGACGGAGCCTTGACCGCCGTTGCCCGGCCCTCTCCCGCGCAGCCCCGGGCTTCCGCAGGTACCTGTGCTCGCCCCCGGGAAGGGGCCTC(SEQ ID NO:17)

[0218] The sequence (5'-3') of the target sequence of the SPDYA gene after bisulfite treatment is as follows:

[0219] AAGGGAAGTAAACGGTTTTAACGTAAGTTTGATTGCGAGACGTGTTTAAGGGAGGTAGGTCGAATGAAGAGGGTTGTGTGAGTTTTGCGCGGGTAGGCGGGATAACGGAGGAGGGAGGTTCGCGGTCGAGGTTCGGGCGGGCGGGGGGTAGGGAGGGGCGGGGTTCGTCGGCGCGTATTTTTAGGTAGGTTTCGTTTTTTCGGTCGGTTGTGCGCGTTGATTGGTTTTTGTCGGTTTCGCGTTTTTTCGTTTCGGGTTGGCGGGAGATTTTAGAGCGGGTATCGTTGTTGGTTAGCGATCGACGAGTAATCGTTTGAGGTTAGGAGCGTTGCGACGGAGTTTTGATCGTCGTTGTTCGGTTTTTTTTCGCGTAGTTTCGGGTTTTCGTAGGTATTTGTGTTCGTTTTCGGGAAGGGGTTTT(SEQ ID NO:18)

[0220] The complementary sequence (5'-3') of the target sequence of the SPDYA gene is as follows:

[0221] GAGGCCCCTTCCCGGGGGCGAGCACAGGTACCTGCGGAAGCCCGGGGCTGCGGGAGAGGGCCGGGCAACGGCGGTCAAGGCTCCGTCGCAGCGCTCCTGGCCTCAGACGGTTGCTCGTCGGTCGCTAGCCAGCAGCGGTACCCGCTCTAAGGTCTCCCGCCAACCCGGAGCGAGGGAGCGCGAGCGCCAGGGGCCAATCAGCGCGCAC AGCCGGCCGAGGGGGCGGGGCCTGCCTGGGAGTGCGCGCCGGCGAACCCCGCCCCTCCCTGCCCCCCGCCCGCCCGAGCCTCGGCCGCGGGCCTCCCTCCTCCGTTATCCCGCCTGCCCGCGCAAAACTCACACAACCCTCTTCATTCGACCTACCTCCCTTGGGCACGTCTCGCAGTCAGGCTTGCGTTGGGGCCGTTTACTTCCCTT(SEQ ID NO:19)

[0222] The complementary sequence of the target sequence of the SPDYA gene after bisulfite treatment (5'-3') is as follows:

[0223] GAGGTTTTTTTTCGGGGGCGAGTATAGGTATTTGCGGAAGTTCGGGGTTGCGCGGGAGAGGGTCGGGTAACGGCGGTTAAGGTTTCGTCGTAGCGTTTTTGGTTTTAGACGGTTGTTCGTCGGTCGTTAGTTAGTAGCGGTATTCGTTTTAAGGTTTTTCGTTAATTCGGAGCGAGGGAGCGCGAGGTCGGTAGGGGTTAATTAGCGCGTATAGTCGGTCGAGGGGGCGGGGTTTGTTTGGGAGTGCGCGTCGGCGAATTTCGTTTTTTTTTGTTTTTCGTTCGTTCGAGTTTCGGTCGCGGGTTTTTTTTTTTCGTTATTTCGTTTGTTCGCGTAAAATTTATATAATTTTTTTTATTCGATTTATTTTTTTTGGGTACGTTTCGTAGTTAGGTTTGCGTTGGGGTCGTTTATTTTTTTT(SEQ ID NO:20)

[0224] The target sequence (5'-3') of the PAX5 gene is as follows:

[0225] TAATTCAAGCCTTCCGCTCCCCCGCCGAGCTGGGGTAGCTGATCACTGAGCTGAAACTAAACGTTTTAGGTGGAAAAAAAGCGTCCGAAGGCACCGTGAAATGATTAAGGAACTAAAGAGCTTCTCGCCATGTGAGATCATGTCCTGTTCTCGCCAACATCACAAGATGTCCCCAGACACGCCGCGCCCCCAGCGCGCCGCCCCACACTGCCGGCCCGGAGCGAGGAAAGGGTAGGCGCTGCGCGGCCGGGCCTGCTCAGCGCGCCAGACGTGGCGGACCCGGCCCGGCCGGAGTAGAGCGGGAAGCCGGGAGAGCAGCAGTGCTGCTGCCGCGCCGCCCCAGACTTTTATAGGGGTTGGGGGGAGGGAAGGAAGGCTTCAGCCTGCGCCGGGCGCTAGCCAGCGCACCTACGGGAAG(SEQ ID NO:21)

[0226] The sequence of the target sequence of the PAX5 gene after bisulfite treatment (5'-3') is as follows:

[0227] TAATTTAAGTTTTTCGTTTTTTCGTCGAGTTGGGGTAGTTGATTATTGAGTTGAAATTAAACGTTTTAGGTGGAAAAAAAGCGTTCGAAGGTATCGTGAAATGATTAAGGAATTAAAGAGTTTTTCGTTATGTGAGATTATGTTTTGTTTTCGTTAATATTATAAGATGTTTTTAGATACGTCGCGTTTTTAGCGCGTCGTTTTATATTGTCGGTTCGGAGCGAGGAAAGGGTAGGCGTTGCGCGGTCGGGTTTGTTTAGCGCGTTAGACGTGGCGGATTCGGTTCGGTCGGAGTAGAGCGGGAAGTCGGGAGAGTAGTAGTGTTGTTGTCGCGTCGTTTTAGATTTTTATAGGGGTTGGGGGGAGGGAAGGAAGGTTTTAGTTTGCGTCGGGCGTTAGTTAGCGTATTTACGGGAAG(SEQ ID NO:22)

[0228] The complementary sequence (5'-3') of the target sequence of the PAX5 gene is as follows:

[0229] CTTCCCGTAGGTGCGCTGGCTAGCGCCCGGCGCAGGCTGAAGCCTTCCTTCCCTCCCCCCAACCCCTATAAAAGTCTGGGGCGGCGCGGCAGCAGCACTGCTGCTCTCCCGGCTTCCCGCTCTACTCCGGCCGGGCCGGGTCCGCCACGTCTGGCGCGCTGAGCAGGCCCGGCCGCGCAGCGCCTACCCTTTCCTCGCTCCGGGCCGGCAGTGTGGGGCGGCGCGCTGGGGGCGCGGCGTGTCTGGGGACATCTTGTGATGTTGGCGAGAACAGGACATGATCTCACATGGCGAGAAGCTCTTTAGTTCCTTAATCATTTCACGGTGCCTTCGGACGCTTTTTTTCCACCTAAAACGTTTAGTTTCAGCTCAGTGATCAGCTACCCCAGCTCGGCGGGGGAGCGGAAGGCTTGAATTA(SEQ ID NO:23)

[0230] The complementary sequence of the target sequence of the PAX5 gene after bisulfite treatment (5'-3') is as follows:

[0231] TTTTTCGTAGGTGCGTTGGTTAGCGTTCGGCGTAGGTTGAAGTTTTTTTTTTTTTTTTTTAATTTTTATAAAAGTTTGGGGCGGCGCGGTAGTAGTATTGTTGTTTTTTCGGTTTTTCGTTTTATTTCGGTCGGGTCGGGTTCGTTACGTTTGGCGCGTTGAGTAGGTTCGGTCGCGTAGCGTTTATTTTTTTTTCGTTTCGGGTCGGTAGTGTGGGGCGGCGCGTTGGGGGCGCGGCGTGTTTGGGGATATTTTGTGATGTTGGCGAGAATAGGATATGATTTTATATGGCGAGAAGTTTTTTAGTTTTTTAATTATTTTACGGTGTTTTCGGACGTTTTTTTTTTATTTAAAACGTTTAGTTTTAGTTTAGTGATTAGTTATTTTAGTTCGGCGGGGGAGCGGAAGGTTTGAATTA(SEQ ID NO:24)

[0232] The target sequence of the VASH2 gene (5'-3') is as follows:

[0233] CAGCTGTGGCAGAACAGTCAGGGCCTGCCTGACCTCTTGAGTTTTATTGTCTCCTCTCAACTTGGGCTTAAAGGGACTTTATTAACCATGACTAATACCAGAGGATCCAAAGCTGCACCCACTTGTTAATTTTGAGGAATTTTTAAATGCGGGATTTAAAAAAGATTTAATTTCACGCATAGGTATGAACAGCCCCTCATCATCCCAGGTAGAGGATGAACAACTCATCATCCCGGGTAGAGGCAGGTAAGTGTGTCCAGCGTCCCTCAGGGAATGCTCTTCTGATGCCAAACCCTCTGCTTCCGCGGGGTCACTTCTCGGGTGGTTTTGTTTCTCCTCTGCTTCCACAGTTGCAAACCCTCGAAGTGCCACGACCCCTGGGGAAACTCGATCTTAAGTCCCATGGCCAAACGCTCCAGCCCGCGGGGCTCTCAGGACACCACAGCGATCGGATTTCGCGTGGCCGCCAGGCTCCCCCTACTCCTGTCCCCTCCCGCCAGAGAACCCCTGGAGCCAATCAGAGCGTCGCGGAGCCCGGGGTTGTAGAGTCCCGAGCCCGGGACCCGCCCCTCTTTGTTGCGGTGGCCAATAGACGCATTCGGAACATCGG(SEQ ID NO:25)

[0234] The sequence (5'-3') of the target sequence of the VASH2 gene after bisulfite treatment is as follows:

[0235] TAGTTGTGGTAGAATAGTTAGGGTTTGTTTGATTTTTTGAGTTTTATTGTTTTTTTTTAATTTGGGTTTAAAGGGATTTTATTAATTATGATTAATATTAGAGGATTTAAAGTTGTATTTATTTGTTAATTTTGAGGAATTTTTAAATGCGGGATTTAAAAAAGATTTAATTTTACGTATAGGTATGAATAGTTTTTTATTATTTTAGGTAGAGGATGAATAATTTATTATTTCGGGTAGAGGTAGGTAAGTGTGTTTAGCGTTTTTTAGGGAATGTTTTTTTGATGTTAAATTTTTTGTTTTCGCGGGGTTATTTTTCGGGTGGTTTTGTTTTTTTTTTGTTTTTATAGTTGTAAATTTTCGAAGTGTTACGATTTTTGGGGAAATTCGATTTTAAGTTTTATGGTTAAACGTTTTAGTTCGCGGGGTTTTTAGGATATTATAGCGATCGGATTTCGCGTGGTCGTTAGGTTTTTTTTATTTTTGTTTTTTTTCGTTAGAGAATTTTTGGAGTTAATTAGAGCGTCGCGGAGTTCGGGGTTGTAGAGTTTCGAGTTCGGGATTCGTTTTTTTTTGTTGCGGTGGTTAATAGACGTATTCGGAATATCGG(SEQ ID NO:26)

[0236] The complementary sequence (5'-3') of the target sequence of the VASH2 gene is as follows:

[0237] CCGATGTTCCGAATGCGTCTATTGGCCACCGCAACAAAGAGGGGCGGGTCCCGGGCTCGGGACTCTACAACCCCGGGCTCCGCGACGCTCTGATTGGCTCCAGGGGTTCTCTGGCGGGAGGGGACAGGAGTAGGGGGAGCCTGGCGGCCACGCGAAATCCGATCGCTGTGGTGTCCTGAGAGCCCCGCGGGCTGGAGCGTTTGGCCATGGGACTTAAGATCGAGTTTCCCCAGGGGTCGTGGCACTTCGAGGGTTTGCAACTGTGGAAGCAGAGGAGAAACAAAACCACCCGAGAAGTGACCCCGCGGAAGCAGAGGGTTTGGCATCAGAAGAGCATTCCCTGAGGGACGCTGGACACACTTACCTGCCTCTACCCGGGATGATGAGTTGTTCATCCTCTACCTGGGATGATGAGGGGCTGTTCATACCTATGCGTGAAATTAAATCTTTTTTAAATCCCGCATTTAAAAATTCCTCAAAATTAACAAGTGGGTGCAGCTTTGGATCCTCTGGTATTAGTCATGGTTAATAAAGTCCCTTTAAGCCCAAGTTGAGAGGAGACAATAAAACTCAAGAGGTCAGGCAGGCCCTGACTGTTCTGCCACAGCTG(SEQ ID NO:27)

[0238] The complementary sequence of the target sequence of the VASH2 gene after bisulfite treatment (5'-3') is as follows:

[0239] TCGATGTTTCGAATGCGTTTATTGGTTATCGTAATAAAGAGGGGCGGGTTTCGGGTTCGGGATTTTATAATTTCGGGTTTCGCGACGTTTTGATTGGTTTTAGGGGTTTTTTGGCGGGAGGGGATAGGAGTAGGGGGAGTTTGGCGGTTACGCGAAATTCGATCGTTGTGGTGTTTTGAGAGTTTCGCGGGTTGGAGCGTTTGGTTATGGGATTTAAGATCGAGTTTTTTTAGGGGTCGTGGTATTTCGAGGGTTTGTAATTGTGGAAGTAGAGGAGAAATAAAATTATTCGAGAAGTGATTTCGCGGAAGTAGAGGGTTTGGTATTAGAAGAGTATTTTTTGAGGGACGTTGGATATATTTATTTGTTTTTATTCGGGATGATGAGTTGTTTATTTTTTATTTGGGATGATGAGGGGTTGTTTATATTTATGCGTGAAATTAAATTTTTTTTAAATTTCGTATTTAAAAATTTTTTAAAATTAATAAGTGGGTGTAGTTTTGGATTTTTTGGTATTAGTTATGGTTAATAAAGTTTTTTTAAGTTTAAGTTGAGAGGAGATAATAAAATTTAAGAGGTTAGGTAGGTTTTGATTGTTTTGTTATAGTTG(SEQ ID NO:28)

[0240] The target sequence (5'-3') of the TSPYL5 gene is as follows:

[0241] CGGACTCGGGCTTTGGCGCGGCCTTTGCCCCGGTTTTTGGCGCGGGAGGACTTTCGACCCCGACTTCGGCCGCTCATGGTGGCGGCGGAGGCAGCTTCAAAGACACGCTGTGACCCTGCGGCTCCTGACGCCAGCTCTCGGTCGGGACCGAGCGGGTCTCTCCACGGCAACCGCCGACGTCACGAACGTACAACTGTACCGTCGCGAGAGGACGTGATGCGCCCGGTGATTGGCGCCGCCGCTGCGGCTGCGCAGGAGACGACCCCCGCGGGCGCTCCCACCCCCATCTCGCGCGGACTCGCTTTA(SEQ ID NO:29)

[0242] The sequence (5'-3') of the target sequence of the TSPYL5 gene after bisulfite treatment is as follows:

[0243] CGGATTCGGGTTTTGGCGCGGTTTTTGTTTCGGTTTTTGGCGCGGGAGGATTTTCGATTTCGATTTCGGTCGTTTATGGTGGCGGCGGAGGTAGTTTTAAAGATACGTTGTGATTTTGCGGTTTTTGACGTTAGTTTTCGGTCGGGATCGAGCGGGTTTTTTTACGGTAATCGTCGACGTTACGAACGTATAATTGTATCGTCGCGAGAGGACGTGATGCGTTCGGTGATTGGCGTCGTCGTTGCGGTTGCGTAGGAGACGATTTTCGCGGGCGTTTTTATTTTTATTTCGCGCGGATTCGTTTTA(SEQ ID NO:30)

[0244] The complementary sequence (5'-3') of the target sequence of the TSPYL5 gene is as follows:

[0245] TAAAGCGAGTCCGCGCGAGATGGGGGTGGGAGCGCCCGCGGGGGTCGTCTCCTGCGCAGCCGCAGCGGCGGCGCCAATCACCGGGCGCATCACGTCCTCTCGCGACGGTACAGTTGTACGTTCGTGACGTCGGCGGTTGCCGTGGAGAGACCCGCTCGGTCCCGACCGAGAGCTGGCGTCAGGAGCCGCAGGGTCACAGCGTGTCTTTGAAGCTGCCTCCGCCGCCACCATGAGCGGCCGAAGTCGGGGTCGAAAGTCCTCCCGCGCCAAAAACCGGGGCAAAGGCCGCGCCAAAGCCCGAGTCCG(SEQ ID NO:31)

[0246] The complementary sequence of the target sequence of the TSPYL5 gene after bisulfite treatment (5'-3') is as follows:

[0247] TAAAGCGAGTTCGCGCGAGATGGGGGTGGGAGCGTTCGCGGGGGTCGTTTTTTGCGTAGTCGTAGCGGCGGCGTTAATTATCGGGCGTATTACGTTTTTTCGCGACGGTATAGTTGTACGTTCGTGACGTCGGCGGTTGTCGTGGAGAGATTCGTTCGGTTTCGATCGAGAGTTGGCGTTAGGAGTCGTAGGGTTATAGCGTGTTTTTGAAGTTGTTTTCGTCGTTATTATGAGCGGTCGAAGTCGGGGTCGAAAGTTTTTTCGCGTTAAAAATCGGGGTAAAGGTCGCGTTAAAGTTCGAGTTCG(SEQ ID NO:32)

[0248] The target sequence of the EMX1 gene (5'-3') is as follows:

[0249] CCGAGGGCCGGGGGCGCCTGGAGAGAAATCCAGCTCCGGCTCTGAGCGTCTCCAGTCAGGCGAGGCGGATAAATCCTTCGCAAAACCCTCTTGGAAATTGCCGCCGCTTCCTGAGCCATCAGTCCCAGCGGGTACGTTATCGAGTAGCACAAACAGTTGGATTTTTCCCTCAAGAACCGAGTCTGGACGCGGAGATGGAGCCAAGTGTGGCTGCATTTTCGGACCCGGAAATCCGTTGGGCACTGAAGGACTTTTCGAACCCTGTAGCGCTGTTGCTTCGCGGTCCATCGTCGCCGCTGCAGACGGATGCGCTCCCCGGCGGCTCTACGCCCTCCAGTCCCGGCCAGGCCTCTGGGCTGGGAGCCGAGCCGTCTCGGGCCCTCCGGCGCCGCGTTTTCTA(SEQ ID NO:33)

[0250] The sequence (5'-3') of the target sequence of the EMX1 gene after bisulfite treatment is as follows:

[0251] TCGAGGGTCGGGGGCGTTTGGAGAGAAATTTAGTTTCGGTTTTGAGCGTTTTTAGTTAGGCGAGGCGGATAAATTTTTCGTAAAATTTTTTTGGAAATTGTCGTCGTTTTTTGAGTTATTAGTTTTAGCGGGTACGTTATCGAGTAGTATAAATAGTTGGATTTTTTTTTTAAGAATCGAGTTTGGACGCGGAGATGGAGTTAAGTGTGGTTGTATTTTCGGATTCGGAAATTCGTTGGGTATTGAAGGATTTTTCGAATTTTGTAGCGTTGTTGTTTCGCGGTTTATCGTCGTCGTTGTAGACGGATGCGTTTTTCGGCGGTTTTACGTTTTTTAGTTTCGGTTAGGTTTTTGGGTTGGGAGTCGAGTCGTTTCGGGTTTTTCGGCGTCGCGTTTTTTA(SEQ ID NO:34)

[0252] The complementary sequence (5'-3') of the target sequence of the EMX1 gene is as follows:

[0253] TAGAAAACGCGGCGCCGGAGGGCCCGAGACGGCTCGGCTCCCAGCCCAGAGGCCTGGCCGGGACTGGAGGGCGTAGAGCCGCCGGGGAGCGCATCCGTCTGCAGCGGCGACGATGGACCGCGAAGCAACAGCGCTACAGGGTTCGAAAAGTCCTTCAGTGCCCAACGGATTTCCGGGTCCGAAAATGCAGCCACACTTGGCTCCATCTCCGCGTCCAGACTCGGTTCTTGAGGGAAAAATCCAACTGTTTGTGCTACTCGATAACGTACCCGCTGGGACTGATGGCTCAGGAAGCGGCGGCAATTTCCAAGAGGGTTTTGCGAAGGATTTATCCGCCTCGCCTGACTGGAGACGCTCAGAGCCGGAGCTGGATTTCTCTCCAGGCGCCCCCGGCCCTCGG(SEQ ID NO:35)

[0254] The complementary sequence of the target sequence of the EMX1 gene after bisulfite treatment (5'-3') is as follows:

[0255] TAGAAAACGCGGCGTCGGAGGGTTCGAGACGGTTCGGTTTTTAGTTTAGAGGTTTGGTCGGGATTGGAGGGCGTAGAGTCGTCGGGGAGCGTATTCGTTTGTAGCGGCGACGATGGATCGCGAAGTAATAGCGTTATAGGGTTCGAAAAGTTTTTTAGTGTTTAACGGATTTTCGGGTTCGAAAATGTAGTTATATTTGGTTTTATTTTCGCGTTTAGATTCGGTTTTTGAGGGAAAAATTTAATTGTTTGTGTTATTCGATAACGTATTCGTTGGGATTGATGGTTTAGGAAGCGGCGGTAATTTTTAAGAGGGTTTTGCGAAGGATTTATTCGTTTCGTTTGATTGGAGACGTTTAGAGTCGGAGTTGGATTTTTTTTTAGGCGTTTTCGGTTTTCGG(SEQ ID NO:36)

[0256] The target sequences and related sequences of the CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5, and EMX1 genes are shown in Table 1.

[0257] Table 1: Target sequences and related sequences of each gene

[0258]

[0259]

[0260] Preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides from the bisulfite-converted sequence of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.

[0261] More preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene under moderately or strictly controlled conditions, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene after bisulfite transformation under moderately or strictly controlled conditions, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.

[0262] Preferably, the composition further includes a reagent for converting the 5-position unmethylated cytosine base of the target sequence of the target gene into uracil. More preferably, the reagent is a bisulfite.

[0263] Nucleic acids used to detect the methylation status of a target gene may also include blocking agents that preferentially bind to DNA in an unmethylated state.

[0264] Preferably, the composition comprises one or more primers and probes as shown in Table 2:

[0265] Table 2 Primer and probe sequences used in this application

[0266]

[0267] In Table 2, “F” represents the forward primer; “R” represents the reverse primer; and “P” represents the probe.

[0268] Preferably, the fluorescent labeling method of the probe sequence used in this application is shown in Table 3.

[0269] Table 3. One fluorescent labeling method for the probe sequences used in this application.

[0270] Sequence Change sequence name 5' mark 3' mark SEQ ID NO:39 CHFR_1P FAM BHQ1 SEQ ID NO:42 SPINT2_1P FAM BHQ1 SEQ ID NO:45 RNF135_1P FAM BHQ1 SEQ ID NO:48 CHST2_1P FAM BHQ1 SEQ ID NO:51 SPDYA_1P FAM BHQ1 SEQ ID NO:54 PAX5_1P FAM BHQ1 SEQ ID NO:57 VASH2_1P FAM BHQ1 SEQ ID NO:60 TSPYL5_1P FAM BHQ1 SEQ ID NO:63 EMX1_1P FAM BHQ1

[0271] In some embodiments, the composition further includes a reagent for converting the unmethylated cytosine base at position 5 of a gene into uracil. Preferably, this reagent is a bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In eukaryotic DNA, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because it has the same base-pairing behavior as cytosine. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most common method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, the unmethylated cytosine is converted into uracil, which corresponds to thymine in its pairing behavior; however, under these conditions, 5-methylcytosine remains unmodified. The original DNA is thus transformed in this way, making 5-methylcytosine, which was previously indistinguishable from cytosine in its hybridization behavior, now detectable as the only remaining cytosine by conventional known molecular biology techniques, such as amplification and hybridization. All these techniques, based on different base-pairing properties, can now be fully utilized. Therefore, typically, this application provides the combined use of bisulfite techniques with one or more methylation assays to determine the methylation status of a CpG dinucleotide sequence within a target sequence of a target gene. Furthermore, the methods of this application are suitable for analyzing heterogeneous biological samples, such as low concentrations of tumor cells in blood or feces. Therefore, when analyzing the methylation status of a CpG dinucleotide sequence in such a sample, those skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion, or extent) of a specific CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation state should also be considered as referring to a value reflecting the methylation status of a CpG dinucleotide sequence.

[0272] On the other hand, this application provides oligonucleotides for in vitro detection of liver cancer, comprising: a fragment of at least 9 nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:16 or their complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:19 or their complementary sequence and containing at least one CpG dinucleotide sequence. Fragments containing at least 9 nucleotides of NO:20 or its complementary sequence and including at least one CpG dinucleotide sequence; and / or fragments containing at least 9 nucleotides of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequences and including at least one CpG dinucleotide sequence; and / or fragments containing at least 9 nucleotides of SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28 or their complementary sequences and including at least one CpG dinucleotide sequence; and / or fragments containing at least 9 nucleotides of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32 or their complementary sequences and including at least one CpG dinucleotide sequence; and / or fragments containing at least 9 nucleotides of SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36 or their complementary sequences and including at least one CpG dinucleotide sequence.

[0273] Preferably, the oligonucleotide for in vitro detection of liver cancer comprises: a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequences; and / or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequences, and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences, and containing at least one CpG dinucleotide sequence; a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16 or their complementary sequences; and / or a fragment of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:16 or their complementary sequences; and / or a fragment of SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences, and containing at least one CpG dinucleotide sequence; a fragment of at least 9 nucleotides in a sequence obtained by bisulfite conversion of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16; and / or a fragment of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:19; and / or a fragment of SEQ ID NO:19; and / or a fragment of SEQ ID NO:10, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO Fragments comprising at least 9 nucleotides and containing at least one CpG dinucleotide sequence in the bisulfite-converted sequence of SEQ ID NO:20 or its complementary sequence; and / or fragments comprising at least 9 nucleotides and containing at least one CpG dinucleotide sequence in the bisulfite-converted sequence of SEQ ID NO:21 or SEQ ID NO:22 or SEQ ID NO:23 or SEQ ID NO:24 or its complementary sequence; fragments comprising at least 9 nucleotides in the bisulfite-converted sequence of SEQ ID NO:25 or SEQ ID NO:26 or SEQ ID NO:27 or SEQ ID NO:28 or its complementary sequence; and / or fragments comprising at least 9 nucleotides and containing at least one CpG dinucleotide sequence in the bisulfite-converted sequence of SEQ ID NO:29 or SEQ ID NO:30 or SEQ ID NO:31 or SEQ ID NO:32 or its complementary sequence; and / or fragments comprising at least 9 nucleotides and containing at least one CpG dinucleotide sequence in the bisulfite-converted sequence of SEQ ID NO:33 or SEQ ID NO:34 or SEQ ID NO:3 ... A fragment consisting of at least 9 nucleotides in the bisulfite conversion sequence of NO:36 or its complementary sequence, and containing at least one CpG dinucleotide sequence.

[0274] The oligonucleotide for in vitro detection of liver cancer of this application further includes: a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequences and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequences and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:8 or their complementary sequences and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:19, SEQ ID NO:19, SEQ ID NO:19, SEQ ID NO:19, SEQ ID NO:19, SEQ ID NO Fragments comprising at least 15 nucleotides of SEQ ID NO:16 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or fragments hybridized under moderately or strictly controlled conditions to SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or their complementary sequences and containing at least 15 nucleotides of at least one CpG dinucleotide sequence; and / or fragments hybridized under moderately or strictly controlled conditions to SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or their complementary sequences and containing at least 15 nucleotides of at least one CpG dinucleotide sequence; and / or fragments hybridized under moderately or strictly controlled conditions to SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28 or their complementary sequences and containing at least 15 nucleotides of at least one CpG dinucleotide sequence; and / or fragments hybridized under moderately or strictly controlled conditions to SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:24. Fragments consisting of at least 15 nucleotides of NO:32 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or fragments hybridized under moderate or severe conditions to at least 15 nucleotides of SEQ ID NO:33 or SEQ ID NO:34 or SEQ ID NO:35 or SEQ ID NO:36 or their complementary sequence and containing at least one CpG dinucleotide sequence.

[0275] Preferably, the oligonucleotide for in vitro detection of liver cancer comprises: a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence after bisulfite conversion of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or their complementary sequences, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence after bisulfite conversion of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 or their complementary sequences, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence after bisulfite conversion of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:8 or their complementary sequences, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or their complementary sequences, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12 or their complementary sequences, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under The following are hybridization conditions: a fragment containing at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO:16 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly conditions to a sequence containing at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly conditions to a sequence after bisulfite conversion of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or its complementary sequence, and containing at least 15 nucleotides of the sequence containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly conditions to a sequence after bisulfite conversion of SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28. A fragment containing at least 15 nucleotides and at least one CpG dinucleotide sequence in a sequence resulting from the bisulfite conversion of SEQ ID NO:28 or its complementary sequence; and / or hybridized under moderately or strictly controlled conditions to a fragment containing at least 15 nucleotides and at least one CpG dinucleotide sequence in a sequence resulting from the bisulfite conversion of SEQ ID NO:29 or SEQ ID NO:30 or SEQ ID NO:31 or SEQ ID NO:32 or its complementary sequence;And / or a fragment containing at least 15 nucleotides of a sequence derived from the bisulfite conversion of SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36 or their complementary sequence, and comprising at least one CpG dinucleotide sequence, under moderately or strictly controlled conditions.

[0276] The oligonucleotide for in vitro detection of liver cancer of this application may further include: an inhibitor that preferentially binds to DNA in an unmethylated state.

[0277] In one specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:37 and SEQ ID NO:38. It also includes the sequence of SEQ ID NO:39.

[0278] In another specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:40 and SEQ ID NO:41. It also includes the sequence of SEQ ID NO:42.

[0279] In another specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:43 and SEQ ID NO:44, and further includes the sequence of SEQ ID NO:45.

[0280] In another specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:46 and SEQ ID NO:47, and further includes the sequence of SEQ ID NO:48.

[0281] In another specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:49 and SEQ ID NO:50, and further includes the sequence of SEQ ID NO:51.

[0282] In another specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:52 and SEQ ID NO:53, and further includes the sequence of SEQ ID NO:54.

[0283] In another specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:55 and SEQ ID NO:56, and further includes the sequence of SEQ ID NO:57.

[0284] In another specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:58 and SEQ ID NO:59, and further includes the sequence of SEQ ID NO:60.

[0285] In another specific embodiment, the oligonucleotide for in vitro detection of liver cancer includes the sequences of SEQ ID NO:61 and SEQ ID NO:62, and further includes the sequence of SEQ ID NO:63.

[0286] On the other hand, this application provides a kit comprising the aforementioned composition. The kit further comprises at least one other component selected from: nucleoside triphosphate, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0287] Typically, the kit also includes a container for holding the patient's biological sample. Furthermore, the kit also includes instructions for using and interpreting the test results.

[0288] This application also relates to the use of the above-described composition and oligonucleotides in the preparation of a kit for in vitro detection of liver cancer.

[0289] This application also relates to the use of one or more of the following genes in the preparation of a kit for the in vitro detection of liver cancer: CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene, and EMX1 gene.

[0290] The CHFR gene (Checkpoint with forkhead and ring finger domains) is a mitotic stress checkpoint gene that has been cloned and located on chromosome 12q24.33. In mammalian cells exposed to drugs that damage microtubule structures (such as nocodazole or paclitaxel), the CHFR protein mediates a delay in metaphase entry. Microscopically, this is characterized by delayed chromosome condensation and a delayed cell cycle progression until cell damage is repaired. Furthermore, CHFR promotes cell survival in response to mitotic stress.

[0291] The SPINT2 gene (Homo sapiens serine peptidase inhibitor, Kunitz type 2, SPINT2) encodes a transmembrane protein. This gene inhibits the HGF / MET signaling pathway by suppressing HGF activation and is classified as a tumor suppressor gene. Furthermore, the SPINT2 gene can also inhibit the activity of hepatocyte growth factor by inhibiting the activation of hepatocyte growth activator. Hepatocyte growth factor can stimulate tumor cell growth and metastasis, and simultaneously stimulate tumor angiogenesis, playing an important role in tumor development and progression. Studies have shown that the SPINT2 gene expression is downregulated by methylation in tissues such as liver cancer, renal cell carcinoma, ovarian cancer, and glioma. SPINT2 expression is upregulated in breast cancer, and elevated SPINT2 expression is significantly associated with poor prognosis. This study found that SPINT2 is lowly expressed in most gastric cancer cell lines and gastric cancer tissues, and low SPINT2 expression is correlated with clinical indicators (such as tumor cell differentiation degree and metastasis) in gastric cancer patients.

[0292] The RNF135 gene (Homo sapiens ring finger protein 135) is an E3 ubiquitin ligase containing a ring finger domain, involved in the regulation of gene transcription, translation, cell adhesion, epithelial development, and cell cycle regulation. RINGfinger protein 135 (RNF135) consists of an N-terminal ring finger domain and C-terminal SPRY and PRY motifs 15, belonging to the E3 ubiquitin ligase family of ring finger proteins, located on chromosome 17q11.2. This gene ubiquitinates RIG-I in the early stages of viral infection and promotes its signal transduction, leading to the production of interferon-β. This process plays a crucial role in a wide range of biological processes related to development and disease pathogenesis. Studies have shown that the RNF135 gene is downregulated in Schwann cells of malignant peripheral nerve sheath tumors, and this downregulation can inactivate the Erk pathway in U87 and U251 glioma cells (the Erk pathway is involved in the regulation of cell cycle progression, cell growth, proliferation, and migration), thereby inhibiting cell growth and migration.

[0293] The CHST2 gene (GlcNAc6ST-2, HEC-GlcNAc6ST) belongs to the carbohydrate 6-O-thiotransferase family, which is involved in the transfer of thio groups to N-acetylglucosamine residues in galactose, N-acetylgalactosamine, or other glycoproteins. Studies have shown that in normal tissues, CHST2 mRNA is expressed only in lymph node endothelial cells and the liver. Within lymph node endothelial cells, it is believed to be involved in the assembly of L-selectin ligands. This ligand binding to L-selectin is the first step in lymphocyte homing, i.e., the adhesion of lymphocytes to lymphatic endothelial cells. In gene expression profiling and cluster analysis of osteosarcoma cell lines with different metastatic potentials, EREG gene expression was co-downregulated, while CHST2 gene expression was co-upregulated.

[0294] The SPDYA(SPY1) gene (Homo sapiens speedy / RINGO cell cycle regulator family member A, SPDYA(SPY1)) is a cell cycle protein belonging to the Speedy / Ringo family of cell cycle regulators. This gene promotes cell proliferation and survival by activating cyclin-dependent kinase-2. During late G1 phase and throughout S phase, Spy1 expression enhances CDK2-dependent p27kip1 degradation by directly promoting p27 degradation. Studies have confirmed that Spy1 is expressed in various human tissues, and its overexpression promotes G1-S phase progression, p27kip degradation, and cell proliferation by activating CDK2.

[0295] The PAX5 gene (paired box protein 5) is an evolutionarily highly conserved gene that encodes a B cell-specific activator protein (BSAP). Studies have demonstrated that B cell differentiation and development is an ordered, dynamic transcriptionally regulated process. B cell differentiation and development play a crucial role in immune regulation and immune responses. Transcription factors influence the directed differentiation and development of B cells, with the transcription factor Pax5 playing a key regulatory role.

[0296] The VASH2 gene (Homo sapiens vasohibin 2, VASH2) is a member of the angiostatin family of proteins. It participates in the regulation of angiogenesis and the endogenous membrane metastasis (EMT) pathway by interacting with proteins in the vascular endothelial growth factor (VEGF) family. Studies have shown that VASH2 is associated with the proliferation, metastasis, and invasion of various human tumors. Therefore, VASH2 can enhance the migration and invasion capabilities of ovarian and breast cancer cells by activating the TGF-β signaling pathway and participating in the regulation of the EMT process.

[0297] The TSPYL5 gene (Homo sapiens TSPY-like 5, TSPYL5) belongs to the TSPYL family. Studies have shown that its expression is lost or downregulated in many tumors. It inhibits the activity of P53 target genes by acting on ubiquitin-specific protease 7 to reduce the level of P53 protein. Meanwhile, TSPYL5 exhibits promoter hypermethylation (nearly 100%) in primary gliomas, resulting in downregulated expression, but shows almost no methylation in normal brain tissue.

[0298] The EMX1 gene (Homo sapiens empty spiracles homeobox 1) belongs to the EMX transcription factor family. It may be involved in regulating various biological processes, such as cell proliferation, migration, and differentiation during brain and neural crest development. In sarcomas, EMX1 exerts a tumor-suppressive effect by inhibiting the activity of stem cell regulatory genes and effectors of the typical Wnt pathway. Studies have shown that EMX1 overexpression reduces tumorigenicity, while reducing the levels of these genes enhances these properties. Furthermore, restoration of EMX1 expression levels inhibits cell proliferation and invasion.

[0299] Furthermore, this application provides a method for in vitro detection of liver cancer, the method comprising the following steps:

[0300] 1) Isolate the target sequence or fragment of the target gene from the biological sample to be tested;

[0301] 2) Determine the methylation status of the target sequence of the target gene;

[0302] 3) The state of the biological sample is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of liver cancer.

[0303] According to certain preferred embodiments, the method further includes the following steps:

[0304] 1) Extract genomic DNA from the biological sample to be tested;

[0305] 2) Treat the DNA sample obtained in step 1) with reagents to convert the 5-position unmethylated cytosine base into uracil or other bases. That is, the 5-position unmethylated cytosine base in the target sequence of the target gene is converted into uracil or other bases. The converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable.

[0306] 3) The DNA sample treated in step 2) is contacted with DNA polymerase and primers for the target sequence of the target gene, so that the target sequence of the treated target gene is amplified to produce an amplification product or is not amplified; if the target sequence of the treated target gene undergoes DNA polymerization, an amplification product will be produced; if the target sequence of the treated target gene does not undergo DNA polymerization, it will not be amplified.

[0307] 4) Detect the amplification products using probes; and

[0308] 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene.

[0309] Preferably, the primers typically comprise fragments of the target sequence of the target gene, wherein the target sequence fragment comprises a fragment of at least 9 nucleotides that are respectively equivalent to, complementary to, or hybridize under moderate or severe conditions to any one of SEQ ID NO:1-4, any one of SEQ ID NO:5-8, any one of SEQ ID NO:9-12, any one of SEQ ID NO:13-16, any one of SEQ ID NO:17-20, any one of SEQ ID NO:21-24, any one of SEQ ID NO:25-28, any one of SEQ ID NO:29-32, or any one of SEQ ID NO:33-36.

[0310] Preferably, a typical probe comprises a fragment of the target sequence of the target gene, the fragment of the target sequence comprising a fragment of at least 15 nucleotides that are respectively equivalent to, complementary to, or hybridize under moderate or severe conditions to any one of SEQ ID NO:1-4, any one of SEQ ID NO:5-8, any one of SEQ ID NO:9-12, any one of SEQ ID NO:13-16, any one of SEQ ID NO:17-20, any one of SEQ ID NO:21-24, any one of SEQ ID NO:25-28, any one of SEQ ID NO:29-32, or any one of SEQ ID NO:33-36.

[0311] Preferably, one or more of the primers and probes are as shown in Table 2 above.

[0312] Furthermore, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplified nucleic acid molecules with detectable labels.

[0313] Preferably, PCR is used to determine methylation status. Methods such as fluorescence-based real-time PCR, methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of a target gene. Among these, fluorescence-based real-time PCR is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and requires no further processing after the PCR step. In short, the fluorescence-based real-time PCR method begins with a mixed sample of genomic DNA, which is converted into a pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR is then performed in a biased reaction (using PCR primers with overlapping known CpG dinucleotides). Sequence differences can be generated at both the amplification level and the fluorescence detection amplification level. The fluorescence-based real-time PCR assay can be used as a quantitative test for the methylation status of genomic DNA samples, where sequence differentiation occurs at the probe hybridization level. In this quantitative approach, the PCR reaction provides methylation-specific amplification in the presence of a fluorescent probe overlapping a specific CpG dinucleotide. A no-offset control for the amount of starting DNA is provided by a reaction in which neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as TaqMan, Lightcycler, etc. TaqMan probes are dual-labeled with a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) and are designed to be specific to regions with relatively high GC content, such that they melt in PCR cycles at a temperature approximately 10°C higher than the forward or reverse primers. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension steps. When Taq polymerase synthesizes new strands in PCR, it eventually encounters the annealed TaqMan probe. The Taq polymerase 5' to 3' endonuclease activity then replaces the TaqMan probe by digesting it, releasing the fluorescent reporter molecule for quantification using a real-time fluorescence detection system to detect the signal that is no longer quenched. Typical reagents used for fluorescence-based real-time PCR analysis may include, but are not limited to: target sequence PCR primers for the target gene; nonspecific amplification blocking agents; TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase, etc.

[0314] In some preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of the real-time PCR reaction. By utilizing real-time PCR to analyze DNA in biological samples, the methylation status of the target sequence of the target gene can be conveniently detected, and the positivity of the tested sample can be quickly and easily determined based on the critical Ct value of the PCR reaction. Therefore, this provides a non-invasive and rapid in vitro detection method for liver cancer.

[0315] The biological sample is selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof. Plasma is the preferred biological sample.

[0316] The inventors of this application have discovered that the methylation status of the target sequences of the CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5, and EMX1 genes in liver cancer tissues differs significantly from that in normal liver tissues: in liver cancer tissues, the target sequences of the CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5, and EMX1 genes are methylated, while in normal liver tissues, the target sequences of the CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5, and EMX1 genes are not methylated. Therefore, this application provides a method for in vitro detection of liver cancer by detecting the methylation status of one or more gene target sequences among CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene and EMX1 gene in a sample. The method provided by this application can detect liver cancer non-invasively and rapidly.

[0317] Example

[0318] This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.

[0319] Example 1 Primer and probe testing

[0320] First, hypomethylation sites were screened from next-generation sequencing data of WBC samples from 340 healthy individuals and cfDNA samples from plasma of 100 healthy individuals. Second, plasma and liver cancer tissue analyses were performed on the screened hypomethylation sites. Sites showing differences in plasma from 377 liver cancer patients and 200 healthy individuals, and also showing differences in 377 liver cancer tissues and 53 adjacent normal tissues, were selected as candidate biomarkers. Then, plasma source tracing was performed on the candidate biomarkers. Finally, through sensitivity and specificity validation in liver cancer tissues and healthy human plasma, nine specific biomarkers were identified: CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene, and EMX1 gene.

[0321] Primers and probes were designed based on the target sequences of the nine genes mentioned above, and the designed primer and probe sequences are shown in Table 2 above.

[0322] The DNA from normal human leukocytes is usually in a low / unmethylated state and can be used as a negative control. In this embodiment, the amount of DNA used is 15.75 ng / reaction. Fully methylated DNA is in a high / fully methylated state and can be used as a positive control. In this embodiment, the amount of DNA used is 200 pg / reaction. The DNA samples are first transformed with bisulfite. Using the transformed BisDNA as a template, real-time PCR amplification is performed using the primers and probes described above. The β-actin (ACTB) gene is used as an internal control. β-actin gene amplicon is created using primers complementary to the β-actin gene sequence, and the β-actin gene amplicon is detected using a specific probe. Each sample undergoes at least one real-time PCR; in some specific embodiments, two or three real-time PCR detections are performed. The PCR system for primer and probe testing is shown in Table 4 below.

[0323] Table 4. PCR system for primer and probe testing.

[0324] Volume (μL) Final concentration Taq DNA Polymerase (Biochain) 1.2 / 4.2×buffer(Biochain) 11.9 1× Forward primer F (10 μM) 1.0 200nM Reverse primer R (10 μM) 1.0 200nM Probe P (10 μM) 1.0 200nM ACTB_F(10μM) 0.5 100nM ACTB_R(10μM) 0.5 100nM ACTB_P(10μM) 0.375 75nM BisDNA 4.0 / <![CDATA[H2O]]> 28.525 / Total 50.0 /

[0325] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.

[0326] The PCR amplification program used was: 94℃, 20 min; (93℃, 30 s; 57℃, 35 s — read fluorescence signal) 45 cycles; 40℃, 5 s.

[0327] The results are shown in Table 5. When BisDNA of fully methylated DNA was used as a template, the CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5 and EMX1 genes were all effectively amplified. However, when BisDNA of WBC was used as a template, except for the internal reference gene ACTB, the other target genes were not amplified.

[0328] Table 5. Results of primer and probe tests for each gene.

[0329]

[0330]

[0331] "No Ct" indicates that no Ct value was detected.

[0332] Example 2

[0333] Sixteen liver cancer tissue samples (10 ng / reaction) and 16 normal human plasma samples (3.5 mL) were selected. Genomic DNA was extracted and converted to BisDNA using bisulfite. Methylation of the CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5, and EMX1 genes was detected according to the PCR reaction system and procedure in Example 1. The threshold for each marker was set at 41. Finally, the Ct values ​​of real-time PCR for the target gene sequences of the 16 liver cancer tissue samples and 16 normal human plasma samples were measured.

[0334] Table 6. Sensitivity / Specificity of Each Gene in Liver Cancer Tissue and Normal Human Plasma

[0335]

[0336]

[0337] Table 6 shows that the sensitivities of detecting hepatocellular carcinoma tissue using the CHFR, SPINT2, RNF135, CHST2, SPDYA, PAX5, VASH2, TSPYL5, and EMX1 genes were 93.75%, 75%, 87.5%, 87.5%, 87.5%, 56.25%, 87.5%, 75%, and 68.75%, respectively.

[0338] Table 6 shows that the methylation of the target sequences of the target genes has good specificity. The specificities of normal human plasma for the CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene, and EMX1 gene are 93.75%, 93.75%, 100%, 87.5%, 100%, 93.75%, 100%, 81.25%, and 81.25%, respectively.

[0339] Of the nine biomarkers associated with liver cancer mentioned above, five biomarkers showed tissue sensitivity exceeding 80% based on tissue testing results: CHFR, RNF135, CHST2, SPDYA, and VASH2. CHFR showed the highest tissue sensitivity at 93.75%. From the results of testing in normal human plasma, six biomarkers showed plasma specificity exceeding 90%: CHFR, SPINT2, RNF135, SPDYA, PAX5, and VASH2. Under small sample size validation conditions, a plasma specificity of 80% is a relatively reasonable and high indicator level. Therefore, the above experimental results demonstrate that the nine target genes selected in this application are potential biomarkers for detecting liver cancer methylation. Detection of methylated DNA sequences of these target genes enables non-invasive in vitro detection of liver cancer and can improve the detection rate of liver cancer.

[0340] In summary, this application utilizes the composition, nucleic acid sequence, kit, and their uses described above, as well as the detection method described above, to detect liver cancer in vitro by detecting the methylated nucleic acid sequence of the target gene and its fragments, thereby effectively improving the sensitivity and specificity of liver cancer in vitro detection.

[0341] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.

Claims

1. A composition for in vitro detection of liver cancer, the composition comprising: Nucleic acid used to detect the methylation status of a target gene. The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene. The target gene is one or more of the following genes: CHFR gene, SPINT2 gene, RNF135 gene, CHST2 gene, SPDYA gene, PAX5 gene, VASH2 gene, TSPYL5 gene, and EMX1 gene.

2. The composition according to claim 1, wherein, The target sequence of the CHFR gene is as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or the target sequence of the CHFR gene includes the sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:

4.

3. The composition according to claim 1, wherein, The target sequence of the SPINT2 gene is as shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, or the target sequence of the SPINT2 gene includes the sequence shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:

8.

4. The composition according to claim 1, wherein, The target sequence of the RNF135 is as shown in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12, or the target sequence of the RNF135 includes the sequence shown in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:

12.

5. The composition according to claim 1, wherein, The target sequence of the CHST2 gene is as shown in SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16, or the target sequence of the CHST2 gene includes the sequence shown in SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:

16.

6. The composition according to claim 1, wherein, The target sequence of the SPDYA gene is as shown in SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20, or the target sequence of the SPDYA gene includes the sequence shown in SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:

20.

7. The composition according to claim 1, wherein, The target sequence of the PAX5 gene is as shown in SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24, or the target sequence of the PAX5 gene includes the sequence shown in SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:

24.

8. The composition according to claim 1, wherein, The target sequence of the VASH2 gene is as shown in SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:28, or the target sequence of the VASH2 gene includes the sequence shown in SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, or SEQ ID NO:

28.

9. The composition according to claim 1, wherein, The target sequence of the TSPYL5 gene is as shown in SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32, or the target sequence of the TSPYL5 gene includes the sequence shown in SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:

32.

10. The composition according to claim 1, wherein, The target sequence of the EMX1 gene is as shown in SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36, or the target sequence of the EMX1 gene includes the sequence shown in SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, or SEQ ID NO:36.

Images