Insecticidal protein Cif and expression vector and application thereof

Abstract

The invention relates to an insecticidal protein Cif and an expression vector and application thereof. The three-dimensional structure of the insecticidal protein Cof comprises two structural domains, and the structural domain I is composed of alpha helixes and located at the 16-187 sites of an amino acid sequence; the connecting domain consists of an alpha helix and three beta folds, and is positioned at the 188-285 sites of the amino acid sequence; and the structural domain II is formed by beta folding and is located at 286-426 sites of the amino acid sequence. The insecticidal protein Cof is a novel non-Cry protein, and can be effectively expressed in bacillus thuringiensis after sequence optimization. Experiments prove that the P5014 can guide expression of the Cif protein and has a poisoning effect on spodoptera frugiperda.

Description

Technical Field

[0001] This invention relates to a novel insecticidal protein Cof, which can be expressed in Bacillus thuringiensis ΔcdsR and has insecticidal activity against fall armyworm. Background Technology

[0002] Pests are a major biological stressor affecting global crop production [Bradshaw CJ, Leroy B, Bellard C, Roiz D, Albert C, Fournier A, Barbet-Massin M, Salles JM, Simard F, Courchamp F. Massive yet grossly underestimated global costs of invasive insects. Nat Commun. 2016 Oct 4; 7:12986]. Lepidoptera pests, due to their wide host range and strong reproductive capacity, are among the most destructive agricultural pest groups, such as the fall armyworm (Spodoptera frugiperda), the cotton bollworm (Helicoverpa armigera), and the diamondback moth (Plutella xylostella). Their larvae feed on various plant tissues, causing significant losses in crop yield and quality [Olmstead DL, Nault BA, Shelton AM. Biology, Ecology, and Evolving Management of Helicoverpa zea (Lepidoptera: Noctuidae) in Sweet Corn in the United States. J Econ Entomol. 2016 Aug; 109(4):1667-76]. To address the resistance of pests to pesticides and the environmental risks of chemical pesticides, biological control strategies based on microbial insecticidal proteins have been rapidly developed. Among them, Bacillus thuringiensis (Bt) has become a research focus due to its specific insecticidal mechanism and has been widely used in genetically modified corn, soybeans, and cotton to control these destructive pests. Bacillus thuringiensis is a Gram-positive bacterium that was first discovered by the Japanese biologist Ishiwata in 1901 in infected silkworms. In 1956, T. Angus proved that the Cry protein produced by Bt has insecticidal effects. In the 1880s, it was confirmed that the Bt gene can be inherited in plants, which opened up the research and application of Bt transgenic products [MeloAL, Soccol VT, Soccol CR. Bacillus thuringiensis: mechanism of action, resistance, and new applications: a review. Crit Rev Biotechnol. 2016; 36(2):317-26].Currently, Bt has become the most widely used microbial insecticide in the agricultural field, playing an important role in agriculture, forestry, and environmental protection. During its growth and metabolism, Bt produces various toxins such as α-exotoxin, β-exotoxin, δ-endotoxin, and γ-exotoxin, which are toxic to a range of insects and protozoa [Pardo-López L, Soberón M, Bravo A. Bacillus thuringiensis insecticidal three-domain Cry toxins: mode of action, insect resistance and consequences for crop protection. FEMS Microbiol Rev. 2013 Jan; 37(1):3-22]. Among these, the most toxic is the δ-endotoxin, which is produced by Bt insecticidal crystal proteins (ICPs). δ-endotoxins are divided into two categories: Cry proteins and Cyt proteins. Cry (Crystal) protein is currently the most widely identified, most thoroughly studied, and broadest-spectrum insecticidal protein, exhibiting highly effective insecticidal activity against various target pests, including Lepidoptera, Coleoptera, and Diptera. After ingestion, the Cry protein dissolves in the alkaline environment of the insect's midgut, specifically binds to receptors in the midgut, undergoes oligomerization, and then inserts into the cell membrane to form pores, leading to autolysis and death of the insect cell [Gómez I, Pardo-López L,]. -Garay C, Fernandez LE, Pérez C, Sánchez J, Soberón M, Bravo A. Role of receptor interaction in the mode of action of insecticidal Cry and Cyt toxins produced by Bacillus thuringiensis. Peptides. 2007 Jan; 28(1):169-73]. In addition, the exotoxins such as Vip and Sip proteins secreted by Bt during its vegetative growth period also have specific insecticidal effects. Studies have shown that Vip1 and Vip2 are toxic to Coleoptera, Vip3 has insecticidal activity against Lepidoptera, and Sip has a good lethal effect on Coleoptera larvae [Estruch JJ, Warren GW, Mullins MA, Nye GJ, Craig JA, Koziel MG. Vip3A, a novel Bacillus thuringiensis vegetarian insecticidal protein with a wide spectrum of activities against lepidopteran insects. Proc Natl Acad Sci US A. 1996 May 28; 93(11):5389-94, Palma L, D, Berry C, Murillo J, Caballero P. Bacillus thuringiensis toxins: an overview of their biocidal activity. Toxins (Basel). 2014 Dec 11;6(12):3296-325].

[0003] In recent years, with the promotion and application of Bt pesticides and genetically modified crops, more than 90% of corn and cotton worldwide rely on toxins such as Cry1Ab, Cry1Ac, and Cry1F, which has significantly reduced the use of chemical pesticides. However, long-term monoculture has led to the rapid evolution of pest resistance, threatening its sustainability [Peterson B, Bezuidenhout CC, Van den Berg J. An Overview of Mechanisms of Cry Toxin Resistance in Lepidopteran Insects. J EconEntomol. 2017 Apr 1;110(2):362-377. doi:10.1093 / jee / tow310.PMID:28334065]. Taking the fall armyworm as an example, its resistance frequency to Cry1Fa has exceeded 80% in some parts of Brazil, and the resistant population showed resistance failure after only 3 years of commercial planting of Bt maize in tropical regions [Boaventura D, Ulrich J, Lueke B, Bolzan A, Okuma D, Gutbrod O, Geibel S, Zeng Q, Dourad PM, Martinelli S, Flagel L, Head G, Nauen R. Molecular characterization of Cry1F resistance in fallarmyworm, Spodoptera frugiperda from Brazil. Insect Biochem Mol Biol. 2020 Jan; 116:103280]. The core of the resistance mechanism lies in the mutation of the midgut receptor gene in the pest (such as the deletion or point mutation of the ABCC2 transporter domain [Jakka SRK, Gong L, Hasler J, Banerjee R, Sheets JJ, Narva K, Blanco CA, Jurat-Fuentes JL. Field-Evolved Mode 1 Resistance of the Fall Armyworm to Transgenic Cry1Fa-Expressing Corn Associated with Reduced Cry1Fa Toxin Binding and Midgut Alkaline Phosphatase Expression. Appl Environ Microbiol. 2015 Dec 4;82(4):1023-1034]), which prevents the Cry toxin from binding effectively.Furthermore, the singular mechanism of action of Cryotoxins exacerbates the risk of resistance. All Cryotoxins rely on the membrane insertion function of Domain I (α-helical domain) and the specific recognition of Domain II (receptor-binding domain), leading to cross-resistance among different Cryotoxins. According to research, Cry1Ab and Cry1Ac share up to 85% Domain II homology. Once pests develop resistance to one of them, their sensitivity to other homologous toxins often decreases significantly. This cross-resistance evolved in the field reduces the effectiveness of Bt crops. As of 2025, at least 26 field resistance cases have been recorded in 7 countries, involving 11 major pests such as corn borer and cotton bollworm. [Yang F, Wang Z, Kerns DL. Resistance of Spodoptera frugiperda to Cry1, Cry2, and Vip3Aa Proteins in Bt Corn and Cotton in the Americas: Implications for the Rest of the World. J Econ Entomol. 2022 Dec 14;115(6):1752-1760., Smith JL, Farhan Y. Monitoring resistance of Ostrinia nubilalis (Lepidoptera:Crambidae) in Canada to Cry toxins] Produced by Bt corn. J Econ Entomol. 2023 Jun 13; 116(3):916-926., Tabashnik BE, Fabrick JA, Carrière Y. Global Patterns of Insect Resistance to Transgenic Bt Crops: The First 25 Years. J Econ Entomol. 2023 Apr 24; 116(2):297-309.]. There is growing concern that commercially available transgenic crops for insect control face significant challenges to sustainability in the future [Tabashnik BE, Carrière Y. Surge in insect resistance to transgenic crops and prospects for sustainability. Nat Biotechnol. 2017 Oct 11; 35(10):926-935.]. Therefore, continued exploration and identification of novel insecticidal proteins are crucial for expanding the control spectrum and addressing resistance issues.

[0004] Notably, recent studies have identified a plant-derived insecticidal protein (IPD113 family). Proteins extracted from this protein are effective against lepidopteran pests in corn and soybean, and structurally similar to Bt's 3d-Cry proteins (three-domain cryoxins). However, it possesses only two of the three characteristic domains, lacking the C-terminal domain typically required for its activity. Although structurally similar, the amino acid sequence similarity is only 8%-12%. [Wei JZ, Lum A, Schepers E, Liu L, Weston RT, McGinness BS, Heckert MJ, Xie W, Kassa A, Bruck D, Rauscher G, Kapka-Kitzman D, Mathis JP, Zhao JZ, Sethi A, Barry J, Lu AL, Brugliera F, Lee EL, van der Weerden NL, Eswar N, Maher MJ, Anderson MA. Novel insecticidal proteins from ferns resemble insecticidal proteins from Bacillus.] thuringiensis. Proc Natl Acad Sci U SA. 2023 Oct 31;120(44):e2306177120]. In contrast, in the 3d-Cry protein, Domain I is responsible for guiding the destruction process after receptor recognition, while Domain II and Domain III are responsible for binding to the receptor [Schwartz JL, Juteau M, Grochulski P, Cygler M, Préfontaine G, Brousseau R, Masson L. Restriction of intramolecular movements within the Cry1Aa toxin molecule of Bacillus thuringiensis through disulfide bond engineering. FEBS Lett. 1997 Jun 30;410(2-3):397-402.].In the most accepted perforation model, Domain I exposes a hydrophobic region through α-1 helix breakage, triggering the formation of preporal oligomeric structures—where hydrophobic hairpins composed of α-4 and α-5 helices insert into the phospholipid bilayer of the membrane, and the remaining structures are distributed on the membrane surface in an umbrella conformation [Kumar AS, Aronson AI. Analysis of mutations in the pore-forming region essential for insecticidal activity of a Bacillus thuringiensis delta-endotoxin. J Bacteriol. 1999 Oct; 181(19): 6103-7., Girard F, Vachon V, Lebel G, Préfontaine G, Schwartz JL, Masson L, Laprade R. Chemical modification of Bacillus thuringiensis Cry1Aa toxin single-cysteine ​​mutants reveals the importance of domain I structural elements in the mechanism of pore formation. Biochim Biophys Acta. 2009 Feb;1788(2):575-80.,Girard F,Vachon V,Préfontaine G,Marceau L,Su Y,Larouche G,Vincent C,Schwartz JL,Masson L,Laprade R.Cysteine ​​scanning mutagenesis of alpha4,a putative pore-lininghelix of the Bacillus thuringiensis insecticidal toxin Cry1Aa.Appl EnvironMicrobiol.2008 May;74(9):2565-72]. This unique membrane insertion mechanism makes it the core of toxicity. It is particularly noteworthy that the conservation of the N-terminal Endotoxin domain between the IPD113 family of insecticidal proteins and 3d-Cry toxins may be more biologically significant than the overall structural similarity.

[0005] The discovery of traditional insecticidal proteins has long relied on microbial screening and gene cloning, which is inefficient and largely unreliable. In recent years, the integration of computational biology and structural biology has significantly improved discovery efficiency, particularly with breakthroughs in AI structure prediction technologies such as AlphaFold 3, achieving near-atomic precision in protein structure [Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, Ronneberger O, Willmore L, Ballard AJ, Bambrick J, Bodenstein SW, Evans DA, Hung CC, O'Neill M, Reiman D, Tunyasuvunakool K, Wu Z, A,Arvaniti E,Beattie C,Bertolli O,Bridgland A,Cherepanov A,CongreveM,Cowen-Rivers AI,Cowie A,Figurnov M,Fuchs FB,Gladman H,Jain R,Khan YA,LowCMR,Perlin K,Potapenko A,Savy P,Singh S,Stecula A,Thillaisundaram A,Tong C,Yakneen S,Zhong ED,Zielinski M, A, Bapst V, Kohli P, Jaderberg M, Hassabis D, Jumper JM. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 2024 Jun; 630(8016):493-500], The AlphaFold protein structure database has released more than 200 million high-precision protein structure models. This AI-based structure prediction method can accurately infer the three-dimensional structure of a protein from its sequence, enabling researchers to analyze the structure and functional regions of proteins on a large scale. Furthermore, structural homology analysis and machine learning methods (such as Scan Net and Masif) [Zhang J, Schaeffer RD, Durham J, Cong Q, Grishin NV. DPAM: A domain parser for AlphaFoldmodels. Protein Sci. 2023 Feb;32(2):e4548., Shankar SS, Banarjee R, Jathar SM, Rajesh S, Ramasamy S, Kulkarni MJ. De novo structure prediction of meteorin and meteorin-like protein for identification of domains, functional receptor binding regions, and their high-risk missense variants. J Biomol Struct Dyn. 2024 Jun;42(9):4522-4536] can predict function and binding regions, providing strong support for the discovery of novel insecticidal proteins.

[0006] Therefore, developing non-Bt insecticidal proteins not only provides new gene resources for the research and development of Bt insecticides and transgenic insect-resistant crops in my country, but also provides new ideas for isolating new insecticidal genes through intelligent screening of insecticidal proteins, providing diversified solutions for agricultural pest control and expanding the evolutionary and functional diversity of insecticidal proteins. Summary of the Invention

[0007] This invention has discovered a novel insecticidal protein, Cof (AlphaFold protein structure database number AF-A0A398CQE0-F1), which is derived from Cohnella faecalis. Its Endotoxin-N domain-containing protein is similar in structure to some existing insecticidal proteins and it can kill the fall armyworm.

[0008] This invention constructed a strain ΔcdsR (P5014-cof) that drives Cof expression based on P5014. Sequence optimization was performed according to the codon bias of Bacillus thuringiensis to obtain a new Cof (nucleotide sequence changed, amino acid sequence unchanged), which can be well expressed in Bacillus thuringiensis with an LC50 of 696 μg / g. These results demonstrate the good application potential of the structurally homologous protein Cof in pest control. This invention provides new gene resources for the development of Bt insecticides and transgenic insect-resistant crops, while opening up innovative avenues for pest control and bringing new hope for the further development and utilization of biopesticides.

[0009] The insecticidal protein Cof has the amino acid sequence shown in SEQ ID No. 1.

[0010] The insecticidal protein Cof has a three-dimensional structure comprising two domains: domain I is composed of an α-helix located at positions 16-187 of the amino acid sequence; the linker domain is composed of an α-helix and three β-sheets located at positions 188-285 of the amino acid sequence; and domain II is composed of β-sheets located at positions 286-426 of the amino acid sequence.

[0011] A gene encoding the aforementioned insecticidal protein Cof.

[0012] The nucleotide sequence of the gene is shown in SEQ ID No. 2 or SEQ ID No. 3.

[0013] An expression vector containing promoter P5014 and the Cof gene described above, wherein the nucleotide sequence of Cof is shown in SEQ ID No. 3.

[0014] Its backbone vector is pHT315 vector, and the expression vector is named pHT315-P5014-Cof.

[0015] The expression vector was constructed using the following method:

[0016] The promoter sequence 5014 was amplified from strain HD73 using specific primers pHTP5014-F / pHTP5014-R. The P5014 promoter was then fused with the synthesized cof gene using overlap PCR. The amplified specific PCR product was recovered from an agarose gel and used as a template for a second round of PCR with primers pHTP5014-F / pHTcof-R to amplify the overlapping fragment, resulting in the fusion fragment P5014-cof. This fusion fragment was then constructed into the pHT315 vector using SphI and SalI restriction sites to obtain the pHT315-P5014-cof plasmid. The primer sequences are as follows:

[0017] pHTP5014-F: ATTACGCAAGCTT GCATGC CTTTCCATCGCGAATAT,

[0018] pHTP5014-R:ATTCTTCATTTGTTTCCATGAGAAAACCACTCCTCTA,

[0019] pHTcof-F: TAGAGGAGTGGTTTTCTCATGGAAACAAATGAAGAAT,

[0020] pHTcof-R: GATCCTCTAGA GTCGAC CTATAATGTACTATGATGACGA.

[0021] An engineered bacterial strain was obtained by transforming the sporeless mutant strain ΔcdsR into the above expression vector.

[0022] The expression vector is pHT315-P5014-Cof, which contains the 5014 promoter and the Cof gene. The engineered bacterial strain is named ΔcdsR(P5014-cof) strain.

[0023] Application of the insecticidal protein Cof in the control of fall armyworm.

[0024] This invention identifies a novel insecticidal protein, Cof, which, after sequence optimization, can be effectively expressed in Bacillus thuringiensis. Our research demonstrates that P5014-guided expression of the Cof protein exhibits a toxic effect against the fall armyworm. This conclusion is supported by the following evidence: First, unbiased structural search analysis shows that the insecticidal domain of the Cof protein is highly similar to domain I of existing Cry and PriB proteins, indicating they are structural homologs. Figure 2 Secondly, SDS-PAGE analysis demonstrated that the 5014 gene promoter (P5014) in the ΔcdsR mutant can direct the protein expression of Cof. Figure 3Finally, regarding insecticidal activity against newly hatched armyworm larvae, the LC50 of the P5014-guided Cof protein in the ΔcdsR mutant was 696 μg / g.

[0025] This invention provides an excellent example of using structural homology to find new insecticidal proteins. Furthermore, Cof proteins may be applicable in synergistic effects with biopesticides or chemical pesticides. This research provides important clues for future exploration of new insecticidal proteins and the co-expression of multiple insecticidal proteins to enhance insecticidal activity. It also reminds us to break through the bottlenecks of traditional insecticidal protein discovery, providing diversified solutions for agricultural pest control and expanding the evolutionary and functional diversity of insecticidal proteins. Attached Figure Description

[0026] Figure 1 The overall structure of Cof

[0027] In the figure, (A)Cof( Co hnella f (aecalis) structural diagram: light gray represents domain I, dark gray represents domain II, and dark gray represents the insecticidal protein region annotated in the protein database (AlphaFold protein structuredatabase number AF-A0A398CQE0-F1); (B) The Cof monomer structure is colored according to the domain allocation given in Figure A.

[0028] Figure 2 Comparison of insecticidal protein structures of Cof

[0029] In the figure, (A) is the structure of the Cof monomer (AlphaFold protein structure database number AF-A0A398CQE0-F1), and the dark gray area represents the insecticidal protein sequence annotated in the UniProt protein database; (B) the Cof insecticidal protein region is related to the Cry1A.105 protein (Bacillus thuringiensis) (PDB 6DJ4); (C) the Cof insecticidal protein region is related to the Cry1Fa protein (Bacillus thuringiensis) (PDB 9BUV); and (D) the Cof insecticidal protein region is related to the PriB protein (Vibrio parahaemolyticus) (PDB 3XOU).

[0030] Figure 3 Promoter P5014 guides the expression of Cof in ΔcdsR.

[0031] The figure shows (A) the construction diagram of plasmid pHT315-P5014-cof, and (B) SDS-PAGE analysis of Cof protein expression level in strain ΔcdsR(P5014-cof). The black arrows indicate the expressed Cof protein.

[0032] Figure 4 Cof insecticidal activity against fall armyworm

[0033] Figure (A) shows the quantification of Cof protein in the engineered bacterial lyophilized powder (ΔcdsR-P5014-cof) used for bioassay, and (B) shows the dose-mortality relationship of the lyophilized powder on newly hatched fall armyworm larvae. The horizontal axis represents the Cof protein content in the applied lyophilized powder, and the vertical axis represents the corrected mortality rate. Detailed Implementation

[0034] The present invention will be further described in detail below with reference to the embodiments.

[0035] The following biological materials are all stored in the applicant's laboratory and are available for public distribution.

[0036] Materials and methods:

[0037] 1. Bacterial strains, plasmids, and growth conditions

[0038] Schaeffer's spore formation medium (SSM medium) [Schaeffer, P., J. Millet, and J.P. Aubert, Catabolic repression of bacterial sporulation. Proceedings of the National Academy of Sciences of the United States of America, 1965, 54(3): p.704-711.] was selected. Its components are 0.8% nutrient broth powder (Becton, Dickinson and Company, New Jersey, USA), 0.025% MgSO4·7H2O, 0.1% KCl, and 0.0002% MnCl2·4H2O. Before use, 0.05M CaCl2 and 0.0001M FeSO4, which have been filtered and sterilized, were added to make the final concentration 5×10⁻⁶. -4 M and 1×10 -6M. In addition, the *E. coli* strain JM109 used in the experiment was for routine molecular cloning experiments, while the ET strain was used to obtain unmethylated plasmid DNA for successful transformation into *Bacillus thuringiensis* [Macaluso, A. and AMMettus, Efficient transformation of *Bacillus thuringiensis* requires nonmethylated plasmid DNA J Bacteriol, 1991, 173(3): p. 1353-1356., Wang, G., et al., Engineered *Bacillus thuringiensis* GO33A with broad insecticidal activity against lepidopteran and coleopteranpests. Applied microbiology and biotechnology, 2006, 72(5): p. 924-930]. *E. coli* were cultured in LB medium at 37°C and 220 rpm. The antibiotics and concentrations used for the growth of *Bacillus thuringiensis* were: erythromycin 5 μg / ml and kanamycin 50 μg / ml. The antibiotics and concentrations used for the growth of *E. coli* were: ampicillin 100 μg / ml. The bacterial strains and plasmids used in this study are summarized in Table 1.

[0039] Table 1 List of all strains used in the experiment

[0040]

[0041] Antibiotic resistance is shown below: ErmR, erythromycin resistance; AmpR, ampicillin resistance.

[0042] 1.Du,C.and KWNickerson,Bacillus thuringiensis HD-73spores havesurface-localized Cry1Ac toxin:Physiological and pathogenicconsequences.Applied and environmental microbiology,1996.62(10):p.3722-3726.

[0043] 2. Zhang

[0044] 3.Arantes, O.and D.Lereclus, Construction of cloning vectors for Bacillus thuringiensis.Gene, 1991.108(1):p.115-119.

[0045] Table 2. Specific primers used in the experiment

[0046] Primer name <![CDATA[Sequence (5′-3′) a > Restriction enzyme sites pHTP5014-F <![CDATA[ATTACGCCAAGCTT GCATGC CTTTCCATCGCGAATAT]]> SphI pHTP5014-R ATTCTTCATTTGTTTCCATGAGAAAACCACTCCTCTA pHTcof-F TAGAGGAGTGGTTTTCTCATGGAAACAAATGAAGAAT pHTcof-R <![CDATA[GATCCTCTAGA GTCGAC CTATAATGTACTATGATGACGA]]> SalI

[0047] The restriction endonuclease site is marked with an underline.

[0048] 2. Structural comparison

[0049] The structure of Cof (AlphaFold protein structure database number AF-A0A398CQE0-F1) was downloaded from the AlphaFold protein structure database and then analyzed at the European Institute of Bioinformatics (EIC) protein structure database. https: / / www.rcsb.org / alignment Download the structures of Cry1A.105, Cry1Fa, and PriB. Use PDB Fold to perform protein structure comparison via the US-align website (https: / / zhanggroup.org / US-align / ) to determine structural similarity and align protein sequences. Use PyMOL to create images.

[0050] 3. Obtain the Cof nucleotide sequence and perform codon optimization on the gene nucleotide sequence.

[0051] The gene sequence can be downloaded from https: / / www.ncbi.nlm.nih.gov / . Search for Cof on the website.

[0052] The gene sequence (D3H35_04475) (GenBank accession number RIE04743.1) was obtained. The nucleotide and amino acid sequences of the gene were downloaded, and codon optimization with Bacillus thuringiensis was performed. The gene fragment was then synthesized (Qingke Biotechnology, Beijing, China).

[0053] 4. Construct a fusion expression vector of the 5014 promoter and the Cof gene.

[0054] To enable Cof expression in the ΔcdsR mutant, the highly transcriptionally active promoter 5014 from the ΔcdsR mutant was selected. First, the promoter sequence was amplified from strain HD73. The 5014 promoter (P5014) is a 690 bp sequence located upstream of the start codon of the 5014 gene. Specific primers pHTP5014-F / pHTP5014-R (Table 2) were used for amplification. The P5014 promoter was fused to the cof gene using overlap PCR. The amplified specific PCR product was recovered from an agarose gel and used as a template for a second round of PCR with primers pHTP5014-F / pHTcof-R to amplify the overlap fragment. The resulting fusion fragment P5014-cof was then digested with SphI and SalI restriction enzymes and constructed into the pHT315 vector to obtain the pHT315-P5014-cof plasmid. After sequencing verification (Qingke Biotechnology, Beijing, China), the mutant strain was transformed into ΔcdsR using electroporation. The constructed ΔcdsR (P5014-cof) strain was identified by erythromycin resistance screening and PCR.

[0055] 5. Protein expression detection

[0056] Single clones of Bacillus thuringiensis ΔcdsR (P5014-cof) and ΔcdsR were picked and inoculated into 7 ml LB medium to activate the strain. 1% of the activated strain was then inoculated into 100 mL SSM liquid medium and grown at 30°C and 220 rpm until T… 24 During the T1 phase, 1 mL of culture medium was centrifuged at 12000 rpm for 1 min to collect bacterial cells. 300 μL of ddH2O was added to each sample for resuspending. 100 μg of quartz sand (0.1 mm in diameter) was added to the cell resuspending solution, and the cells were shaken for 3 min 30 s to disrupt the total protein content. 30 μL of supernatant from each sample was added to 10 μL of 4×SDS-PAGE loading buffer (Solarbio, Bessock, UK), and the mixture was incubated in a boiling water bath for 10 min. Cof protein expression was then detected by SDS-PAGE (4% polyacrylamide stacking gel, 10% polyacrylamide separating gel, 10 μL loading volume) and Coomassie brilliant blue staining to assess the expression of Cof protein in each strain at T1.24 The amount of Cof protein contained in the bacterial cells collected from a 24.75 μL bacterial culture.

[0057] 6. Insecticide activity test

[0058] ΔcdsR(P5014-cof) and ΔcdsR strain 1% were inoculated into 100 mL of SSM medium and cultured at 30℃ and 220 rpm until T... 24 During the freeze-drying process, 0.9g of the feed was weighed into 18mL of sterile water (50mg / mL), and diluted in half to 25mg / mL, 12.5mg / mL, 6.25mg / mL, and 3.125mg / mL, respectively. Using sterile water as a control, the feed was microwaved to melt into a liquid without particles. After the feed was cooled to 50-60℃, 15g of feed was weighed and added to 3mL of the prepared freeze-dried powder solution. The mixture was gently shaken and mixed. The feed was evenly distributed into 24-well plates and allowed to dry for 1-2 hours to reach the appropriate humidity. Newly hatched fall armyworm larvae were transferred to the 24-well plates with a fine brush, one larva per well, using the most vigorous larvae possible. The 24-well plates were covered with clean tissue paper and then covered with a lid, secured with rubber bands. The 24-well plates were placed in an incubator at 25℃ for incubation. After 7 days, the mortality rate of the larvae was recorded. If the survival rate of the control group was greater than 80%, the corrected mortality rate was calculated. Each concentration was tested at least three times.

[0059] result

[0060] 1. The structure of the Cof insecticidal protein is similar to that of existing insecticidal proteins.

[0061] To develop novel, efficient, and environmentally friendly biopesticides, this study aims to discover insecticidal proteins with novel mechanisms of action from nature. We observed that although many insecticidal proteins differ significantly in their amino acid sequences, they may exert their toxic functions through similar three-dimensional structures (i.e., "structural homology"). This phenomenon suggests that structure-based homology searches are an effective strategy for discovering novel insecticidal proteins. Notably, the fern-derived IPD113-Cow protein and the bacterial 3d-Cry toxin protein, despite being evolutionarily distant, exhibit significant structural conservation in their N-terminal endotoxin domains, suggesting that this structural framework may have crucial biological significance in insecticidal function. Therefore, we selected the amino acid sequence of the IPD113-Cow protein as a "template" and conducted a large-scale homology search in the AlphaFold protein structure database to discover potential homologs in other species that are structurally similar to IPD113 but have different sequences, with the aim of discovering novel insecticidal proteins with application potential. By performing a homology search on the amino acid sequence of the IPD113-Cow protein from ferns in the AlphaFold protein structure database, we unexpectedly discovered a predicted protein from Cohnella faecalis (AlphaFold protein structure database number AF-A0A398CQE0-F1), named Cof, which showed a high degree of similarity to the IPD113-Cow protein in three-dimensional structure (TM-score: 0.77, rmsdb). 2.3). According to the functional annotation of the UniProt protein database, amino acids 27-185 of Cof are annotated as an insecticidal protein. The structure of Cof is similar to the two domains of the 3d-Cry protein structure. Domain I (16-187AA) is composed of α-helices, the linker domain (188-285) is composed of one α-helix and three β-sheets, and domain II (286-426) is composed of β-sheets. Figure 1An unbiased search of the insecticidal protein structure of Cof in a protein structure database revealed three unique structures derived from bacteria: PirB protein (a Prb-like protein associated with the insect Photorhabdus) extracted from Vibrio parahaemolyticus (PDB 3X0U), which is toxic to shrimp; Cry1Fa protein (PDB 9BUV) and Cry1A.105 protein (PDB 6DJ4) extracted from Bt, which is specific to Lepidoptera. These structural homologs showed very low sequence homology to Cof (16%–21%) (Table 2), but were structurally very similar, with TM-scores reaching 0.81, and exhibited minimal overall local structural differences (rmsdb). (less than 3.0), thus it is speculated whether Cof protein has an insecticidal effect on certain pests.

[0062] Table 3. Sequence and structural similarity of insecticidal protein regions annotated with CoF.

[0063] a) Similarity was determined using PDB Fold with the RCSB PDB protein alignment tool (https: / / www.rcsb.org / alignment). b) The geometric deviation of corresponding atomic positions in the two structures was measured, reflecting the local differences in the overall structure. c) A weighted average of the superposition length and root mean square deviation was used to assess the global topological similarity of the two structures. The TM-score value ranged from 0 to 1, with values ​​closer to 1 indicating greater similarity.

[0064] 2. The 5014 gene promoter directs the expression and accumulation of the exogenous protein Cof.

[0065] To enable the expression and detection of the exogenous protein Cof in Bacillus thuringiensis, we obtained the gene sequence from NCBI (GenBank accession number RIE04743.1), downloaded the nucleotide and amino acid sequences, optimized the codons for Bacillus thuringiensis, and synthesized the gene fragment (Qingke Biotechnology, Beijing, China). After obtaining the synthesized Cof gene fragment, we selected the ΔcdsR mutant strain from our laboratory (this strain does not produce spores or crystals), and chose the highly transcriptionally active promoter 5014 from the strain. Using the P5014 promoter to guide the efficient expression of Cof in the Bacillus thuringiensis ΔcdsR mutant, we first constructed the pHT315-P5014-cof plasmid, which contains the P5014-cof fusion fragment (…). Figure 3(A). The pHT315-P5014-cof fusion expression vector was introduced into the ΔcdsR mutant strain, successfully obtaining the ΔcdsR(P5014-cof) strain. To confirm whether the ΔcdsR(P5014-cof) strain could express the Cof protein, we used protein SDS-PAGE to show the molecular weight prediction (https: / / www.novopro.cn / tools / protein-sds-page-mw.html) and observed that the Cof protein band size was 50 kDa. The protein of the ΔcdsR(P5014-cof) strain was then detected. The strain was first cultured in SSM medium to the T24 stage, and then the cells were collected and the protein was extracted for detection. The SDS-PAGE experiment showed that ΔcdsR(P5014-cof) produced a 50 kDa Cof protein (…). Figure 3 In section B), we used lyophilized powder of the strain to quantitatively detect the Cof protein of strain ΔcdsR(P5014-cof). Figure 4 A) found that 0.78125 mg of bacterial cells contained 0.12 mg of protein. This result indicates that the exogenous protein Cof can be expressed in Bacillus thuringiensis ΔcdsR, and the expression level in SSM medium can be used to determine its bioactivity.

[0066] 3. The exogenous protein Cof expressed in ΔcdsR has insecticidal activity against fall armyworm.

[0067] Compared to the ΔcdsR mutant, the ΔcdsR(P5014-cof) strain showed significant accumulation of Cof protein. To investigate whether Cof possesses insecticidal activity against the fall armyworm, we fed newly hatched fall armyworm larvae with feed treated with both the ΔcdsR(P5014-cof) strain and the ΔcdsR mutant strain. The results showed that the ΔcdsR(P5014-cof) strain, concentrated 10-fold, exhibited certain insecticidal activity against newly hatched fall armyworm larvae, with a corrected mortality rate of 35.38%. In contrast, the control group ΔcdsR did not show significant toxicity, indicating that Cof possesses insecticidal activity against the fall armyworm. Further screening was conducted: newly hatched fall armyworm larvae were fed a large amount of freeze-dried ΔcdsR(P5014-cof) strain mixed with feed. The results showed that the median lethal concentration (LC50) of Cof protein against the fall armyworm was... 50 The concentration of the protein was 696 μg / g (95% confidence interval: 550–880 μg / g). These results clearly demonstrate that the Cof protein exhibits significant insecticidal activity against the fall armyworm and possesses the potential for application as a novel insecticidal protein.

Claims

1. Insecticidal protein Cof, whose amino acid sequence is shown in SEQ ID No.

1.

2. The insecticidal protein Cof according to claim 1, wherein its three-dimensional structure comprises two domains: domain I is composed of an α-helix located at positions 16-187 of the amino acid sequence; the linker domain is composed of an α-helix and three β-sheets located at positions 188-285 of the amino acid sequence; and domain II is composed of β-sheets located at positions 286-426 of the amino acid sequence.

3. A gene encoding the insecticidal protein Cof as described in any one of claims 1 or 2.

4. The gene for the insecticidal protein Cof according to claim 3, wherein the nucleotide sequence is shown in SEQ ID No. 2 or SEQ ID No.

3.

5. An expression vector containing promoter P5014 and the gene for the insecticidal protein Cof as described in claim 4, wherein the nucleotide sequence of Cof is shown in SEQ ID No.

3.

6. The expression vector according to claim 5, wherein the backbone vector is a pHT315 vector, and the expression vector is named pHT315-P5014-Cof.

7. The method for constructing the expression vector according to claim 6, wherein the promoter sequence 5014 is amplified from strain HD73 using specific primers pHTP5014-F / pHTP5014-R, the P5014 promoter is fused with the synthesized cof gene using overlap PCR, the amplified specific PCR product is recovered by agarose gel extraction, used as a template and subjected to a second round of PCR using primers pHTP5014-F / pHTcof-R to amplify the overlap fragment, resulting in the fusion fragment P5014-cof; the fusion fragment is then constructed into the pHT315 vector after SphI and SalI restriction sites, yielding the pHT315-P5014-cof plasmid, wherein the primer sequences are as follows: pHTP5014-F:ATTACGCCAAGCTT GCATGC CTTTCCATCGCGAATAT, pHTP5014-R:ATTCTTCATTTGTTTCCATGAGAAAACCACTCCTCTA, pHTcof-F: TAGAGGAGTGGTTTTCTCATGGAAACAAATGAAGAAT, pHTcof-R:GATCCTCTAGA GTCGAC CTATAATGTACTATGATGACGA。 8. An engineered bacterial strain obtained by transforming a sporeless mutant strain ΔcdsR into the expression vector according to any one of claims 5 or 6.

9. The engineered bacterial strain of claim 8, wherein the expression vector is pHT315-P5014-Cof, which contains the 5014 promoter and the Cof gene, and the engineered bacterial strain is named ΔcdsR(P5014-cof) strain.

10. The use of the insecticidal protein Cof according to claim 1 or 2 in the control of fall armyworm.

Images