Preparation method and application of chlorella exosome and mRNA complex nanoparticles
By using Chlorella exosomes as carriers and combining them with electroporation to prepare mRNA composite nanoparticles, the problems of stability and low cellular uptake efficiency of existing mRNA delivery systems have been solved, realizing safe and scalable mRNA delivery and expanding its application in the biomedical field.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-21
- Publication Date
- 2026-06-02
AI Technical Summary
Existing mRNA delivery systems suffer from problems such as poor stability, low cellular uptake efficiency, strong immunogenicity, and delivery difficulties, which limit their widespread application in the biomedical field. In particular, exosomes derived from mammalian cells have limitations such as low yield, complex extraction process, and high cost.
Using Chlorella exosomes as carriers, mRNA composite nanoparticles were prepared under specific culture conditions and by electroporation. Taking advantage of the natural targeting and biocompatibility of Chlorella exosomes, targeted delivery and intracellular expression of mRNA were achieved.
This has enabled the safe and scalable production of mRNA, improved intracellular expression efficiency and stability, reduced immune rejection and toxic side effects, and broadened the application prospects of mRNA in vaccines, tumor immunology and gene therapy.
Smart Images

Figure CN121555319B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and gene delivery, specifically relating to a method for preparing Chlorella exosomes and their mRNA composite nanoparticles and their applications. Background Technology
[0002] mRNA (messenger ribonucleic acid) has demonstrated revolutionary application potential in the biomedical field in recent years. Unlike DNA used in traditional gene therapy, mRNA can be translated into functional proteins in the cytoplasm without entering the cell nucleus, avoiding the risk of genome integration. Furthermore, its expression time is controllable, resulting in higher biosafety. As a nucleic acid molecule capable of encoding specific proteins, mRNA shows great potential in vaccine development, tumor immunotherapy, gene replacement therapy, and cell reprogramming. However, mRNA itself is unstable, easily degraded by RNases in body fluids, and its negative charge and large molecular weight lead to low cellular uptake efficiency and difficult in vivo delivery, limiting its clinical application.
[0003] Currently used mRNA delivery systems include lipid nanoparticles, polymer vectors, and viral vectors. While viral vectors such as lentiviruses and adeno-associated viruses have high transfection efficiency, their widespread application is limited by issues such as strong immunogenicity, potential tumorigenicity, limited vector capacity, and complex and costly production. Among non-viral vectors, lipid nanoparticles are one of the most successful delivery platforms, having been approved for use in several mRNA vaccines. Lipid nanoparticles promote cellular uptake and endosome escape by forming complexes with mRNA through ionizable lipids; however, they still have limitations such as strong liver targeting, potential for inflammatory responses, unclear long-term safety, and stringent formulation stability and storage conditions. Other non-viral vectors, such as polymer nanoparticles and cationic liposomes, often face challenges in clinical translation due to high toxicity, low transfection efficiency, or rapid in vivo clearance.
[0004] Exosomes are extracellular vesicles, approximately 30–150 nanometers in diameter, actively secreted by cells. They possess a lipid bilayer structure and naturally carry bioactive molecules such as proteins, nucleic acids, and lipids, playing a crucial role in intercellular communication. As drug delivery carriers, exosomes exhibit several significant advantages: high biocompatibility, especially low immunogenicity when derived from the cell itself or homologous cells; natural targeting, enabling tissue or cell-specific homing via surface proteins; ability to cross biological barriers such as the blood-brain barrier; effective protection of contents from degradation, enhancing stability; and further enhancement of their function through cell-based engineering. In recent years, exosomes have been successfully applied to the delivery of various substances, including small molecule drugs, proteins, siRNA, and miRNA, demonstrating broad prospects for clinical translation.
[0005] However, exosomes derived from mammalian cells suffer from low yields, complex extraction processes, and high costs, limiting their large-scale application. In contrast, exosomes derived from plants and microalgae have advantages such as wide availability, low culture costs, ease of large-scale production, and high biosafety, gradually becoming an emerging direction in delivery vector research. Microalgae, as a type of photosynthetic microorganism, have rapid growth rates, simple culture conditions, and their exosomes are structurally similar to mammalian exosomes, possessing good membrane stability and bioactivity. Chlorella, a single-celled freshwater microalga belonging to the Chlorella genus of the Chlorophyta phylum, is characterized by rapid growth, short reproductive cycles, and ease of artificial cultivation. *Chlorella sorokinense* (… Chlorella sorokiniana Chlorella is a common algae rich in polyunsaturated fatty acids, polysaccharides, and antioxidants, and is widely used in aquatic feed and functional foods. Currently, there are no reports on the functionality of Chlorella exosomes or the preparation methods of their mRNA-composite nanoparticles. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a method for preparing Chlorella exosomes and their mRNA composite nanoparticles and their applications, using Chlorella exosomes as carriers to load and protect mRNA, thereby achieving targeted delivery and intracellular expression.
[0007] The technical solution adopted by this invention to solve the above-mentioned technical problems is: a method for preparing Chlorella exosomes, comprising the following steps:
[0008] Step 1: Inoculate Chlorella into 30-100 mL of BG11 medium and culture for 6-8 days at 20-30℃ and 100-200 rpm in a shaker. Then, continue inoculating the seed culture into 500-700 mL of BG11 medium and supplement with glucose to a final concentration of 0.8-1.2 g / L. Incubate at 20-30℃, 100-200 rpm, and a light intensity of 50-60 μmol·m⁻¹. -2 ·s -1 Cultured in a shaker, on the second day of mixed culture, exogenously add 200-400 mg / L NaNO2 solution of nitrite, or change the light intensity to 120-160 μmol·m -2 ·s -1 (High light), or add 0.5-1mM 6-BA (plant hormone) exogenously, or change the culture medium to a nitrogen-deficient environment (nitrogen deficiency), or do not do any treatment, and finally collect the Chlorella algal solution after 5-6 days of culture;
[0009] Step 2: Centrifuge the Chlorella cultures obtained in Step 1 using different culture modes at 0-6℃, sequentially at 200-400g for 8-12 min, 1000-3000g for 15-25 min, and 8000-12000g for 20-40 min to remove cells and cell debris. After passing the supernatant through a 0.22μm aqueous filter membrane, centrifuge the filtrate at 80000-120000g for 80-100 min to collect the precipitate, which is the Chlorella exosome.
[0010] Further, in step 1, *Chlorella vulgaris* was inoculated into 50 mL of BG11 medium and cultured in a shaker at 25°C and 150 rpm for 6-8 days. Then, the seed culture was further inoculated into 600 mL of BG11 medium, and glucose was added to a final concentration of 1 g / L. The culture was then cultured at 25°C, 150 rpm, and a light intensity of 55 μmol·m⁻¹. -2 ·s -1 Cultured in a shaker, on the second day of mixed culture, exogenously added a NaNO2 solution containing 300 mg / L nitrite, or the light intensity was changed to 140 μmol·m⁻². -2 ·s -1 (High light), or add 1mM 6-BA (plant hormone) exogenously, or change the culture medium to a nitrogen-deficient environment (nitrogen deficiency), or do not do any treatment, and finally collect the Chlorella algal solution after 5-6 days of culture;
[0011] Step 2: The Chlorella algal solutions obtained in Step 1 under different culture modes are centrifuged sequentially at 300g for 102 min, 2000g for 20 min, and 10000g for 3 min at 4℃ to remove cells and cell debris. The supernatant is then filtered through a 0.22μm aqueous filter membrane and then ultracentrifuged at 100000g for 90 min to collect the precipitate, which is the Chlorella exosome.
[0012] Further, the formula of the BG11 culture medium is as follows: NaNO3 1.5g, K2HPO4 0.04g, MgSO4·7H2O 0.075g, CaCl2·2H2O 0.036g, Na2CO3 0.02g, citric acid 0.006g, ferric citrate 0.006g, trace element solution A5 1mL and distilled water 1000mL; the formula of the trace element solution A5 is as follows: H3BO3 2.86g / L, MnCl2·4H2O 1.81g / L, ZnSO4 0.222g / L, Na2MoO4 0.39g / L, CuSO4·5H2O 0.079g / L, Co(NO3)2·6H2O 0.049g / L.
[0013] Furthermore, the Chlorella mentioned is Sorokin Chlorella FACHB-25.
[0014] The present invention also provides the application of the microalgal exosome nanoparticles prepared by the above method in the preparation of antioxidants.
[0015] The present invention also provides the application of the microalgal exosome nanoparticles prepared by the above method in the preparation of CAT, SOD enhancers and / or MDA antagonists, ABTS free radical scavengers, ROS scavengers and / or DPPH free radical scavengers, and mitochondrial membrane potential restorers.
[0016] The present invention also provides the application of Chlorella exosomes prepared by the above method in the preparation of mRNA delivery vectors.
[0017] This invention also provides a method for preparing Chlorella exosome mRNA composite nanoparticles, comprising the following steps: dissolving Chlorella exosomes prepared by the above method in PBS buffer to prepare an exosome solution; mixing exosomes and mRNA at a mass ratio of 1:1-1:3; incubating the mixture in a cuvette at 0-6℃ for 20-40 min; adding electroporation buffer; performing electroporation on the mixture in the cuvette using an electroporator, controlling the voltage at 100-500V and the capacitance at 150-500μF; incubating at 35-40℃ for 30-60 min; and then incubating the mixture at 80000-120000g. , Centrifuge at 0-6℃ for 50-70 min to remove electroporation buffer and free mRNA, and collect the precipitate particles, which are the mRNA composite nanoparticles of Chlorella exosomes.
[0018] Furthermore, the mRNA is a chemically modified or unmodified mRNA encoding the target protein, with a concentration of 14 mg / mL, dissolved in RNase-free water.
[0019] Furthermore, the electroporation buffer solution is formulated as follows: 10-50 mM TrisHCl, 200-300 mM sucrose, pH 7.3-7.6.
[0020] Compared with existing technologies, the advantages of this invention are as follows: This invention discloses a method for preparing Chlorella exosomes and their mRNA composite nanoparticles, and their applications. Using naturally edible Chlorella exosomes as a carrier, safe and scalable mRNA delivery is achieved. This system exhibits good biocompatibility and low immunogenicity, reducing in vivo immune rejection and toxic side effects. Its food-derived nature also contributes to its good safety profile, further enhancing its acceptance in clinical applications. Compared to mammalian cell exosomes, microalgal exosomes have the advantages of wide availability, low cost, and ease of large-scale culture. Combined with electroporation, they can efficiently load and protect mRNA from degradation, significantly improving its stability and intracellular expression efficiency. Compared with traditional synthetic carriers such as lipid nanoparticles, natural exosome carriers have better biodegradability and long-term safety, and do not have strong liver-targeting limitations, broadening the application prospects of mRNA in vaccines, tumor immunotherapy, and gene therapy. Furthermore, microalgal exosomes themselves possess strong antioxidant activity, which is effective both in vivo and in vitro. This invention is simple and convenient to operate, inexpensive, has a short production cycle, and is suitable for batch processing and factory production. Attached Figure Description
[0021] Figure 1 The figures (a) show the growth curves and (b) show the protein concentrations of exosomes of *Chlorella sorokinense* FACHB-25 under polyculture, polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormone, and polyculture + nitrite conditions in Example 1. ns indicates no significant difference, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, and **** indicates p < 0.0001.
[0022] Figure 2 This is a TEM electron microscope image of exosomes extracted from Chlorella facobacterium var. sorogenesis FACHB-25 under mixed culture, mixed culture + nitrogen deficiency, mixed culture + high light, mixed culture + plant hormone, and mixed culture + nitrite modes in Example 2.
[0023] Figure 3 The exosomes extracted from *Chlorella vulgaris* FACHB-25 in Example 3 under mixed culture, mixed culture + nitrogen deficiency, mixed culture + high light, mixed culture + plant hormone, and mixed culture + nitrite modes are (a) particle number, (b) particle size distribution, and (c) Zeta potential. ns indicates no significant difference, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, and **** indicates p < 0.0001.
[0024] Figure 4The results of in vitro antioxidant enzyme activity assays of exosomes at different concentrations extracted under the co-culture mode in Example 4 are shown. (a) represents the CAT enzyme activity of samples at different concentrations, (b) represents the SOD enzyme activity of samples at different concentrations, and (c) represents the MDA enzyme activity of samples at different concentrations. ns indicates no significant difference, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, and **** indicates p<0.0001.
[0025] Figure 5 The results of in vitro free radical scavenging assays of exosomes of different concentrations extracted under the co-culture mode in Example 5 are shown, where (a) is the ABTS scavenging rate of different samples and (b) is the DPPH scavenging rate of different samples.
[0026] Figure 6 The results of in vitro antioxidant assays of exosomes extracted at different concentrations under the co-culture mode in Example 6 are shown. (a) shows the relative ROS content in HaCaT cells; (b) shows the fluorescence image of the DCFH-DA probe in HaCaT cells; (c) shows the red / green ratio in the JC-1 staining results; and (d) shows the JC-1 staining results of HaCaT cells. ns indicates no significant difference, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, and **** indicates p<0.0001.
[0027] Figure 7 The results of in vivo antioxidant assays of exosomes at different concentrations extracted under the co-culture mode in Example 7 are shown, where (a) is the fluorescence map of ROS levels in zebrafish embryos; and (b) is the relative expression level of the eln1 gene in zebrafish embryos.
[0028] Figure 8 This is an agarose gel electrophoresis image of the in vitro transcription template PCR amplification product from Example 8;
[0029] Figure 9 The exosomes and mRNA solutions of *Chlorella sorokinense* FACHB-25 in Example 9 were used to measure the RNA concentrations embedded and free RNA concentrations under different electroporation parameters.
[0030] Figure 10 The embedding rate of mRNA in the Chlorella exosome mRNA composite nanoparticles under electroporation with different electroporation parameters in Example 10;
[0031] Figure 11 This is a comparison of the particle size of the exosomes extracted from Chlorella facsimile FACHB-25 and the mRNA composite nanoparticles of Chlorella exosomes in Example 11.
[0032] Figure 12Agarose gel electrophoresis images of reverse transcription PCR products of mRNA embedded in exosomes collected under different electroporation conditions. Detailed Implementation
[0033] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.
[0034] Example 1: Screening a culture mode for high exosome production by Chlorella in a mixed culture mode.
[0035] Chlorella polyculture model: [This refers to a specific type of algae cultivation method, likely involving a single algae colony.] Chlorella sp FACHB-25 was inoculated into 50 mL of BG11 medium and cultured in a shaker at 25℃ and 150 rpm for 6-8 days. The seed culture was then inoculated into 600 mL of BG11 medium, with glucose supplemented to a final concentration of 1 g / L. The culture was then incubated at 25℃, 150 rpm, and a light intensity of 55 μmol·m². -2 ·s -1 The algae were cultured in a shaker for 5-6 days, and the *Chlorella sorokinica* FACHB-25 algal solution was collected. The BG11 medium formula was as follows: NaNO3 1.5g, K2HPO4 0.04g, MgSO4·7H2O 0.075g, CaCl2·2H2O 0.036g, Na2CO3 0.02g, citric acid 0.006g, ferric citrate 0.006g, trace element solution A5 1mL, and distilled water 1000mL. The trace element solution A5 formula was: H3BO3 2.86g / L, MnCl2·4H2O 1.81g / L, ZnSO4 0.222g / L, Na2MoO4 0.39g / L, CuSO4·5H2O 0.079g / L, and Co(NO3)2·6H2O 0.049g / L.
[0036] Chlorella polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormones, polyculture + nitrite mode: [These methods] will cause single algae to fall... Chlorella sp FACHB-25 was inoculated into 50 mL of BG11 medium and incubated at 25 °C, 150 rpm, and 55 μmol·m⁻¹. -2 ·s -1 The culture was carried out in a shaker for 6-8 days, and then the seed culture was inoculated into 600 mL of BG11 medium while supplementing glucose to a final concentration of 1 g / L. The culture was then carried out in a shaker at 25℃ and 150 rpm. On the second day of the mixed culture, the following operations were performed: exogenous addition of 300 mg / L NaNO2 solution containing nitrite was made, and the light intensity was changed to 140 μmol·m⁻¹. -2 ·s -1(High light), add 1mM 6-BA (plant hormone) exogenously, change the culture medium to a nitrogen-deficient environment (nitrogen deficiency), and finally collect the Chlorella fachob-25 algal solution after 5-6 days of culture.
[0037] OD 680 Measurement method: Take 200 μL of *Chlorella vulgaris* FACHB-25 algal solution obtained under different culture modes, and measure the absorbance at 680 nm using a microplate reader to obtain the OD of the algal solution obtained under different culture modes. 680 .
[0038] Method for extracting exosomes from algal culture: 800 mL of *Chlorella vulgaris* FACHB-25 culture obtained under different culture modes was collected. Differential centrifugation was performed at 4℃ at 300 g for 10 min, 2,000 g for 20 min, and 10,000 g for 30 min to remove cells and cell debris. The supernatant was filtered through a 0.22 μm aqueous filter membrane, and the filtrate was then ultracentrifuged at 100,000 g for 90 min. The precipitate was resuspended in 2 mL of sterile PBS buffer to obtain an exosome suspension, which was stored at -80℃ for subsequent experiments.
[0039] Protein concentration determination method: Take 100 μL of exosome suspension extracted from algal culture under different culture modes and add 100 μL of lysis buffer at a volume ratio of 1:1. Sonicate three times for 10 seconds and then incubate on ice for 30 min. The lysis buffer formula is as follows: 50 mM Tris-HCl (pH 7.4 - 8.0), 1% Triton X-100, 10% sodium deoxycholate, 1 mM benzyl sulfonyl fluoride, and 1 mM ethylenediaminetetraacetic acid.
[0040] Take 20 μL of different sample lysis buffers into each well of a 96-well microplate, and add 200 μL of LCA working solution (MA0082-2, Meilun Biotechnology) to each well. Incubate at 37℃ for 30 min, and measure the absorbance of the sample at 562 nm using a microplate reader. Calculate the exosome protein concentration based on the linear relationship between the absorbance value after subtracting the blank control and the exosome protein concentration.
[0041] Figure 1 (a) shows the growth curves of *Chlorella sorokinense* FACHB-25 under polyculture, polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormone, and polyculture + nitrite modes. Figure 1 As shown in (a), under the polyculture + nitrite mode, *Chlorella sorokinica* FACHB-25 reached its OD value on day 5. 680The maximum value was 6.63, which was 1.1 times that of mixed culture, 1.05 times that of mixed culture + nitrogen deficiency, 0.88 times that of mixed culture + high light, and 1.32 times that of mixed culture + plant hormones. This indicates that the biomass of Chlorella sorogenesis FACHB-25 under the mixed culture + nitrite mode was slightly lower than that under the mixed culture + high light mode, but higher than that under the other three culture modes.
[0042] Figure 1 (b) shows the exosome protein concentrations extracted from *Chlorella sorokinense* FACHB-25 algal solutions under polyculture, polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormone, and polyculture + nitrite conditions. The *Chlorella* exosome concentrations were determined using the BCA method. Figure 1 As shown in Figure (b), the concentration of Chlorella exosomes extracted under the mixed culture + nitrite mode was 8.8 ± 0.8 mg / g dry weight of algae, which was 5.27 times that of mixed culture, 12.05 times that of mixed culture + nitrogen deficiency, 6.52 times that of mixed culture + high light, and 1.66 times that of mixed culture + plant hormones, respectively. This indicates that the protein concentration extracted from Chlorella sorokinica FACHB-25 under the mixed culture + nitrite mode was significantly higher than that under the other four modes.
[0043] The above results indicate that Chlorella sorogenesis FACHB-25 cultured under the mixed culture + nitrite mode has relatively high biomass and higher protein concentration of exosomes, and it was found that Chlorella sorogenesis FACHB-25 cultured under the mixed culture + nitrite mode has a higher yield of exosomes.
[0044] Example 2: Structural characterization of exosomes extracted from Chlorella cultured under mixed culture, mixed culture with nitrogen deficiency, mixed culture with high light, mixed culture with plant hormones, and mixed culture with nitrite.
[0045] Transmission electron microscopy (TEM) measurements: The morphology and structure of exosomes from *Chlorella vulgaris* FACHB-25 cultured under polyculture, polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormone, and polyculture + nitrite modes were observed using a JEM-2100 TEM microscope. Exosome suspensions extracted from algal cultures grown under the polyculture, polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormone, and polyculture + nitrite modes in Example 1 were dropped onto a carbon-coated copper grid. After standing at room temperature for 10 min, excess sample was removed with filter paper. The copper grid was then stained with phosphotungstic acid for 10 s, and excess liquid was removed with filter paper. The samples were washed with PBS buffer for 1 min, and excess liquid was removed with filter paper. After drying under incandescent light, the morphology of the freshly prepared samples was observed using TEM.
[0046] Figure 2 Transmission electron microscopy images of exosomes from *Chlorella vulgaris* FACHB-25 under polyculture, polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormones, and polyculture + nitrite modes, as shown below. Figure 2As shown, the exosomes of Chlorella sorokinosa FACHB-25 have a typical "tea saucer"-like structure with a round shape and some depressions, and have a lipid bilayer structure, which is consistent with the structure of conventional exosomes.
[0047] Example 3: NTA (nanoparticle tracking analysis technology) and zeta potential of exosomes extracted from Chlorella cultured under mixed culture, mixed culture + nitrogen deficiency, mixed culture + high light, mixed culture + plant hormone, and mixed culture + nitrite modes.
[0048] NTA and zeta potential determination: Exosome suspensions extracted from algal cultures cultivated under different modes in Example 1 were dissolved in PBS buffer, and the particle number, particle size, and zeta potential of the sample were measured using a nanoparticle tracking analyzer. After the instrument was powered on, a standard solution of 100 nm polystyrene microspheres was diluted 250,000 times with ultrapure water, and 1 mL of the diluted standard solution was used for automatic instrument calibration. After automatic calibration, the sample cell was cleaned with 1X PBS buffer, and the exosome sample was diluted to an appropriate concentration with clean PBS solution for injection testing. Dilution was used to avoid multiple scattering effects caused by the instrument. The results are as follows: Figure 3 As shown.
[0049] Figure 3 (a) shows the number of exosome particles extracted from *Chlorella sorokinense* FACHB-25 under polyculture, polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormone, and polyculture + nitrite modes. The number of exosome particles extracted under the polyculture + nitrite mode was 1.7e+12±0.2 particles / g dry algae weight, which was 9.57 times that of the polyculture mode, 11.06 times that of the polyculture + nitrogen deficiency mode, 2.18 times that of the polyculture + high light mode, and 1.58 times that of the polyculture + plant hormone mode, respectively. This indicates that the number of exosome particles extracted from *Chlorella sorokinense* FACHB-25 under the polyculture + nitrite mode was significantly higher than that under the other four modes.
[0050] Figure 3 (b) and (c) show the NTA particle size distribution and zeta potential of Chlorella extract under polyculture, polyculture + nitrogen deficiency, polyculture + high light, polyculture + plant hormone, and polyculture + nitrite modes. The particle size distribution conforms to the classical exosome particle size range of 30–150 nm, and the zeta potential conforms to the classical exosome range of -10 to -50 mV.
[0051] In summary, when Chlorella is cultured using a combination of light and glucose, light provides energy to the photosynthetic system, driving the synthesis of basic organic matter. Glucose, as an exogenous carbon source, is rapidly absorbed. The two work synergistically to enhance carbon metabolism pathways such as glycolysis and the TCA cycle, improving energy conversion efficiency and promoting biomass accumulation and efficient exosome secretion. When nitrite is present in the water, it inhibits the function of the PsbO subunit in photosynthetic system II, interfering with key physiological processes such as photosynthesis and DNA processing. As a stress response, Chlorella upregulates the expression of genes related to carbon metabolism and oxidative phosphorylation, increasing ATP synthesis through enhanced metabolism. Simultaneously, nitrite-induced ROS stress activates the MAPK signaling pathway, regulating the expression of secretion-related genes and guiding exosome production. The synergistic effect of co-culture and nitrite stress not only ensures the basic growth of Chlorella but also provides a feasible pathway for its efficient preparation by stimulating exosome secretion.
[0052] Example 4: Determination of the in vitro antioxidant enzyme activity of HaCaT cells by different concentrations of exosomes extracted under the mixed culture mode of Example 1.
[0053] 1. CAT free radical scavenging experiment:
[0054] Step 1: Take HaCaT cells from different culture conditions, add 9 volumes of PBS at a weight (g):volume (mL) ratio of 1:9, mechanically homogenize under ice-water bath conditions, centrifuge at 4000 rpm for 10 minutes, and take the supernatant for testing.
[0055] Step 2: Prepare two clean reaction tubes, labeling them as the control tube and the assay tube, respectively;
[0056] Step 3: Add 1.0 mL of pre-warmed (37°C) hydrogen peroxide-containing reaction solution to each of the two tubes, and then add 0.1 mL of pre-warmed (37°C) buffer solution to each tube to complete the construction of the basic reaction system.
[0057] Step 4: Add 0.1 mL of the sample to be tested to the test tube. To ensure that the reaction system volumes of the two tubes are consistent, add 0.1 mL of double-distilled water to the control tube to replace the sample. At this point, the reaction systems of both tubes are complete.
[0058] Step 5: Place the two reaction tubes on a vortex mixer and mix thoroughly. Then quickly place them in a 37°C constant temperature water bath and strictly control the reaction time to 1 minute (i.e. 60 seconds). This process requires precise timing to ensure uniform reaction conditions.
[0059] Step 6: After the reaction time is over, immediately add 1.0 mL of ammonium molybdate solution to each of the two tubes, and then add 0.1 mL of auxiliary reaction reagent to each tube. Mix well after each reagent is added. The reaction between catalase and hydrogen peroxide is terminated by ammonium molybdate, and the remaining hydrogen peroxide is promoted to form a stable pale yellow complex.
[0060] Step 7: After the liquid in the reaction tube is mixed, place it in a zeroed spectrophotometer or ELISA reader. Under the conditions of 405nm wavelength and 0.5cm optical path, measure the absorbance values of the control tube and the test tube respectively, and record them as A control and A test.
[0061] The formula for calculating catalase activity (unit: U / mL) is: (Control A - Assay A) × 1.0 × 271 × Dilution factor / (Sample volume × 60). Figure 4 As shown in (a), compared with the control group, H2O2 induced a significant decrease in intracellular CAT activity, and Chlorella exosomes were able to restore LPS-induced cellular CAT enzyme activity to 15.76 U / mg protein.
[0062] 2. SOD free radical scavenging experiment:
[0063] Step 1: Take HaCaT cells from different culture conditions, add 9 volumes of PBS at a weight (g):volume (mL) ratio of 1:9, mechanically homogenize under ice-water bath conditions, centrifuge at 4000 rpm for 10 minutes, and take the supernatant for testing.
[0064] Step 2: Prepare a 96-well microplate and label the control wells, control blank wells, and assay wells (if the sample is colored or contains antioxidants, additional sample blank wells are required).
[0065] Step 3: Set up the basic reaction system: Add 20 μL of double-distilled water and 20 μL of enzyme working solution to the control wells; add 20 μL of double-distilled water and 20 μL of enzyme diluent to the control blank wells; add 20 μL of the serum / plasma sample to be tested and 20 μL of enzyme working solution (xanthine oxidase stock solution and enzyme diluent are mixed at a volume ratio of 1:10) to the assay wells, ensuring accurate sample addition in each well;
[0066] Step 4: Quickly add 200 μL of substrate solution to each well using a multichannel pipette, and immediately gently mix by pipetting (avoid generating air bubbles). At this point, the reaction starts, and the sample addition interval needs to be shortened to reduce errors.
[0067] Step 5: Seal the ELISA plate and place it in a 37°C incubator for precise incubation for 30 minutes.
[0068] Step 6: Immediately after incubation, place the microplate into the zeroed instrument and measure the absorbance of each well at a wavelength of 450 nm. Record the values as A control, A control blank, A measurement, and A sample blank, respectively.
[0069] Inhibition percentage (%) = ((Control A - Blank A) - (Assay A - Blank A)) / (Control A - Blank A) × 100%, SOD activity (U / mL) = (Inhibition percentage / (50 - Inhibition percentage)) × Dilution factor × (Total volume of reaction system / Sample volume). Figure 4 As shown in (b), compared with the control group, H2O2 induced a significant decrease in intracellular SOD activity, and Chlorella exosomes were able to restore LPS-induced cellular SOD enzyme activity to 17.25 U / mg protein.
[0070] 3. MDA free radical scavenging experiment:
[0071] Step 1: Take HaCaT cells from different culture conditions, add 9 volumes of PBS at a weight (g):volume (mL) ratio of 1:9, mechanically homogenize under ice-water bath conditions, centrifuge at 4000 rpm for 10 minutes, and take the supernatant for testing.
[0072] Step 2: Add 1.0 mL of double-distilled water, 0.5 mL of trichloroacetic acid solution, and 0.5 mL of TBA solution to the blank tube; add 1.0 mL of the corresponding concentration of standard working solution, 0.5 mL of trichloroacetic acid solution, and 0.5 mL of TBA solution to each concentration standard tube; add 1.0 mL of the sample to be tested, 0.5 mL of trichloroacetic acid solution, and 0.5 mL of TBA solution to the test tube. Mix the reagents immediately after adding them to each tube using a vortex mixer.
[0073] Step 3: Adjusting reaction conditions and heating the reaction: Add 2 drops of concentrated hydrochloric acid to each reaction tube and mix gently to adjust the pH of the system to 1.0-2.0. Then place the reaction tubes in a boiling water bath and heat precisely for 15 minutes (start timing from when the water bath boils again) to ensure that each tube is heated evenly.
[0074] Step 4, Termination of Reaction and Centrifugation: After heating, immediately remove the reaction tubes and place them in an ice bath to cool for 10 minutes to terminate the reaction and stabilize the complex. After cooling, place all reaction tubes in a centrifuge at 3000 °C. g Centrifuge for 10 minutes to remove the precipitate and keep the supernatant for later use (the supernatant is a pink MDA-TBA complex solution).
[0075] Step 5, Absorbance Measurement: Transfer the supernatant after centrifugation into cuvettes. At a wavelength of 532 nm, zero the instrument with the supernatant from the blank tube and measure the absorbance values of each standard tube and the test tube in sequence. Record the values as A standard (each concentration) and A test.
[0076] MDA content (U / mg protein) is calculated using the formula: (x determination × dilution factor × sample volume) / (protein concentration × sample volume). Figure 4 As shown in (c), compared with the control group, H2O2 induced a significant increase in intracellular MDA activity, and Chlorella exosomes were able to restore LPS-induced cellular MDA enzyme activity to 7.59 U / mg protein.
[0077] The above results demonstrate that Chlorella exosome nanoparticles can effectively exert antioxidant effects on HaCaT cells in vitro. The decrease in MDA and the increase in SOD and CAT activities form a clear causal relationship, jointly confirming that Chlorella exosomes can break the imbalance between oxidative damage and antioxidant defense, and construct a stable antioxidant microenvironment in the in vitro HaCaT cell model.
[0078] Example 5 and Example 1: Determination of the in vitro free radical scavenging effect of different concentrations of exosomes extracted under mixed culture mode on HaCaT cells.
[0079] Determination of ABTS and DPPH scavenging rates: The ability of exosomes obtained under mixed culture conditions to scavenge free radicals from HaCaT cells was investigated using a free radical scavenging assay with 2,2′-hydrazine-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) and 1,1-diphenyl-2-trinitrophenylhydrazine (DPPH). ABTS / deionized water (DW) solutions and DPPH / ethanol solutions were prepared separately. 0.5 mL of exosomes and 4 mL of ABTS solution were used as test groups, and their absorbance was measured at 734 nm. A blank control group (using DW instead of exosomes) and a baseline group (using DW instead of ABTS solution) were also set up. A test sample group was prepared by adding DW to a total volume of 5 mL of exosomes and 1 mL of DPPH solution, and incubated in the dark for 30 min, with its absorbance measured at 517 nm. A blank control group (using DW instead of exosomes) and a baseline group (using 95% ethanol instead of DPPH solution) were also set up.
[0080] Depend on Figure 5 As shown in (a), regarding ABTS clearance, exosomes exhibited ABTS clearance rates below 10% at concentrations between 6.25 and 100 μg / mL, but achieved a clearance rate of 28.9% at a concentration of 400 μg / mL; Figure 5As shown in Figure (b), the DPPH scavenging rate of exosomes at different concentrations ranged from 20% to 40%. This indicates that exosomes obtained under mixed culture conditions have a certain in vitro free radical scavenging effect, and this scavenging ability is dose-dependent.
[0081] Example 6: Determination of the in vitro oxidative damage activity of exosomes extracted at different concentrations under the mixed culture mode of Example 1 on HaCaT cells.
[0082] ROS content determination: HaCaT cells were seeded into 96-well plates and cultured in an incubator for 12 h until the cell density reached 60%-70%. Five groups were established: a control group, an H2O2 model group, and three different concentrations of exosomes. Each group had three replicates. According to the group settings, the cells were first treated with exosomes for 12 h, and then treated with 600 μmol / L H2O2 solution for 4 h. 2',7'-dichlorofluorescein diacetate (DCFH-DA) was diluted with serum-free medium at a ratio of 1:500 to a final concentration of 10 μmol / L. The original cell culture medium was removed, and the diluted DCFH-DA was added. The cell culture plates were transferred to a cell culture incubator and incubated for 20 min. The cells were washed three times with serum-free medium. Detection was performed using a multi-mode microplate reader (488 nm excitation wavelength, 525 nm emission wavelength) or a fluorescence inverted microscope (Nikon TS2R-FL, JP), and the results were recorded.
[0083] Mitochondrial membrane potential measurement: HaCaT cells were treated with different concentrations of exosomes (1.5 μg / mL, 25 μg / mL, 100 μg / mL), and the model group was treated with H2O2. The treated cells were cultured at 37℃ in a 5% CO2 incubator for 72 h. 1×102 6 Cells were resuspended in cell culture medium. 20 min in advance, 10 μM of m-chlorophenyl hydrazone carbonyl cyanide (CCCP; an apoptosis inducer) was added to untreated cells as a positive control, and the cells were incubated at 37°C for 20 min. 0.5 mL of cells were added to 0.5 mL of JC-1 staining working solution, and the cells were incubated at 37°C for 20 min. 1,000 cells were then incubated at 4°C. g Centrifuge for 4 min, aspirate the supernatant, and wash twice with JC-1 staining buffer. Resuspend the cells in an appropriate amount of JC-1 staining buffer, and photograph and record using a fluorescence inverted microscope.
[0084] Depend on Figure 6 As shown in (a) and (b), H2O2 induces oxidative stress in HaCaT cells. Compared with the control group, H2O2 induced a significant increase in intracellular ROS content. In cells treated with exosomes, the ROS content decreased to 63.44% of that in the H2O2 model group, and the fluorescence intensity was significantly reduced. Moreover, this scavenging ability was dose-dependent.
[0085] Depend on Figure 6 As shown in (c) and (d), H2O2 induces mitochondrial damage in HaCaT cells. Compared with the control group, H2O2 induces changes in the mitochondrial membrane potential of HaCaT cells. The high-concentration exosome group (100 μg / mL) showed a relative fluorescence intensity of 5.8 for the JC-1 polymer / monomer, indicating that exosomes were able to restore the mitochondrial membrane potential of HaCaT cells in a dose-dependent manner, thereby maintaining the integrity of the mitochondrial membrane.
[0086] Example 7 and Example 1: Determination of oxidative damage in zebrafish by different concentrations of exosomes extracted under mixed culture conditions.
[0087] ROS determination: 2-day-fiber embryos were placed in 6-well plates, 15 embryos per well. A zebrafish oxidative stress model was established by water-soluble H2O2. Normal control, model control, and experimental groups were set up, and samples were added. The embryos were incubated at 28.5℃ in the dark for 22 hours. After incubation, the DCFH-DA probe was added, and the embryos were incubated at 28.5℃ in the dark for 1 hour for ROS detection. The embryos were then observed under a fluorescence inverted microscope and photographed under the same exposure conditions.
[0088] q-PCR: 4-day-fiber (4dpf) embryos were placed in 6-well plates, 30 embryos per well, with a normal control group and an experimental group. Samples were added, and the plates were incubated at 28.5°C in the dark for 24 hours. Total RNA was extracted from each group of zebrafish and reverse transcribed into cDNA. q-PCR was used to detect the expression of β-actin and the target gene, with β-actin used as an internal control for gene expression. The relative RNA expression level of the target gene was calculated using the 2^ΔΔCt method.
[0089] Depend on Figure 7 As shown in (a), H2O2 induced oxidative stress in zebrafish embryos. Compared with the control group, H2O2 induced a significant increase in ROS levels and a marked increase in fluorescence intensity in zebrafish embryos. After treatment with 5% concentration of Chlorella exosomes, the fluorescence intensity was significantly reduced (p < 0.05), and the exosomes were able to restore the H2O2-induced ROS levels in zebrafish.
[0090] Depend on Figure 7 As shown in (b), zebrafish possess elastin (eln1, eln2) genes similar to those in humans. Compared to the control group, the relative expression level of the eln1 gene reached 1.37 after exosome treatment, significantly higher than that of the control group. These results indicate that exosome treatment can increase the expression level of elastin genes in zebrafish, potentially alleviating skin aging and sagging.
[0091] A comprehensive assessment of in vitro and in vivo oxidative damage revealed that exosomes obtained under mixed culture conditions can improve mitochondrial function, reduce ROS production, maintain mitochondrial membrane integrity, and have strong antioxidant activity, effectively alleviating oxidative stress in the body.
[0092] The above results indicate that the polyculture + nitrite culture mode can significantly increase the number of exosomes and their protein content. Simultaneously, Chlorella exosomes can enhance the CAT and SOD enzyme activities, weaken the MDA enzyme activity, scavenge ABTS and DPPH free radicals in HaCaT cells, eliminate ROS in HaCaT cells, and restore mitochondrial membrane potential. Furthermore, Chlorella exosomes can also alleviate oxidative stress in zebrafish.
[0093] Example 8: Preparation of mRNA.
[0094] The gene sequence encoding the SpoU methyltransferase domain of Saccharomyces cerevisiae TRM3 is as follows: GTTACACGTTCTGAATTGATTGTGGTATCTTCATTAGTTGATAAGCCGCCAAACCTGGGAGGTATTTGTAGGTTATGTGATGTTTTAGGTGTGGGACTGCTTACTGTACAAGACATCAAAGTCAAAAACCATCCTCAATTTAAAAATGTTGCTGTGACTGCTGATAGATGGATGCCCATGGAGGAAGTTGCCCTAGATGAGATTGCAAGTTTCATGAAAG Primers for upstream and downstream amplification were designed based on the gene encoding the SpoU methyltransferase domain of Saccharomyces cerevisiae TRM3.
[0095] Using the pET22b plasmid containing the SpoU methyltransferase domain of *Saccharomyces cerevisiae* TRM3 containing the T7 promoter as a template, a 50 μL PCR system was constructed as follows: 25 μL high-fidelity DNA polymerase premix, 1 μL plasmid template, 1 μL upstream amplification primer, and 1 μL downstream amplification primer, with the volume brought to 50 μL using RNase-free water. The nucleotide sequence of the upstream amplification primer is as follows: GACTTCATCGATAATACGACTCACTATAGGGGAATTGTGAGCG; the nucleotide sequence of the downstream amplification primer is as follows: CTCGAGCATGTGTTGAACTGTATAGGAATGAAC. The obtained PCR amplification products were subjected to nucleic acid gel electrophoresis, and the results are shown below. Figure 8 As shown, the bands were of correct size and uniform, with no nonspecific amplification. The target band was excised and recovered from the gel. Using this PCR amplification product as a template, in vitro transcription was performed using the T7 High Efficiency Transcription Kit, followed by RNA purification using the phenol-chloroform method. 50 μL of RNase-free H2O was added, and the mixture was incubated at 37°C for 5 min to promote dissolution. After brief centrifugation, the RNA concentration was measured and stored at -80°C.
[0096] Example 9: Preparation of composite nanoparticles of Sorokin Chlorella exosomes and mRNA from Example 8.
[0097] Step 1: During the logarithmic growth phase and stationary phase of *Chlorella sorokinica* in the mixed culture mode, algal solutions were collected. Differential centrifugation was performed at 4°C using 300 mL / min. g Centrifuge for 10 minutes, 2000 g Centrifuge for 20 minutes, 10000 g Centrifuge for 30 min to remove cells and cell debris, then filter the supernatant through a 0.22 μm filter membrane. Finally, centrifuge the filtrate at 100,000-120,000 ml / min. g The precipitate was obtained by ultracentrifugation for 60-90 min, and then resuspended in an appropriate volume of sterile PBS to obtain Chlorella exosome solution. The protein concentration was detected by BCA method and stored at -80℃ for later use.
[0098] Step 2: Take the mRNA prepared in Example 8 and determine its concentration before use. Dilute the mRNA and exosomes to 100 μL each, with a concentration ratio of 1:1 to 1:3. Mix and incubate in a cuvette at 4°C. After standing for 30 min, add 2 times the volume of electroporation buffer (10 mM TrisHCl, 250 mM sucrose, pH 7.5, filtered through a 0.22 μm filter) to increase the capacitance. This process must be carried out on ice at 4°C throughout.
[0099] Step 3: Use a BioRad electroporator to perform electroporation on the mixture in the cuvette, controlling the voltage at 100-500V and the capacitance at 150-500μF. Then incubate at 37 ℃ for 30-60 min to restore the EV membrane structure. The mixture is then subjected to electroporation at 100,000... g Centrifuge at 4℃ for 60 min to remove electroporation buffer and free mRNA. Collect the supernatant, which contains free mRNA, and collect the precipitate particles, which are the mRNA-EV composite nanoparticles of Chlorella exosomes. Mix the mRNA-EV composite nanoparticles with methanol at a volume ratio of 1:5, and then use a probe sonicator to sonicate the mRNA-EV mixture to break the exosome membrane, releasing the mRNA embedded in the EVs. Then, use NanoDrop to determine the concentration of collected free RNA and the concentration of mRNA released from the exosomes in the mRNA-EV composite nanoparticle solution.
[0100] Figure 9 The statistical results of embedded RNA concentration and free RNA concentration under different electroporation parameters are presented. The initial RNA concentration was 23 ng / μL, and the exosome concentration was 50 ng / μL. It can be seen that as the electroporation parameters are gradually increased from 150V and 100μF to 500V and 500μF, the embedded RNA concentration shows a clear upward trend, increasing from about 10 ng / μL to about 20 ng / μL, while the free RNA concentration decreases accordingly. Finally, the concentration of free RNA tends to be equal to that of embedded RNA in the highest parameter group. This phenomenon indicates that the RNA embedding efficiency has reached an optimal level under this condition, providing a valuable basis for parameter selection for constructing an efficient nucleic acid delivery system.
[0101] Determination of mRNA encapsulation rate in composite nanoparticles prepared in Examples 10 and 9.
[0102] The embedding efficiency of the mRNA-EV sample was calculated using the following formula: embedding efficiency (%) = mRNA concentration in mRNA-EV / total mRNA concentration * 100%, where the total mRNA concentration is the mRNA concentration in the mixture before electroporation transformation in step 2 of Example 9.
[0103] Figure 10 The statistical results of loading efficiency under different conditions show that as the electroporation parameters increase from 150V and 100μF to 500V and 500μF, the encapsulation efficiency exhibits a clear increasing trend, rising from approximately 38% to approximately 75%. Therefore, this electroporation condition can be selected for subsequent experiments. The concentration ratio of the above-mentioned mRNA solution to Chlorella exosome solution can also be 0.5:1, 1.5:3, or any value within the range of 0.5:1.
[0104] Characterization of the composite nanoparticles prepared in Examples 11 and 9.
[0105] Particle size determination: The mRNA composite nanoparticles of Chlorella exosomes prepared in Example 9 were dissolved in PBS buffer, and the particle size of the sample was measured using a Malvern particle size analyzer. Dilution was performed to avoid multiple scattering effects caused by the instrument. The results are as follows: Figure 11 As shown.
[0106] Depend on Figure 11 It was found that the particle size of *Chlorella sorokinense* exosomes falls within the range of 30-200 nm, while the particle size of exosomes containing mRNA was approximately 50-100 nm larger than that of empty exosomes. This significant increase in particle size directly demonstrates that the mRNA molecules were successfully encapsulated within the exosome, rather than merely attached to the surface, thus providing crucial physical evidence for the effectiveness of exosomes as nucleic acid drug delivery carriers. Furthermore, the particle size distribution of mRNA-loaded exosomes was more concentrated, with a peak percentage as high as approximately 70%, compared to the approximately 50% peak percentage of ordinary exosomes, exhibiting higher uniformity.
[0107] Verification of mRNA integrity in the composite nanoparticles prepared in Examples 12 and 9.
[0108] mRNA was separated from the methanol-dissolved mRNA-EV composite nanoparticle solution in Example 9 using a carrier co-precipitation method. First, a 3M NaCl solution was prepared, and the pH was adjusted to approximately 5.2. Then, 1 / 10 volume of NaCl solution and 2.5 times the volume of anhydrous ethanol were added to the methanol-dissolved mRNA sample. After mixing, the mixture was incubated at -80°C overnight (16-24 h), and then at 4°C for 12000... g Centrifuge for 30 min, carefully remove the supernatant, add 500 μL of pre-cooled 75% ethanol solution and wash gently, then incubate at 12000 mL / min at 4°C. g After centrifugation for 5 minutes, carefully remove the supernatant to avoid disturbing the precipitate. Open the cap of the EP tube and place it in a clean bench to air dry for 2-3 minutes until the ethanol has just evaporated. Immediately add RNase-free water to resuspend the tube to avoid excessive drying. Store at -20°C.
[0109] The purified mRNA solution was subjected to reverse transcription. A 20 μL reverse transcription reaction system was prepared on ice, and cDNA was obtained after the reaction was performed according to the kit. The cDNA was then immediately placed on ice or stored at -20°C. The obtained cDNA was prepared into a 50 μL reaction system for PCR amplification, constructing a 50 μL PCR system (same as in Example 8 above). The obtained PCR amplification product was subjected to nucleic acid gel electrophoresis. If the bands were normal, the integrity of the mRNA in the composite nanoparticles prepared in Example 9 could be confirmed. Figure 12To identify nucleic acid gel bands of reverse transcription PCR products of mRNA embedded in exosomes collected under different electroporation conditions (150V 100μF, 200V 200μF, 500V 500μF), and to compare them with... Figure 8 The comparison shows that the band positions in the two images are consistent, which verifies that the mRNA embedded in the composite nanoparticles is consistent with and complete with the mRNA sequence before embedding.
[0110] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.
Claims
1. A method for preparing Chlorella exosomes, characterized in that... The specific steps are as follows: Step 1: Inoculate *Chlorella sorokinense* FACHB-25 into 30-100 mL of BG11 medium and culture for 6-8 days at 20-30℃ and 100-200 rpm in a shaker. Then, continue inoculating the seed culture into 500-700 mL of BG11 medium and supplement with glucose to a final concentration of 0.8-1.2 g / L. Incubate at 20-30℃, 100-200 rpm, and a light intensity of 50-60 μmol·m⁻². -2 ·s -1 The algae were cultured in a shaker. On the second day of the mixed culture, a NaNO2 solution containing 200-400 mg / L nitrite was added exogenously. After 5-6 days of culture, the algal solution of Chlorella was collected. Step 2: Centrifuge the Chlorella solution obtained in Step 1 using differential centrifugation at 0-6℃, sequentially at 200-400g for 8-12 min, 1000-3000g for 15-25 min, and 8000-12000g for 20-40 min to remove cells and cell debris. After passing the supernatant through a 0.22μm aqueous filter membrane, centrifuge the filtrate at 80000-120000g for 80-100 min to collect the precipitate, thus obtaining Chlorella exosomes.
2. The method for preparing Chlorella exosomes according to claim 1, characterized in that... The process includes the following steps: The formula for the BG11 culture medium is as follows: NaNO3 1-2g, K2HPO4 0.03-0.05g, MgSO4·7H2O 0.05-0.1g, CaCl2·2H2O 0.02-0.04g, Na2CO3 0.01-0.03g, citric acid 0.005-0.007g, ferric citrate 0.005-0.007g, trace element solution A5 0.5-2mL, and distilled water 800-1200mL.
Citation Information
Patent Citations
Microalgal extracellular vesicles, preparation and use thereof
CN118201625A