Bordetella pertussis engineered strain, preparation method and application thereof

Abstract

This invention discloses an engineered strain of Bordetella pertussis, its preparation method, and its application. The engineered Bordetella pertussis strain and the Bordetella pertussis strain (…) Bordetella pertussis Compared to ), expressing Jinzhou Pseudomonas ( Pseudomonas jinjuensis The lpxD protein is derived from [source missing]. The strain of Bordetella pertussis engineered strain provided by this invention has a significant effect on increasing OMV production, which will promote the development of Bordetella pertussis OMV vaccines.

Description

Technical Field

[0001] The present invention belongs to the field of vaccinology, particularly to the field of prevention or treatment of Bordetella pertussis ( Bordetella (B.) pertussis ) infection. Specifically, it relates to an engineered strain of Bordetella pertussis, its preparation method and applications. Background Art

[0002] Pertussis, also known as whooping cough, is a highly contagious respiratory disease caused by Bordetella pertussis ( Bordetella (B.) pertussis ), namely Bordetella pertussis bacillus. The characteristics of pertussis are severe coughing fits, followed by a forced inhalation accompanied by the characteristic whooping sound. Bordetella pertussis was first identified as the pathogen of pertussis in 1906. Bordetella pertussis is a Gram-negative bacterium that specifically infects humans. The bacteria are transmitted from person to person by inhaling respiratory droplets. During the 1940s - 1950s, whole-cell pertussis (wP) vaccines were used against this bacterium, which consisted of inactivated Bordetella pertussis combined with diphtheria and tetanus toxoids. Due to some serious complications of the wP vaccine, in the late 1990s, the wP vaccine was replaced by acellular (aP) vaccines. aP vaccines contain combinations of some of the most important virulence factors of Bordetella pertussis, such as pertussis toxin, filamentous hemagglutinin, Bordetella pertussis adhesin, and fimbrial proteins 2 and 3.

[0003] However, pertussis disease persists in populations vaccinated with aP vaccines, and epidemiological data have reported an increase in the incidence of pertussis worldwide in recent years, which may be related to the evolution of pertussis strains and the shortened duration of protection of aP vaccines. To prevent the recurrence of pertussis, there is an urgent need in the art to develop a more effective new vaccine.

[0004] In recent years, more and more people have started to pay attention to the use of outer membrane vesicles (OMVs) as vaccines, such as the OMV-based Neisseria meningitidis ( Neisseria meningitidis ) vaccine BEXSERO, which contains OMVs of the New Zealand strain NZ98 / 254 and was approved for marketing by the European EMA and the US FDA in 2013 and 2015. US9623102B2 uses OMVs of Bordetella pertussis and OMVs of Bordetella parapertussis to induce a strong immune response, reduce bacterial colonization and ensure long-term effectiveness.

[0005] OMV (also known as "outer membrane vesicles") is a double-membrane structure, usually spherical, with a diameter in the range of 20 - 250 nm (sometimes 10 - 500 nm), which buds off from the outer membrane of Gram-negative bacteria. The interior of the OMV membrane contains phospholipids (PL), and the exterior contains lipopolysaccharides (LPS) and PL, and is mixed with membrane proteins at different positions, largely reflecting the structure of the bacterial outer membrane from which it buds off. The lumen of OMV can contain various compounds from the periplasm or cytoplasm, such as proteins, RNA / DNA, and peptidoglycan (PG), but different from bacterial cells, OMV lacks the ability to self-replicate. OMV vaccines have the following main advantages. First, OMV can carry most substances of bacteria, including key antigens on the bacterial surface, but does not have the replication ability of bacteria. Second, OMV has natural adjuvant properties and can strongly stimulate innate immune responses and adaptive immune responses; third, OMV has good stability to high temperatures and some chemicals. These characteristics demonstrate the great potential of OMV as a new form of bacterial vaccine.

[0006] However, Bordetella pertussis cannot secrete high levels of OMV, which greatly limits the development of pertussis OMV vaccines. There are few reports on increasing the production of Bordetella pertussis OMV. For example, Eline F. de Jonge (Curr Res MicrobSci. 2022 Nov 12:3:100172.) and others knocked out both the mlaF gene and the pldA gene in Bordetella pertussis, resulting in the accumulation of outer membrane phospholipids and an increase in OMV production. Eline F de Jonge et al. also found that conditional knockout of the pal gene can also increase the production of Bordetella pertussis OMV (Res Microbiol. 2022 May-Jun;173(4-5):103937.). In addition, knocking out the mltA gene of Bordetella pertussis (CN 118853525 B) or specific point mutations of the OmpA protein of Bordetella pertussis (CN116438193A) also have the effect of increasing OMV production. Except for the above-mentioned targets, there are few reports on other new targets for increasing OMV production in Bordetella pertussis. Therefore, it is urgent to find new targets for increasing production to accelerate the development of Bordetella pertussis OMV vaccines. Summary of the Invention

[0007] To solve the above technical problems, the present invention provides an engineered strain of Bordetella pertussis, its preparation method and application.

[0008] Specifically, the present invention solves the above technical problems through the following technical solutions: In the first aspect of the present invention, an engineered strain of Bordetella pertussis is provided, and the engineered strain of Bordetella pertussis and the Bordetella pertussis strain ( Bordetella pertussis), compared with expressing the lpxD protein derived from Pseudomonas jinzhouensis ( Pseudomonas jinjuensis ).

[0009] In some embodiments, the Bordetella pertussis strain is BAA 589.

[0010] In some embodiments, the lpxD protein is expressed by a promoter.

[0011] In some embodiments, the promoter is an endogenous or exogenous promoter capable of initiating gene expression in the BAA 589 strain.

[0012] In some embodiments, the promoter is selected from the pompp promoter, the pptx promoter, and the J23119 promoter.

[0013] In some specific embodiments, the promoter is the pompp promoter.

[0014] In some embodiments, the lpxD protein comprises the amino acid sequence shown in SEQ ID NO: 1, or the gene encoding the lpxD protein comprises the nucleotide sequence shown in SEQ ID NO: 2.

[0015] In some embodiments, the pompp promoter comprises the nucleotide sequence shown in SEQ ID NO: 3.

[0016] The second aspect of the present invention provides a nucleic acid construct, which comprises a gene encoding the lpxD protein derived from Pseudomonas jinzhouensis ( Pseudomonas jinjuensis ).

[0017] In some embodiments, the nucleic acid construct further comprises a promoter for expressing the gene.

[0018] In some embodiments, the promoter is the pompp promoter.

[0019] In some embodiments, the lpxD protein comprises the amino acid sequence shown in SEQ ID NO: 1, or the gene comprises the nucleotide sequence shown in SEQ ID NO: 2.

[0020] The third aspect of the present invention provides a method for preparing an engineered Bordetella pertussis strain, the method comprising: introducing the nucleic acid construct as described in the second aspect of the present invention into a Bordetella pertussis strain ( Bordetella pertussis ).

[0021] The fourth aspect of the present invention provides a method for preparing pertussis outer membrane vesicles, the method comprising culturing the Bordetella pertussis engineered strain as described in the first aspect of the present invention and obtaining pertussis outer membrane vesicles from the culture.

[0022] The fifth aspect of the present invention provides pertussis outer membrane vesicles prepared by the method as described in the fourth aspect of the present invention.

[0023] The sixth aspect of the present invention provides the use of the nucleic acid construct as described in the second aspect of the present invention in the preparation of a Bordetella pertussis engineered strain.

[0024] The seventh aspect of the present invention provides the use of the Bordetella pertussis engineered strain as described in the first aspect of the present invention in the preparation of pertussis outer membrane vesicles.

[0025] The eighth aspect of the present invention provides a composition comprising at least two of the following: (1) The Bordetella pertussis engineered strain as described in the first aspect of the present invention; (2) The pertussis outer membrane vesicles as described in the fifth aspect of the present invention; (3) An adjuvant and / or a pharmaceutically acceptable carrier.

[0026] The ninth aspect of the present invention provides the use of the Bordetella pertussis engineered strain as described in the first aspect of the present invention, the pertussis outer membrane vesicles as described in the fifth aspect of the present invention, or the composition as described in the eighth aspect of the present invention in the preparation of a drug or vaccine for preventing and / or treating Bordetella pertussis infection.

[0027] On the basis of conforming to the common knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred examples of the present invention.

[0028] The reagents and raw materials used in the present invention are all commercially available.

[0029] The positive and progressive effects of the present invention are as follows: The present invention provides an engineered strain of Bordetella pertussis, which has the effect of significantly increasing the yield of OMV, and will promote the development of Bordetella pertussis OMV vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a plasmid map for gene editing.

[0031] Figure 2 It is the result of PCR verification of the strain.

[0032] Figure 3 For I2:: PjlpxD It is the sequencing result of the strain.

[0033] Figure 4Determination of the number of OMV concentration particles in the bacterial liquid before purification.

[0034] Figure 5 Determination of the concentration of purified OMV.

[0035] Figure 6 Determination of the number of particles of purified OMV.

[0036] Figure 7 Determination of the particle size of purified OMV. Specific implementation mode

[0037] Definition

[0038] OMV: outer membrane vesicles, referring to the outer membrane vesicles secreted by Gram-negative bacteria.

[0039] IPTG: Isopropyl β-D-thiogalactoside, a commonly used inducer that can induce the expression of target genes according to requirements.

[0040] NTA: Nanoparticle tracking analysis, a detection method that uses the characteristics of light scattering and Brownian motion to obtain the particle size distribution of samples in a liquid suspension.

[0041] Pseudomonas jinjuensis The lpxD gene can synthesize LOS with short acyl chains. After replacing the lpxD gene of Bordetella pertussis with PjlpxD for expression, theoretically, the acyl chain of Bordetella pertussis LOS will become shorter, thus achieving the purpose of attenuating the strain. Therefore, those skilled in the art generally use PjlpxD Attenuation 。

[0042] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications. In order to exemplarily illustrate the technical solutions and technical effects of the present invention, the present invention selects the BAA-589 strain purchased from ATCC (American type culture collection).

[0043] Example 1: Strain construction

[0044] 1.1 Plasmid construction information

[0045] From Pseudomonas jinjuensisThe amino acid sequence encoding the LpxD protein was obtained from the bacteria and denoted as PjLpxD (SEQ ID NO: 1). The PjLpxD sequence was codon-optimized for expression in Bordetella pertussis, resulting in the optimized PjlpxD nucleotide sequence (SEQ ID NO: 2), and this sequence was gene-synthesized. The PjlpxD fragment was obtained by PCR from the gene-synthesized fragment. Additionally, the leader promoter region of the gene encoding Outer Membrane Protein P, designated as the pompp fragment (the primer sequences are shown in Table 1 and the nucleotide sequence of the pompp fragment is shown in SEQ ID NO: 3), was amplified by PCR from the genome of the starting strain BAA-589. The two obtained fragments were inserted into the plasmid backbone by homologous recombination, and further verified by colony PCR and plasmid sequencing to ensure the correct target sequence on the plasmid. The plasmid map is as Figure 1 shown.

[0046] Table 1.

[0047] 1.2 Plasmid Transformation and Strain Verification

[0048] The above gene-editing plasmid was introduced into competent Bordetella pertussis cells by electroporation. The electroporation parameters were: voltage 1.6 - 2.2 kV, resistance 200 Ω, capacitance 25 μF, and the electroporation time not exceeding 5 ms. After electroporation, SS liquid medium was added, and the cells were resuscitated in a shaker at 35 - 37 °C and 220 - 240 rpm. After resuscitation, the cells were centrifuged, most of the supernatant was discarded, and the cell pellet was resuspended and spread on a BG plate containing 10 μg / ml gentamicin resistance. The plate was incubated statically in an incubator at 35 - 37 °C. After suitable-sized monoclonal colonies grew on the electroporation plate, the monoclonal colonies were verified by PCR using the primers shown in Table 2 below. As Figure 2 shown in the verification results, the size of the PCR product of clone 6 was as expected, indicating that the PjlpxD gene had been successfully integrated into the Bordetella pertussis genome, and the target strain was obtained, denoted as I2:: PjlpxD strain (where I is a non-functional region in Bordetella pertussis).

[0049] Table 2.

[0050] Furthermore, the PCR product of the I2:: PjlpxD strain was sequenced to confirm that the edited sequence of the target strain was consistent with the expectation. As Figure 3 shown, the sequencing results indicated that the PjlpxD gene had been correctly inserted into the target site and the strain sequence was correct.

[0051] Example 2: Determination of OMV production

[0052] After obtaining the strain, the OMV production of the target strain I2:: PjlpxD was determined. The colonies on the plate were inoculated into 4 ml of SS liquid medium and cultured in a shaker at 35 °C and 240 rpm as the seed liquid. After the seed liquid was cultured for about 20 h, the seed liquid was transferred to a shake flask containing 200 ml of SS medium and cultured in a shaker at 35 °C and 240 rpm. After about 45 h of transfer, the OMV concentration in the strain supernatant was measured. The measurement method was as follows: Take 1 ml of the bacterial solution, centrifuge at 10,000 rpm for 5 min, take out the supernatant, filter the supernatant using a 0.22 µm filter head, dilute the filtered supernatant by a suitable multiple, and use a NanoSight Pro instrument to measure the OMV particle concentration according to the instruction manual. As Figure 4 shown, the OMV concentration of the I2:: PjlpxD strain was 1.97E11 / ml of the bacterial solution, which was significantly higher than the OMV concentration of the control strain, 3.15E10 / ml of the bacterial solution, indicating that the expression of PjlpxD gene could increase the number of OMV particles secreted by Bordetella pertussis.

[0053] In addition, the fermented bacterial solution was collected for OMV purification. The OMV purification method was as follows: The bacterial solution was centrifuged at 4000 rpm for 60 min at 4 °C to obtain the supernatant, and the supernatant was filtered using a 0.22 µm filter head. The filtered supernatant (140 ml each) was ultracentrifuged. First, use a large rotor for ultracentrifugation (ultracentrifugation conditions: 4 °C, 33,000 rpm for 1.5 h) for 2 rounds, and then use a small rotor for ultracentrifugation (ultracentrifugation conditions: 4 °C, 50,000 rpm for 1.5 h). After ultracentrifugation, 0.6 ml of buffer was added to each to resuspend the OMV, and the OMV was filtered and sterilized using a 0.22 µm filter head. After filtration, OMV samples were obtained for subsequent analysis.

[0054] The protein concentration of the purified OMV samples was measured using the BCA method. As Figure 5 shown, the OMV protein concentration of the control strain was 0.13 mg / ml of OMV, and the OMV protein concentration of the I2:: PjlpxD strain was 1.28 mg / ml of OMV. Compared with the control strain, the OMV protein concentration of the I2:: PjlpxD strain increased by about 9.8 times, indicating that the expression of PjlpxD gene could increase the OMV production of Bordetella pertussis.

[0055] The number of particles of the purified OMV was measured using a NanoSight Pro instrument. As Figure 6As shown, the number of OMV particles of the control strain was 1.64E12 / ml OMV, I2:: PjlpxD The number of OMV particles of the I2:: PjlpxD strain was 3.36E13 / ml OMV. The number of OMV particles of the I2:: PjlpxD strain was approximately 20-fold higher than that of the control strain, indicating that

[0056] the expression of the Figure 7 gene could increase the OMV secretion of Bordetella pertussis. PjlpxD In addition, the particle size and polydispersity index (PDI) of the purified OMV were measured using a Malvern DLS instrument. As

[0057] shown, the OMV particle size of the I2:: strain was approximately 97 nm, which was within the size range of Bordetella pertussis OMV. In addition, the PDI value of the purified OMV was approximately 0.2, indicating good homogeneity of the OMV. PjLpxD amino acid sequence (SEQ ID NO: 1) Codon-optimized PjlpxD gene nucleotide sequence (SEQ ID NO: 2) pompp nucleotide sequence (SEQ ID NO: 3) GATGAACCATGCATACAACCTATTGAATCTTCACAGTTAGCCCGCGCGCGATTCCGGATTAAGGGGACAGGATGTTGCAACTTACCAACAATGGGGCGGGAAACCGGCTTTTTTCTGAGCCTGACCATAGCCAGTCCTGCCGATTTTTGATGCAATAGCGTCAACTTCCCTTCGCGGAGTTAGGGGGGGCGGCAGGCCGGTATGTGCTGCATTGCTGCTCTTGTCACTCAAATCAACGGAGATTTCTTAA Plasmid backbone nucleotide sequence (SEQ ID NO: 4) Nucleotide sequence upstream of the plasmid backbone insertion site (SEQ ID NO: 5) TGGCCGAGGTGCCCATCAGG Nucleotide sequence downstream of the plasmid backbone insertion site (SEQ ID NO: 6) CTCGAGCCAGGCATCAAATA Although the specific embodiments of the present invention have been described above, those skilled in the art should understand that these are only examples. Without departing from the principle and essence of the present invention, various changes or modifications can be made to these embodiments. Therefore, the protection scope of the present invention is defined by the appended claims.

Claims

1. An engineered strain of Bordetella pertussis, characterized in that, The engineered strain of Bordetella pertussis and the strain of Bordetella pertussis ( Bordetella pertussis Compared to ), expressing Jinzhou Pseudomonas ( Pseudomonas jinjuensis lpxD protein from ( ) source; The Bordetella pertussis strain is BAA 589, and the amino acid sequence of the lpxD protein is shown in SEQ ID NO:

1.

2. The engineered strain of Bordetella pertussis as described in claim 1, characterized in that, The nucleotide sequence of the gene encoding the lpxD protein is shown in SEQ ID NO:

2.

3. A method for preparing engineered strains of Bordetella pertussis, characterized in that, The method includes: To Bordetella pertussis strain ( Bordetella pertussis The code introduced in ) is derived from Pseudomonas jinjuense ( Pseudomonas jinjuensis The gene for the lpxD protein; The Bordetella pertussis strain is BAA 589, and the amino acid sequence of the lpxD protein is shown in SEQ ID NO:

1.

4. The method as described in claim 3, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO:

2.

5. A method for preparing pertussis outer membrane vesicles, characterized in that, The method includes culturing the engineered strain of Bordetella pertussis as described in claim 1 or 2, and obtaining pertussis outer membrane vesicles from the culture.

6. The application of a nucleic acid construct in the preparation of engineered strains of Bordetella pertussis; said nucleic acid construct contains encoding compounds derived from Pseudomonas jinzhouense (… Pseudomonas jinjuensis The gene for the lpxD protein; The Bordetella pertussis strain is BAA 589, and the amino acid sequence of the lpxD protein is shown in SEQ ID NO:

1.

7. The application as described in claim 6, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO:

2.

8. The use of the engineered strain of Bordetella pertussis as described in claim 1 or 2 in the preparation of pertussis outer membrane vesicles.

9. A composition comprising: (1) The engineered strain of Bordetella pertussis according to claim 1 or 2; (2) Adjuvants and / or pharmaceutically acceptable carriers.

10. Use of the engineered strain of Bordetella pertussis according to claim 1 or 2 or the composition according to claim 9 in the preparation of a medicament for the prevention of Bordetella pertussis infection; in, The drug is selected from vaccines.

Images