SNP (Single Nucleotide Polymorphism) marker for targeted identification of systemic lupus erythematosus of children and application thereof

By identifying the SNP marker RS25671007 of the 734th base pair of the PABPC3 gene, specific primers were designed for PCR amplification, solving the problem of early diagnosis of systemic lupus erythematosus in children, achieving rapid and accurate detection and diagnosis, and reducing costs.

CN121653243APending Publication Date: 2026-03-13CHINA AGRI UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-31
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing technologies are insufficient for achieving high sensitivity and specificity in early diagnosis of systemic lupus erythematosus in children. Traditional antibody testing methods have low positive rates, and kidney biopsy carries high risks, while high-throughput sequencing technology is costly and difficult to popularize.

Method used

By identifying the SNP marker RS25671007 of the 734th base pair of the PABPC3 gene, specific primers were designed for PCR amplification to target and identify systemic lupus erythematosus in children, providing a rapid and accurate diagnostic and detection method.

Benefits of technology

This technology enables early targeted diagnosis and detection of systemic lupus erythematosus in children, shortening the diagnosis time, improving detection accuracy, reducing costs, and avoiding the risks associated with traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121653243A_ABST
    Figure CN121653243A_ABST
Patent Text Reader

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) marker for targeted identification of systemic lupus erythematosus of children and application of the SNP marker. A new SNP site (RS25671007) is identified in a child systemic lupus erythematosus patient through whole exon sequencing, the site is located at the 734th pair of basic groups of a PABPC3 gene, and mutation from C to T exists at the site, or mutation from threonine to isoleucine exists in coded amino acid. In addition, in-vitro cell model experiments prove that the SNP causes significant up-regulation of the antibody type transformation function, and the SNP can be used as a reference marker for risk stratification or medication guidance of early targeted diagnosis, detection, gene evaluation and the like of systemic lupus erythematosus of children.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomarker technology, specifically to SNP biomarkers for targeted identification of systemic lupus erythematosus in children and their applications. Background Technology

[0002] Systemic lupus erythematosus (SLE) is one of the most common autoimmune diseases. It is a complex disease caused by multiple factors, including genetics, environment, and immunity. Clinical manifestations include the production of various autoantibodies and the deposition of immune complexes affecting multiple organs (skin, kidneys, lungs, heart, and brain), leading to a series of complications and, in severe cases, death. Its pathogenesis remains incompletely understood, and treatment options are limited and incurable. Childhood systemic lupus erythematosus (cSLE), compared to other types of SLE, presents challenges such as limited diagnostic techniques, rapid onset, and severe consequences. Therefore, exploring effective early diagnostic methods for both SLE and cSLE has been a key focus and challenge in basic immunology and rheumatology.

[0003] Current methods for diagnosing SLE rely on antibody testing, such as anti-double-stranded DNA (dsDNA), antinuclear antibodies (ANA), and anti-Sm antibodies. However, the positive rate of antibodies in pediatric patients is low, and the sensitivity and specificity may be insufficient. Renal biopsy is the gold standard for assessing lupus nephritis, but it carries certain risks, including bleeding and infection, resulting in low acceptance and making it difficult to use for early diagnosis in pediatric patients.

[0004] Genetic testing and high-throughput sequencing technologies, such as whole-exome sequencing, epigenome sequencing, and metabolome sequencing, can efficiently and comprehensively analyze genomic polymorphisms. However, they are costly and have low adoption rates in primary hospitals, making them difficult to use directly for large-scale clinical screening and affecting the early diagnosis of pediatric patients. Furthermore, SNP screening methods have limitations in verifying disease associations; therefore, there is an urgent need for more sensitive, accurate, and direct targeted biomarkers. Summary of the Invention

[0005] The purpose of this invention is to discover SNP markers that can be targeted to identify systemic lupus erythematosus (SLE) in children, thereby providing more targeted examination sites for the identification, detection, and gene assessment of SLE in children, improving the detection rate and diagnostic accuracy of the disease, and shortening the identification time and cost.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides an application of an SNP marker in one of the following ways, wherein the SNP marker is RS25671007, located at the 734th base pair of the PABPC3 gene:

[0008] 1) Application in the preparation of products for targeted identification of systemic lupus erythematosus in children;

[0009] 2) Application in the preparation of products for targeted screening of systemic lupus erythematosus in children;

[0010] 3) Application in the preparation of products for detecting gene mutations or amino acid mutations associated with systemic lupus erythematosus in children.

[0011] Furthermore, the PABPC3 gene has a mutation from C to T at base pair 734, or the amino acid encoded by base pair 734 has a mutation from threonine to isoleucine.

[0012] Preferably, the product further includes a reagent for detecting the SNP marker.

[0013] More preferably, the reagent for detecting the SNP marker is a set of primers, the set of primers including primer pair one and primer pair two, primer pair one having primers as shown in SEQ ID NO.7 and SEQ ID NO.8, and primer pair two having primers as shown in SEQ ID NO.9 and SEQ ID NO.10.

[0014] Secondly, the present invention provides primers for detecting an SNP marker, the SNP marker being RS25671007, located at base pair 734 of the PABPC3 gene, the primers comprising primer pair one and primer pair two, the primer pair one having primers as shown in SEQ ID NO.7 and SEQ ID NO.8, and the primer pair two having primers as shown in SEQ ID NO.9 and SEQ ID NO.10.

[0015] Furthermore, the PABPC3 gene has a mutation from C to T at base pair 734, or the amino acid encoded by base pair 734 has a mutation from threonine to isoleucine.

[0016] Thirdly, the present invention provides any of the following applications of the primers described in the second aspect:

[0017] (1) To prepare products for targeted identification of systemic lupus erythematosus in children;

[0018] (2) To develop products for targeted screening of systemic lupus erythematosus in children;

[0019] (3) Prepare products for detecting gene mutations or amino acid mutations associated with systemic lupus erythematosus in children.

[0020] Fourthly, the present invention provides a method for non-diagnostic or non-therapeutic targeted identification of systemic lupus erythematosus in children, the method comprising:

[0021] Step 1: Extract DNA from the sample to be tested;

[0022] Step 2: Using the primers described in claim 5 or 6, and with the whole genome DNA of the sample to be tested as a template, perform PCR amplification of the 734th base pair of the PABPC3 gene;

[0023] Step 3: Obtain the identification conclusion based on the amplification results.

[0024] Fifthly, the present invention provides a method for non-diagnostic or non-therapeutic targeted detection of systemic lupus erythematosus in children, the method comprising:

[0025] Step 1: Extract DNA from the sample to be tested;

[0026] Step 2: Using the primers described in claim 5 or 6, and with the genomic DNA of the sample to be tested as a template, perform PCR amplification of the 734th base pair of the PABPC3 gene;

[0027] Step 3: Obtain the detection conclusion based on the amplification results.

[0028] In a sixth aspect, the present invention provides a method for detecting gene mutations or amino acid mutations associated with systemic lupus erythematosus in children without diagnostic or therapeutic purposes, the method comprising:

[0029] Step 1: Extract DNA from the sample to be tested;

[0030] Step 2: Using the primers described in claim 5 or 6, and with the genomic DNA of the sample to be tested as a template, perform PCR amplification of the 734th base pair of the PABPC3 gene;

[0031] Step 3: Based on the amplification results, obtain the conclusion of PABPC3 gene mutation or encoded amino acid mutation.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0033] This invention identifies a novel SNP (RS25671007) in children with systemic lupus erythematosus (cSLE) using whole-exome sequencing. This site is located at base pair 734 of the PABPC3 gene and contains a C-to-T mutation, or a mutation encoding an amino acid from threonine to isoleucine. Although not all cSLE patients have this mutation, this invention allows for rapid identification and screening of cSLE patients with this mutation. Furthermore, this invention demonstrates through in vitro cell model experiments that this SNP significantly upregulates antibody class switching function, and can be used as a reference marker for early targeted diagnosis, detection, gene assessment, risk stratification, or medication guidance in children with cSLE. Attached Figure Description

[0034] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings:

[0035] Figure 1 This document describes the whole-exome sequencing analysis of mutated genes in cSLE patients in Example 1 of this invention. A represents the number and type of mutations compared in the bioinformatics analysis; B represents the chromosomal information of the mutation sites compared in the bioinformatics analysis; C represents the mutation type compared in the bioinformatics analysis; D represents the gene location information of the mutation sites compared in the bioinformatics analysis; E represents the annotation of mutated genes detected in the whole-exome sequencing analysis in the ClinVar database; F represents the genes associated with important SNPs or INDELs identified using the NIH-related mutant database; G represents the functional annotation of the proteins encoded by the screened mutated genes; H represents the interaction analysis and GO pathway enrichment analysis of the proteins encoded by the screened mutated genes. I represents the mutation site on the PABPC3 gene.

[0036] Figure 2 This is for the verification of mutated gene sites in cSLE patients in Example 1 of the present invention; wherein, A is a schematic diagram of Sanger sequencing results of three patients and their parents; B is a schematic diagram of the patient's genetic map; C is a schematic diagram of risk gene mutation sites; and D is information on species evolution conservation.

[0037] Figure 3 This is a diagram illustrating the construction and functional verification of site-directed mutant cell lines in Example 1 of the present invention; wherein, A is a schematic diagram of CRISPR Cas9; B is a diagram of sg sequence, donor sequence, and plasmid digestion and recombination transformation; C is a diagram of double-positive cell screening and monoclonal cells; D is a Sanger sequencing of mutant cell lines; E is a flow cytometry diagram illustrating the production of IgA antibodies by site-directed mutant cell lines and normal unmutated cell lines; F is a statistical diagram illustrating the ratio of IgA antibody production by mutant cell lines and normal cell lines. Detailed Implementation

[0038] In the description of this invention, "targeted identification" is to make a definitive diagnosis for individuals who have developed SLE-related symptoms or signs; "targeted screening" is to identify individuals with SLE or at high risk of SLE in healthy or asymptomatic populations; and "detection" is to be carried out using different strategies and technologies based on different SLE-related purposes, such as diagnosis, screening, and monitoring.

[0039] In the description of this invention, it should be noted that unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0040] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0041] Example 1

[0042] Since the etiology of cSLE is not fully understood, previous literature has reported the presence of many unknown pathogenic SNPs in patients. This embodiment performed whole-exome sequencing on blood samples from healthy children and cSLE patients, and integrated and analyzed the sequencing data to ultimately identify pathogenic SNPs closely associated with cSLE. The specific process is as follows:

[0043] 1. Sample grouping and sequencing strategy

[0044] Blood samples from 5 healthy children and 5 cSLE patients were collected from the Department of Rheumatology and Immunology, Capital Institute of Pediatrics, for whole-exome sequencing. Novel mutation sites were identified by comparing the data with the human genome dbSNP database. Preliminary results obtained so far are as follows:

[0045] (1) Through alignment with genomic DNA analysis, a total of 210,000 SNPs and 27,000 INDEL sites were identified, with relatively high frequencies on chromosomes 16, 17, 19, and 22. Figure 1 (A, B). Among these mutation sites, a large proportion are located in introns, causing approximately 61,000 SNPs or INDELs that lead to mistranslation. Figure 1 (C, D)

[0046] (2) Further annotation of all variants using the ClinVar clinical database revealed that approximately 38,000 variants were clinically annotated, representing 16.1% of the total variants. Figure 1 (Among them, there are 35,100 SNPs).

[0047] (3) The next step is to use the latest version of the clinical medical mutant database provided by the NIH for annotation, and to screen for potentially important SNPs or INDELs. Through step-by-step filtering, 9217 SNPs were found to be supported by clinical data. After removing those labeled "benign" or "uncertain," 403 SNPs remained. Figure 1 (F). After removing synonymous mutations, 337 SNPs were identified, associated with 256 genes. Functional annotation of these genes revealed that their functions are concentrated in processes such as antigen processing and presentation. Figure 1 (G).

[0048] (4) Interaction analysis was performed on the proteins encoded by the genes screened in (3). The results showed that the functions of these proteins are mainly concentrated in ion transport channels. Figure 1 (H).

[0049] 2. Sequencing data integration and analysis

[0050] Based on the above WES sequencing data, candidate genes were screened from variants in the database that were not yet annotated. Simultaneously, genes with high mutation frequencies and limited domestic and international research potential were also screened. In this example, the PABPC3 gene on chromosome 13 of one cSLE patient was identified. The mutation sites on this gene that have been studied are as follows... Figure 1 As shown in Figure I. In addition, this embodiment also incidentally discovered that the 734th base pair (RS25671007) of the PABPC3 gene in this patient sample was mutated from C to T, that is, the amino acid changed from threonine to isoleucine (PABPC3:chr:13:g.NC_000013.11:25671007C>T). Further analysis of the genetic information of the parents revealed that neither parent had any base pair mutations. Figure 2 (A, B). Therefore, this embodiment pinpointed the mutation location of the gene, and subsequently analyzed its genetic conservation. The results showed that it is conserved across different species. Figure 2 (C, D)

[0051] 3. Multi-dimensional screening strategy (functional prediction, experimental verification)

[0052] This embodiment further utilizes Cas9 technology to construct a site-directed mutant cell line at the RS25671007 site, where the C mutation is converted to the T mutation, to verify the function of this site, as detailed below:

[0053] (1) Constructing site-directed mutagenesis cell lines, the flowchart is as follows: Figure 3 As shown in A, the details are as follows:

[0054] (1.1) Plasmid construction

[0055] (1.1.1) Construction of pX330-gRNA-Cas9 plasmid

[0056] a. Guide oligo annealing reaction system: 1 μl 100 μM guide F (sense, as shown in Table 1: guide RNA1-sense, guide RNA2-sense), 1 μl 100 μM guide R (antisense, as shown in Table 1: guide RNA1-antisense, guide RNA2-antisense), 1 μl 10×T4 DNA ligation buffer, 0.5 μl T4 PNK, 6.5 μl H2O, totaling 10 μl. The system was reacted in a PCR instrument according to the following program: 37℃ for 30 min, 95℃ for 5 min, cooling to 25℃ at a rate of 0.1℃ per second, and 25℃ for 1 h. Guide RNA primers are shown in Table 1.

[0057] b. Ligation into the vector: After the reaction is completed, the product is diluted at a ratio of 1:50 and ligated into the vector according to the following ligation system: 50 ng of pX330 plasmid digested with BBSI, 1 μl of diluted guide oligo, 1 μl of 10×T4 DNA ligation buffer, 1 μl of T4 DNA ligase, 6.3 μl of H2O, and a total of 10 μl of the system is incubated in a PCR instrument at 22℃ for 30 min.

[0058] (1.1.2) Constructing the pEGFP-N1 donor plasmid

[0059] Ligation reaction system: 5 μl 2×ClonExpress Mix, 94 ng NotI digested pEGFP-N1 plasmid (94 ng is calculated according to the formula given in the kit), 62 ng ligation fragment, add water to the total volume of 10 μl, and incubate in a PCR instrument at 50℃ for 20 min. Primers are shown in Table 2 as donor-sense and donor-antisense. (The mass ratio of plasmid to fragment should be 1:3-1:10 as much as possible).

[0060] Table 1 Primers for plasmid construction

[0061]

[0062] (1.1.3) Point mutations on the donor plasmid

[0063] a. Target plasmid amplification: The target plasmid was amplified using Phanta Max Super-Fidelity DNA Polymerase. Primers 1 and 2 correspond to guide RNA1 and guide RNA2 in Table 1. After thawing and thoroughly mixing each reaction group, the reaction system is shown in Table 2 below:

[0064] Table 2 Target plasmid amplification system

[0065]

[0066] The PCR reaction conditions are shown in Table 3 below:

[0067] Table 3 PCR Procedure for Target Plasmid Amplification

[0068]

[0069] After the reaction, a small amount of the amplification product was taken for agarose gel electrophoresis to check whether the target plasmid was correctly amplified.

[0070] b. Dpn I digestion of amplified products: Because the amplified products contain the original template plasmid, to prevent the formation of false positive transformants after transformation, Dpn I digestion must be performed before recombination cyclization to remove the methylated template plasmid. The reaction system is shown in Table 4 below. After gently aspirating and mixing, briefly centrifuge to collect the residue at the bottom of the tube, and incubate at 37℃ for 1-2 hours.

[0071] c. Recombination reaction: Prepare the reaction system shown in Table 4 on ice. Gently pipette and mix (do not shake), then briefly centrifuge to collect the reaction solution at the bottom of the tube. Incubate at 37°C for 30 min; then cool to 4°C or immediately on ice.

[0072] Table 4 Recombination Reaction System

[0073]

[0074] (1.1.4) Transformation of recombinant products

[0075] a. Thaw and clone DH5a competent cells on ice.

[0076] b. Add 10 μL of the recombinant product to 100 μL of competent cells, gently tap the tube wall to mix (do not shake to mix), and let stand on ice for 30 min.

[0077] c. After heat shock in a 42℃ water bath for 45 seconds, immediately place on ice to cool for 2-3 minutes.

[0078] d. Add 900 μL of LB liquid medium (without antibiotics) and incubate at 37°C for 1 hour (200-250 rpm).

[0079] e. Preheat the LB solid medium plates with the corresponding resistance in an incubator at 37°C.

[0080] Centrifuge at 5,000 rpm (2400 x g) for 5 min and discard 900 μL of supernatant. Resuspend the bacteria in the remaining culture medium and gently spread it evenly on a plate containing the correct antibiotic using a sterile spreader.

[0081] Incubate g in an incubator at 37℃ with the inverted incubator for 12-16 hours.

[0082] (1.1.5) Identification of recombinant products

[0083] After overnight culture, the number of clones on the recombinant reaction transformation plate was significantly higher than that of the negative control. Several single clones were picked and inoculated into LB liquid medium containing appropriate antibiotics and cultured overnight. Plasmids were then extracted for first-generation sequencing.

[0084] (1.1.6) Plasmid extraction and purification

[0085] a. Take 100-300 mL of overnight cultured bacterial solution, add it to a centrifuge tube, and centrifuge at 12000xg for 2-3 minutes to collect the bacteria.

[0086] b. Add 12 mL of Buffer P1 (with RNase A added) to the centrifuge tube containing the bacterial pellet, and mix thoroughly with a pipette or vortex mixer to suspend the bacterial pellet.

[0087] c. Add 12 mL of Bufer P2 to the centrifuge tube, gently invert and mix 8-10 times to fully lyse the bacteria, and let stand at room temperature for 3-5 minutes.

[0088] d. Add 12 mL of Buffer E3 to the centrifuge tube and immediately invert to mix 8-10 times. A white flocculent precipitate will appear. Let it stand at room temperature for 5 minutes. Pour the entire solution into an endotoxin-free filter and slowly push the push handle to filter. Collect the filtrate in a clean 50 mL centrifuge tube.

[0089] e. Add 0.3 times the volume of isopropanol to the filtrate and mix by inverting the container.

[0090] f. Connect the negative pressure device correctly. After connecting the connecting tube to the DNA adsorption column, insert it into the socket of the negative pressure device.

[0091] g. Column equilibration: Add 2 mL of Buffer Ps to the DNA adsorption column. Turn on and adjust the negative pressure to -300 to -700 mbar, then remove the solution from the column.

[0092] h. Transfer the mixture of filtrate and isopropanol from step e to an equilibrated adsorption column and remove the solution from the column.

[0093] i. Add 10 mL of Buffer PW to the DNA adsorption column and aspirate the solution on the column.

[0094] j. Maintain negative pressure suction for 10 minutes to remove residual rinsing solution from the adsorption membrane and dry the membrane. If suctioning more than 6 samples at a time, the negative pressure suction time can be appropriately extended. Turn off the negative pressure switch after the adsorption membrane is dry.

[0095] k. When the pressure is restored to 0 mbar, remove the adsorption column and place the DNA adsorption column in a new 50 mL centrifuge tube. Add 1-3 mL of Endo-Free Bufer EB to the center of the adsorption membrane, incubate at room temperature for 2-5 minutes, centrifuge at 12000x for 5 minutes, and collect the plasmid solution into the centrifuge tube. Store the plasmid at -20℃.

[0096] (1.1.7) Plasmid electroporation of CH12F3 cell line

[0097] Take approximately 3-5 million CH12F3 cells (a commercially available cell line capable of specifically producing IgA through antibody class conversion, 10 mL) and centrifuge at 1500 rpm for 5 min. Discard the supernatant, resuspend the cells twice with sterile PBS, and then resuspend them in the cell pellet using buffer R from the electroporation kit. Aliquot the cells into three 1.5 mL centrifuge tubes, adding 10-20 μg of pX330-gRNA-Cas9 plasmid and pEGFP-N1 donor plasmid to each tube and mixing well. Place an electroporation tube in the electroporation apparatus and add 3 mL of electroporation buffer to the tube. Attach the electroporation tip to the electroporator, aspirate 100 μL of the electroporation mixture, and place it in the electroporation tube. Stimulate the cells with 1700 V, 20 ms, and 1 pulse to induce plasmid entry into the CH12F3 cells. Incubate the electroporated cells in an incubator.

[0098] In summary, this embodiment utilizes Cas9 technology to construct site-directed mutant cell lines. Through transfection and selection, cell lines with mutations at the corresponding sites of the PABPC3 gene were obtained. The corresponding sg sequence, donor sequence, and schematic diagram of plasmid digestion, recombination, and transformation are shown below. Figure 3 As shown in Figure B, the results of double-positive screening of the labeled cells are as follows. Figure 3 As shown in Figure C, the cells were amplified in large quantities, followed by Sanger sequencing to screen for the ideal mutant cell lines with the corresponding C-to-T mutation. Figure 3 (D).

[0099] (2) Functional validation at the cell line level

[0100] Subsequently, flow cytometry was used to verify the antibody class switching function of this mutant cell line. The results showed that, compared with the normal mouse B lymphocyte CH12F3 cell line, the proportion of IgA produced by this mutant cell line was significantly increased. Figure 3 The presence of E and F in the middle indicates that the immune response is stronger after the gene mutation.

[0101] The above studies confirm that the RS25671007 site and mutation can be used as a reference marker for early targeted diagnosis, detection, gene assessment, risk stratification, or medication guidance in children with systemic lupus erythematosus who have mutations at this site.

[0102] Example 2

[0103] After verifying that site-directed mutations in this gene affect the proportion of SLE antibodies, this embodiment designs specific primers for the SNP mutation site at the 734th base pair (RS25671007) and provides a targeted typing kit for detecting this SNP mutation site, thereby assisting in the identification / detection of SLE in children.

[0104] This kit includes specific primers, selected from the following primer pairs.

[0105] The first set of primer sequences is as follows:

[0106] Forward primer 1: ATGATCGATGAAAGTGGAAAATCCAAAGGATT (SEQ ID NO.7); upstream, GC content: 34.4%, Tm: 65;

[0107] Reverse primer 1: CTGGTTGGGCACAGCTCGTA (SEQ ID NO.8); downstream, GC content: 60%, Tm: 62;

[0108] Forward primer 2: TCCTGTAACGGAAAGGTCGC (SEQ ID NO.9); upstream, GC content: 55%, Tm: 60;

[0109] Reverse primer 2: CCACTTTCATCGATCATTACTTTCA (SEQ ID NO.10); downstream, GC content: 40%, Tm: 59.4;

[0110] The second set of primer sequences is as follows:

[0111] Forward primer 1': ATGATCGATGAAAGTGGAAAATCCAAAGGATT (SEQ ID NO.7); upstream, GC content: 34.4%, Tm: 65;

[0112] Reverse primer 1': CTGGTTGGGCACAGCTCGTA (SEQ ID NO.8); downstream, GC content: 60%, Tm: 62;

[0113] Forward primer 2': CACGAAGCAGCTGAAAGAGC (SEQ ID NO.11); upstream, GC content: 55%, Tm: 60;

[0114] Reverse primer 2': CCACTTTCATCGATCATTACTTTCA (SEQ ID NO.10); downstream, GC content: 40%, Tm: 59.4;

[0115] The third set of primer sequences is as follows:

[0116] Forward primer 1”: ATGATCGATGAAAGTGGAAAATCCAAAGGATT (SEQ ID NO.7); upstream, GC content: 34.4%, Tm: 65;

[0117] Reverse primer 1”: GAAGGAGGTGCTCGCTGGTT; (SEQ ID NO.12); downstream, GC content: 60%, Tm: 62;

[0118] Forward primer 2”: TCCTGTAACGGAAAGGTCGC (SEQ ID NO.9); upstream, GC content: 55%, Tm: 60;

[0119] Reverse primer 2”: CCACTTTCATCGATCATTACTTTCA (SEQ ID NO.10); downstream, GC content: 40%, Tm: 59.4;

[0120] The fourth set of primer sequences is as follows:

[0121] Forward primer 1”': ATGATCGATGAAAGTGGAAAATCCAAAGGATT (SEQ ID NO.7); upstream, GC content: 34.4%, Tm: 65;

[0122] Reverse primer 1”': GAAGGAGGTGCTCGCTGGTT; (SEQ ID NO.12); downstream, GC content: 60%, Tm: 62;

[0123] Forward primer 2”': CACGAAGCAGCTGAAAGAGC (SEQ ID NO.11); upstream, GC content: 55%, Tm: 60;

[0124] Reverse primer 2”': CCACTTTCATCGATCATTACTTTCA (SEQ ID NO.10); downstream, GC content: 40%, Tm: 59.4;

[0125] It also includes the reaction system: DNA template and thermostable DNA polymerase.

[0126] The DNA amplification reaction mixture system is shown in Table 5:

[0127] Table 5 PCR reaction system

[0128]

[0129] The reaction conditions are shown in Table 6:

[0130] Table 6 Reaction conditions

[0131]

[0132] Reagent kit performance characterization:

[0133] Four sets of candidate primer sequences were diluted according to the required concentrations for the reaction system. Forward primer 1 and reverse primer 1 were used as one set, and forward primer 2 and reverse primer 2 were used as another set. These were validated in the same sample, which consisted of a cSLE child with an RS25671007 mutation and a healthy individual sample from Example 1. The other sets were the same. Each sample was replicated in triplicate. A blank control group (sterile, enzyme-free water) and a negative control (healthy individual sample) were also included. PCR amplification was performed on the PABPC3 point mutation-positive cSLE sample according to the above reaction system and conditions, followed by agarose gel electrophoresis. If no bands were observed in either the forward or reverse primer set, the sample was considered negative. If a band was observed in either the forward or reverse primer set, the sample might be a false positive. If both the forward and reverse primer sets showed bands, the sample was considered positive.

[0134] The experimental results are as follows: all four sets of candidate primer sequences can indicate PABPC3 mutations and validate cSLE samples. After screening, the first set of primer sequences, namely SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, showed the best performance, with clear and bright agarose gel electrophoresis bands without tailing, and no false positives were observed in the validated samples. Both pairs of primers in the second and third sets showed one unclear band in negative samples, indicating that the primer design may lead to a false positive risk in negative samples. The two pairs of primers in the fourth set were judged to have no false positives, but the bands were not clear enough and showed tailing. Since all four sets of primer sequences were validated using the same batch of samples, the second, third, and fourth sets of primer sequences could be excluded based on the false positive risk and the clarity of the bands. In other words, among the four sets of primer sequences, only the two pairs of sequences in the first set can accurately and quickly identify cSLE positive samples without being affected by the risk of false positives.

[0135] Example 3

[0136] This embodiment combines the research results of Embodiments 1 and 2, and further uses the 734th base pair of the PABPC3 gene as an SNP marker for clinical detection of cSLE, as detailed below:

[0137] 1. Clinical sample testing

[0138] Peripheral blood samples were randomly collected from 10 children diagnosed with cSLE and 10 healthy children from the Capital Institute of Pediatrics Affiliated Hospital. DNA was extracted from the samples, and the PABPC3 mutation status in these samples was detected by PCR amplification and agarose gel electrophoresis using the kit obtained in Example 2. The mutation was also verified by gene sequencing.

[0139] The test results are shown in Table 7 below. Of the 10 cSLE positive samples, 4 were PABPC3 mutation positive samples, and all 10 healthy samples were negative. Furthermore, the detection rate of this kit was 100% in disease samples with PABPC3 point mutations. The electrophoresis result was defined as positive for PABPC3 mutation as follows: both sets of PCR primers showing positive bands was considered positive; neither set of PCR primers showing positive bands was considered negative.

[0140] This test kit takes only 3 hours from sampling to diagnosis, compared to 1-2 days for traditional comprehensive testing methods such as blood routine, urine routine, and biopsy. This significantly shortens the time, which is beneficial for accurate and timely medical diagnosis and indicates whether the patient is at risk of lupus.

[0141] Table 7 Clinical Sample Testing Results

[0142]

[0143]

[0144] The results in Table 7 show that the SNP biomarker of the present invention has a 100% detection accuracy in cSLE patients with a mutation at the 734th base pair of the PABPC3 gene, and can also accurately and quickly detect samples that may have false negatives (low levels of anti-dsDNA antibodies), such as cSLE sample 4. Furthermore, whether or not SLE symptoms are present will not affect the final identification, screening, or detection of SLE.

[0145] 2. Typical cSLE Cases

[0146] Typical cSLE patient case 1:

[0147] Gender: Female, Age: 12 years old.

[0148] Hospitalization status: Antinuclear antibody: negative; Lupus anticoagulant (LA) test: both normal; IgG and IgA: elevated; total IgE concentration: 967 kDa / L; T and B lymphocyte subsets: no obvious abnormalities. During the diagnostic process, classic lupus markers were negative, LA test was normal, and immune cell classification was normal. Further diagnosis requires auxiliary medical indicators such as lupus skin and kidney markers, along with multiple blood routine tests.

[0149] This patient had low levels of classic lupus markers and normal immune cells, requiring further medical evaluation of the condition using multiple indicators. Using this kit, DNA was extracted from the patient's blood sample, followed by PCR amplification and agarose gel electrophoresis. The PABPC3 gene mutation was detected approximately 3 hours later, directly confirming SLE.

[0150] cSLE patient case 2:

[0151] Gender: Female, Age: 5 years old.

[0152] Hospitalization status: Cytokine panel (12 tests): IFN-γ 85.75 pg / ml; ANA 1:1000 (granular type); nRNP 2 + SSA2 +dsDNA 280.42 IU / mL; urine IgG 1.04 mg / dL; complete blood count: white blood cell count 3.72 x 10⁹ / L ↓, lymphocyte count 1.46 x 10⁹ / L ↓, hemoglobin 112 g / L, platelet count 229 x 10⁹ / L; serum 6 items: total serum IgE 244 IU / mL ↑; humoral immunity (A+M+G); immunoglobulin IgG 15.5 g / L ↑, immunoglobulin IgA 2.91 g / L↑, Immunoglobulin IgM 0.53 g / L↓; Fine immunophenotyping of lymphocytes: Absolute T lymphocyte count 861.89 / uL↓, absolute number of helper / inducing T lymphocytes 298.09 / uL↓, absolute number of suppressor / cytotoxic T lymphocytes 432.25 / uL↓, absolute number of lymphocytes 1589.1 / uL↓, absolute number of suppressor / cytotoxic exhausted T cells 6.05 / L↓, absolute number of suppressor / cytotoxic effector memory T cells 3.03 / uL↓, absolute number of helper / inducing naive T cells 230.13 / uL↓, absolute number of helper / inducing central memory T cells 58.13 / uL↓, absolute number of helper / inducing effector memory T cells 6.86 / uL↓, absolute number of memory B cells 98.39 / uL↑. Lupus anticoagulant (LA) test: 1.24↑.

[0153] This patient had elevated levels of classic lupus markers, but a low proportion of most related immune cells, requiring a combination of medical indicators to assess the condition. Using this kit, DNA was extracted from the patient's blood sample, amplified by PCR, and subjected to agarose gel electrophoresis. The PABPC3 gene mutation was detected approximately 3 hours later, allowing for a direct diagnosis of SLE.

[0154] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents. The embodiments described above merely illustrate several implementations of the invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be understood that those skilled in the art can make several modifications and improvements without departing from the concept of the invention, and these all fall within the protection scope of the invention. Therefore, the protection scope of this patent should be determined by the appended claims.

Claims

1. The application of an SNP marker, wherein the SNP marker is RS25671007, located at base pair 734 of the PABPC3 gene: 1) Application in the preparation of products for targeted identification of systemic lupus erythematosus in children; 2) Application in the preparation of products for targeted screening of systemic lupus erythematosus in children; 3) Application in the preparation of products for detecting gene mutations or amino acid mutations associated with systemic lupus erythematosus in children.

2. The application according to claim 1, characterized in that, The PABPC3 gene has a mutation from C to T at base pair 734, or the amino acid encoded by base pair 734 has a mutation from threonine to isoleucine.

3. The application according to claim 1 or 2, characterized in that, The product also includes reagents for detecting the SNP markers.

4. The application according to claim 3, characterized in that, The reagent used to detect the SNP marker is a set of primers, the set of primers including primer pair one and primer pair two, primer pair one having primers as shown in SEQ ID NO.7 and SEQ ID NO.8, and primer pair two having primers as shown in SEQ ID NO.9 and SEQ ID NO.

10.

5. Primers for detecting an SNP marker, characterized in that, The SNP marker is RS25671007, located at base pair 734 of the PABPC3 gene. The primers include primer pair one and primer pair two. Primer pair one has primers as shown in SEQ ID NO.7 and SEQ ID NO.8, and primer pair two has primers as shown in SEQ ID NO.9 and SEQ ID NO.

10.

6. The primer according to claim 5, characterized in that, The PABPC3 gene has a mutation from C to T at base pair 734, or the amino acid encoded by base pair 734 has a mutation from threonine to isoleucine.

7. Any of the following applications of the primers according to claim 5 or 6: (1) To prepare products for targeted identification of systemic lupus erythematosus in children; (2) To develop products for targeted screening of systemic lupus erythematosus in children; (3) Prepare products for detecting gene mutations or amino acid mutations associated with systemic lupus erythematosus in children.

8. A method for non-diagnostic or non-therapeutic targeted identification of systemic lupus erythematosus in children, characterized in that, The method includes: Step 1: Extract DNA from the sample to be tested; Step 2: Using the primers described in claim 5 or 6, and with the whole genome DNA of the sample to be tested as a template, perform PCR amplification of the 734th base pair of the PABPC3 gene; Step 3: Obtain the identification conclusion based on the amplification results.

9. A method for non-diagnostic or non-therapeutic targeted detection of systemic lupus erythematosus in children, characterized in that, The method includes: Step 1: Extract DNA from the sample to be tested; Step 2: Using the primers described in claim 5 or 6, and with the genomic DNA of the sample to be tested as a template, perform PCR amplification of the 734th base pair of the PABPC3 gene; Step 3: Obtain the detection conclusion based on the amplification results.

10. A method for detecting gene mutations or amino acid mutations associated with systemic lupus erythematosus in children, not for diagnostic or therapeutic purposes, characterized in that, The method includes: Step 1: Extract DNA from the sample to be tested; Step 2: Using the primers described in claim 5 or 6, and with the genomic DNA of the sample to be tested as a template, perform PCR amplification of the 734th base pair of the PABPC3 gene; Step 3: Based on the amplification results, obtain the conclusion of PABPC3 gene mutation or encoded amino acid mutation.

Citation Information

Cited By

  • Application of PABPC3 as target in diagnosis and treatment of systemic lupus erythematosus

    CN121896347A