Specific marker of exon region of hmcn2 gene of oplegnathus fasciatus, primer pair, detection method, kit and application

Abstract

The application belongs to the field of molecular biology, and particularly relates to a specific marker of an exon region of a Oplegnathus punctatus hmcn2 gene, a primer pair, a detection method, a kit and application. The specific marker of the exon region of the Oplegnathus punctatus hmcn2 gene is a nucleotide sequence of non-insertion and insertion specific markers of the exon region of the Oplegnathus punctatus hmcn2 gene DNA fragments, and the sequence is shown in bases of SEQ ID NO:1 and SEQ ID NO:2. The specific marker is applied to identification of female and male genetic sex of the Oplegnathus punctatus. The application establishes a method for realizing rapid genetic sex identification by rapidly detecting an exon DNA insertion variation of the Oplegnathus punctatus hmcn2 gene, and the method has a wide application prospect in the fields of sex identification of the Oplegnathus punctatus, preparation of high male seedlings and family selection breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to a specific marker, primer pair, detection method, kit, and application of the exon region of the hmcn2 gene of the spotted sea bream. Background Technology

[0002] Spotted sea bream ( Oplegnathus punctatus Fish (X1X1X2X2 / X1X2Y) is a valuable aquaculture germplasm resource in my country's coastal waters, possessing excellent economic traits and genetic breeding value. Its unique X1X1X2X2 / X1X2Y sex determination system reflects a special genomic evolutionary history and is important material for studying sex chromosome differentiation in fish. Establishing genetic sex molecular markers can precisely monitor the genetic structure of aquaculture populations, prevent inbreeding depression and germplasm degradation, and support the construction of core populations and pedigree management. Marker-assisted sex control can effectively isolate conservation populations from production populations, ensuring genetic diversity and providing technical support for long-term genetic improvement and sustainable utilization of germplasm resources, which is of significant strategic importance to the revitalization of the aquaculture seed industry.

[0003] Hemicentin 2 (hmcn2), a member of the Fibulin family, is an extracellular matrix (ECM) protein with a characteristic C-terminal Fibulin module. Primarily produced by epithelial cells, the Hmcn2 gene mediates homocellular adhesion, maintains the stability of dermal-epidermal junctions and tendon-muscle connections, participates in synaptic tissue formation and ECM remodeling, and provides essential conditions for fibroblast ingrowth. Recent genome-wide RNAi screening revealed that the hmcn2 gene-encoded protein is a host factor essential for early HIV-1 replication; siRNA knockdown significantly inhibited viral replication in 293T and HeLa cells. Proteomics analysis showed that HMCN2 is involved in extracellular matrix remodeling associated with venous hypertension. As an important member of the Fibulin family, the Hmcn2 gene plays a crucial role in maintaining epithelial tissue integrity and embryonic development. Its genetic variations are closely related to susceptibility to various connective tissue-related diseases, making it one of the hot topics in current extracellular matrix biology and genetics research. To date, there have been no reports of genetic identification of male and female spotted sea bream based on exon DNA insertion variations in the hmcn2 gene. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies for detecting exon DNA insertion variations in the hmcn2 gene of spotted sea bream, and to provide specific markers, primer pairs, detection methods, kits and applications for the exon region of the hmcn2 gene of spotted sea bream.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A specific marker for insertion variation in the exon region of the spotted sea bream gene is a DNA fragment of the non-insertion and insertion-specific markers in the exon region of the spotted sea bream hmcn2 gene, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] A specific marker for detecting insertion variations in the exon region of the spotted sea bream gene is provided. The specific marker for detecting insertion variations in the exon region of the spotted sea bream gene is the nucleotide sequence of the non-insertion and insertion specific markers of the DNA fragment in the exon region of the spotted sea bream hmcn2 gene, and the sequence is the base shown in SEQ ID NO:1 and SEQ ID NO:2.

[0008] The specific marker for detecting insertion variation in the exon region of the spotted sea bream gene, wherein the nucleotide sequence of the non-insertion and insertion specific marker of the DNA fragment in the exon region of the spotted sea bream hmcn2 gene, shown in SEQ ID NO:1, is a homologous fragment in the exon region of the hmcn2 gene shared by both male and female spotted sea bream X1 chromosomes, in which no DNA insertion variation has occurred, and is a common DNA characteristic marker for non-insertion and insertion in the exon region of the spotted sea bream hmcn2 gene.

[0009] The application of a specific marker for detecting insertional variations in the exon region of the spotted sea bream gene, wherein the specific marker is used in detecting the genetic sex of the spotted sea bream.

[0010] A method for identifying insertional variations in the exon region of the spotted sea bream gene using the specific markers described above.

[0011] 1) PCR amplification: Take the spotted sea bream to be tested and extract genomic DNA; use the obtained genomic DNA as a template, use the specific primers for the exon region of the spotted sea bream hmcn2 gene to perform PCR amplification, and compare the obtained PCR amplification product with the non-insertion and insertion specific markers of the spotted sea bream hmcn2 gene exon region DNA fragment.

[0012] 2) Result Interpretation: Two DNA fragments, 252bp and 497bp, were amplified from the genomic DNA of the spotted sea bream to be tested. This indicates that the spotted sea bream to be tested is an individual with DNA fragment insertion variation in the exon region of the hmcn2 gene. The 252bp is the base shown in SEQ ID NO:1, and the 497bp is the base shown in SEQ ID NO:2.

[0013] 3) If only a single DNA fragment of 252 bp is amplified in the genomic DNA of the spotted sea bream to be tested, it can be determined that the spotted sea bream to be tested is an individual in which no DNA fragment insertion variation has occurred in the exon region of the spotted sea bream hmcn2 gene; 252 bp is the base shown in SEQ ID NO:1.

[0014] The specific primer in step 1) is:

[0015] Ch hmcn2 _F:1:5'-GACAGAATGATAAGGTGTGACTC-3';

[0016] Ch hmcn2 _R:2:5'-GGTTAACAGCTGGATGTCCGCCC-3'.

[0017] The spotted sea bream individuals that did not exhibit DNA fragment insertion mutations in the exon region of the hmcn2 gene of the spotted sea bream were females X1X1X2X2.

[0018] The spotted sea bream exhibited a DNA fragment insertion mutation in the exon region of the hmcn2 gene, and the individual was a male fish, X1X2Y.

[0019] A primer for a specific marker of exon region insertion variation in the *Scotyledon tomentosa* gene,

[0020] Ch hmcn2 _F:1:5'-GACAGAATGATAAGGTGTGACTC-3';

[0021] Ch hmcn2 _R:2:5'-GGTTAACAGCTGGATGTCCGCCC-3'.

[0022] A kit for identifying the genetic sex of spotted sea bream, the kit containing the aforementioned primers.

[0023] A kit for identifying the genetic sex of spotted sea bream, the kit containing the aforementioned primers.

[0024] Advantages of this invention:

[0025] This invention analyzes the whole genome sequence of the spotted rock seabream, comparing the hmcn2 gene on the Y fusion chromosome of male spotted rock seabream with the homologous gene on the X chromosome of female spotted rock seabream. It discovers a large sequence insertion in the exon of the hmcn2 gene on the Y chromosome, successfully screening and obtaining specific large-fragment DNA insertion marker sequences of homologous regions of the hmcn2 gene exons on both X and Y chromosomes. This is significant for understanding the differences in the stability and regulatory mechanisms of epithelial tissue connections between male and female spotted rock seabream. Based on this, a rapid detection method for genetic sex determination using DNA insertion variations in the hmcn2 gene exons of spotted rock seabream is established. This method not only simplifies the identification process of hmcn2 gene exon variations in spotted rock seabream but also shortens the identification time and improves detection efficiency. This method has broad application prospects in the fields of sex determination, preparation of high-male seedlings, and family selection in spotted rock seabream, thereby accelerating the genetic breeding process of spotted rock seabream and improving the efficiency of large-scale production of high-quality seedlings. It has significant economic and scientific value for promoting the development of spotted rock seabream aquaculture. Attached Figure Description

[0026] Figure 1 This is a nucleotide sequence alignment diagram of the Y chromosome hmcn2 gene exon region and the X1 chromosome hmcn2 gene exon region provided in this embodiment of the invention; the modules connected by the connecting lines in the diagram represent highly homologous regions of the hmcn2 gene exon region on the X and Y chromosomes, and the area framed in the middle is the target sequence ChrX1 of this invention. hmcn2 Location information on the X1 chromosome.

[0027] Figure 2 ChrX1 provided for embodiments of the present invention hmcn2 and Chry hmcn2 Specific location information on the X and Y chromosomes; 252bp represents ChrX1. hmcn2 The length of the fragment, 497bp represents Chrys. hmcn2 Length; Chry hmcn2 The middle low region represents the inserted 245bp nucleotide sequence, which is related to ChrX1. hmcn2 The fragment has no homologous matching sequence.

[0028] Figure 3 The X chromosome ChrX1 obtained as provided in the embodiments of the present invention hmcn2 ChrY with Y chromosome hmcn2 Nucleotide sequence alignment diagram, with primer positions at both ends indicated by double black underlines; *: represents ChrX1 hmcn2 and Chry hmcn2 Sequence consistency: blank areas indicate sequences with inconsistent bases; -------: represents insertion or deletion sequences; black single underline represents the region where the insertion sequence is located.

[0029] Figure 4 The X chromosome ChrX1 provided in the embodiments of the present invention hmcn2 ChrY with Y chromosome hmcn2 A schematic diagram of differentially inserted DNA fragments with homologous nucleotide sequences; black areas represent homologous regions, and blank areas represent deleted regions and site information.

[0030] Figure 5 The image shows the 1.5% agarose gel electrophoresis results of PCR products from male and female spotted sea bream provided in this embodiment of the invention. M: DL 2000 DNA Maker; ♂: physiological male fish; ♀: physiological female fish. Individuals showing two bands (497bp and 252bp) are individuals with DNA insertion in the exon of the hmcn2 gene, which are also genetically male fish, and are physiologically male based on histological identification. Individuals showing a single band (252bp) are individuals without DNA insertion in the exon of the hmcn2 gene, which are also genetically female fish, and are physiologically female based on histological identification. Detailed Implementation

[0031] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.

[0032] This invention utilizes the published genome information of the spotted sea bream (CNP0001488, Li et al., 2021) and, through genomic bioinformatics analysis, discovered a large DNA sequence insertion variation (e.g., ...) in the hmcn2 gene on the male Y chromosome compared to its homologous gene on the female X1 chromosome. Figure 1 and Figure 2 (As shown). This invention selects the 21,032,552bp~21,032,80bp region on the female X1 chromosome containing the hmcn2 gene, and the 49,877,796bp~49,878,292bp region on the male Y chromosome that is homologous to the hmcn2 gene and contains a DNA sequence insertion, as the research target regions. On the X1 chromosome, the DNA fragment is 252bp in length and is named ChrX1. hmcn2 Its sequence is shown in SEQ ID NO:1; while on the Y chromosome, the DNA fragment is 497 bp in length and contains a sequence homologous to the hmcn2 gene on the X1 chromosome, and is named ChrY. hmcn2 Its sequence is shown in SEQ ID NO:2. Through analysis of ChryY... hmcn2 With ChrX1 hmcn2 Alignment with homologous sequences revealed that it was related to ChrX1. hmcn2Three DNA sequence insertions and deletions were found between positions 103 and 116 (12 bp deletion), 151 and 155 (3 bp deletion), and 181 and 182 (260 bp insertion), with a total insertion and deletion size of 245 bp (e.g., ...). Figure 3 and Figure 4 (As shown). This inserted sequence serves as a DNA marker for detecting whether a base insertion variation has occurred in the exon of the hmcn2 gene of the spotted rock seabream; simultaneously, because this marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics, this fragment is also a DNA marker specific to the Y chromosome of male spotted rock seabream, while ChrX1 hmcn2 These are DNA markers shared by males and females of the spotted rock sea bream to indicate their genetic sex.

[0033] This invention utilizes a specific long DNA insertion sequence found in the exon region (49,877,796bp~49,878,292bp) of the hmcn2 gene on the Y chromosome of male spotted sea bream as a marker to detect whether DNA insertion variations have occurred in the hmcn2 gene exons. This discovery has led to a method for rapidly detecting hmcn2 gene exon variations in spotted sea bream, and further applied to the rapid identification of the genetic sex of spotted sea bream. Specifically, the detection method first confirms the presence of a Y chromosome-specific hmcn2 gene nucleotide fragment (497bp) in the spotted sea bream sample. This step achieves rapid identification by designing specific PCR primers. This invention, through comparative analysis of the hmcn2 gene sequence on the Y chromosome of spotted sea bream with homologous sequences on chromosomes X1 and X2, identifies the hmcn2 gene (ChrX1) on chromosome X1. hmcn2 Its sequence is as shown in SEQ ID NO:1) and the sequence on the Y chromosome homologous to the nucleotide sequence (ChrY). hmcn2 The sequence is shown in SEQ ID NO:2. Based on the characteristic of a large DNA insertion in this homologous exon region on the Y chromosome, we designed a pair of primers. Analysis of the PCR products by 1.5% agarose gel electrophoresis can quickly determine whether a DNA insertion mutation has occurred in the exon of the hmcn2 gene of the spotted rockfish. Furthermore, since this DNA insertion marker is located on the male Y chromosome and exhibits sex-linked inheritance characteristics, it is also suitable for accurately identifying the genetic sex of the spotted rockfish. The upstream and downstream primer sequences are as follows:

[0034] Ch hmcn2 _F:1:5'-GACAGAATGATAAGGTGTGACTC-3'(X hmcn2 ID No:2)(SEQ ID NO:3;

[0035] Ch hmcn2_R:2:5'-GGTTAACAGCTGGATGTCCGCCC-3'(X hmcn2 ID No:3 (SEQ ID NO:4).

[0036] The steps for identifying exon insertion variations in the hmcn2 gene of spotted rock seabream using the above primers mainly include: extracting high-quality whole-genome DNA from spotted rock seabream, amplifying the specific marker DNA fragment of the exon insertion on the hmcn2 gene on the Y chromosome, and detecting the PCR product DNA by agarose gel electrophoresis; among them, two DNA fragments of 497bp and 252bp were amplified in the Y chromosome and X1 chromosome of male spotted rock seabream (X1X2Y), respectively, and the 497bp fragment was a marker fragment specific to the hmcn2 gene of the variant exon; while in female spotted rock seabream (X1X1X2X2) individuals, only a single DNA fragment of 252bp was amplified.

[0037] This invention is based on whole-genome sequencing of male and female spotted sea bream and localization and DNA sequence alignment analysis of the hmcn2 gene in male and female individuals. It reveals a long-segment insertion mutation in the exon region of the hmcn2 gene on the Y chromosome of male spotted sea bream. This insertion mutation serves as a unique DNA marker for the insertion of the hmcn2 gene exon on the Y chromosome of spotted sea bream. This method allows for rapid sexing of spotted sea bream by utilizing the hmcn2 gene exon insertion mutation. It can quickly, accurately, and efficiently distinguish whether the tested spotted sea bream have undergone hmcn2 gene exon insertion mutations. In spotted sea bream individuals with hmcn2 gene exon mutations, two bands (497 bp and 252 bp) are amplified, with the 497 bp band being the specific target band. In individuals with non-mutated exons, only a single band (252 bp) is amplified. These target bands can be rapidly and accurately identified using agarose gel electrophoresis, enabling rapid identification of whether the hmcn2 gene exon of spotted sea bream has undergone mutations. Meanwhile, since this specific target band (497bp) is located on the male Y chromosome and has male-linked inheritance characteristics, this fragment is also a DNA marker unique to the Y chromosome of male spotted rockfish, and can be used for rapid identification of the genetic sex of male spotted rockfish.

[0038] Example 1: Screening and Validation of DNA Markers Specific to Exon Base Insertion Variations in the hmcn2 Gene of Spotted Rockfish

[0039] Discovery of homologous regions and large insertion target DNA sequences in the hmcn2 gene on the X and Y chromosomes of the spotted rock seabream: The DNA sequences from the male neo-Y chromosome and the female X1 chromosome were derived from published hmcn2 genome information (CNP0001488, Li et al., 2021). Comparative genomic bioinformatics analysis of the male and female hmcn2 genome sequences revealed that the hmcn2 gene on the male neo-Y chromosome is homologous to the hmcn2 gene on the female X1 chromosome, and contains a large insertion DNA fragment. The target DNA fragment of the hmcn2 gene on the X1 chromosome is 252 bp in length and is named ChrX1. hmcn2 Its sequence is SEQ ID NO:1:

[0040] GACAGAATGATAAGGTGTGACTCTTTGGTCCTGACTAAAGTAGAGAAGTCATTTTAGTCTGAGGGGAGCCAACAGGTTCTGATGATGGTTTTGGGTTGAGGAATGACCAAACTATTGAAGGACAGG AGCACAGGCTCAACCACAATGGGACTTTTTTTTTTTTTACTTGTGTGTGAACAGTGGAAGCACAGCAGCTCAGTTAGGTTCAGACCAAGCTTTGAGGTGGCGGGCGGACATCCAGCTGTTAACC.

[0041] The target DNA fragment of the hmcn2 homologous gene on the male fish's heterochromosome Y is 497 bp in length, and it contains a sequence homologous to X1, named ChrY. hmcn2 Its sequence is SEQ ID NO:2:

[0042] GACAGAATGATAAGGTGTGACTCTTCGGTCCTGACTAAAGTAGAAAAGTCATTTCAGTCTGAGGGGAGCCAACAGCATCTGATGATGGTTTTGGGTGGAGGAATGAAGGACAGGAGCACAAGCT CAACCACAATGGGACTTTTTTTTTTTACTTGGGTATGAACAGTCACAGGCAGTCCTGCAGTATGGGGGTGAACTTGGGACAACTGGGAGAAGTTGGAGACAAAGAGAACAATTTTTCTTTGTTG AGCTGAAGGGCCTGAAAAGATTAGGTTGGAAACTCAGGTCAGAGGCTTCTCATTAGTCCAGAACAGAGACTCCCAAGTGAGGAAGGATTTGATGCTCGCCTGCAGGAGTGGCAGGTTTGCTGTGC AGGATCTCACCATAATTGTTAACGCTGTGGGAAGAAACGAGGCAGGGTTTTCCGTGGAAGCACAGCAGCTTCTGTCGGGTTCAGACCAAGCTTTGAGGTGGCGGGCGGACATCCAGCTGTTAACC.

[0043] Whole genome scans of males and females, along with the localization and DNA sequence alignment of the hmcn2 gene in both individuals, showed that it is related to the ChrX gene segment of the hmcn2 gene located on chromosome X1. hmcn2 homologous Chry hmcn2 Three exon DNA sequence insertions occurred on the Y chromosome, corresponding to ChrX1. hmcn2 Between positions 103 and 116 (12bp deletion), 151 and 155 (3bp deletion), and 181 and 182 (260bp insertion), the size is 245bp. Figure 3 , Figure 4 The target region of the hmcn2 gene on the Y chromosome (ChrY). hmcn2 DNA sequence ratio with homologous DNA regions of chromosome X1 (ChrX1) hmcn2 A 245bp DNA sequence was inserted, which is a unique DNA marker for exon insertion mutations in the hmcn2 gene of the spotted rock seabream. Its presence or absence can be used to identify the ChrY species of spotted rock seabream. hmcn2 Whether the gene has undergone exon insertion variation. Furthermore, because this marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics, ChrY... hmcn2This fragment is also a DNA marker unique to the Y chromosome of male spotted rock snapper, and ChrX1 hmcn2 These are DNA markers shared by males and females of the spotted rock seabream, such as... Figure 3 As shown.

[0044] Sequence verification of DNA markers specific to exon insertion variants in the hmcn2 gene: Based on the nucleotide sequence characteristics of SEQ ID NO:2 of the hmcn2 gene on the Y chromosome and SEQ ID NO:1 of the homologous gene on the X1 chromosome, two primers were designed ( Figure 1 Selected female and male spotted rock seabream of known physiological sex and extracted high-quality DNA from them, while using Ch... hmcn2 _F:1、Ch hmcn2 PCR amplification was performed using two primers, _R:2. The reaction conditions and procedure are as follows: The PCR reaction system was 20 µL, including 5.8 µL of 10× Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), and upstream and downstream primers (Ch hmcn2 _F:1、Ch hmcn2 _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch-down PCR amplification program: 94℃ 3mins, 61.5℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 59℃ 30s, 72℃ 1min30s, 30 cycles; 72℃ 10min, 15℃ storage. PCR products were distinguished by 1.5% agarose gel electrophoresis, revealing differences between exon variants and non-variant hmcn2 gene individuals. The differentially expressed exon variant and non-variant hmcn2 gene fragments were recovered from the gel and transformed into competent cells using the PMD18-T vector. Positive clones were selected and sent to Qingdao Paisennuo Gene Biotechnology Co., Ltd. for sequencing. Sequencing results confirmed that the hmcn2 gene homologous to the X and Y chromosomes of the spotted sea bream contains a large inserted target DNA sequence fragment, such as... Figure 1 and Figure 2 As shown.

[0045] Example 2: Establishment and Application of Exon Insertion Variation Identification Technology for the HMCN2 Gene of Spotted Sea Bream

[0046] Genetic identification was conducted on spotted sea bream (12 of which were female and 12 were male) raised by Laizhou Mingbo Aquatic Products Co., Ltd. in Laizhou City, Yantai, Shandong Province.

[0047] High-quality DNA extraction: DNA was extracted from the fin rays of the spotted sea bream using the Tiangen Marine Animal DNA Extraction Kit. The integrity of the genomic DNA was identified by 1.0% agarose gel electrophoresis. The OD value of the DNA supernatant was measured using a UV spectrophotometer. The DNA concentration was adjusted to 70 ng / µL and stored at -20℃ for later use.

[0048] PCR reaction system and PCR amplification identification: Primers specific to the exon insertion variation of the hmcn2 gene of the spotted sea bream were used. hmcn2 _F:1 and Ch hmcn2 _R:2 The presence or absence of exon variations in the hmcn2 gene of the spotted sea bream was detected by PCR. The PCR reaction system was 20 µL, including 5.8 µL of 10× Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), and upstream and downstream primers (Ch... hmcn2 _F:1、Ch hmcn2 _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch-down PCR amplification program: 94℃ 3mins, 61.5℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 59℃ 30s, 72℃ 1min30s, 30 cycles; 72℃ 10min, 4℃ storage. Using 1.5% agarose gel electrophoresis at a constant voltage of 110V for 20 minutes, gel imaging clearly distinguished between individuals with inserted and non-inserted hmcn2 gene in the exon-forming part of the spotted rock seabream (see [link to relevant documentation]). Figure 5 ).

[0049] Depend on Figure 5 It is evident that two target bands (497bp and 252bp) are amplified in individuals of the spotted rock seabream with DNA insertion in the exon of the hmcn2 gene. Among them, the 497bp band is the ChrY band, which is a specific target band for DNA insertion variation in the exon of the hmcn2 gene. hmcn2 In individuals where no DNA insertion variants have occurred in the exons of the hmcn2 gene, only a single band of ChrX1 can be amplified. hmcn2 (252bp). Due to ChrY hmcn2 The marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics; therefore, ChrY... hmcn2 This fragment is also a DNA marker unique to the Y chromosome of male spotted rock snapper, and ChrX1 hmcn2This is a DNA feature marker shared by male and female spotted sea bream, which can be used to distinguish selected spotted sea bream. The method of this invention can not only quickly, accurately and efficiently identify whether the hmcn2 gene of the spotted sea bream to be tested has undergone gene exon insertion variation, but also has important significance and application value in the study of the differences in epithelial tissue connection and connective tissue regulation between male and female spotted sea bream based on the hmcn2 gene, as well as in sex identification, high-male seedling preparation and family selection.

[0050] As described above, this invention utilizes a pair of primers to amplify 497bp and 252bp bands in individuals with DNA insertion mutations, while only a 252bp band is amplified in individuals without insertion mutations. These bands can be distinguished by agarose gel electrophoresis, thus enabling rapid and accurate identification of DNA insertion mutations in the exons of the hmcn2 gene of the spotted rock seabream. The detection method of this invention significantly shortens the identification time, improves detection efficiency, and has important application value in sex determination, high-male seedling preparation, and family selection of spotted rock seabream.

Claims

1. A specific molecular marker for the genetic sex determination of spotted sea bream, characterized in that: The specific molecular markers are DNA fragments with nucleotide sequences as shown in SEQ ID NO:1 and DNA fragments with nucleotide sequences as shown in SEQ ID NO:

2.

2. The application of the specific molecular marker according to claim 1 in identifying the genetic sex of spotted sea bream, characterized in that: Specifically Genomic DNA was extracted from the spotted sea bream to be tested. Using the obtained genomic DNA as a template, PCR amplification was performed using primers. The nucleotide sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:

4. If only a single DNA fragment of 252 bp shown in SEQ ID NO:1 is amplified, the tested spotted sea bream is determined to be female; Amplifying the 252bp and 497bp bases shown in SEQ ID NO:1 and SEQ ID NO:2 indicates that the tested spotted sea bream is male.

3. A primer for detecting the specific molecular marker of claim 1, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:

4.

4. A kit for identifying the genetic sex of spotted sea bream, characterized in that: The kit contains the primers as described in claim 3.

5. A method for identifying the genetic sex of spotted sea bream using the specific molecular marker described in claim 1, characterized in that: Genomic DNA was extracted from the spotted sea bream to be tested. Using the obtained genomic DNA as a template, PCR amplification was performed using primers. The nucleotide sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:

4. If only a single DNA fragment of 252 bp shown in SEQ ID NO:1 is amplified, the tested spotted sea bream is determined to be female; Amplifying the 252bp and 497bp bases shown in SEQ ID NO:1 and SEQ ID NO:2 indicates that the tested spotted sea bream is male.

Images