Various antibodies that bind to human CD16 and / or human CD123 and uses thereof

Abstract

The present application provides a bispecific antibody comprising a first antigen binding region that binds to human CD16 and a second antigen binding region that binds to human CD123, a single domain antibody that binds to human CD16, a pharmaceutical composition comprising the bispecific antibody or the single domain antibody, an antibody-natural killer cell (NK cell) conjugate, and uses thereof.

Description

Invention Field

[0001] This invention generally relates to the fields of genetic engineering and antibody medicine; specifically, this application relates to bispecific antibodies binding to human CD16 and human CD123, single-domain antibodies binding to human CD16, and their uses. Background of the Invention

[0002] CD16, also known as FcγRIII, is a transmembrane protein primarily expressed on natural killer (NK) cells, mast cells, and macrophages. CD16 can recognize the Fc portion of IgG antibodies, mediating NK cell-mediated ADCC (antibody-dependent cell-mediated killing) of tumor cells. [1] NK cells are the third largest type of lymphocyte after T cells and B cells, and they play an important role in the body's immunity.

[0003] CD123, also known as the human interleukin-3 (IL-3) receptor α chain, belongs to the cytokine receptor superfamily. It has a molecular weight of approximately 40 kDa and is a type I transmembrane glycoprotein. The interleukin-3 receptor is a heterodimer formed by the α chain (CD123) and the β chain (CD131). After IL-3 binds to CD123, CD131 provides signal transduction, thereby regulating the function of hematopoietic cells and immune cells and stimulating endothelial cell proliferation. [2] .

[0004] CD123 is mainly expressed in bone marrow progenitor cells, plasmacytoid dendritic cells, monocytes, basophils, and a small subset of B cells. [3] Approximately 80% of acute myeloid leukemia (AML) patients overexpress CD123 in their problasts. Studies have shown that overexpression of the CD123 antigen corresponds to poor prognosis and lower remission rates in AML. [4] .

[0005] NK cells are the body's first line of defense against tumors. They have a broad-spectrum killing effect on tumor cells in tumor immunity. They do not depend on antigen stimulation and directly kill tumor cells and virus-infected target cells in a non-specific manner.

[0006] Bispecific antibodies (BsAbs) are a class of artificial antibodies containing two distinct antigen-binding sites. They bridge the gap between target cells and functional molecules (cells), stimulating targeted immune responses. They have become a research hotspot in antibody engineering and hold broad application prospects in the immunotherapy of diseases. Bispecific antibodies targeting tumor antigens and CD16 bind to NK cells via CD16 and to tumor cells via tumor antigens. This allows NK cells to target tumor antigen-positive tumor cells, activating them and enabling NK cells to kill tumor cells. [5] .

[0007] The development and application of novel antibodies binding to human CD16 and / or human CD123 are needed in this field. Therefore, given the broad applicability of anti-human CD16 and / or human CD123 antibodies, exploring and developing new anti-human CD16 and / or human CD123 antibodies based on clinical needs has significant biological and medical implications. Invention Overview

[0008] In a first aspect, this application provides a bispecific antibody comprising a first antigen-binding region for binding human CD16 and a second antigen-binding region for binding tumor cell surface antigens, wherein the first antigen-binding region for binding human CD16 comprises:

[0009] HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; or

[0010] HCDR1 as shown in SEQ ID NO:4, HCDR2 as shown in SEQ ID NO:5, and HCDR3 as shown in SEQ ID NO:6;

[0011] The amino acid sequence of HCDR is defined according to Kabat.

[0012] Secondly, this application provides a bispecific antibody comprising a first antigen-binding region that binds to human CD16 and a second antigen-binding region that binds to human CD123.

[0013] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 comprises:

[0014] HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; or

[0015] HCDR1 as shown in SEQ ID NO:4, HCDR2 as shown in SEQ ID NO:5, and HCDR3 as shown in SEQ ID NO:6;

[0016] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0017] In some embodiments of the second aspect, the second antigen-binding region binding to human CD123 comprises:

[0018] As shown in SEQ ID NO:7, HCDR1,

[0019] HCDR2, as shown in SEQ ID NO:8,

[0020] HCDR3, as shown in SEQ ID NO:9,

[0021] LCDR1, as shown in SEQ ID NO:10,

[0022] LCDR2 as shown in SEQ ID NO:11, and

[0023] LCDR3 as shown in SEQ ID NO:12;

[0024] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0025] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16 is in the form of a single-domain antibody.

[0026] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16-binding antibody comprises a monovalent or multivalent single-domain antibody that binds to human CD16.

[0027] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16 binding site comprises an amino acid sequence as shown in SEQ ID NO:13, 14 or 15.

[0028] In some embodiments of the second aspect, the second antigen-binding region binding to human CD123 is in Fab form or in the form of a single-chain antibody (scFv).

[0029] In some embodiments of the second aspect, the second antigen-binding region binding to human CD123 comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:16 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:17.

[0030] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 comprises the amino acid sequence shown in SEQ ID NO:13; and / or the second antigen-binding region binding to human CD123 comprises a heavy chain variable region with the amino acid sequence shown in SEQ ID NO:16 and a light chain variable region with the amino acid sequence shown in SEQ ID NO:17; or

[0031] The first antigen-binding region of the human CD16 binding site comprises the amino acid sequence shown in SEQ ID NO:14; and / or the second antigen-binding region of the human CD123 binding site comprises a heavy chain variable region with the amino acid sequence shown in SEQ ID NO:16 and a light chain variable region with the amino acid sequence shown in SEQ ID NO:17; or

[0032] The first antigen-binding region of the human CD16 binds to an amino acid sequence as shown in SEQ ID NO:15; and / or the second antigen-binding region of the human CD123 binds to a heavy chain variable region as shown in SEQ ID NO:16 and a light chain variable region as shown in SEQ ID NO:17.

[0033] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 and the second antigen-binding region binding to human CD123 are linked by an antibody heavy chain constant region Fc fragment, wherein the antibody heavy chain constant region Fc fragment includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368, and 407 of the first Fc fragment are C, S, A, and V, respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368, and 407 of the second Fc fragment are C, S, A, and V, respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering.

[0034] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 and the second antigen-binding region binding to human CD123 are linked by an antibody heavy chain constant region Fc fragment, wherein the antibody heavy chain constant region Fc fragment includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 234, 235 and 331 of the first Fc fragment and the second Fc fragment are F, E and S, respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering.

[0035] In some embodiments of the second aspect, the first antigen-binding region binding human CD16 and the second antigen-binding region binding human CD123 are linked by an antibody heavy chain constant region Fc fragment, the antibody heavy chain constant region Fc fragment comprising a first Fc fragment and a second Fc fragment, wherein one of the first Fc fragment and the second Fc fragment is linked to the first antigen-binding region binding human CD16, and the other of the first Fc fragment and the second Fc fragment is linked to the second antigen-binding region binding human CD123.

[0036] In some embodiments of the second aspect, the bispecific antibody comprises a first arm that binds to human CD16 and a second arm that binds to human CD123, wherein

[0037] The first arm contains an amino acid sequence as shown in SEQ ID NO:18, 38, or 39; and / or

[0038] The second arm contains an amino acid sequence as shown in SEQ ID NO:19, or contains an amino acid sequence as shown in SEQ ID NO:20 and 21.

[0039] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as shown in SEQ ID NO:18; and / or

[0040] The second arm contains the amino acid sequence shown in SEQ ID NO:19;

[0041] or

[0042] The first arm comprises an amino acid sequence as shown in SEQ ID NO:18; and / or

[0043] The second arm contains the amino acid sequences shown in SEQ ID NO:20 and 21;

[0044] or

[0045] The first arm comprises an amino acid sequence as shown in SEQ ID NO:38; and / or

[0046] The second arm contains the amino acid sequence shown in SEQ ID NO:19;

[0047] or

[0048] The first arm comprises an amino acid sequence as shown in SEQ ID NO:38; and / or

[0049] The second arm contains the amino acid sequences shown in SEQ ID NO:20 and 21;

[0050] or

[0051] The first arm contains an amino acid sequence as shown in SEQ ID NO:39; and / or

[0052] The second arm contains the amino acid sequence shown in SEQ ID NO:19;

[0053] or

[0054] The first arm contains an amino acid sequence as shown in SEQ ID NO:39; and / or

[0055] The second arm contains the amino acid sequences shown in SEQ ID NO:20 and 21.

[0056] Thirdly, this application provides a single-domain antibody that binds to human CD16, which contains

[0057] HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; or

[0058] HCDR1 as shown in SEQ ID NO:4, HCDR2 as shown in SEQ ID NO:5, and HCDR3 as shown in SEQ ID NO:6;

[0059] The amino acid sequence of HCDR is defined according to Kabat.

[0060] In some embodiments of the third aspect, the single-domain antibody comprises an amino acid sequence as shown in SEQ ID NO:13, 14 or 15.

[0061] Fourthly, this application provides a nucleic acid molecule that encodes the bispecific antibody described in the first or second aspect or the single-domain antibody described in the third aspect.

[0062] Fifthly, this application provides a pharmaceutical composition comprising the bispecific antibody described in the first or second aspect, or the single-domain antibody described in the third aspect, and a pharmaceutically acceptable excipient, diluent, or carrier.

[0063] In some embodiments of the fifth aspect, the pharmaceutical composition further comprises natural killer cells (NK cells).

[0064] In a sixth aspect, this application provides an antibody-natural killer cell (NK cell) conjugate, wherein the antibody is the bispecific antibody described in the first or second aspect, or the single-domain antibody described in the third aspect;

[0065] When the antibody is the bispecific antibody described in the first or second aspect, the antibody is coupled to the NK cell by binding to the antigen-antibody of the CD16 molecule on the NK cell via its first antigen-binding region of human CD16; or

[0066] When the antibody is a single-domain antibody as described in the third aspect, the antibody is coupled to the NK cell by means of its antigen-antibody binding to the CD16 molecule on the NK cell.

[0067] In a seventh aspect, this application provides the use of the bispecific antibody described in the first or second aspect, the single-domain antibody described in the third aspect, the pharmaceutical composition described in the fifth aspect, or the antibody-NK cell conjugate described in the sixth aspect in the preparation of a medicament for the prevention or treatment of tumors.

[0068] Eighthly, this application provides the use of the bispecific antibody described in the first or second aspect, or the single-domain antibody described in the third aspect, in the preparation of products for detecting CD16-positive cells.

[0069] In some embodiments of this application, the human CD16 is human CD16a or human CD16b. Brief description of the attached diagram

[0070] Figure 1 The results show the binding activity of the anti-CD16 antibody with CD16a-His and CD16b-NA1-His, respectively.

[0071] Figure 2 The study showed the killing effect of anti-CD16×CD123 bispecific antibody on Molm-13 target cells mediated by NK cells from different donors. In this study, A represents NK cells from donor 1, and B represents NK cells from donor 2.

[0072] Figure 3 The results of NK cell self-killing mediated by anti-CD16×CD123 bispecific antibody were shown. In this study, A represents NK cells from donor 1, and B represents NK cells from donor 2.

[0073] Figure 4 The binding activity of the humanized N5G3 antibody N5G3-h5 with CD16a-His, CD16b-NA1-His and CD16b-NA2-His were shown.

[0074] Figure 5 The results of N5G3-h5×anti-CD123 bispecific antibody-mediated killing of Molm-13 and MV-411 target cells by NK cells are shown. In the figure, A represents Molm-13 target cells and B represents MV-411 target cells.

[0075] Figure 6 The results showed that the N5G3-h5×anti-CD123 bispecific antibody mediated the self-killing of NK cells.

[0076] Figure 7 The in vivo tumor-suppressing effect of the N5G3-h5×anti-CD123 bispecific antibody was demonstrated.

[0077] Sequence Description

[0078] SEQ ID NO:1-3 show the amino acid sequences of HCDR1, HCDR2 and HCDR3 of single-domain antibodies N5G3 and N5G3-h5, respectively.

[0079] SEQ ID NO:4-6 show the amino acid sequences of HCDR1, HCDR2 and HCDR3 of the single-domain antibody N1D9, respectively.

[0080] SEQ ID NO:7-9 show the amino acid sequences of HCDR1, HCDR2 and HCDR3 of the heavy chain variable region H7A3-h2-m5-VH that binds to the second antigen-binding region of human CD123.

[0081] SEQ ID NO:10-12 show the amino acid sequences of LCDR1, LCDR2, and LCDR3 of the light chain variable region L27E5-VL that binds to the second antigen-binding region of human CD123, respectively.

[0082] SEQ ID NO:13 shows the amino acid sequence of the single-domain antibody N5G3.

[0083] SEQ ID NO:14 shows the amino acid sequence of the single-domain antibody N5G3-h5.

[0084] SEQ ID NO:15 shows the amino acid sequence of the single-domain antibody N1D9.

[0085] SEQ ID NO:16 shows the amino acid sequence of the heavy chain variable region H7A3-h2-m5-VH of the second antigen-binding region of human CD123.

[0086] SEQ ID NO:17 shows the amino acid sequence of the light chain variable region L27E5-VL of the second antigen-binding region of human CD123.

[0087] SEQ ID NO:18 shows the amino acid sequence of N5G3-h5-IgG1m3-FcH1.

[0088] SEQ ID NO:19 shows the amino acid sequence of anti-CD123-ScFv-IgG1m3-FcK.

[0089] SEQ ID NO:20 shows the amino acid sequence of H7A3-h2-m5-IgG1m3-FcK.

[0090] SEQ ID NO:21 shows the amino acid sequence of the light chain L27E5 of the second antigen-binding region of human CD123.

[0091] SEQ ID NO:22 shows the amino acid sequence of the extracellular region (hCD16a-ECD) of human (homo sapiens) CD16a.

[0092] SEQ ID NO:23 shows the amino acid sequence of the extracellular region (hCD16b-NA1-ECD) of human (homo sapiens) CD16b-NA1.

[0093] SEQ ID NO:24 shows the amino acid sequence of the extracellular region (hCD16b-NA2-ECD) of human (homo sapiens) CD16b-NA2.

[0094] SEQ ID NO:25 shows the amino acid sequence of the extracellular region (CD123-ECD) of human (homo sapiens) CD123.

[0095] SEQ ID NO:26 shows the amino acid sequence of the His tag.

[0096] SEQ ID NO:27 shows the amino acid sequence of the Fc segment (IgG1-Fc) of human (homo sapiens) antibody IgG1.

[0097] SEQ ID NO:28 shows the amino acid sequence of the Fc segment (mFc) of mouse (mus musculus) antibody IgG2a.

[0098] SEQ ID NO:29 shows the amino acid sequence of the human IgG1 subtype antibody Fc fragment mutant IgG1m3-Fc.

[0099] SEQ ID NO:30 shows the amino acid sequence of the human IgG1 subtype antibody Fc fragment mutant IgG1m3-FcH1.

[0100] SEQ ID NO:31 shows the amino acid sequence of the heavy chain H7A3-h2-m5 that binds to the second antigen-binding region of human CD123.

[0101] SEQ ID NO:32 shows the amino acid sequence of the single-chain antibody fragment anti-CD123-ScFv that binds to human CD123.

[0102] SEQ ID NO:33 shows the amino acid sequence of the human IgG1 subtype antibody Fc segment mutant IgG1m3-FcK with the hinge region amino acid sequence of EPKSSD.

[0103] SEQ ID NO:34 shows the amino acid sequence of the human IgG1 subtype antibody Fc segment mutant IgG1m3-FcK with the hinge region amino acid sequence of EPKSCD.

[0104] SEQ ID NO:35 shows the amino acid sequence of the heavy chain variable region of antibody DP47.

[0105] SEQ ID NO:36 shows the amino acid sequence of the light chain variable region of antibody DP47.

[0106] SEQ ID NO:37 shows the nucleotide sequence of primer PCal-CH2R.

[0107] SEQ ID NO:38 shows the amino acid sequence of N5G3-IgG1m3-FcH1.

[0108] SEQ ID NO:39 shows the amino acid sequence of N1D9-IgG1m3-FcH1. Invention Details

[0109] The inventors of this application have prepared a bispecific antibody using genetic engineering techniques to bind a first antigen-binding region of human CD16 and a second antigen-binding region of tumor cell surface antigens (e.g., human CD123). This antibody binds to NK cells via CD16 and to tumor cells via tumor cell surface antigens (e.g., human CD123), enabling NK cells to target tumor cells (e.g., CD123-positive tumor cells), activating NK cells and achieving NK cell killing of tumor cells (e.g., CD123-positive tumor cells). In various aspects of this application, novel bispecific antibodies comprising a first antigen-binding region of human CD16 and a second antigen-binding region of tumor cell surface antigens (e.g., human CD123), single-domain antibodies binding to human CD16, nucleic acid molecules encoding the bispecific antibody or the single-domain antibody, vectors containing the nucleic acid molecules, host cells containing the nucleic acid molecules or the vector, methods for preparing and purifying the bispecific antibody or the single-domain antibody, and medical and biological applications of the bispecific antibody or the single-domain antibody are provided. Based on the sequences of bispecific antibodies or single-domain antibodies provided in this application, bispecific antibodies or single-domain antibodies that bind to human CD16 and / or bind to tumor cell surface antigens (e.g., human CD123) can be constructed as drugs for clinical use in the prevention or treatment of tumors (e.g., CD123-positive tumors), or bispecific antibodies or single-domain antibodies that bind to human CD16 and / or bind to tumor cell surface antigens (e.g., human CD123) can be used to prepare products for detecting CD16-positive cells (e.g., kits, test strips, test cards, or microfluidic devices).

[0110] Unless otherwise specified, this application is implemented using conventional molecular biology, microbiology, cell biology, biochemistry and immunology techniques in the art.

[0111] Unless otherwise specified, the terms used in this application have the meanings commonly understood by those skilled in the art.

[0112] definition

[0113] As used herein, the term "antibody" refers to an immunoglobulin molecule capable of specifically binding to a target via at least one antigen recognition site located in the variable region of an immunoglobulin molecule. Targets include, but are not limited to, carbohydrates, polynucleotides, lipids, peptides, etc. The term "antibody" as used herein includes not only complete (i.e., full-length) antibodies, but also their binding fragments (e.g., Fab, Fab', F(ab')2, Fv), their variants, fusion proteins containing antibody portions, humanized antibodies, chimeric antibodies, bispecific antibodies, linear antibodies, single-chain antibodies, single-domain antibodies, multispecific antibodies (e.g., bispecific antibodies), and any other modified configurations of immunoglobulin molecules containing antigen recognition sites of desired specificity, including glycosylated variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies.

[0114] Typically, a full-length or complete antibody consists of two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and first, second, and third constant regions (CH1, CH2, and CH3). Each light chain contains a light chain variable region (VL) and a constant region (CL). Full-length antibodies can be any type of antibody, such as IgD, IgE, IgG, IgA, or IgM (or subclasses mentioned above), but the antibody does not need to belong to any specific class. Immunoglobulins can be assigned to different classes based on the antibody amino acid sequence of the constant region of the heavy chain. Generally, there are five main classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further subdivided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant regions corresponding to different immunoglobulin classes are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional structures of different classes of immunoglobulins are well known.

[0115] As used herein, the term "bispecific antibody" refers to an antibody that simultaneously binds to two antigenic epitopes. These two epitopes can be on different antigens or on the same antigen. Bispecific antibodies can have various structural configurations. For example, a bispecific antibody can consist of two Fc fragments and two binding portions fused to them (similar to natural antibodies, except that the two arms bind to different antigenic targets or epitopes). The antigen-binding portions can be single-domain antibodies, single-chain antibodies (scFv), or Fab fragments. When targeting two given antigenic epitopes, the two different binding portions of the bispecific antibody each bind to the N-terminus of an Fc fragment. The antigen-binding portion configuration of the two arms can have four combinations: single-domain antibody + Fab fragment, single-domain antibody + scFv, scFv + single-domain antibody, and Fab fragment + single-domain antibody. The Fc fragment can contain mutations that ensure heavy chain heteropolymerization; KIH technology (knob-in-hole, KIH) is one strategy to address heavy chain heteropolymerization. Typically, KIH (kidney-in-heap) technology refers to modifying the amino acid sequence of the CH3 region to create a structure that facilitates the pairing of heterologous half-antibodies, thus forming bispecific antibodies while preserving as much of the normal antibody structure as possible. For guidance on KIH technology, see, for example, "An efficient route to human bispecific IgG," A. Margaret Merchant et al., Nature Biotechnology, Volume 16, 1998. [6] The full text of that document is included in this paper by way of citation.

[0116] The antigen-binding region may contain a heavy chain variant region (VH), a light chain variant region (VL), or both. Each of the VH and VL typically contains three complementarity-determining regions, CDR1, CDR2, and CDR3.

[0117] It is well known to those skilled in the art that complementarity-determining regions (CDRs, typically CDR1, CDR2, and CDR3) are the regions in the variable region that have the greatest impact on antibody affinity and specificity. There are two common definitions for the CDR sequence of VH or VL: the Kabat definition and the Chothia definition. (See, for example, Kabat, “Sequences of Proteins of Immunological Interest,” National Institutes of Health, Bethesda, MD. (1991)) [7] ;A1-Lazikani et al., J.Mol.Biol.273:927-948(1997) [8]; and Martin et al., Proc. Natl. Acad. Sci. USA 86: 9268-9272 (1989)) [9] For a given antibody's variable region sequence, the CDR region sequence in the VH and VL sequences can be determined according to the Kabat definition or the Chothia definition. In the embodiments of this application, the Kabat definition of the CDR sequence is used.

[0118] For a given antibody's variable region sequence, the CDR region sequence can be analyzed in various ways, such as using the online software Abysis (http: / / www.abysis.org / ).

[0119] For general antibodies, examples of antigen-binding regions include, but are not limited to: (1) Fab fragments, which may be monovalent fragments having VL-CL chains and VH-CH1 chains; (2) F(ab')2 fragments, which may be divalent fragments having two Fab' fragments connected by disulfide bridges (i.e., Fab' dimers) in the hinge region; (3) Fv fragments having VL and VH domains on a single arm of the antibody; (4) single-chain Fv(scFv), which may be a single polypeptide chain consisting of VH and VL domains connected by peptide linkers; (5) (scFv)2, which may contain two VH domains and two VL domains connected by peptide linkers, the two VL domains being combined with the two VH domains via disulfide bridges; and (6) single-domain antibody forms.

[0120] In the construction of bispecific antibodies, the "antigen binding region" includes, but is not limited to, single-domain antibody forms, Fab fragment forms, and / or single-chain antibody (scFv) forms.

[0121] As used in this article, "single-chain antibody (scFv, single-chain fragment variable)" refers to an antibody with a single-chain structure, typically constructed using genetic engineering techniques. It is a polypeptide chain containing a heavy chain variable region (VH) and a light chain variable region (VL). A flexible linker is usually designed between the heavy and light chain variable regions so that they can fold into the correct conformation to bind the antigen.

[0122] As used herein, the terms “Fab (fragment antigen binding) fragment,” “Fab portion,” or similar terms refer to antibody fragments that bind to antigens produced by treating an intact antibody with papain, including the intact light chain (VL-CL), the heavy chain variable region, and the CH1 fragment (VH-CH1).

[0123] As used herein, the term "single-domain antibody" refers to a naturally occurring heavy chain monovariable domain antibody lacking the light chain. Such antibodies contain a heavy chain variable region (VHH) and conventional CH2 and CH3 regions (e.g., one or two groups of regions: the heavy chain variable region (VHH) and conventional CH2 and CH3 regions). The VHH structure, cloned and expressed independently, possesses structural stability and antigen-binding activity comparable to the original heavy chain antibody and is the smallest known unit capable of binding to a target antigen. Single-domain antibodies are also known as nanobodies (Nb).

[0124] As used herein, the terms “Fc fragment,” “Fc domain,” and “Fc portion” are used interchangeably to refer to a portion of the antibody heavy chain constant region, including the hinge region, the CH2 and CH3 fragments of the heavy chain constant region, and are determined with reference to the EU numbering of human IgG1 antibodies.

[0125] As used in this article, "specific binding" refers to a non-random binding reaction between two molecules, such as the binding of an antibody to an antigenic epitope.

[0126] As used herein, the term "tumor" refers to a growth or solid lesion formed by abnormal cell growth. Tumors can be benign, pre-malignant, or malignant. In some embodiments of this application, the tumor is a CD123-positive tumor, such as acute myeloid leukemia (AML) or blastic plasmacytoid dendritic cell tumor (BPDCN).

[0127] In a first aspect, this application provides a bispecific antibody comprising a first antigen-binding region for binding human CD16 and a second antigen-binding region for binding tumor cell surface antigens, wherein the first antigen-binding region for binding human CD16 comprises:

[0128] HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; or

[0129] HCDR1 as shown in SEQ ID NO:4, HCDR2 as shown in SEQ ID NO:5, and HCDR3 as shown in SEQ ID NO:6;

[0130] The amino acid sequence of HCDR is defined according to Kabat.

[0131] In some embodiments of the first aspect, the tumor surface antigen is selected from: CD123, HER1, HER2, HER3, EpCAM, CEA, PSMA, CD19, CD20, CD22, CD38, and BCMA.

[0132] Secondly, this application provides a bispecific antibody comprising a first antigen-binding region that binds to human CD16 and a second antigen-binding region that binds to human CD123.

[0133] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 comprises:

[0134] HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; or

[0135] HCDR1 as shown in SEQ ID NO:4, HCDR2 as shown in SEQ ID NO:5, and HCDR3 as shown in SEQ ID NO:6;

[0136] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0137] In some embodiments of the second aspect, the second antigen-binding region binding to human CD123 comprises:

[0138] As shown in SEQ ID NO:7, HCDR1,

[0139] HCDR2, as shown in SEQ ID NO:8,

[0140] HCDR3, as shown in SEQ ID NO:9,

[0141] LCDR1, as shown in SEQ ID NO:10,

[0142] LCDR2 as shown in SEQ ID NO:11, and

[0143] LCDR3 as shown in SEQ ID NO:12;

[0144] The amino acid sequences of HCDR and LCDR are defined according to Kabat.

[0145] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16 is in the form of a single-domain antibody.

[0146] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16-binding antibody comprises a monovalent or multivalent single-domain antibody that binds CD16.

[0147] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16-binding antibody comprises a monovalent single-domain antibody that binds to CD16.

[0148] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16 binding site comprises an amino acid sequence as shown in SEQ ID NO:13.

[0149] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16 binding site comprises an amino acid sequence as shown in SEQ ID NO:14.

[0150] In some embodiments of the first or second aspect, the first antigen-binding region of the human CD16 binding site comprises an amino acid sequence as shown in SEQ ID NO:15.

[0151] In some embodiments of the second aspect, the second antigen-binding region binding to human CD123 is in Fab form or in the form of a single-chain antibody (scFv).

[0152] In some specific embodiments of the second aspect, the second antigen-binding region of the human CD123 is in Fab form.

[0153] In some specific embodiments of the second aspect, the second antigen-binding region of the human CD123 is in the form of a single-chain antibody (scFv).

[0154] In some embodiments of the second aspect, the second antigen-binding region binding to human CD123 comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:16 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:17.

[0155] In some embodiments of the first or second aspect, the amino acid sequence of the first antigen-binding region of the human CD16 binding site differs from the amino acid sequence shown in SEQ ID NO:13, 14 or 15 by substitution, deletion and / or addition of about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.

[0156] In some embodiments of the first or second aspect, the amino acid sequence of the first antigen-binding region of the human CD16 binding site has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:13, 14 or 15.

[0157] In some embodiments of the first or second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 13, 14 or 15 may be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still retaining a similar function to the first antigen-binding fragment.

[0158] In some embodiments of the first or second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 13, 14 or 15, and the resulting amino acid sequence still retains a similar function to the first antigen-binding fragment.

[0159] In some embodiments of the first or second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO: 13, 14 or 15, as long as the altered amino acid sequence substantially maintains the function of the first antigen-binding fragment.

[0160] In some embodiments of the second aspect, the second antigen-binding region of the human CD123-binding compound comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:16.

[0161] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding region of human CD123 differs from the amino acid sequence shown in SEQ ID NO:16 by substitution, deletion, and / or addition of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0162] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding region of human CD123 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:16.

[0163] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:16 may also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining the function of the heavy chain variable region of the second antigen-binding region of human CD123 similar to that described above.

[0164] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:16, and the resulting amino acid sequence still retains the function of the heavy chain variable region of the second antigen-binding region of human CD123 similar to that described above.

[0165] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:16, as long as the altered amino acid sequence substantially maintains the function of the heavy chain variable region of the second antigen-binding region of said human CD123.

[0166] In some embodiments of the second aspect, the second antigen-binding region of the human CD123-binding compound comprises a light chain variable region with an amino acid sequence as shown in SEQ ID NO:17.

[0167] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the second antigen-binding region of the human CD123 is different from the amino acid sequence shown in SEQ ID NO:17 by substitution, deletion and / or addition of about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.

[0168] In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the second antigen-binding region of the human CD123 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:17.

[0169] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:17 may also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining the function of the light chain variable region of the second antigen-binding region of human CD123 similar to that described above.

[0170] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:17, and the resulting amino acid sequence still retains the function of the light chain variable region of the second antigen-binding region of human CD123 similar to that described above.

[0171] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:17, as long as the altered amino acid sequence substantially maintains the function of the light chain variable region of the second antigen-binding region of said human CD123.

[0172] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 comprises an amino acid sequence as shown in SEQ ID NO: 13; and / or

[0173] The second antigen-binding region that binds to human CD123 includes a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:16 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:17.

[0174] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 comprises an amino acid sequence as shown in SEQ ID NO: 14; and / or

[0175] The second antigen-binding region that binds to human CD123 includes a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:16 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:17.

[0176] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 comprises an amino acid sequence as shown in SEQ ID NO: 15; and / or

[0177] The second antigen-binding region that binds to human CD123 includes a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:16 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:17.

[0178] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 and the second antigen-binding region binding to human CD123 are linked by an antibody heavy chain constant region Fc fragment, wherein the antibody heavy chain constant region Fc fragment includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368, and 407 of the first Fc fragment are C, S, A, and V, respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368, and 407 of the second Fc fragment are C, S, A, and V, respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering.

[0179] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 and the second antigen-binding region binding to human CD123 are linked by an antibody heavy chain constant region Fc fragment, wherein the antibody heavy chain constant region Fc fragment includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, and the amino acids at positions 349, 366, 368, and 407 of the second Fc fragment are C, S, A, and V, respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering.

[0180] In some embodiments of the second aspect, the first antigen-binding region binding to human CD16 and the second antigen-binding region binding to human CD123 are linked by an antibody heavy chain constant region Fc fragment, wherein the antibody heavy chain constant region Fc fragment includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 234, 235 and 331 of the first Fc fragment and the second Fc fragment are F, E and S, respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering.

[0181] In some embodiments of the second aspect, the first antigen-binding region binding human CD16 and the second antigen-binding region binding human CD123 are linked by an antibody heavy chain constant region Fc fragment, the antibody heavy chain constant region Fc fragment comprising a first Fc fragment and a second Fc fragment, wherein one of the first Fc fragment and the second Fc fragment is linked to the first antigen-binding region binding human CD16, and the other of the first Fc fragment and the second Fc fragment is linked to the second antigen-binding region binding human CD123.

[0182] In some embodiments of the second aspect, the first antigen-binding region of the human CD16 (e.g., at the C-terminus) is linked to the N-terminus of the first Fc fragment (e.g., an amino acid sequence such as SEQ ID NO:30).

[0183] In some embodiments of the second aspect, the second antigen-binding region of the human CD123 (e.g., at the C-terminus) is linked to the N-terminus of the second Fc fragment (e.g., an amino acid sequence such as SEQ ID NO: 33 or 34).

[0184] In some embodiments of the second aspect, the Fc fragment of the antibody heavy chain constant region is an Fc fragment of the IgG1 isotype. In some embodiments, the first Fc fragment is an Fc fragment of the IgG1 isotype; and / or the second Fc fragment is an Fc fragment of the IgG1 isotype.

[0185] In some embodiments of the first aspect, the Fc fragment of the antibody heavy chain constant region is an Fc fragment of the IgG1m3 isotype. In some embodiments, the first Fc fragment is an Fc fragment of the IgG1m3 isotype; and / or the second Fc fragment is an Fc fragment of the IgG1m3 isotype.

[0186] In some embodiments of the second aspect, the bispecific antibody comprises a first arm that binds to human CD16 and a second arm that binds to human CD123, wherein

[0187] The first arm contains an amino acid sequence as shown in SEQ ID NO:18, 38, or 39; and / or

[0188] The second arm contains an amino acid sequence as shown in SEQ ID NO:19, or contains an amino acid sequence as shown in SEQ ID NO:20 and 21.

[0189] In some embodiments of the second aspect, the amino acid sequence of the first arm comprises an amino acid sequence as shown in SEQ ID NO:18, 38 or 39.

[0190] In some embodiments of the second aspect, the amino acid sequence of the first arm differs from the amino acid sequence shown in SEQ ID NO:18, 38 or 39 by substitution, deletion and / or addition of about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.

[0191] In some embodiments of the second aspect, the amino acid sequence of the first arm has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:18, 38 or 39.

[0192] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:18, 38 or 39 may be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still maintaining a similar function to the first arm.

[0193] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 18, 38 or 39, and the resulting amino acid sequence still retains a similar function to the first arm.

[0194] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO: 18, 38 or 39, as long as the altered amino acid sequence substantially maintains a similar function of the first arm.

[0195] In some embodiments of the second aspect, the amino acid sequence of the second arm comprises the amino acid sequence shown in SEQ ID NO:19.

[0196] In some embodiments of the second aspect, the amino acid sequence of the second arm differs from the amino acid sequence shown in SEQ ID NO:19 by substitution, deletion, and / or addition of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0197] In some embodiments of the second aspect, the amino acid sequence of the second arm has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:19.

[0198] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:19 may also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still maintaining a similar function to the second arm.

[0199] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:19, and the resulting amino acid sequence still retains a similar function to the second arm.

[0200] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:19, as long as the altered amino acid sequence substantially maintains a similar function to the second arm.

[0201] In some embodiments of the second aspect, the amino acid sequence of the second arm comprises the amino acid sequence shown in SEQ ID NO:20.

[0202] In some embodiments of the second aspect, the second arm comprises a sequence of substituted, deleted, and / or added amino acids that differ from the amino acid sequence shown in SEQ ID NO:20 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0203] In some embodiments of the second aspect, the second arm comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:20.

[0204] In some embodiments of the second aspect, the second arm comprises an amino acid sequence in which the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:20 is truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining a similar function to the second arm.

[0205] In some embodiments of the second aspect, the second arm comprises an amino acid sequence in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids are added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:20, while still maintaining a similar function of the second arm.

[0206] In some embodiments of the second aspect, the second arm comprises an amino acid sequence in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids are added or deleted in a region other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:20, while still maintaining a similar function of the second arm.

[0207] In some embodiments of the second aspect, the amino acid sequence of the second arm comprises the amino acid sequence shown in SEQ ID NO:21.

[0208] In some embodiments of the second aspect, the second arm comprises a sequence of substituted, deleted, and / or added amino acids that differ from the amino acid sequence shown in SEQ ID NO:21 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0209] In some embodiments of the second aspect, the second arm comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:21.

[0210] In some embodiments of the second aspect, the second arm comprises an amino acid sequence in which the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:21 is truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining a similar function to the second arm.

[0211] In some embodiments of the second aspect, the second arm comprises an amino acid sequence in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids are added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:21, while still maintaining a similar function of the second arm.

[0212] In some embodiments of the second aspect, the second arm comprises an amino acid sequence in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids are added or deleted in a region other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO:21, while still maintaining a similar function of the second arm.

[0213] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as shown in SEQ ID NO:18; and / or the second arm comprises an amino acid sequence as shown in SEQ ID NO:19.

[0214] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as shown in SEQ ID NO:18; and / or the second arm comprises an amino acid sequence as shown in SEQ ID NO:20 and 21.

[0215] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as shown in SEQ ID NO:38; and / or the second arm comprises an amino acid sequence as shown in SEQ ID NO:19.

[0216] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as shown in SEQ ID NO:38; and / or the second arm comprises an amino acid sequence as shown in SEQ ID NO:20 and 21.

[0217] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as shown in SEQ ID NO:39; and / or the second arm comprises an amino acid sequence as shown in SEQ ID NO:19.

[0218] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as shown in SEQ ID NO:39; and / or the second arm comprises an amino acid sequence as shown in SEQ ID NO:20 and 21.

[0219] Thirdly, this application provides a single-domain antibody that binds to human CD16, which contains

[0220] HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; or

[0221] HCDR1 as shown in SEQ ID NO:4, HCDR2 as shown in SEQ ID NO:5, and HCDR3 as shown in SEQ ID NO:6;

[0222] The amino acid sequence of HCDR is defined according to Kabat.

[0223] In some embodiments of the third aspect, the single-domain antibody binds to human CD16a.

[0224] In some implementations of the third aspect, the single-domain antibody binds to human CD16b.

[0225] In some embodiments of the third aspect, the single-domain antibody binds to both human CD16a and human CD16b.

[0226] In some embodiments of the third aspect, the single-domain antibody comprises an amino acid sequence as shown in SEQ ID NO:13.

[0227] In some embodiments of the third aspect, the single-domain antibody comprises an amino acid sequence as shown in SEQ ID NO:14.

[0228] In some embodiments of the third aspect, the single-domain antibody comprises an amino acid sequence as shown in SEQ ID NO:15.

[0229] In some embodiments of the third aspect, the amino acid sequence of the single-domain antibody differs from the amino acid sequence shown in SEQ ID NO:13, 14 or 15 by substitution, deletion and / or addition of about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids.

[0230] In some embodiments of the third aspect, the amino acid sequence of the single-domain antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with SEQ ID NO:13, 14 or 15.

[0231] In some embodiments of the third aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 13, 14 or 15 may be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still maintaining similar functions to the single-domain antibody.

[0232] In some embodiments of the third aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 13, 14 or 15, and the resulting amino acid sequence still retains a similar function to the single-domain antibody.

[0233] In some embodiments of the third aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in regions other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO: 13, 14 or 15, provided that the altered amino acid sequence substantially maintains a similar function to the single-domain antibody.

[0234] Fourthly, this application provides a nucleic acid molecule that encodes the bispecific antibody described in the first or second aspect, or the single-domain antibody described in the third aspect.

[0235] In some embodiments of the fourth aspect, the nucleic acid molecule may include DNA molecules and RNA molecules. The nucleic acid molecule may be single-stranded or double-stranded, and may be cDNA.

[0236] In some embodiments of the fourth aspect, the nucleic acid molecule is operatively linked to a regulatory nucleotide sequence that can be recognized by a host cell transformed with the vector.

[0237] Fifthly, this application provides a pharmaceutical composition comprising the bispecific antibody described in the first or second aspect, or the single-domain antibody described in the third aspect, and a pharmaceutically acceptable excipient, diluent, or carrier.

[0238] In some embodiments of the fifth aspect, the pharmaceutical composition further comprises natural killer cells (NK cells).

[0239] In some embodiments of the fifth aspect, the bispecific antibody or the single-domain antibody may be mixed with NK cells and administered together, for example, by intravenous injection.

[0240] In some embodiments of the fifth aspect, the bispecific antibody or the single-domain antibody may be administered separately from NK cells, for example by intravenous injection via NK cells, or by intraperitoneal injection.

[0241] In some embodiments of the fifth aspect, the pharmaceutical composition is used to prevent or treat tumors, such as CD123-positive tumors.

[0242] In some embodiments of the fifth aspect, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell tumor.

[0243] In some embodiments of the fifth aspect, the pharmaceutical composition may further comprise one or more of the following substances: lubricants, such as talc, magnesium stearate and mineral oil; wetting agents; emulsifiers; suspending agents; preservatives, such as benzoic acid, sorbic acid and calcium propionate; sweeteners and / or flavoring agents, etc.

[0244] In some embodiments of the fifth aspect, the pharmaceutical composition of this application may be formulated as tablets, pills, powders, lozenges, elixirs, suspensions, emulsions, solutions, syrups, suppositories, or capsules.

[0245] In some embodiments of the fifth aspect, the pharmaceutical composition of this application may be delivered using any physiologically acceptable method of administration, including but not limited to: oral administration, parenteral administration, nasal administration, rectal administration, intraperitoneal administration, intravascular injection, subcutaneous administration, transdermal administration, inhalation administration, etc.

[0246] In some embodiments of the fifth aspect, a pharmaceutical composition for therapeutic use can be formulated for storage in the form of a lyophilized preparation or an aqueous solution by mixing a reagent of the desired purity with, as appropriate, a pharmaceutically acceptable carrier, excipient, etc.

[0247] In a sixth aspect, this application provides an antibody-natural killer cell (NK cell) conjugate, wherein the antibody is the bispecific antibody described in the first or second aspect, or the single-domain antibody described in the third aspect;

[0248] When the antibody is the bispecific antibody described in the first or second aspect, the antibody is coupled to the NK cell by binding to the antigen-antibody of the CD16 molecule on the NK cell via its first antigen-binding region of human CD16; or

[0249] When the antibody is a single-domain antibody as described in the third aspect, the antibody is coupled to the NK cell by means of its antigen-antibody binding to the CD16 molecule on the NK cell.

[0250] In some embodiments of the sixth aspect, the antibody-NK cell conjugate is used to prevent or treat tumors, such as CD123-positive tumors.

[0251] In some embodiments of the sixth aspect, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell tumor.

[0252] In some embodiments of the fifth or sixth aspect, the NK cells are obtained from the in vitro culture and expansion of NK cells derived from peripheral blood mononuclear cells (PBMCs); the NK cells are obtained from the in vitro culture and expansion of NK cells derived from umbilical cord blood; the NK cells are obtained from the in vitro culture and expansion of NK cell lines; or the NK cells are obtained from the in vitro induction, culture, and expansion of induced pluripotent stem cells (iPSCs) or mesenchymal stem cells (ESCs).

[0253] In some implementation schemes of the fifth or sixth aspect, the cytotoxic activity of NK cells is primarily mediated through:

[0254] 1) Direct lysis of target cells: NK cells release cytotoxic particles such as perforin and granzymes through exocytosis, which activate the caspase pathway to induce necrosis or apoptosis of target cells.

[0255] 2) Secretion of cytokines: Cytokine-mediated killing effect. NK cells can synthesize and secrete a variety of cytokines, such as IFN-γ, TNF-α, IL-1, IL-5, IL-8, IL-10 and G-CSF, which induce apoptosis of target cells.

[0256] 3) Induction of apoptosis: Activation of NK cells to express Fas(CD95) ligand and tumor necrosis factor-associated apoptosis-inducing ligand (TRAIL) molecules, inducing CD95... + Target cells and TRAIL receptor-positive target cells undergo apoptosis through a cascade of endogenous enzyme reactions;

[0257] 4) ADCC: Antibody-dependent cell-mediated cytotoxicity;

[0258] 5) Immune checkpoint pathway: It expresses programmed death receptor 1 (PD-1) and cytotoxic T lymphocyte-associated protein 4 (CTLA4), etc., and exerts its effects by inhibiting immune checkpoints.

[0259] The aforementioned multiple mechanisms of action, along with the potential for application as a universal product and reliable safety profile, make NK cell therapy an attractive immunotherapy.

[0260] Activation of CD16 molecules can also promote the maturation and activation of NK cells, as well as the production of cytokines, which play a crucial role in immune responses and inflammation. Therefore, targeting CD16 molecules to activate NK cell function may be an effective immunotherapy strategy, particularly in combating cancer and viral infections. In summary, CD16, as a key activating receptor on NK cells, plays a central role in mediating ADCC and enhancing NK cell function. Activating CD16 molecules with specific antibodies can significantly enhance the killing ability of NK cells against tumor cells and virus-infected cells, providing new possibilities and research directions for immunotherapy.

[0261] In a seventh aspect, this application provides the use of the bispecific antibody described in the first or second aspect, the single-domain antibody described in the third aspect, the pharmaceutical composition described in the fifth aspect, or the antibody-NK cell conjugate described in the sixth aspect in the preparation of a medicament for the prevention or treatment of tumors.

[0262] In some embodiments of the seventh aspect, the tumor is the CD123-positive tumor.

[0263] In some embodiments of the seventh aspect, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell tumor.

[0264] Eighthly, this application provides methods for preventing or treating tumors, including administering to an individual in need the bispecific antibody described in the first or second aspect, the single-domain antibody described in the third aspect, the pharmaceutical composition described in the fifth aspect, or the antibody-NK cell conjugate described in the sixth aspect.

[0265] In some embodiments of the eighth aspect, the tumor is a CD123-positive tumor.

[0266] In some embodiments of the eighth aspect, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell tumor.

[0267] Ninthly, this application provides the use of the bispecific antibody described in the first or second aspect, and the single-domain antibody described in the third aspect, in the preparation of products for detecting CD16-positive cells.

[0268] In some embodiments of the ninth aspect, the product is a reagent kit, test strip, test card, or microfluidic device.

[0269] In some embodiments of the ninth aspect, the product may also include detection markers, such as colloidal gold, chemiluminescent markers, fluorescent markers, nanoparticle markers, etc.

[0270] In some embodiments of the ninth aspect, the product may also include other reagents for detection, such as enzymes or colloidal gold-labeled antigens or antibodies, substrates, reference standards, diluents, washing solutions, etc.

[0271] In some embodiments of the ninth aspect, the product may further include reagents for processing biological samples for detection, the biological samples being blood.

[0272] In some embodiments of the ninth aspect, the product may also include a product instruction manual.

[0273] This application also provides a vector comprising a nucleic acid molecule encoding a bispecific antibody as described in the first or second aspect, or a single-domain antibody as described in the third aspect, and a host cell comprising said nucleic acid molecule or vector. In other aspects, this application also provides a method for generating a bispecific antibody as described in the first or second aspect, or a single-domain antibody as described in the third aspect. In some embodiments, the method for generating a bispecific antibody as described in the first or second aspect, or a single-domain antibody as described in the third aspect, includes culturing host cells to express the nucleic acid molecule. In some embodiments, the method for generating a bispecific antibody as described in the first or second aspect, or a single-domain antibody as described in the third aspect, further includes recovering said bispecific antibody or said single-domain antibody from a host cell culture medium.

[0274] In some embodiments of this application, human CD16 can be human CD16a.

[0275] In some embodiments of this application, human CD16 can be human CD16b.

[0276] It should be understood that the above detailed description is only intended to provide a clearer understanding of the contents of this application to those skilled in the art, and is not intended to limit in any way. Those skilled in the art can make various modifications and variations to the described embodiments.

[0277] The following examples are for illustrative purposes only and are not intended to limit the scope of this application. Example

[0278] Example 1: Preparation of recombinant protein

[0279] 1.1 Preparation of recombinant antigen

[0280] The preparation and identification of anti-CD16 monoclonal antibodies require the extracellular regions of recombinant antigens human CD16a (hCD16a-ECD, SEQ ID NO:22), CD16b-NA1 (hCD16b-NA1-ECD, SEQ ID NO:23), and CD16b-NA2 (hCD16b-NA2-ECD, SEQ ID NO:24), while the identification of CD123 antibodies requires the extracellular region of recombinant antigen CD123 (CD123-ECD, SEQ ID NO:25). These proteins undergo post-translational modifications (such as glycosylation or disulfide bonds), therefore, using mammalian cell expression systems is more conducive to maintaining the structure and function of recombinant proteins. In addition, to facilitate the purification of recombinant proteins and the identification of monoclonal antibody functions, a His tag (His, SEQ ID NO:26) or the Fc segment of human antibody IgG1 (IgG1-Fc, SEQ ID NO:27) or the Fc segment of mouse antibody IgG2a (mFc, SEQ ID NO:28) was added to the C-terminus of these recombinant proteins.

[0281] Based on the amino acid sequences of various recombinant proteins from the Uniprot database, genes (containing His tags or Fc / mFc encoding genes) for these recombinant proteins were designed and synthesized. Using conventional molecular biology techniques, the synthesized recombinant protein genes were cloned into suitable eukaryotic expression vectors (such as Invitrogen's pcDNA3.1). Then, using liposomes (such as Invitrogen's 293fectin) or other cationic transfection reagents (such as PEI), the prepared recombinant protein expression plasmids were transfected into HEK293 cells (such as Invitrogen's HEK293F) and cultured in serum-free suspension for 3-4 days. The culture supernatant was then harvested by centrifugation or other methods.

[0282] Recombinant proteins expressed via His-tag fusion were purified in one step from the culture supernatant using a metal chelate affinity chromatography column (e.g., GE's HisTrap FF). Recombinant proteins expressed via Fc and mFc fusion were purified in one step using a Protein A / G affinity chromatography column (e.g., GE's Mabselect SURE). The recombinant protein storage buffer was then replaced with PBS (pH 7.0) or other suitable buffer using a desalting column (e.g., GE's Hitrap desaulting). If necessary, the samples could be filtered sterilized and then aliquoted and stored at -20°C.

[0283] 1.2 Preparation of recombinant antibodies

[0284] The C-terminus of the heavy chain variable region of a recombinant antibody (including single-domain antibodies) is fused with the Fc segment of human antibody IgG1 (IgG1-Fc, SEQ ID NO:27) or a mutant of the Fc segment of human antibody IgG1 (IgG1m3-Fc, SEQ ID NO:29). The synthesized recombinant antibody gene is cloned into a suitable eukaryotic expression vector (such as pcDNA3.1 from Invitrogen) using conventional molecular biology techniques to express the recombinant antibody. The prepared recombinant protein expression plasmid is transfected into HEK293 cells (such as HEK293F from Invitrogen) using liposomes (such as 293fectin from Invitrogen) or other cationic transfection reagents (such as PEI), and cultured in serum-free suspension for 3-4 days. The culture supernatant is then harvested by centrifugation and purified in one step using a Protein A / G affinity chromatography column (such as Mabselect SURE from GE). Then, use a desalting column (such as GE's Hitrap desaulting column) to replace the recombinant antibody preservation buffer with PBS (pH 7.0) or other suitable buffer. If necessary, the sample can be filtered for sterilization and then aliquoted and stored at -20°C.

[0285] Example 2: Screening of a camel immune bank

[0286] 2.1 Construction of the Camel Immunity Bank

[0287] One healthy adult Bactrian camel was selected, and blood was collected to obtain baseline serum before immunization. For the first immunization, 1 mg of CD16a-His fusion protein was emulsified with Fischer's complete adjuvant and injected subcutaneously at multiple sites. Two weeks later, for booster immunization, 1 mg of CD16a-His fusion protein was emulsified with Fischer's incomplete adjuvant and injected subcutaneously at multiple sites. A total of 5 booster immunizations were performed, and blood was collected before each immunization for antibody titer analysis. For the seventh immunization, no adjuvant was added, and 1 mg of CD16a-His fusion protein was used as the antigen and injected subcutaneously at multiple sites for pulse immunization. Three days later, 200 mL of peripheral blood was collected for lymphocyte separation.

[0288] Lymphocytes were isolated from 200 mL of camel peripheral blood using a camel peripheral blood lymphocyte isolation kit (Solarbio, CAT#P5750). Total RNA was extracted from the lymphocytes using a total RNA extraction kit (Tiangen, CAT#DP430). Using the extracted total RNA as a template, the variable region (VHH) of the camel single-domain antibody heavy chain was synthesized using a first-strand cDNA synthesis kit (Thermo Scientific, CAT#K1621). Gene-specific primers were used for reverse transcription, with the primer pairing region located in the CH2 domain of the antibody heavy chain constant region, specifically the sequence PCal-CH2R: TCCTTCCCCGTCAGCCAGTCCT (SEQ ID NO:37). The synthesized cDNA was immediately stored at -70℃ for later use. Then, using the cDNA obtained from reverse transcription as a template, [reference missing]

[10] Primers were synthesized, and the camel single-domain antibody VHH gene was isolated by nested PCR. Finally, the amplified VHH gene was cloned into the vector pADSCFV-S (see Chinese Patent Application No. 201510097117.0).

[11] The VHH library was built, with a capacity of 2.4E8 and an accuracy rate of 70%.

[0289] 2.2 Screening of the camel immune bank

[0290] Using the recombinant protein CD16a-mFc prepared in Example 1 as the antigen, a solid-phase screening strategy was employed (experimental protocol referenced: Phage Display: A Universal Laboratory Guide, edited by Clackson, T., and Lowman, HB; translated by Ma Lan et al., Chemical Industry Press, 2008.5).

[12] The phage library displaying camel single-domain antibodies constructed above was screened. Three rounds of screening were carried out through binding, elution, neutralization, infection and amplification. Finally, two single-domain antibodies that specifically bind to CD16a-His, N5G3 (SEQ ID NO:13) and N1D9 (SEQ ID NO:15), were obtained.

[0291] Using conventional molecular biology techniques, the nucleotide sequences of the N5G3 and N1D9 variable regions were cloned into eukaryotic expression vectors (such as Invitrogen's pcDNA3.1) that fused with nucleotide sequences encoding the Fc fragment of human antibodies. The prepared recombinant plasmids were then transfected into HEK293 cells (such as Invitrogen's HEK293F) to express the recombinant protein.

[0292] Example 3: Identification of anti-CD16 single-domain antibody

[0293] 3.1. Analysis of anti-CD16 antibody binding specificity

[0294] Anti-His-tagged mouse monoclonal antibody (Beijing Kangwei Century Biotechnology Co., Ltd., CW0286M) was coated onto 96-well ELISA plates at 5 μg / mL, 100 μL / well, and incubated overnight at 4°C. After blocking with PBS (containing 0.05% Tween 20 and 3% milk) at 37°C for 1 hour, 1 μg / mL of recombinant antigens CD16a-His and CD16b-NA1-His were added, and the plates were incubated at 37°C for 1 hour. The ELISA plates were washed with PBST buffer (PBS containing 0.1% Tween 20), and the recombinant anti-CD16a monoclonal antibodies selected in Example 2.2 (5 μg / mL, 100 μL / well) were added, and the plates were bound at 37°C for 1 hour. The ELISA plates were washed with PBST, and HRP mouse anti-human IgG (Beijing Biosen Biotechnology Co., Ltd., bsm-0297M-HRP) was added, and the plates were bound at 37°C for 1 hour. Wash the ELISA plate with PBST buffer, add OPD substrate chromogenic solution, and stop the color development with 1M H2SO4 after 5-10 minutes. Measure the optical density at 492nm / 630nm using a microplate reader. ELISA analysis results are as follows: Figure 1 As shown, N5G3 exhibits good binding activity to CD16a-His but does not bind to CD16b-NA1-His; N1D9 binds to both CD16a-His and CD16b-NA1-His.

[0295] 3.2 Affinity analysis of anti-CD16 single-domain antibody

[0296] The affinity of anti-CD16 antibodies was determined using surface plasmon resonance (SPR) technology with a Biacore T200. All reagents and consumables, including the amino-coupled assay kit (BR-1000-50), human antibody capture kit (BR-1008-39), S-series sensor chip CM5 chip (14100530), and 10×HBS-EP (BR100669) at pH 7.4, were purchased from Cytiva. Following the kit instructions, the carboxylated CM5 chip surface was activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). The anti-human IgG (Fc) antibody (capture antibody) was diluted to 25 μg / mL with 10 mM pH 5.0 sodium acetate and then injected at a flow rate of 10 μL / min to achieve a conjugation volume of approximately 10,000 response units (RU). After injection of the capture antibody, 1M ethanolamine was injected to block unreacted groups. For kinetic measurements, the anti-CD16a antibody was diluted to 0.5–1 μg / mL and injected at a flow rate of 10 μL / min, ensuring that approximately 100 RU of antibody was captured by the anti-human Fc antibody. Then, CD16a-His and CD16b-NA1-His were injected at a series of concentration gradients (e.g., 6.17 nM, 18.5 nM, 55.6 nM, 166.7 nM, and 500 nM) at 25 °C at a rate of 30 μL / min from low to high concentrations. The binding time was 90 s and the dissociation time was 600 s. The chip surface was then regenerated by injecting 3 M MgCl2 solution at a rate of 10 μL / min for 30 s. The binding rate (K0) was calculated using Biacore T200 evaluation software version 3.0 by fitting binding and dissociation sensor maps using a 1:1 binding model. on ) and dissociation rate (K off ). Using ratio K off / K on Calculate the dissociation equilibrium constant (K) D The fitting results are shown in Tables 1 and 2. N5G3 does not bind to CD16b.

[0297] Table 1. Affinity constants of anti-CD16 single-domain antibodies binding to CD16a-His

[0298] <![CDATA[K on (M -1 s -1 )]]> <![CDATA[K off (s -1 )]]> <![CDATA[K D (M)]]> N5G3 1.508E+5 2.122E-4 1.407E-9 N1D9 2.235E+5 1.247E-3 5.579E-9

[0299] Table 2. Affinity constants of anti-CD16 single-domain antibodies binding to CD16b-His

[0300] <![CDATA[K on (M -1 s -1 )]]> <![CDATA[K off (s -1 )]]> <![CDATA[K D (M)]]> N1D9 2.178E+5 1.494E-3 6.857E-9

[0301] 3.3 Preparation of anti-CD16×CD123 bispecific antibody

[0302] A mutant of anti-CD16 single-domain antibody fused to the C-terminus of the Fc segment of human antibody IgG1 (IgG1m3-FcH1, SEQ ID NO:30) was constructed. The antigen-binding fragment of human CD123 comprises a Fab fragment (the amino acid sequence of the heavy chain H7A3-h2-m5 is shown in SEQ ID NO:31; the amino acid sequence of the light chain L27E5 is shown in SEQ ID NO:21) or a single-chain antibody fragment (the amino acid sequence of anti-CD123-scFv is shown in SEQ ID NO:32). The amino acid sequence of the human CD123 antigen-binding fragment is derived from Chinese Patent Application No. CN202010080449.9.

[13] A mutant of the human antibody IgG1 (IgG1m3-FcK, SEQ ID NO: 33 or 34) was fused to the C-terminus of the antigen-binding region of human CD123. Following Example 1.2, eukaryotic expression vectors for each recombinant protein were constructed, and combined to express anti-CD16×CD123 bispecific antibodies.

[0303] 3.4 Anti-CD16×CD123 bispecific antibody-mediated killing of Molm-13 target cells by NK cells

[0304] Molm-13 cells expressing CD123 were purchased from Nanjing Kebai Biotechnology Co., Ltd. NK cells were provided by Beijing Sanyoulikang Cell Technology Co., Ltd., with different donors from different healthy volunteers. The test medium was N500 serum-free medium (Shenzhen Dakwei Biotechnology Co., Ltd., 6113031) + 2% inactivated FBS. DP47 antibody served as a negative control, referring to US patent application US20160200833A1.

[14] Preparation (the amino acid sequence of the heavy chain variable region of DP47 is shown in SEQ ID NO:35, and the amino acid sequence of the light and heavy chain variable regions is shown in SEQ ID NO:36). Molm-13 cells were resuspended in test medium to a concentration of 4*10⁻⁶. 5 NK cells were resuspended in test medium to a concentration of 2*10⁶ / mL. 6 The antibody was diluted to 40 nM using test medium as a starting point, with a 4-fold gradient and 10 concentration points. 50 μL of Molm-13 cells, 50 μL of NK cells, and 50 μL of antibody were mixed together and added to each well of a 96-well plate, resulting in a total volume of 150 μL per well for the experimental group. Simultaneously, wells containing Molm-13 cells and wells containing both Molm-13 cells and NK cells were set up, with the volume brought to 150 μL using test medium. The plates were incubated in a CO2 incubator (37°C, 5% CO2) for 20 hours. Non-radioactive cytotoxicity assay kit ( The Non-Radioactive Cytotoxicity Assay (Promega, catalog number G1780) was used to detect antibody-mediated NK cell killing of Molm-13 cells. Absorbance was measured at 490 nm using a Biotek 800TS microplate reader. Statistical analysis was performed using Graphpad Prism 7.0 software. The calculation formula is as follows:

[0305] Kill rate (%) = {absorbance value of experimental group - (absorbance value of spontaneous release of Molm-13 cells + NK cells)} / {maximum absorbance value of Molm-13 cells - absorbance value of spontaneous release of Molm-13 cells} × 100.

[0306] Figure 2 A and Figure 2 B represents the killing of Molm-13 cells by different donor NK cells mediated by anti-CD16×CD123 bispecific antibodies. Table 3 shows the killing of Molm-13 cells by NK cells mediated by anti-CD16×CD123 bispecific antibodies. 50 The results showed that both the N1D9×anti-CD123-Fab bispecific antibody and the N5G3×anti-CD123-Fab bispecific antibody had significant killing effects.

[0307] Table 3. Killing of Molm-13 target cells by NK cells mediated by anti-CD16×CD123 bispecific antibody EC 50 value

[0308]

[0309] 3.5 Anti-CD16×CD123 bispecific antibody mediates NK cell self-killing

[0310] NK cells were provided by Beijing Sanyoulikang Cell Technology Co., Ltd., with different donors from different healthy volunteers. The test medium was N500 serum-free medium (Shenzhen Dakwei Biotechnology Co., Ltd., 6113031) + 2% inactivated FBS. DP47 antibody served as a negative control. Daremumab (purchased from Beijing Meixin Kangnian Pharmacy) served as a positive control; existing literature has confirmed that daratumumab mediates NK cell self-killing.

[15] NK cells were resuspended in test medium to a concentration of 1*102. 6Antibody was diluted to 40 nM with test medium as a starting point, using a 4-fold gradient in 10 concentration points. 100 μL of NK cells and 50 μL of antibody were mixed together and added to each well of a 96-well plate, resulting in a total volume of 150 μL per well for the experimental group. A separate well for NK cells was also included, and the volume was brought up to 150 μL with test medium. The cells were incubated in a CO2 incubator (37°C, 5% CO2) for 20 hours. CytoTox-Globe was used to monitor the cell count. TM Cytotoxicity Detection System (CytoTox-Glo) TM The Cytotoxicity Assay (Promega, catalog number G9291) was used to detect antibody-mediated NK cell self-killing. Full-wavelength fluorescence detection was performed using a Molecular Devices (SpectraMax I3X) reader. Statistical processing of the raw data was performed using Graphpad Prism 7.0 software. The calculation formula is as follows:

[0311] Kill rate (%) = {absorbance value of experimental group - absorbance value of spontaneous release of NK cells} / {absorbance value of maximum release of NK cells - absorbance value of spontaneous release of NK cells} × 100.

[0312] Figure 3 A and Figure 3 B represents the NK cell self-killing mediated by anti-CD16×CD123 bispecific antibodies from different donors. The results showed that N1D9×anti-CD123-Fab bispecific antibody mediated some NK cell self-killing, while N5G3×anti-CD123-Fab bispecific antibody did not mediate NK cell self-killing.

[0313] Example 4: Humanization and Identification of N5G3 Antibody

[0314] 4.1 Humanization of N5G3 antibody

[0315] N5G3 was humanized to reduce its immunogenicity. The humanization strategy employed a classic framework transplantation approach.

[16] The amino acid sequence of N5G3 was compared with human antibody germline gene sequences in the IMGT database. Suitable germline gene sequences were selected to provide frame regions 1 to 3 (FR1+FR2+FR3) for the antibody, and a suitable J region gene sequence was selected to provide frame region 4 (FR4). This template can be selected based on various factors, such as the relative total length of the antibody, the size of the CDR, the amino acid residues located at the junction between the antibody frame regions (FR) and hypervariable regions (CDR), and the overall sequence homology. The selected template can be a mixture of multiple sequences or a shared template, with the aim of maintaining the appropriate conformation of the parental complementarity-determining region (CDR) as much as possible. Simultaneously, considering the solubility, stability, and expression yield of the humanized antibody, four hotspot amino acids 37F / 44E / 45R / 47F in FR2 were reverse-mutated, ultimately yielding the humanized molecule N5G3-h5 (SEQ ID NO:14).

[0316] 4.2 Binding characteristics and affinity analysis of humanized N5G3 antibody N5G3-h5

[0317] Referring to Example 3.1, the binding specificity of the humanized N5G3 molecule N5G3-h5 was analyzed using ELISA. The ELISA analysis results are as follows: Figure 4 As shown, N5G3-h5 exhibits good binding activity to CD16a, but does not bind to CD16b-NA1-His or CD16b-NA2-His. The Fc fragment in the N5G3-h5 antibody is the Fc mutant of IgG1, IgG1m3-Fc.

[0318] Referring to Example 3.2, affinity analysis of N5G3-h5 was performed using Biacore T200, and the results are shown in Table 4. N5G3-h5 does not bind to CD16b.

[0319] Table 4. Affinity constants of humanized antibody N5G3-h5 binding to human CD16a-His

[0320] <![CDATA[K on (M -1 s -1 )]]> <![CDATA[K off (s -1 )]]> <![CDATA[K D (M)]]> N5G3 5.234E+5 2.320E-4 4.432E-10 N5G3-h5 4.123E+5 1.631E-4 3.956E-10

[0321] Example 5: In vitro activity analysis of N5G3-h5×anti-CD123 bispecific antibody

[0322] 5.1 Affinity analysis of N5G3-h5×anti-CD123 bispecific antibody in the CD16a and CD123 directions

[0323] Referring to Example 3.4, an N5G3-h5×anti-CD123 bispecific antibody was prepared. Referring to Example 3.2, the affinity of the N5G3-h5×anti-CD123 bispecific antibody was analyzed using a Biacore T200. The results are shown in Tables 5 and 6.

[0324] Table 5. Affinity constants of N5G3-h5×anti-CD123 bispecific antibody binding to CD16a-His

[0325] <![CDATA[K on (M -1 s -1 )]]> <![CDATA[K off (s -1 )]]> <![CDATA[K D (M)]]> N5G3×anti-CD123-ScFv 2.825E+5 2.604E-4 9.216E-10 N5G3×anti-CD123-Fab 3.108E+5 3.040E-4 9.780E-10 N5G3-h5×anti-CD123-ScFv 2.605E+5 2.369E-4 9.092E-10 N5G3-h5×anti-CD123-Fab 2.572E+5 2.620E-4 1.018E-9

[0326] Table 6. Affinity constants of N5G3-h5×anti-CD123 bispecific antibody binding to CD123-His

[0327] <![CDATA[K on (M -1 s -1 )]]> <![CDATA[K off (s -1 )]]> <![CDATA[K D (M)]]> N5G3×anti-CD123-ScFv 8.589E+4 6.945E-5 8.085E-10 N5G3×anti-CD123-Fab 8.548E+4 1.011E-4 1.183E-9 N5G3-h5×anti-CD123-ScFv 8.645E+4 7.014E-5 8.113E-10 N5G3-h5×anti-CD123-Fab 8.161E+4 1.140E-4 1.397E-9

[0328] 5.2N5G3-h5×anti-CD123-Fab bispecific antibody mediates NK cell killing of Molm-13 and MV-411 target cells.

[0329] Referring to Example 3.5, the killing of Molm-13 and MV-411 target cells by NK cells mediated by the N5G3-h5×anti-CD123-Fab bispecific antibody was analyzed. Figure 5 A and Figure 5 B represents the killing of Molm-13 and MV-411 cells by NK cells mediated by the N5G3-h5×anti-CD123-Fab bispecific antibody, respectively. Table 7 shows the killing of Molm-13 and MV-411 target cells by NK cells mediated by the N5G3-h5×anti-CD123-Fab bispecific antibody. 50 The results showed that the killing ability of the N5G3-h5×anti-CD123-Fab bispecific antibody was basically equivalent to that of the N5G3×anti-CD123-Fab bispecific antibody.

[0330] Table 7. Killing of EC by NK cells against Molm-13 and MV-411 target cells mediated by N5G3-h5×anti-CD123-Fab bispecific antibody 50 value

[0331]

[0332] 5.3N5G3-h5×anti-CD123-Fab bispecific antibody-mediated NK cell self-killing

[0333] Referring to Example 3.5, the self-killing of NK cells mediated by the N5G3-h5×anti-CD123-Fab bispecific antibody was analyzed. Figure 6 The study investigated the use of N5G3-h5×anti-CD123-Fab bispecific antibody to mediate NK cell self-killing. The results showed that neither N5G3-h5×anti-CD123-Fab bispecific antibody nor N5G3×anti-CD123-Fab bispecific antibody mediated NK cell self-killing.

[0334] Example 6: In vivo tumor-suppressive activity analysis of N5G3-h5×anti-CD123 bispecific antibody

[0335] The in vivo antitumor effect of the N5G3-h5×anti-CD123 bispecific antibody was evaluated using a Molm-13 tumor cell model in immunodeficient mice reconstituted with human NK cells. NK cells were provided by Beijing Sanyoulikang Cell Technology Co., Ltd. Six-week-old female NOG mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Molm-13 cells were purchased from Nanjing Kebai Biotechnology Co., Ltd. Fifty NOG mice in the logarithmic growth phase were intravenously injected with 1E+04 Molm-13 cells per mouse via tail vein. The inoculation diary was dated day 0. Mice were divided into five groups of 10 mice each, based on body weight. The drug was administered three times, on days 1, 4, and 7. The dosing regimen is shown in Table 8 below. Group 1 is the solvent control group. In Group 3, the premixing and elution of NK cells and N5G3-h5×anti-CD123 bispecific antibody means that after NK cells and N5G3-h5×anti-CD123 bispecific antibody bind at 37°C for 1 hour, they are washed once with PBS and then resuspended for injection.

[0336] Table 8. Dosing Regimen

[0337]

[0338]

[0339] Mice were weighed twice a week during the experiment to monitor their survival time. Survival curves were plotted using statistical software. Results are as follows: Figure 7 As shown, all mice in Group 1, which were only inoculated with tumor cells but not given NK cells and N5G3-h5×anti-CD123 bispecific antibodies, died after 33 days. Group 5, which received NK cells but not N5G3-h5×anti-CD123 bispecific antibodies, had a longer survival time than Group 1, indicating that NK cells have a certain tumor-suppressing effect. Groups 2, 3, and 4, which received both NK cells and N5G3-h5×anti-CD123 bispecific antibodies, all had significantly longer survival times than Group 5.

[0340] All publications and patent documents referenced in this specification are incorporated herein by reference as if each publication or patent were expressly indicated to be incorporated herein by reference individually. Various changes and equivalent substitutions may be made to the embodiments disclosed in this application without departing from the true spirit and scope of the disclosure. Unless the context otherwise requires, any feature, step, or embodiment of the embodiments disclosed herein may be used in combination with any other feature, step, or embodiment.

[0341] Sequence information

[0342] SEQ ID NO:1

[0343]

[0344] SEQ ID NO:2

[0345]

[0346] SEQ ID NO:3

[0347]

[0348] SEQ ID NO:4

[0349]

[0350] SEQ ID NO:5

[0351]

[0352] SEQ ID NO:6

[0353]

[0354] SEQ ID NO:7

[0355]

[0356] SEQ ID NO:8

[0357]

[0358] SEQ ID NO:9

[0359]

[0360] SEQ ID NO:10

[0361]

[0362] SEQ ID NO:11

[0363]

[0364] SEQ ID NO:12

[0365]

[0366] SEQ ID NO:13

[0367]

[0368] SEQ ID NO:14

[0369]

[0370] SEQ ID NO:15

[0371]

[0372] SEQ ID NO:16

[0373]

[0374] SEQ ID NO:17

[0375]

[0376] SEQ ID NO:18

[0377]

[0378] SEQ ID NO:19

[0379]

[0380] SEQ ID NO:20

[0381]

[0382] SEQ ID NO:21

[0383]

[0384] SEQ ID NO:22

[0385]

[0386] SEQ ID NO:23

[0387]

[0388] SEQ ID NO:24

[0389]

[0390] SEQ ID NO:25

[0391]

[0392] SEQ ID NO:26

[0393]

[0394] SEQ ID NO:27

[0395]

[0396] SEQ ID NO:28

[0397]

[0398] SEQ ID NO:29

[0399]

[0400] SEQ ID NO:30

[0401]

[0402] SEQ ID NO:31

[0403]

[0404] SEQ ID NO:32

[0405]

[0406] SEQ ID NO:33

[0407]

[0408] SEQ ID NO:34

[0409]

[0410] SEQ ID NO:35

[0411]

[0412] SEQ ID NO:36

[0413]

[0414] SEQ ID NO:37

[0415]

[0416] SEQ ID NO:38

[0417]

[0418]

[0419] SEQ ID NO:39

[0420]

[0421] References

[0422] 1.Dixon KJ,Wu J,Walcheck B.Engineering Anti-Tumor MonoclonalAntibodies and Fc Receptors to Enhance ADCC by Human NK Cells.Cancers(Basel).2021Jan 16;13(2):312.

[0423] 2.Testa U,Pelosi E,Frankel A.CD 123is a membrane biomarker and atherapeutic target in hematologic malignancies.Biomark Res.2014Feb 10;2(1):4.

[0424] 3.Munoz L et al.,Haematologica.86(12):1261-9.

[0425] 4.Testa U,Riccioni R,Militi S,Coccia E,Stellacci E,Samoggia P,Latagliata R,Mariani G,Rossini A,Battistini A,Lo-Coco F,Peschle C.Elevatedexpression of IL-3Ralpha in acute myelogenous leukemia is associated withenhanced blast proliferation,increased cellularity,and poorprognosis.Blood.2002Oct15;100(8):2980-8.

[0426] 5.Demaria O,Gauthier L,Debroas G,Vivier E.Natural killer cellengagers incancer immunotherapy:Next generation of immuno-oncologytreatments.Eur JImmunol.2021Aug;51(8):1934-1942.16.

[0427] 6.A.Margaret Merchant et al.,An efficient route to human bispecificIgG,Nature Biotechnology,Volume16,1998.

[0428] 7.Kabat,Sequences of Proteins of Immunological Interest,NationalInstitutes of Health,Bethesda,Md.(1991).

[0429] 8.A1-Lazikani et al.,J.Mol.Biol.273:927-948(1997).

[0430] 9.Martin et al.,Proc.Natl.Acad.Sci.USA86:9268-9272(1989).

[0431] 10. E., Poignavent, V., Vincke, C., et al. (2018) Ritzenthaler C, Muyldermans S, Monsion B. Construction of High-Quality Camel Immune AntibodyLibraries. Methods Mol Biol 1701:169-187.

[0432] 11.CN 201510097117.0

[0433] 12. Phage Display: A Universal Laboratory Guide / Edited by Clackson, T., and Lowman, HB.; Translated by Ma Lan et al. Chemical Industry Press, May 2008.

[0434] 13.CN 202010080449.9

[0435] 14.US20160200833A1

[0436] 15. Tineke Casneuf et al., Blood Adv.2017Oct 24;1(23):2105-2114.

[0437] 16. Tan, P., Mitchell, D, A., Buss, T, N., et al. (2022) "Superhumanized" antibodies: reduction of immunogenic potential by complementarity-determining region grafting with human germline sequences: application to an anti-CD28. JImmunol 169(2):1119-1125.

Claims

1. A bispecific antibody comprising a first antigen binding region that binds human CD16 and a second antigen binding region that binds a tumor cell surface antigen, wherein the first antigen binding region that binds human CD16 comprises: a HCDR1 as depicted in SEQ ID NO: 1, a HCDR2 as depicted in SEQ ID NO: 2 and a HCDR3 as depicted in SEQ ID NO: 3; or a HCDR1 as depicted in SEQ ID NO: 4, a HCDR2 as depicted in SEQ ID NO: 5 and a HCDR3 as depicted in SEQ ID NO: 6; preferably, the first antigen binding region that binds human CD16 is in the format of a single domain antibody; more preferably, the first antigen binding region that binds human CD16 comprises a monovalent or multivalent single domain antibody that binds CD16; and / or preferably, the tumor surface antigen is selected from the group consisting of CD123, HER1, HER2, HER3, EpCAM, CEA, PSMA, CD19, CD20, CD22, CD38 and BCMA; optionally, CD16 is CD16a or CD16b; wherein the amino acid sequences of the HCDRs are defined according to Kabat.

2. A bispecific antibody comprising a first antigen binding region that binds human CD16 and a second antigen binding region that binds human CD123; preferably, the first antigen binding region that binds human CD16 comprises: a HCDR1 as depicted in SEQ ID NO: 1, a HCDR2 as depicted in SEQ ID NO: 2 and a HCDR3 as depicted in SEQ ID NO: 3; or a HCDR1 as depicted in SEQ ID NO: 4, a HCDR2 as depicted in SEQ ID NO: 5 and a HCDR3 as depicted in SEQ ID NO: 6; more preferably, the first antigen binding region that binds human CD16 is in the format of a single domain antibody; most preferably, the first antigen binding region that binds human CD16 comprises a monovalent or multivalent single domain antibody that binds human CD16; and / or preferably, the second antigen binding region that binds human CD123 comprises: a HCDR1 as depicted in SEQ ID NO: 7, a HCDR2 as depicted in SEQ ID NO: 8, a HCDR3 as depicted in SEQ ID NO: 9, a LCDR1 as depicted in SEQ ID NO: 10, a LCDR2 as depicted in SEQ ID NO: 11, and a LCDR3 as depicted in SEQ ID NO: 12; more preferably, the second antigen binding region that binds human CD123 is in the format of a Fab or a single chain antibody (scFv); most preferably, the second antigen binding region that binds human CD123 is in the format of a Fab; optionally, CD16 is CD16a or CD16b; wherein, the amino acid sequences of the HCDRs and the LCDRs are defined according to Kabat.

3. The bispecific antibody of claim 1 or 2, wherein The first antigen-binding region of the human CD16 binding site comprises an amino acid sequence as shown in SEQ ID NO: 13, 14 or 15; and / or The second antigen-binding region that binds to human CD123 includes a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:16 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:

17. Preferably, the first antigen-binding region binding to human CD16 comprises the amino acid sequence shown in SEQ ID NO:13; and / or the second antigen-binding region binding to human CD123 comprises a heavy chain variable region with the amino acid sequence shown in SEQ ID NO:16 and a light chain variable region with the amino acid sequence shown in SEQ ID NO:17; or The first antigen-binding region of the human CD16 binding site comprises the amino acid sequence shown in SEQ ID NO:14; and / or the second antigen-binding region of the human CD123 binding site comprises a heavy chain variable region with the amino acid sequence shown in SEQ ID NO:16 and a light chain variable region with the amino acid sequence shown in SEQ ID NO:17; or The first antigen-binding region of the human CD16 binds to an amino acid sequence as shown in SEQ ID NO:15; and / or the second antigen-binding region of the human CD123 binds to a heavy chain variable region as shown in SEQ ID NO:16 and a light chain variable region as shown in SEQ ID NO:

17.

4. The bispecific antibody as described in claim 2 or 3, wherein... The first antigen-binding region binding to human CD16 and the second antigen-binding region binding to human CD123 are linked by an Fc fragment of the antibody heavy chain constant region, wherein the Fc fragment of the antibody heavy chain constant region includes a first Fc fragment and a second Fc fragment; preferably, the Fc fragment of the antibody heavy chain constant region is an Fc fragment of the IgG1 subtype; more preferably, the Fc fragment of the antibody heavy chain constant region is an Fc fragment of the IgG1m3 subtype; wherein The amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368, and 407 of the first Fc fragment are C, S, A, and V, respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368, and 407 of the second Fc fragment are C, S, A, and V, respectively; preferably, the amino acids at positions 354 and 366 of the first Fc fragment are C and W, and the amino acids at positions 349, 366, 368, and 407 of the second Fc fragment are C, S, A, and V, respectively; and / or The amino acids at positions 234, 235, and 331 of the first Fc fragment and the second Fc fragment are F, E, and S, respectively; and / or one of the first and second Fc fragments is linked to the first antigen binding region that binds human CD16 and the other of the first and second Fc fragments is linked to the second antigen binding region that binds human CD123; wherein the amino acid positions of the antibody constant region are determined according to EU numbering.

5. The bispecific antibody of any one of claims 2-4, comprising a first arm that binds human CD16 and a second arm that binds human CD123, wherein the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19, or comprises amino acid sequences as set forth in SEQ ID NO: 20 and 21; preferably, the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 38; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 38; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21.

6. A single domain antibody that binds human CD16, comprising a HCDR1 as set forth in SEQ ID NO: 1, a HCDR2 as set forth in SEQ ID NO: 2, and a HCDR3 as set forth in SEQ ID NO: 3; or a HCDR1 as set forth in SEQ ID NO: 4, a HCDR2 as set forth in SEQ ID NO: 5, and a HCDR3 as set forth in SEQ ID NO: 6; preferably, the single domain antibody comprises an amino acid sequence as set forth in SEQ ID NO: 13, 14, or 15; optionally, CD16 is CD16a or CD16b; the amino acid sequences of the HCDRs are according to the definition of Kabat.

7. A pharmaceutical composition comprising the bispecific antibody of any one of claims 1-5 or the single domain antibody of claim 6 and a pharmaceutically acceptable excipient, diluent, or carrier; preferably, the pharmaceutical composition further comprises natural killer cells (NK cells). ​ ​ ​ wherein ​ ​ ​ More preferably, the NK cells are obtained from in vitro culture and expansion of NK cells derived from peripheral blood mononuclear cells (PBMCs); the NK cells are obtained from in vitro culture and expansion of NK cells derived from umbilical cord blood; the NK cells are obtained from in vitro culture and expansion of a NK cell line; or the NK cells are obtained from in vitro induction, culture and expansion from induced pluripotent stem cells (iPSCs) or mesenchymal stem cells (MSCs).

8. An antibody-natural killer cell (NK cell) conjugate, wherein the antibody is the bispecific antibody of any one of claims 1-5, or the single domain antibody of claim 6; when the antibody is the bispecific antibody of any one of claims 1-5, the antibody is conjugated to the NK cell via antigen-antibody binding of its first antigen binding region to CD16 molecules on the NK cell; or when the antibody is the single domain antibody of claim 6, the antibody is conjugated to the NK cell via antigen-antibody binding of the antibody to CD16 molecules on the NK cell; More preferably, the NK cells are obtained from in vitro culture and expansion of NK cells derived from peripheral blood mononuclear cells (PBMCs); the NK cells are obtained from in vitro culture and expansion of NK cells derived from umbilical cord blood; the NK cells are obtained from in vitro culture and expansion of a NK cell line; or the NK cells are obtained from in vitro induction, culture and expansion from induced pluripotent stem cells (iPSCs) or mesenchymal stem cells (MSCs).

9. Use of the bispecific antibody of any one of claims 1-5, the single domain antibody of claim 6, the pharmaceutical composition of claim 7, or the antibody-NK cell conjugate of claim 8 in the manufacture of a medicament for preventing or treating a tumor; preferably, the tumor is a CD123-positive tumor; more preferably, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell neoplasm.

10. Use of the bispecific antibody of any one of claims 1-5, or the single domain antibody of claim 6 in the manufacture of a product for detecting CD16-positive cells; preferably, the product is a kit, a test strip, a test card or a microfluidic device.

Images