Fluorescent quantitative PCR (Polymerase Chain Reaction) detection composition, method and kit for simultaneously detecting spiroplasma, insect plasma and intermediate plasma
By designing specific primers and probes, combining degenerate bases, and employing real-time PCR technology, the problem of simultaneously detecting spiroplasma, spiroplasma, and intermediate spiroplasma in existing technologies has been solved. This achieves highly sensitive and specific detection of multiple microorganisms, making it suitable for the safety testing of biological products.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-30
- Publication Date
- 2026-04-03
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biological detection technology, and in particular relates to a fluorescent quantitative PCR detection composition, method and kit for simultaneously detecting spiroplasma, spiroplasma and intermediate spiroplasma. Background Technology
[0002] With the development of science and technology in recent years Insect cells and plant-derived materials are increasingly used in biomedical fields such as vaccine production, recombinant protein expression, and cell and gene therapy. The safety of cell matrices used in biopharmaceutical production is a major concern. In the pharmacopoeias of various countries, the chapters on mycoplasma detection often mention that if materials from insect or plant sources are used in the production process, spiroplasm testing is required. The 2025 edition of the Chinese Pharmacopoeia General Chapter 0234, "Preparation and Quality Control of Animal Cell Matrices for Biopharmaceutical Production," states in the cell assay section on mycoplasma / spiroplasm testing that if insect cells are used, or if plant-derived materials are used in cell culture, spiroplasm testing should be performed, and the methods used, such as culture or nucleic acid methods, should be able to detect intermediate spiroplasm and spiroplasm.
[0003] Spiroplasmas are a class of spiral-shaped prokaryotes with unique structures and modes of locomotion, belonging to the class Mollusceria and order Entomoptera. Within the order Entomoptera, besides the family Spiroplasidae, there is also the family Entomoptera, which includes genera such as Entomoptera and Intermediapoptera. Currently, detection methods for these three major groups of microorganisms are relatively limited. Methods involved include qPCR and colloidal gold enzyme-linked immunosorbent assay (ELISA), but these common methods are all specific to a particular species of microorganism. Currently, there is no broad-spectrum, highly specific, and highly sensitive detection method for all three groups of microorganisms. Summary of the Invention
[0004] The purpose of this invention is to provide a fluorescence quantitative PCR detection composition, method, and kit for simultaneously detecting spiroplasma, spiroplasma, and intermediate spiroplasma. This kit can accurately and rapidly detect the presence of spiroplasma, spiroplasma, and intermediate spiroplasma contamination in samples.
[0005] To achieve the above objectives, this application adopts the following technical solution: In a first aspect, the present invention provides a fluorescence quantitative PCR detection composition for the simultaneous detection of spiroplasma, spiroplasma, and intermediate spiroplasma, the detection composition comprising the following primers and probes for detection: The upstream primer, as shown in SEQ ID No. 1, is: AAGYCMCGRCTAACTATGTG. The downstream primer, as shown in SEQ ID No. 2, is: ADCDYCTRMGCACSCTDTA. The probe, as shown in SEQ ID No. 3, is: GCGTTATCCGGAWTTAYTGGGCG; In this context, degenerate base R represents A or G, degenerate base Y represents C or T, degenerate base S represents G or C, degenerate base M represents A or C, degenerate base W represents A or T, and degenerate base D represents A, G, or T.
[0006] In the above technical solutions, the fluorescent group of the probe can be any one of FAM, HEX, CY5, JOE, and CY3.
[0007] In the above technical solutions, the quenching group of the probe can be any one of TAMRA, MGB, BHQ1, and BHQ2.
[0008] Secondly, the present invention provides a kit for simultaneously detecting spiroplasma, parasites and intermediate spiroplasma in biological products, the kit comprising the above-mentioned detection composition.
[0009] In the above technical solution, the kit also includes a positive control, a negative control, and a real-time PCR reaction reagent.
[0010] In the above technical solution, the reagent kit mainly consists of reagent A and reagent B: Reagent A is a premixed solution for real-time PCR reaction, which includes Premix Ex Taq for probe-based qPCR, 50×ROX Reference Dye, nuclease-free water, and the above-mentioned detection composition; Reagent B is a control, including positive and negative standards.
[0011] Thirdly, the present invention provides a fluorescence quantitative PCR detection method for simultaneously detecting spiroplasma, parasites, and intermediate spiroplasmas for non-diagnostic purposes, comprising the following steps: S1. Extract the DNA template from the sample to be tested; S2. Establish a real-time PCR reaction system using the above-mentioned detection composition; S3. Perform quantitative real-time PCR detection; S4. Result analysis of the sample to be tested.
[0012] In the above technical solution, the real-time PCR reaction system is 20 μL, containing 15 μL of real-time PCR reaction premix and 5 μL of template; the real-time PCR reaction premix includes PremixEx Taq, 50×ROX Reference Dye, nuclease-free water, and the detection composition according to claim 1; the template is the DNA of the sample to be tested, positive control standard, and negative control standard.
[0013] In the above technical solution, the reaction conditions of the fluorescence quantitative PCR reaction system are: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 5 sec, 58℃ annealing for 34 sec, 40 cycles.
[0014] The beneficial effects of this invention are as follows: 1. In addition to comparing multiple species of the genera *Spiroplasma*, *Spiroplasma*, and *Intermediaplasma* under the order *Spiroplasma*, this invention also compares the sequences of other mycoplasmas belonging to the class *Mucariaceae*. The variable region of the 16S rRNA sequence is selected for primer and probe design, resulting in strong specificity. By introducing degenerate bases, it can specifically identify more than 50 species of *Spiroplasma*, *Spiroplasma*, and *Intermediaplasma*, while effectively avoiding the detection of other mycoplasmas.
[0015] 2. By designing multiple pairs of degenerate probe primers targeting the more conserved regions of the 16S rRNA variable region, primers and probes with high specificity and sensitivity were ultimately screened, enabling accurate quantification of 2×10⁻⁶ m² / g²⁻¹. 6 Positive signals ranging from copies / μL to 20 copies / μL.
[0016] 3. The kit for simultaneous detection of spiroplasma, spiroplasma, and intermediate spiroplasma of the present invention contains positive and negative standards for detection, and simultaneously tests the qPCR detection method. The primers are highly specific and there is no cross-reactivity between the primers and probes, which can simultaneously cover most spiroplasma, spiroplasma, and intermediate spiroplasma subtypes.
[0017] 4. Through repeated screening and optimization of the reaction system, including the concentration of primers and probes, the final detection method requires very little sample. At the same time, the detection target is the DNA genome that transcribes 16S rRNA, making extraction more convenient and the extracted sample more stable. Each detection requires as little as 5μL of nucleic acid sample and can still detect it stably. Attached Figure Description
[0018] Figure 1 A schematic diagram of the 16S rRNA structure; Figure 2 Alignment diagram of 16S rRNA sequences from multiple species for primer and probe design regions; Figure 3 Design a region conservation analysis diagram for primers and probes; Figure 4 Detect the qPCR amplification curve for Sc; Figure 5 Sc is used to detect the qPCR standard curve; Figure 6 En was used to detect the qPCR amplification curve; Figure 7 To detect the qPCR standard curve for En; Figure 8 Detect the qPCR amplification curve for Ml; Figure 9 To generate a standard curve for qPCR detection in Ml. Detailed Implementation
[0019] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below in conjunction with specific embodiments. This invention can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the inventive concept to those skilled in the art. This invention will be defined only by the claims.
[0020] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0021] The present invention will now be further illustrated with specific examples. The following embodiments are only for explaining the present invention and do not constitute a limitation thereof. The test samples and test procedures used in the following embodiments include the following (if the specific experimental conditions are not specified in the embodiments, they are usually performed according to conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following embodiments can be obtained commercially unless otherwise specified).
[0022] Experimental materials used in the embodiments of this invention: DNA extraction kit: purchased from Tiangen, product number: DP705.
[0023] The Premix Ex Taq (Probe qPCR) reagent for probe-based qPCR was purchased from TaKaRa (containing 50×ROX Reference Dye), catalog number: RR390A.
[0024] The nuclease-free water was purchased from Invitrogen, catalog number: 10977-015.
[0025] By consulting references and comparing with the NCBI database, 16S rRNA reference sequences for Spiroplasma, Zygophyllum, Intermediate Mycoplasma, and other common mycoplasma were selected. Representative variable region sequences were chosen, and appropriate primer and probe design regions were selected using alignment software. Figure 1 As shown.
[0026] Based on the base differences among spiroplasma, spiroplasma, and intermediate mycoplasma, degenerate bases were designed. Combined with alignment with other common mycoplasma sequences, it was determined that the primer-probe sequences can specifically recognize only spiroplasma, spiroplasma, and intermediate mycoplasma. Primer-probe information is shown in Table 1. Selected regions and alignment sequences are listed below. Figure 2 Conservation analysis of the selected primer and probe regions can be found in [link to relevant documentation]. Figure 3 In addition to comparing 9 common non-spiroplasma mycoplasma species, a total of 38 spiroplasma species, 5 spiroplasma species, and 12 intermediate mycoplasma species were compared.
[0027] Table 1 Primer and probe sequence information
[0028] In this context, degenerate base R represents A or G, degenerate base Y represents C or T, degenerate base S represents G or C, degenerate base M represents A or C, degenerate base W represents A or T, and degenerate base D represents A, G, or T.
[0029] Positive plasmids were constructed using genetic engineering techniques. Representative reference genomes of spiroplasma, spiroplasma, and intermediate spiroplasma were selected, and corresponding sequences were chosen based on primer design regions. The plasmids were then constructed into the pUC57 plasmid vector. Specific sequence information is as follows: The reference GenBank number for the sequence of the representative species of Spiroplasma, Spiroplasma citri, is M23942.1, SEQ ID No. 4: AAGACGGTCTTCGGATTGTAAAAGTCTGTTGTAAGGGAAGAACAGTAAGTATAGGAAATGATACTTATTTGACGGTACCTTACCAGAAAGCCACGGCTAACTATGTGCCAGCAGCCGCGGTAATACATAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGCAGACGGTTTAACAAGTTTGGGGTCAAATCCTGGAGCTCAACTCCAGGTTCGCCTTGAAAACTGTTAAGCTAGAGTGTAGGAAAGGTCGATGGAATTCCATGTGTAGCGGTGAAATGCGTAGATATATG。
[0030] The reference GenBank number for the sequence of the representative species of Entomoplasma, Entomoplasma ellychniae, is M24292.1, SEQ ID No. 5: TGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTGTAAGGGAAGAAAAAATTTGAGAGGAAATGCTCTTATCTTGACGGTACCTTACCAGAAAGCCACGGCTAACTATGTGCCAGCAGCCGCGGTAATACATAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTATAGGGTGCGTAGGCGGTTTCGCAAGTTTGAGGTTAAAGCCCGGAGCTCAACTCCGGTTCGCCTTGAAAACTGTGGGACTAGAATATCAGAGAGGTAAACGGAATTCCATGTGTAGCGGTAAAATGCGTAGAT The sequence of the representative species of Mesoplasma lactucae (Mesoplasma lactucae) refers to GenBank number M24479.1, SEQ ID No. 6: TGAGTGATGAAGGTCTTCGGATTGTAAAGCTCTGTTGTAAAGGAAGAATAGACAGAAGAGGAAATGCTTTTGTTTTGACGGTACTTTACCAGAAAGTCACGGCTAACTATGTGCCAGCAGCCGCGGTAATACATAGGTGACAAGCGTTA TCCGGATTTATTGGGCGTACAGGGTGCGTAGGCGGTTGTGTAAGTTTGAGGTTAAAGACCGGAGCTCAACTCCGGTTTGCCTTGAAAACTATGCAACTAGAATGTAACAGAGGTGAGTGGAATTCCATGTGTAGCGGTGAAATGCGTAGAT
[0031] In addition to positive plasmids, real microbial samples were selected for primer screening and method development. Specific information about the microorganisms is shown in Table 2.
[0032] Table 2 Microbial Information
[0033] The positive control group consisted of spiroplasma, spiroplasma, intermediate spiroplasma, and their corresponding plasmids.
[0034] The negative control group consisted of negative cells, DMEM culture medium, and various other negative mycoplasma.
[0035] Nucleic acid extraction was performed using the magnetic bead method universal genomic DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd.
[0036] Add 200 μL of sample to an EP tube. Add 20 μL of Proteinase K and 350 μL of lysis buffer GHL. Incubate in a constant-temperature shaking metal bath at 75°C and 1500 rpm for 15-30 min until no clumps remain in the sample.
[0037] Add 350 μL of isopropanol, shake to mix for 10 sec, add 15 μL of magnetic bead suspension GH, shake to mix for 1 min, and let stand for a total of 9 min (shaking to mix for 1 min every 3 min).
[0038] Place the centrifuge tubes on a magnetic rack and let them stand for 30 seconds until the magnetic beads are fully adsorbed. Then carefully aspirate the liquid. Add 900 μL of buffer GDZ and vortex to mix for 2 min.
[0039] Place the centrifuge tube on a magnetic rack and let it stand for 30 seconds until the magnetic beads are completely adsorbed. Then carefully remove the liquid. Add 500 μL of buffer GDZ and vortex to mix for 2 min.
[0040] Place the centrifuge tubes on the magnetic rack and let them stand for 30 seconds until the magnetic beads are fully attracted. Then carefully remove the liquid.
[0041] Remove the centrifuge tube from the magnetic rack, add 900 μL of PWD wash solution, and vortex to mix for 2 min.
[0042] Place the centrifuge tubes on the magnetic rack and let them stand for 30 seconds until the magnetic beads are fully attracted. Then carefully remove the liquid.
[0043] Remove the centrifuge tube from the magnetic rack, add 300 μL of PWD wash solution, and vortex to mix for 2 min.
[0044] Place the centrifuge tubes on the magnetic rack and let them stand for 30 seconds. Once the magnetic beads are fully attracted, carefully remove the liquid.
[0045] Place the centrifuge tubes on a magnetic rack and let them air dry at room temperature for 3-10 minutes.
[0046] Remove the centrifuge tube from the magnetic rack, add 100 μL of elution buffer TB, vortex to mix, and incubate at 56°C for 10 min, inverting the tube 3 times during the incubation period, 3-5 times each time.
[0047] Place the centrifuge tube on a magnetic rack and let it stand for 2 minutes until the magnetic beads are fully adsorbed. Then, carefully transfer the DNA solution to a new centrifuge tube and store it at 2–8°C. If not used on the same day, store it at -80°C.
[0048] Positive plasmids, positive bacterial strains, and negative bacterial strains were selected for primer and probe screening tests. The qPCR reaction system configuration is shown in Table 3 below.
[0049] Table 3 qPCR reaction system
[0050] Using an ABI 7500 PCR instrument, set the qPCR reaction program according to Table 4 and collect signals at 58℃.
[0051] Table 4 qPCR reaction procedure
[0052] Based on the above qPCR detection method, three positive plasmid reference samples were tested. The standard curve results are shown in Tables 5-7. The standard curves obtained by the primers and probes all met the acceptable criteria (R). 2>0.99, 90%≤Eff%≤110%, recovery rate between 50%-150%.
[0053] Table 5 Analysis of Sc Standard Curve Results
[0054] UD: undetermined; NA: Not applicable Table 6. Analysis of En Standard Curve Results
[0055] UD: undetermined; NA: Not applicable Table 7 Analysis of Ml Standard Curve Results
[0056] UD: undetermined; NA: Not applicable According to Tables 5-7 and Figures 4-9 It can be seen that the template copy count is 10. 7 ~10 2 Within the specified range, the established quantitative PCR detection method exhibits good amplification curves, with a correlation coefficient R of Sc. 2 =0.999, amplification efficiency of 99.087%; correlation coefficient R of En 2 =1.000, amplification efficiency of 98.834%; correlation coefficient R of Ml 2 =0.999, amplification efficiency of 99.177%.
[0057] Specificity refers to the ability of an analytical method to accurately determine the analyte in the presence of other components (such as impurities, degradation products, excipients, etc.). Other components besides the target analyte cannot be detected.
[0058] Based on the preliminary primer and probe screening and testing results, *Spiroplasma*, *Trichophyton*, *Intermediate*, and their corresponding plasmids were selected as positive groups; PBS, DMEM culture medium, cells (CHO, Vero, HEK293), *Mycoplasma pneumoniae*, *Mycoplasma oralis*, *Mycoplasma hyopneumoniae*, *Acholesterolus reesei*, *Mycoplasma arginine*, *Mycoplasma gallisepticum*, *Mycoplasma syringae*, *Mycoplasma salivariae*, and *Mycoplasma fermentata* were selected as negative groups for specificity testing. The specificity test results are shown in Table 8.
[0059] Table 8 Specificity Result Analysis
[0060] As shown in Table 9, this detection method has good specificity, with only spiroplasma, spiroplasma, intermediate spiroplasma and corresponding plasmids showing positive results, while all other samples showed negative results.
[0061] The limit of detection (LOD) refers to the lowest amount of a target analyte that can be detected in a sample. The LOD serves only as a limit test indicator and a basis for qualitative identification. The purpose of the LOD test is to confirm the lowest concentration or amount that can be reliably detected.
[0062] Based on the previous primer and probe screening and testing results, groups of 1000 copies, 100 copies, and 20 copies / reaction were tested for spiroplasma, spiroplasma, and intermediate spiroplasma, respectively, with 12 replicates set for each group, to verify the lowest detection limit of the method. The detection limit results are shown in Table 9.
[0063] Table 9 Analysis of the results of the lowest detection limit
[0064] The results of the limits of detection (LODs) are shown in Table 9. In this detection method, the LOD standard is that all 12 replicates are detected. Therefore, the LODs for spiroplasma, spiroplasma, and intermediate plasma are all 100 copies / reaction.
[0065] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A fluorescence quantitative PCR detection composition for simultaneously detecting spiroplasma, spiroplasma, and intermediate spiroplasma, characterized in that: The detection composition includes the following primers and probes for detection: The upstream primer, as shown in SEQ ID No. 1, is: AAGYCMCGRCTAACTATGTG. The downstream primer, as shown in SEQ ID No. 2, is: ADCDYCTRMGCACSCTDTA. The probe, as shown in SEQ ID No. 3, is: GCGTTATCCGGAWTTAYTGGGCG; In this context, degenerate base R represents A or G, degenerate base Y represents C or T, degenerate base S represents G or C, degenerate base M represents A or C, degenerate base W represents A or T, and degenerate base D represents A, G, or T.
2. The detection composition according to claim 1, characterized in that: The fluorescent group of the probe can be any one of FAM, HEX, CY5, JOE, or CY3.
3. The detection composition according to claim 1, characterized in that: The quenching group of the probe can be any one of TAMRA, MGB, BHQ1, or BHQ2.
4. A kit for simultaneously detecting spiroplasma, parasites, and intermediate spiroplasma in biological products, characterized in that: The kit comprises the detection composition of claim 1.
5. The reagent kit according to claim 4, characterized in that: The kit also includes a positive control, a negative control, and a quantitative real-time PCR reaction reagent.
6. The reagent kit according to claim 4, characterized in that: The kit mainly consists of reagent A and reagent B: Reagent A is a premixed solution for real-time PCR reaction, comprising Premix Ex Taq for probe-based qPCR, 50×ROX Reference Dye, nuclease-free water, and the detection composition as described in claim 1; Reagent B is a control, including positive and negative standards.
7. A real-time quantitative PCR detection method for simultaneously detecting spiroplasma, parasites, and intermediate spiroplasmas for non-diagnostic purposes, characterized in that: Includes the following steps: S1. Extract the DNA template from the sample to be tested; S2. Establish a real-time PCR reaction system using the detection composition described in claim 1; S3. Perform quantitative real-time PCR detection; S4. Result analysis of the sample to be tested.
8. The detection method according to claim 7, characterized in that: The quantitative PCR reaction system is 20 μL, containing 15 μL of quantitative PCR reaction premix and 5 μL of template; the quantitative PCR reaction premix includes Premix Ex Taq for probe-based qPCR, 50×ROX Reference Dye, nuclease-free water, and the detection composition according to claim 1; the template is the DNA of the sample to be tested, positive control standard, and negative control standard.
9. The detection method according to claim 8, characterized in that: The reaction conditions for the quantitative real-time PCR reaction system were: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 5 sec, 58℃ annealing for 34 sec, for 40 cycles.