Nucleic acid aptamer specifically combined with lung cancer cells as well as screening method and application of nucleic acid aptamer

Abstract

The invention relates to the technical field of biological medicine, in particular to a nucleic acid aptamer specifically combined with lung cancer cells and a screening method and application of the nucleic acid aptamer. A cell SELEX screening method is improved, lung cancer cells are used as positive screening cells, normal lung epithelial cells are used as negative screening cells for screening, the screening pressure is increased round by round, the screening efficiency is improved, and the nucleic acid aptamers Apt-1 and Apt-2 with high specificity and affinity for the lung cancer cells are obtained. As a novel molecular recognition probe, the nucleic acid aptamer disclosed by the invention has a wide application prospect in the aspects of early diagnosis, targeted therapy and the like of lung cancer.

Description

Nucleic acid aptamers that specifically bind to lung cancer cells, their screening methods and applications Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to nucleic acid aptamers that specifically bind to lung cancer cells, their screening methods, and applications. Background Technology

[0002] Lung cancer is a common malignant tumor that seriously threatens human life and health. In the early stages of lung cancer, most people do not experience any discomfort, and even in the middle and late stages, there is no obvious pain. Without regular cancer screening, it is difficult to detect the disease. If the optimal treatment window for lung cancer is missed, patients will incur higher costs and significantly reduce their quality of life once it reaches an advanced stage. Furthermore, the difficulty and effectiveness of treatment differ greatly from those in the early stages. Currently, clinical methods for diagnosing lung cancer can be broadly categorized into imaging examinations, tumor marker testing, and pathological diagnosis, with pathology considered the gold standard for cancer diagnosis at present. Most patients are already in the middle or late stages of lung cancer when they seek medical attention, thus missing the optimal treatment window.

[0003] Chemotherapy remains one of the main treatments for non-small cell lung cancer. However, because chemotherapy drugs are non-selective and non-targeting, they are highly toxic to normal tissues and cells while killing cancer cells, often causing severe side effects while exerting their therapeutic effects.

[0004] Therefore, the key to lung cancer diagnosis and treatment currently lies in developing effective early diagnostic methods and highly specific targeted drugs against cancer cells. However, there are very few targets that can be reliably used for early cancer diagnosis or treatment in clinical practice. Therefore, developing targeted diagnostic or therapeutic drugs that can specifically recognize tumor tissue rather than normal tissue has become a top priority in anticancer drug development.

[0005] Aptamers can fold into three-dimensional structures and bind specifically to target molecules through their spatial configuration. Nucleic acid aptamers are single-stranded oligonucleotide sequences (ssDNA, RNA, or modified RNA). Systematic Evolution of Ligands by Exponential Enrichment (SELEX) is a highly efficient in vitro screening technique used to enrich and identify nucleic acid aptamers from random sequence libraries that can bind to target molecules with high affinity and high specificity. Compared to natural antibodies in vivo, nucleic acid aptamers, obtained through in vitro screening, not only bind to target molecules with high affinity and high specificity but also have significant advantages in structural stability, molecular modification, and production cost. Studies have shown that nucleic acid aptamers, as recognition molecular probes, have broad application prospects in molecular biology, cell imaging, and the diagnosis and treatment of tumor diseases.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The purpose of this invention is to provide nucleic acid aptamers that specifically bind to lung cancer cells, and their application in the early diagnosis and treatment of lung cancer. This invention utilizes an improved cell SELEX technique to screen for nucleic acid aptamers that can specifically bind to lung cancer cells while not binding to normal lung cells.

[0008] The present invention provides a nucleic acid aptamer that specifically binds to lung cancer cells, characterized in that the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0009] Those skilled in the art will understand that while specific nucleotide sequences are provided in this invention, it should be understood that these nucleotide sequences include conserved sequence variants, such as sequences having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity. The nucleotide sequences can be optimized through truncation, base substitution, base deletion, etc. As long as the optimized nucleic acid aptamer has a substantially identical or similar molecular structure, physicochemical properties, and function to the original nucleic acid aptamer, and can be applied to specifically bind to lung cancer cells, it should fall within the equivalent protection scope of this invention.

[0010] In some embodiments of the present invention, the nucleic acid aptamer further includes modifications, and the modified nucleic acid aptamer specifically binds to lung cancer cells. For example, the modifications include at least one of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization.

[0011] In some embodiments of the present invention, the modification includes the modification or substitution of one or more nucleotides. Optionally, the modification or substitution may be performed at one or more of the following positions: ribose position, deoxyribose position, phosphate position, and base position.

[0012] Those skilled in the art will understand that the nucleic acid aptamers obtained after the above modifications should also be able to specifically bind to lung cancer cells to meet the application requirements. In other words, the nucleic acid aptamers modified in the above way all have the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamers, and can all be used to specifically bind to lung cancer cells.

[0013] In some embodiments of the present invention, the lung cancer cells are non-small cell lung cancer cells. In some specific embodiments, the lung cancer cells are lung adenocarcinoma cells.

[0014] The present invention also provides a conjugate of a nucleic acid aptamer, characterized in that the conjugate comprises the above-mentioned nucleic acid aptamer and a substance for labeling, detection, diagnosis or treatment attached to the nucleic acid aptamer.

[0015] In some embodiments of the present invention, the substance is selected from at least one of radioactive substances, therapeutic substances, proteins, sugar residues, lipids, siRNA, miRNA, nanomaterials, biotin, digoxigenin, FAM, luminescent nanomaterials, and enzymes.

[0016] Those skilled in the art will understand that the ligation of the substance with the nucleic acid aptamer can be achieved through any one or more of the following methods: such as T4 DNA ligase ligation, PCR ligation, biosynthetic ligation, etc. Those skilled in the art will also understand that the sequences obtained after the above ligation should be able to specifically bind to lung cancer cells to meet the application requirements. In other words, the nucleic acid aptamer conjugates ligated with the substance all possess essentially the same or similar molecular structure, physicochemical properties, and functions as the original nucleic acid aptamers, and can all be used to specifically bind to lung cancer cells.

[0017] The present invention also provides a method for screening nucleic acid aptamers that specifically bind to lung cancer cells, characterized in that the screening method is a cell SELEX screening method, wherein the cell SELEX screening method uses lung cancer cells as positive screening cells and normal lung epithelial cells as negative screening cells.

[0018] In some embodiments of the present invention, the cell SELEX screening method includes the following steps: (1) designing and synthesizing an initial nucleic acid aptamer library with random sequences; (2) incubating the initial nucleic acid aptamer library with reverse screening cells and forward screening cells respectively to obtain nucleic acid sequences that bind to forward screening cells but do not bind to reverse screening cells, and using them as the library for the next round of screening; (3) repeating the screening process of step (2) for 3-9 rounds to obtain nucleic acid aptamers that specifically bind to forward screening cells.

[0019] In some embodiments of the present invention, the initial nucleic acid aptamer library is a single-stranded DNA (ssDNA) library.

[0020] In some embodiments of the present invention, the cell SELEX screening method further includes the step of monitoring library retention and affinity during the screening process. Preferably, library retention is detected by qRCR. Preferably, library affinity is detected by flow cytometry.

[0021] In some embodiments of the present invention, the cell SELEX screening method further includes a step of high-throughput sequencing of nucleic acid aptamers that bind to the positive screening cells in the final round of screening and selecting sequences with higher enrichment levels. The sequences with higher enrichment levels are the nucleic acid aptamers that specifically bind to the positive screening cells.

[0022] In some embodiments of the present invention, the length of the nucleic acid aptamers in the initial nucleic acid aptamer library is 30-60 nucleotides. In some embodiments of the present invention, the sequence of the nucleic acid aptamers in the initial nucleic acid aptamer library includes a primer sequence and a random sequence, wherein the length of the random sequence is 30-40 nucleotides, preferably 35-38 nucleotides. In some embodiments, the full length of the nucleic acid aptamer sequence is 55-80 nucleotides.

[0023] In some embodiments of the present invention, the cell SELEX screening method includes 5-10 rounds of screening, preferably 4-7 rounds, each round including reverse screening and forward screening. Preferably, in each round of screening, a reverse screening is performed first, followed by a forward screening. In some embodiments of the present invention, the cell SELEX screening method reduces the library usage starting from the second round of screening. Preferably, the library usage decreases by 40%-90% with each round. Preferably, the library usage in the final round of screening is 2%-5% of the library usage in the first round of screening.

[0024] In some embodiments of the present invention, the cell SELEX screening method reduces the library-cell incubation time starting from the second round of screening. Preferably, the incubation time is reduced by 10-20 minutes each time. Preferably, the incubation time for the last 1-4 rounds of screening is 30 minutes.

[0025] The present invention also provides the use of the above-mentioned nucleic acid aptamers or conjugates in the preparation of lung cancer diagnostic reagents or kits.

[0026] The present invention also provides reagents or kits for the diagnosis of lung cancer, characterized in that the reagents or kits comprise the above-mentioned nucleic acid aptamers or the above-mentioned conjugates.

[0027] The present invention also provides the use of the above-mentioned nucleic acid aptamers or conjugates in the preparation of medicaments for treating lung cancer or in compositions for targeting lung cancer cells.

[0028] The present invention also provides a medicament for treating lung cancer or a composition for targeting lung cancer cells, characterized in that it comprises the above-mentioned nucleic acid aptamer or the above-mentioned conjugate.

[0029] The present invention has at least the following beneficial effects: The present invention improves the cell SELEX screening method by using lung cancer cells as positive screening cells and normal lung epithelial cells as negative screening cells, and increasing the screening pressure in each round to improve the screening efficiency. Nucleic acid aptamers Apt-1 and Apt-2 with high specificity and affinity for lung cancer cells were obtained. As a novel molecular recognition probe, the nucleic acid aptamers of the present invention have broad application prospects in early diagnosis and targeted therapy of lung cancer. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the specific embodiments of this disclosure or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0031] Figure 1 shows a schematic diagram of the screening process for nucleic acid aptamers; Figure 2 shows the retention rate of each round of screening in Example 1; Figure 3 shows the results of flow cytometry detection of library affinity in each round of screening in Example 1; Figure 4 shows the flow cytometry detection of GeoMean FITC-A binding of libraries to NCI-1650 and BEAS-2B cells in each round of screening in Example 1; Figure 5 shows the flow cytometry detection of GeoMean FITC-A binding of libraries to NCI-1650 and BEAS-2B cells in each round of screening in Example 1 (with corresponding background values ​​removed); Figure 6 shows the results of laser confocal fluorescence microscopy detection of the binding specificity of nucleic acid aptamers Apt-1 and Apt-2 to NCI-1650 and BEAS-2B cells. Detailed Implementation

[0032] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0033] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations according to this application. As used herein, the singular form includes the plural form unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this description, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0034] The cell culture, molecular biology, immunology, microbiology, genetics, analytical chemistry, organic synthetic chemistry, medical and medicinal chemistry, and protein and nucleic acid hybridization described herein are well-known and widely used by those skilled in the art. Unless otherwise stated, all reagents used in the examples are commercially available or prepared according to conventional or disclosed methods and are ready for direct use without further processing; similarly, the instruments used in the examples are commercially available. Unless otherwise stated, molecular biology reagents are used according to the manufacturer's specifications.

[0035] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] Example 1. Nucleic Acid Aptamer Screening 1. Construction of Initial Nucleic Acid Library Design and synthesis of a single-stranded DNA library lib1-76nt with random sequences, the sequence information of which is as follows: GGGACCAGCACACGCATAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTTATGCGTGCTACCGTG (SEQ ID NO: 3). Where N represents any base among A, T, C, and G.

[0037] Table 1. Library and primer sequences

[0038] 2. First round of screening (1) Take one tube of the synthesized lib1-76nt library dry powder, centrifuge at 14000g for 10min, add 138μL DPBS, vortex to dissolve the dry powder, centrifuge at 14000g for 10min, and dispense into PCR tubes.

[0039] (2) Place the sample in a PCR instrument for renaturation. The procedure is: 95℃ for 10 min, then immediately in an ice water bath for 5 min, and equilibrate to room temperature.

[0040] (3) Add the refolded library to BEAS-2B reverse screening cells, mix slowly by pipetting, and incubate on ice for 60 min on a shaker; (4) Centrifuge at 1000 rpm at room temperature for 5 min, and aspirate the supernatant with a pipette tip and label it as pool-.

[0041] Wash cells with 200 μl of DPBS, centrifuge at 1000 rpm at room temperature for 5 min, and label the supernatant as wash1-; wash cells with 200 μl of DPBS, centrifuge at 1000 rpm at room temperature for 5 min, and label the supernatant as wash2-; wash cells with 200 μl of DPBS, centrifuge at 1000 rpm at room temperature for 5 min, and label the supernatant as wash3-; wash cells with 200 μl of DPBS, centrifuge at 1000 rpm at room temperature for 5 min, and label the supernatant as wash4-.

[0042] Add 200 μl of ultrapure water to the cells and boil for 10 min. Centrifuge at 10000 rpm for 2 min at room temperature. Label the supernatant as Elution-.

[0043] (5) Add pool- to NCI-H1650 positive sieve cells, mix slowly with a pipette, and incubate on ice for 60 min on a shaker; after centrifuging at 1000 rpm at room temperature for 5 min, aspirate the supernatant with a pipette tip and record it as pool+.

[0044] Wash cells with 200 μl of DPBS, centrifuge at 1000 rpm at room temperature for 5 min, and label the supernatant as wash1+; wash cells with 200 μl of DPBS, centrifuge at 1000 rpm at room temperature for 5 min, and label the supernatant as wash2+; wash cells with 200 μl of DPBS, centrifuge at 1000 rpm at room temperature for 5 min, and label the supernatant as wash3+; wash cells with 200 μl of DPBS, centrifuge at 1000 rpm at room temperature for 5 min, and label the supernatant as wash4+.

[0045] Add 200 μl of ultrapure water to the cells and boil for 10 min. Centrifuge at 10000 rpm for 2 min at room temperature. Label the supernatant as Elution+.

[0046] (6) Take an 8-tube Roche PCR apparatus, add 30 μl of Q-PCR mix to each well, then add 1 μl each of Elution- and Elution+, and perform quantitative real-time PCR. Calculate the retention rate (two replicates for each retention rate). The PCR program is as follows: 95℃ for 2 min; 95℃ for 0.5 min, 57℃ for 0.5 min, 72℃ for 0.5 min, 25 cycles. The composition of the Q-PCR mix is ​​as follows:

[0047] (7) Preparation of single-stranded DNA: Take 2 ml of ePCR mix out of -20℃, add it to the remaining Elution+, transfer it to a 50 ml centrifuge tube and mix well. Add 8 ml of EM90 oil, place on a high-power vortex mixer and vortex to prepare an emulsion. The composition of the ePCR mix is ​​as follows:

[0048] The emulsion was aliquoted into PCR tubes, 90 μl per tube. The PCR program was: 95℃ for 2 min; 95℃ for 1 min, 57℃ for 1 min, 72℃ for 1 min, 25 cycles.

[0049] Recover the ePCR product. Concentrate the ePCR product with n-butanol, transfer the ePCR product to a 10ml centrifuge tube, fill with n-butanol, mix well, and centrifuge at 10000g for 10 min. After centrifugation, separate the layers, remove the upper clear layer, and transfer the lower amplification product to a small EP tube (approximately 100μl). Take 90μl and transfer it to a small centrifuge tube, add 100μl of Urea loading buffer, mix well, and heat in a PCR instrument at 95 degrees Celsius for 10 min.

[0050] Single-stranded DNA was separated by denaturing PAGE electrophoresis, and ssDNA was concentrated with n-butanol. The ssDNA was dialyzed overnight in a 3.5 kDa dialysis bag with DPBS, and the concentration was determined by micro-UV microscopy. The obtained ssDNA (pool1) was used as the library for the next round of screening.

[0051] 3. Rounds 2-6 of the screening: The screening criteria change in each round from round 2 to round 6, as shown in the table below. The other steps are the same as above.

[0052] Table 2. Screening criteria for each round of library screening

[0053] 4. Screening Results The retention rates of the six rounds of library screening are shown in Table 3 and Figure 2.

[0054] Table 3. Retention rates of each round of library screening

[0055] It can be seen that the retention rate of the first four rounds of positive screening increased in each round; the retention rate decreased after 10% serum was added in the fifth round and 30% serum was added in the sixth round.

[0056] 5. Flow cytometry detection of library affinity (1) The ssDNA obtained from each round of screening, namely pool1, pool2, pool3, pool4, pool5 and pool6, were diluted with DPBS to 200nM*150μl, aliquoted into PCR tubes, and placed in a PCR instrument for renaturation. The program was: 95℃*10min, immediately followed by an ice-water bath for 5min, and then equilibration to room temperature.

[0057] (2) Divide the positive and negative screening cells into 6 equal parts, take 2 parts of each part (one positive screening (Target+) and one negative screening (Target-)), centrifuge to remove the supernatant, add 50 μl of the renatured library to each part, add 5 μl of salmon sperm DNA at 1 mg / ml to each part, mix well, and incubate in an ice water bath for 1 h.

[0058] (3) Place it in a centrifuge and centrifuge at 4℃ for 5 minutes, then remove the supernatant.

[0059] (4) Add 200 μl of cooled DPBS, vortex gently, centrifuge at 1000 g for 5 min at 4 °C, and rinse once. Then add cooled DPBS to resuspend.

[0060] (5) Library affinity was measured by flow cytometry, and the results are shown in Figure 3. The average fluorescence intensity (GeoMean FITC-A) of each group of samples was taken and plotted. The results are shown in Table 4 and Figure 4.

[0061] Table 4.

[0062] The fluorescence values ​​obtained in the previous step were subtracted from the corresponding blank background values, and the results were plotted as shown in Table 5 and Figure 5.

[0063] Table 5.

[0064] With each screening round, the binding of the library to NCI-H1650 cells increased significantly (the average fluorescence intensity of GeoMean FITC-A increased by up to 6.2 times), while the binding to cells selected from the reverse screening did not increase significantly (the average fluorescence intensity of GeoMean FITC-A increased by up to 2.9 times). The selected libraries exhibited superior affinity and specificity.

[0065] 6. High-throughput sequencing sample preparation and sequencing results (1) The ssDNA obtained from each round of screening was used as a single-stranded template. 0.5 μM * 10 μl was added to 400 μl of PCR mix and dispensed into eight-tube PCR tubes, 100 μl per well. PCR amplification was performed on a Bio-Rad instrument for 25 cycles. The PCR program was as follows: 95℃ pre-denaturation for 1 min, 95℃ denaturation for 60 s, 60℃ for 60 s, and 72℃ for 60 s. The information of the forward-labeled primers used is shown in Table 6.

[0066] Table 6. Forward tag primers for high-throughput sequencing

[0067] The reverse primer is Lib1A2: CACGGTAGCACGCATAACGC (SEQ ID NO: 5).

[0068] (2) After PCR, 20 μl of each sample was taken for preservation and electrophoresis detection, and the rest were mixed and dispensed into two 15 ml centrifuge tubes and concentrated with n-butanol to a volume of about 100 μl.

[0069] (3) The double strands were recovered using the UNIQ-10 oligonucleotide purification kit. The resulting dsDNA solution was labeled Apt-NCI-H1650 with a mass concentration of 416.9 μg / μl and a volume of 180 μl. 10 μl of the purified sample was subjected to 3% agarose gel electrophoresis, and the remainder was sequenced.

[0070] (4) The obtained raw sequencing results were analyzed using software to extract sequences according to the tag primers, resulting in a total of 1,255,852 sequences, of which 1,048,576 were sequence types. The sequences with higher enrichment levels were selected from the obtained enriched libraries. The specific sequences are as follows: Apt-1: CACGCATAACCCACCCCATCTGTCCCGTCCCCCTGCTGTGTCCCTCGCGTTATGCGTG (SEQ ID NO: 1) Apt-2: CACGCATAACCCTGCTACTATAGCGACCTATGGAGTCTTAACGGGCTGCGTTATGCGTG (SEQ ID NO: 2).

[0071] Example 2. Specific binding of Apt-1 and Apt-2 to lung cancer cells. Approximately 1 x 10⁻⁶ cells cultured in a cell dish... 6Both positive screening cells (NCI-1650) and negative screening cells (BEAS-2B) were washed three times with PBS1 at 37°C, then incubated with FAM-labeled aptamers Apt-1 and Apt-2 in DPBS solution at 37°C for 30 minutes. After removing the supernatant, the cells were washed three times with PBS at 37°C, and observed and photographed under a fluorescence microscope.

[0072] As shown in Figure 6, both nucleic acid aptamers Apt-1 and Apt-2 specifically bound to lung cancer cells NCI-1650, but not to normal lung epithelial cells BEAS-2B.

[0073] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to lung cancer cells, characterized in that, The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. The nucleic acid aptamer according to claim 1, characterized in that, The nucleic acid aptamer also includes modification, and the modified nucleic acid aptamer specifically binds to lung cancer cells.

3. The nucleic acid aptamer according to claim 2, characterized in that, The modification includes at least one of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization.

4. A method for screening nucleic acid aptamers that specifically bind to lung cancer cells, characterized in that, The screening method is the SELEX cell screening method, which uses lung cancer cells as positive screening cells and normal lung epithelial cells as negative screening cells.

5. A conjugate of nucleic acid aptamers, characterized in that, The conjugate includes the nucleic acid aptamer as described in any one of claims 1-3 and a substance for labeling, detection, diagnosis or treatment attached to the nucleic acid aptamer.

6. The conjugate according to claim 5, characterized in that, The substance is selected from at least one of radioactive substances, therapeutic substances, proteins, sugar residues, lipids, siRNA, miRNA, nanomaterials, biotin, digoxigenin, FAM, luminescent nanomaterials, and enzymes.

7. The use of the nucleic acid aptamer according to any one of claims 1-3 or the conjugate according to claim 5 or 6 in the preparation of lung cancer diagnostic reagents or kits.

8. A reagent or kit for the diagnosis of lung cancer, characterized in that, The reagent or kit comprises the nucleic acid aptamer as described in any one of claims 1-3 or the conjugate as described in claim 5 or 6.

9. The use of the nucleic acid aptamer according to any one of claims 1-3 or the conjugate according to claim 5 or 6 in the preparation of a medicament for treating lung cancer or a composition for targeting lung cancer cells with a medicament.

10. A drug for treating lung cancer or a composition for targeting lung cancer cells, characterized in that, Includes the nucleic acid aptamer as described in any one of claims 1-3 or the conjugate as described in claim 5 or 6.

Images