Application of myocardial injury marker RSPO1 in preparation of products for identifying cardiovascular diseases

By evaluating the expression profile of LGR4 ligand and constructing a human RSPO1 mutant mouse model, the problem of accurately regulating macrophage phenotypic transformation in existing technologies has been solved, enabling precise diagnosis and early intervention of cardiovascular diseases and providing new drug targets and diagnostic tools.

CN121978344APending Publication Date: 2026-05-05RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Filing Date
2025-12-31
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Current technologies lack key molecules for Lgr4-metabolic recoding-macrophage phenotypic transformation, making it difficult to precisely regulate inflammatory responses and affecting the prevention and treatment of heart failure after myocardial infarction.

Method used

By evaluating the expression profile of LGR4 ligands in cardiovascular diseases, especially the significant differential expression of RSPO1, we clarified its role as an upstream regulatory mechanism of LGR4, provided RSPO1 as a biomarker for myocardial injury, and used it to prepare cardiovascular disease diagnostic products. We also used CRISPR-Cas9 technology to construct a human RSPO1 point mutant mouse model to simulate the pathological process of human diseases.

Benefits of technology

It enables precise regulation of macrophage phenotypic transformation, reduces inflammatory response, provides cross-species applicable diagnostic biomarkers for cardiovascular diseases, improves the early diagnosis and intervention capabilities for heart failure after myocardial infarction, and enhances target support for clinical drug development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121978344A_ABST
    Figure CN121978344A_ABST
Patent Text Reader

Abstract

The invention relates to application of a myocardial injury marker RSPO1 in preparation of a product for identifying cardiovascular diseases. The invention evaluates the expression profiles of all LGR4 ligands under cardiovascular diseases at present, provides the application of RSPO1 as a potential drug target, and further provides the application of the myocardial injury marker RSPO1 in preparation of products for identifying cardiovascular diseases based on the application. The invention also provides application of the reagent for detecting the RSPO1 protein level in preparation of products for diagnosing cardiovascular diseases. According to the invention, the problem of insufficient adaptability and specificity of the existing marker is solved, RSPO1 is developed into a diagnostic marker, a DY4645-05 ELISA kit is adopted for detection and adaptation of multiple samples such as serum, multiple cardiovascular diseases can be diagnosed, cross-species application is realized, a basic research and clinical diagnosis detection system is unified, and powerful support is provided for diagnosis and treatment of cardiovascular diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of biomedicine and biomedical detection technology, and in particular to the application of RSPO1, a myocardial injury marker, in the preparation of products for identifying cardiovascular diseases. Background Technology

[0002] Heart failure is the end stage of various heart diseases and a major public health problem threatening human health. Coronary atherosclerotic heart disease (CAD) accounts for approximately 50% of all heart failure cases, ranking first among causes. Although timely reperfusion therapy can reduce early mortality and complications in CAD patients with myocardial infarction, many still develop ventricular remodeling and heart failure over time. This is a significant reason for repeated hospitalizations and even death in CAD patients after myocardial infarction, severely impacting their long-term prognosis. Currently, the pathophysiological processes and specific mechanisms of heart failure caused by myocardial infarction are not fully understood. Given the increasing number of myocardial infarction patients, in-depth exploration of the key molecules and specific mechanisms of ventricular remodeling after myocardial infarction will help intervene, delay, and even prevent the progression to heart failure in myocardial infarction patients, improve their prognosis, and has significant practical implications for promoting the translation and application of basic research on myocardial infarction in clinical practice.

[0003] Previous studies have shown that coordinated and orderly inflammatory responses, recruitment of inflammatory cells, and phenotypic changes play a crucial role in regulating myocardial infarction injury repair and ventricular remodeling. Macrophages, as the most numerous inflammatory cells in cardiac tissue, are a core component of the myocardial infarction immune microenvironment. Macrophages participate in the post-myocardial infarction cardiomyocyte response by efficiently phagocytizing necrotic cardiomyocytes, while simultaneously co-regulating the post-myocardial infarction non-cardiomyocyte response, participating in the regulation of neutrophil, fibroblast, and endothelial cell functions. Previous animal studies have found that macrophage-specific Lgr4 knockout significantly inhibits the infiltration of pro-inflammatory macrophages and the expression of inflammatory cytokines, and increases the number of Ly6clow-anti-inflammatory macrophages, thereby improving the development of ventricular remodeling and heart failure after myocardial infarction. However, its potential ligands and its upstream regulatory mechanisms in cardiovascular diseases remain unclear.

[0004] CN121027535A discloses the application of IGSF1 protein as a biomarker for cardiac function recovery. It provides the use of this protein as a biomarker in the preparation of products for detecting and / or diagnosing heart failure with improved ejection fraction; the protein includes one or more of the following: IGSF1, LIMS1, MPP1, PTX3, SLC2A3, FERMT3, ARPC1B, IGHG1, PTGS1, ACTN1, and RTN4. A novel serum biomarker is provided whose expression level can accurately predict heart failure patients with reduced ejection fraction and potential for cardiac function recovery, and whose changes precede changes in ejection fraction.

[0005] CN118443947A discloses an early circulating plasma biomarker for detecting coronary atherosclerotic heart disease, amyloid protein P component (APCS), and its application. It also discloses the application of this biomarker in the preparation of diagnostic kits or reagents to differentiate between patients with coronary heart disease and healthy individuals. This biomarker, screened using human plasma proteomics technology, is more sensitive and specific as a molecular marker. It has been validated by plasma ELISA, demonstrating that APCS may be involved in the pathogenesis of coronary heart disease and can serve as an early diagnostic biomarker and a novel therapeutic target for the disease.

[0006] However, the aforementioned existing technologies lack key molecules that regulate Lgr4-metabolic recoding-macrophage phenotypic transformation. Therefore, identifying key molecules (or ligands) that regulate Lgr4-metabolic recoding-macrophage phenotypic transformation is beneficial for precisely regulating macrophage phenotypic transformation, reducing inflammatory responses, and also for the development and clinical intervention of neutralizing antibodies and other clinical drugs. This has significant value for the prevention and treatment of heart failure after myocardial infarction. Summary of the Invention

[0007] To better identify cardiovascular diseases, this invention provides the application of the myocardial injury marker RSPO1 in the preparation of products for identifying cardiovascular diseases.

[0008] This invention evaluates the expression profiles of all LGR4 ligands in cardiovascular diseases and provides the application of RSPO1 as a potential drug target. Based on this, this application further provides the application of the myocardial injury marker RSPO1 in the preparation of products for identifying cardiovascular diseases, and provides the application of reagents for detecting RSPO1 protein levels in the preparation of products for cardiovascular disease diagnosis.

[0009] This invention clarifies the upstream regulatory mechanism of LGR4 ligand in cardiovascular diseases, precisely regulates the phenotypic transformation of macrophages, and reduces inflammatory responses.

[0010] The objective of this invention can be achieved through the following technical solutions: Firstly, this invention provides the application of the myocardial injury marker RSPO1 in the preparation of products for identifying cardiovascular diseases.

[0011] This application investigated the expression profiles of all LGR4 ligands in cardiovascular diseases. In particular, this invention provides the expression levels of RSPO1, RSPO2, RSPO3, RSPO4, NORRIN, and RANKL in mouse heart tissue under cardiovascular disease conditions. The study found significant differential expression of RSPO1 under cardiovascular disease conditions, revealing its effectiveness as an upstream regulatory mechanism of LGR4 and demonstrating its potential as a cardiovascular drug target. Therefore, this application uses RSPO1 or its gene as a biomarker for assessing cardiovascular disease.

[0012] Specifically, in this study, mouse single-cell sequencing and transgenic tracing mice confirmed that RSPO1 primarily originates from cardiac fibroblasts. This demonstrated significant differential expression of RSPO1 in mouse cardiovascular disease, revealing its effectiveness as an upstream regulatory mechanism of LGR4 and showcasing its potential as a cardiovascular drug target. Further research indicates that RSPO1 is also universally applicable in human and rat cardiac tissues.

[0013] In one embodiment of the present invention, the product includes a reagent kit and a chip.

[0014] In one embodiment of the present invention, the cardiovascular disease is selected from one or more of atherosclerosis, ischemic cardiomyopathy, hypertrophic cardiomyopathy, and heart failure.

[0015] Secondly, this invention provides the application of reagents for detecting RSPO1 protein levels or the RSPO1 gene in the preparation of products for cardiovascular disease diagnosis.

[0016] In one embodiment of the present invention, the product includes a reagent kit and a chip.

[0017] In one embodiment of the present invention, the reagent for detecting RSPO1 protein levels is an antibody that can specifically bind to RSPO1.

[0018] In one embodiment of the present invention, the cardiovascular disease is selected from one or more of atherosclerosis, ischemic cardiomyopathy, hypertrophic cardiomyopathy, and heart failure.

[0019] In one embodiment of the present invention, the biological sample targeted by the reagent for detecting RSPO1 protein level or RSPO1 gene is selected from serum, plasma, whole blood or saliva, etc., but serum is more preferred.

[0020] In one embodiment of the present invention, the biological species targeted by the reagent for detecting RSPO1 protein levels or the RSPO1 gene are selected from humans, mice, rats, and pigs.

[0021] Thirdly: The present invention provides products for the diagnosis of cardiovascular diseases, said products comprising reagents for RSPO1 protein levels or RSPO1 genes.

[0022] In one embodiment of the present invention, the product includes a reagent kit and a chip.

[0023] In one embodiment of the present invention, the product further includes a reagent for processing biological samples, the biological samples being selected from serum, plasma, whole blood, or saliva, etc.

[0024] Fourth aspect: The present invention provides the application of a mutant of human RSPO1 in the preparation of an ischemic cardiomyopathy model, wherein the mutant of human RSPO1 is the R219W point mutation of human RSPO1.

[0025] This application identified multiple single nucleotide mutation sites in RSPO1 in an obese adolescent cohort. Based on the relationship between obesity, metabolic abnormalities and cardiovascular disease, this finding explores the correlation between RSPO1 activating SNP mutations and cardiovascular disease.

[0026] Furthermore, this invention selects the mutation site with the strongest effect and uses CRISPR-Cas9 technology to construct human point mutant mice.

[0027] Preferably, gRNA targeting the mouse Rspo1 gene, donor oligonucleotides containing the p.R219W (CGG to TGG) mutation, and Cas9 protein are designed and co-injected into fertilized mouse eggs to produce offspring with the target gene knockout.

[0028] Preferably, the application of human RSPO1 point mutant mice in the preparation of coronary atherosclerosis and ischemic cardiomyopathy is provided.

[0029] The preparation of human RSPO1 p.R219W point mutant mice included: S1: The gRNA targeting the mouse Rspo1 gene, the donor oligonucleotide containing the p.R219W mutation, and the Cas9 protein were co-injected into fertilized mouse eggs to produce offspring with the target gene knockout. gRNA (matching reverse strand of gene): GCCTGTTGGCATTCTCCCTCCGG (shown in SEQID NO.1) S2: Positive F0 generation heterozygous mutant mice were mated with wild-type C57BL / 6 mice to obtain F1 generation mice. 7-10 days after the birth of F1 generation mice, the genotype was identified by tail tip tissue sequencing, and F1 generation mice carrying the p.R219W heterozygous mutation were screened out. S3: Select F1 generation heterozygous mutant mice for crossbreeding to obtain F2 generation mice. Select homozygous mutant mice by sequencing. The homozygous mutant mice are the stable human RSPO1 p.R219W point mutant mice. The sequence of the homozygous RSPO1 p.R219W mouse is as follows: AACTGTTGCAGGGCAGAAGAGGAGGAAGGGGGGCCAGGGCTGGAGGGAGAATGCCACAGGCATCCGGCCAGGAAGAACA (shown in SEQ ID NO.2) The sequence of wild-type mice is: AACTGTTGCAGGGCAGAAGAGGAGGAAGGGGGGCCAGGGCCGGAGGGAGAATGCCACAGGCATCCGGCCAGGAAGAACA (shown in SEQ ID NO.3) This invention provides the application of the myocardial injury biomarker RSPO1 in the preparation of products for identifying cardiovascular diseases, and the application of reagents for detecting RSPO1 protein levels in the preparation of products for cardiovascular disease diagnosis. Specifically, it has applications in diagnosing coronary atherosclerosis, ischemic cardiomyopathy, and other cardiovascular diseases. By detecting serum RSPO1 protein levels, it assists in the assessment of patients' risk of coronary heart disease and heart failure, and in the early diagnosis and intervention of these conditions, providing new targets and intervention strategies for the clinical diagnosis and treatment of cardiovascular diseases.

[0030] Compared with the prior art, the present invention has the following beneficial effects: 1. In terms of mechanism research, we have broken through the fragmented limitations of existing LGR4 ligand research and conducted the first systematic evaluation of the expression profiles of all LGR4 ligands, including RSPO1, RSPO2, RSPO3, RSPO4, Norrin, and RANKL, in cardiovascular diseases. We have clarified that RSPO1 has the most significant expression difference after myocardial infarction and determined that it mainly originates from cardiac fibroblasts by using single-cell sequencing and transgenic tracing mice, providing key targets for precise intervention.

[0031] 2. In terms of model construction, to overcome the problem of low matching degree between existing models and the genetic background of human diseases, based on the RSPO1 p.R219W mutation found in the obese adolescent cohort, and targeting the key role of obesity and metabolic and cardiovascular diseases, human point mutation mice were constructed using CRISPR-Cas9 technology. This model can simulate the pathological process of human diseases and can be used for research on atherosclerosis and ischemic cardiomyopathy, thereby improving the accuracy of preclinical drug evaluation.

[0032] 3. In terms of diagnostic applications, to address the shortcomings of existing biomarkers in terms of adaptability and specificity, RSPO1 will be developed as a diagnostic biomarker and detected using the DY4645-05 ELISA kit. It is compatible with multiple samples, including serum, and can diagnose a variety of cardiovascular diseases. It is also applicable across species, unifying the basic research and clinical diagnostic testing system, and providing strong support for the diagnosis and treatment of cardiovascular diseases. Attached Figure Description

[0033] Figure 1 This is a schematic diagram of the expression profile of LGR4 ligand in cardiac tissue RNA-seq at different time points after myocardial infarction.

[0034] Figure 2 This is a schematic diagram illustrating the expression profile of LGR4 ligand at different time points after myocardial infarction in an in vivo myocardial infarction model combined with RT-qPCR experiments.

[0035] Figure 3 A schematic diagram illustrating the origin of RSPO1 in mice analyzed using single-cell sequencing and RSPO1 tracing.

[0036] Figure 4 A schematic diagram of constructing a human RSPO1 point mutant mouse based on CROSPR-CAS9 technology is shown, where the WT gene sequence is: GGGGGGCCAGGGCCGGAGGGAGA (SEQ ID NO.4); and the RSPO1-MUT gene sequence is GGGGGGCCAGGGCTGGAGGGAG (SEQ ID NO.5).

[0037] Figure 5 A schematic diagram illustrating the preparation of an acute myocardial injury mouse model based on human RSPO1 point mutant mice.

[0038] Figure 6 A schematic diagram illustrating a method for detecting human serum RSPO1 levels as a means of early diagnosis of acute coronary syndrome. Detailed Implementation

[0039] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are based on the technical solution of the present invention and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.

[0040] Unless otherwise specified, the experimental methods described in the following examples are routine biomedical and chemical laboratory experimental methods.

[0041] Example 1: To clarify the potential of RSPO1 as a drug target for cardiovascular diseases, this invention collected the expression profiles of all LGR4 ligands, including RSPO1-4 (RSPO1, RSPO2, RSPO3, RSPO4), NORRIN, and RANKL, and reanalyzed their expression profiles in cardiovascular diseases. The results are as follows: Figure 1 As shown, RSPO1 showed the most significant differential expression level after myocardial infarction.

[0042] To further validate the above expression profile in vitro, a myocardial infarction model was constructed in wild-type C57BL / c mice at approximately 8 weeks of age. The specific construction method is as follows: 1) Endotracheal intubation: Mice were anesthetized in a 2% isoflurane anesthesia box for 15 minutes. After the anesthesia took effect, the mice were fixed in a supine position on a 37°C constant-temperature operating table. Then, non-invasive endotracheal intubation was performed orally using an endotracheal intubation tool, and a ventilator was connected. Successful endotracheal intubation was observed when the mouse's respiratory rhythm was the same as that of the ventilator. The anesthesia concentration was then adjusted to 1.0% and used until the end of the surgery. 2) Disinfection and intercostal separation: After successful cannulation, the mouse was fixed in a right lateral decubitus position on a temperature-controlled operating table. Hair on the chest and left subcostal region was removed using a small animal shaver to fully expose the surgical site. The surgical site was disinfected sequentially with 75% alcohol and povidone-iodine. A transverse incision was made 2-3 cm below the axilla, followed by blunt dissection of the subcutaneous fascia and muscle, taking care to avoid damaging blood vessels. The 3rd-4th intercostal space was bluntly dissected using toothless forceps, and a thoracic retractor was inserted to fully expose the heart. During heart exposure, care should be taken to avoid damaging the pericostal vessels and lung tissue to prevent massive hemorrhage and pneumothorax. 3) Expose the heart: Use a small animal thoracic retractor to expose the heart along the 3rd-4th intercostal space. At this time, the left atrial appendage, left ventricle, and lung tissue can be seen. Gently push the lung tissue along the left side and carefully separate the pericardium with toothless forceps to expose the coronary arteries. 4) Coronary artery ligation: The course of the coronary vessels was observed using an Olympus microscope. The left coronary artery appeared as a pale pink vessel, emerging from the lower edge of the left atrial appendage and extending downwards along the left ventricle to the apex of the heart. The course and location of the coronary artery were identified. Using a needle holder, an 8-0 suture with needles was used to ligate the coronary artery 2 mm below the lower edge of the left atrial appendage. After successful ligation, the infarcted cardiac tissue turned white, and local myocardial activity decreased. In the sham group, mice underwent endotracheal intubation, intercostal separation, and cardiac exposure, but the coronary arteries were not ligated. 5) Ischemia-reperfusion: The steps for constructing a mouse model of ischemia-reperfusion injury, including endotracheal intubation, exposure of the heart, and ligation of the coronary arteries, are the same as the experimental steps described above. The coronary arteries are ligated with 8-0 needle sutures for 45 minutes, and then the coronary artery ligation sutures are released. The chest cavity and skin are closed in sequence. 6) Close the thoracic cavity and skin; after successful coronary artery ligation, use 6-0 needle-supported sutures to close the thoracic cavity along the 3rd-4th intercostal space using a figure-eight suture, and suture the skin tissue using 3-0 needle-supported silk sutures. After the skin suturing is completed, remove the anesthesia equipment and continue to observe the mouse's vital signs for about 15 minutes. After the mouse resumes spontaneous breathing, remove the endotracheal tube. The above experimental animals have been approved by the animal ethics committee of the institution before the experiment (following the 3R principle: Replace, Reduce, Optimize), ensuring that the experimental procedures comply with animal welfare regulations. The approval number must be retained for future reference.

[0043] Heart tissues were collected on postoperative days 1, 3, 7, 14, and 28. mRNA was extracted using Trizol reagent and RT-qPCR was performed to determine the expression trend of the LGR4 ligand.

[0044] Table 1. Primers The results are as follows Figure 2 As shown, among all LGR4 ligands, only RSPO1 and RSPO3 showed significant increases after myocardial infarction, with RSPO1 showing the most significant upregulation trend among all LGR4 ligands.

[0045] Furthermore, to analyze the origin of RSPO1, the inventors used single-cell sequencing data of cardiac tissue from mice at different time points after myocardial infarction to perform expression profiling analysis. The results... Figure 3 As shown in A-3B, RSPO2 and RSPO4 were not detected in single-cell data due to their low expression levels. Among all detected LGR4 ligands, RSPO1 had the highest expression abundance, and it mainly originated from fibroblasts in cardiac tissue, confirming that RSPO1 is a more promising drug intervention target.

[0046] In previous reports, patent CN114958861A utilized the tdTomato labeling system to mark and track RSPO1 mice. This invention uses CRISPR-CAS9 technology to add a tdTomato sequence to the end of the RSPO1 genome in mice. This strategy results in all RSPO1-expressing cells being labeled with red fluorescence. To confirm the origin of RSPO1, the inventors obtained these mice and constructed a myocardial infarction model. Seven days after surgery, heart tissue was collected for OCT embedding and frozen sectioning. The tissue was co-stained with tdTomato and the fibroblast marker gene (Vimentin) to determine whether RSPO1 originates from fibroblasts and to investigate the changes in RSPO1-positive fibroblast expression trends after myocardial infarction. Figure 3The results showed that RSPO1 and vimentin co-localize, and myocardial infarction treatment significantly increased the number of RSPO1+Vimentin+ cells in cardiac tissue, further confirming that the origin and expression pattern of RSPO1 match the cardiovascular disease state and confirming its potential as a drug target for cardiovascular diseases.

[0047] Example 2: This invention provides a human RSPO1 point mutation site and its application in the preparation of an ischemic cardiomyopathy model.

[0048] In previous studies, screening of all Wnt-related paracrine factors in 1994 obese patients and 2161 controls revealed that 12 obese patients carried the same mutation in RSPO1 (p.R219W / Q), a mutation that predisposes to obesity in humans. Further mechanistic studies showed that this mutation disrupts the electrostatic interaction between RSPO1 and the extracellular matrix, leading to excessive RSPO1 release, which in turn activates the LGR4-Wnt / β-catenin signaling pathway, thereby activating intracellular signaling pathways. To explore the relationship between this RSPO1 SNP mutation and cardiovascular disease, this invention used CRISPR-Cas9 technology to construct human point-mutant mice: the coding sequence (CDS) of the mouse Rspo1 gene and the p.R219W mutation site in the human RSPO1 gene (corresponding to arginine → tryptophan at amino acid position 219, and CGG → TGG in the nucleotide sequence) were obtained from the NCBI database. A gRNA targeting the mouse Rspo1 gene, a donor oligonucleotide containing the p.R219W (CGG to TGG) mutation (specific gRNA sequence: GCCTGTTGGCATTCTCCCTCCGG), and Cas9 protein were designed and co-injected into fertilized mouse oocytes. Positive F0 generation heterozygous mutant mice were mated with wild-type C57BL / 6 mice to obtain F1 generation mice. 7-10 days after birth, the genotype of the F1 generation mice was identified by tail tip tissue sequencing. F1 generation mice carrying the p.R219W heterozygous mutation were selected. These F1 generation heterozygous mutant mice were then crossbred to obtain F2 generation mice. Homozygous mutant mice (showing only a single peak of "TGG" at the target site) were selected by sequencing. These homozygous mutant mice are the stably inherited human RSPO1 p.R219W point mutation mice, which can be used for subsequent cardiovascular disease model construction (such as coronary atherosclerosis and ischemic cardiomyopathy models) and related mechanism research. The construction results are as follows: Figure 4 As shown, combined with F2 generation sequencing results, this construction strategy yielded homozygous RSPO1 p.R219W point mutant mice.

[0049] Furthermore, to clarify the relationship between this human point mutation and cardiovascular disease, a myocardial infarction model was constructed using mice with homozygous genotypes or control mice. The specific procedure was as follows: The skin was incised along the left sternal border at the 3rd and 4th intercostal spaces. Subcutaneous tissue was bluntly dissected until the thoracic cavity and heart were exposed. The pericardium was gently opened with ophthalmic forceps, and a ligation was made 2 mm below the lower edge of the left atrial appendage using 6-0 silk (ensuring the ligation was appropriately tight; successful ligation was indicated by the anterior wall of the left ventricle turning pale and the pulsation weakening; if the ligation was too loose, myocardial infarction would not be obvious, while if it was too tight, cardiac arrest could easily occur). After ligation, the heartbeat was observed, and then the chest wall muscles and skin were sutured layer by layer. The wound was disinfected with iodine solution after suturing. All experimental animals were approved by the animal ethics committee of the institution before the experiment (following the 3R principle: Replace, Reduce, Optimize) to ensure that the experimental procedures complied with animal welfare regulations. The approval number was retained for future reference.

[0050] Echocardiography was used to assess changes in cardiac function in both groups of mice at 1, 3, 7, and 28 days post-surgery. The main indicators included left ventricular ejection fraction and short-axis constriction. Figure 5 The results showed that human RSPO1 point mutations aggravated postoperative heart failure after myocardial infarction, manifested as decreased left ventricular ejection fraction (LVEF) and short-axis stenosis rate (LVFS), accompanied by an increase in left ventricular end-diastolic volume (LVEDV). This confirmed that it can serve as an effective model of acute myocardial injury for a series of studies on the prognosis of RSPO1-mediated cardiovascular diseases.

[0051] Example 3: This invention provides the application of RSPO1 or its gene in the preparation of diagnostic reagents for atherosclerosis, ischemic cardiomyopathy, hypertrophic cardiomyopathy, and heart failure. RSPO1 or its gene can be used as a biomarker for judging cardiovascular diseases (especially myocardial injury).

[0052] Furthermore, this embodiment provides the application of RSPO1 as a biomarker for myocardial injury. The detection of RSPO1 protein levels in human serum using the double-antibody sandwich ELISA principle (DY4645-05 Human R-Spondin 1 DuoSet ELISA Development System) requires strict adherence to procedures including reagent preparation, plate preparation, and sample testing. The specific protocol is as follows: (1) Prepare antibodies: human RSPO1 capture antibody (843803), human RSPO1 detection antibody (843804), human RSPO1 standard (843805), streptavidin-HRP (893975).

[0053] (2) Coating with capture antibody: Add 100 μL of diluted human RSPO1 capture antibody (dilution ratio: 1:1000) to a 96-well microplate at a ratio of 1:1000. Seal the plate with sealing film and incubate at room temperature overnight. The next day, aspirate the liquid from each well and wash the plate. (3) Dilute the patient's serum sample 1:20, then add 100 μL / well of the diluted serum sample, human RSPO1 standard, and PBS solution as a blank control. Seal the plate with a new sealing film, incubate at room temperature for 2 hours, and then wash to remove impurities. Then add 100 μL / well of the diluted human RSPO1 detection antibody, seal the plate with a new sealing film, incubate at room temperature for 2 hours, and then wash the plate. (4) Then add 100 μL / well of diluted streptavidin-HRP, seal the plate, incubate at room temperature for 20 minutes, and then wash the plate; add 100 μL / well of substrate solution (a 1:1 mixture of chromogenic reagent A (hydrogen peroxide) and chromogenic reagent B (tetramethylbenzidine)), incubate at room temperature for 20 minutes, and then add 100 μL / well of stop solution (2 N H2SO4). Gently tap the plate to ensure even mixing. At this time, the solution color changes from blue to yellow. (5) Immediately afterwards, the absorbance of each well was measured at a wavelength of 450 nm using an ELISA reader, and the results were calculated.

[0054] Preoperative serum samples were collected from both healthy patients and patients with acute coronary syndrome (Appendix 1), and the protein level of RSPO1 in the serum was further detected using the above experimental methods. The results are as follows: Figure 6 As shown, the serum RSPO1 level in ACS patients was significantly higher than that in control patients, further suggesting its potential application as a biomarker for cardiovascular disease damage.

[0055] Appendix Table 1. Basic clinical characteristics of normal coronary angiography controls and ACS patients The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. Application of the myocardial injury marker RSPO1 in the preparation of products for identifying cardiovascular diseases.

2. Application of reagents for detecting RSPO1 protein levels or the RSPO1 gene in the preparation of products for cardiovascular disease diagnosis.

3. The application according to claim 2, characterized in that, The products include reagent kits and chips.

4. The application according to claim 2, characterized in that, The reagent used to detect RSPO1 protein levels is an antibody that can specifically bind to RSPO1.

5. The application according to claim 2, characterized in that, The cardiovascular disease mentioned is selected from one or more of the following: atherosclerosis, ischemic cardiomyopathy, hypertrophic cardiomyopathy, and heart failure.

6. The application according to claim 2, characterized in that, The biological samples used to detect RSPO1 protein levels or the RSPO1 gene are selected from serum, plasma, whole blood, or saliva.

7. A product for diagnosing cardiovascular diseases, characterized in that, The product includes reagents for RSPO1 protein levels or the RSPO1 gene.

8. The cardiovascular disease diagnostic product according to claim 7, characterized in that, The products include reagent kits and chips.

9. The cardiovascular disease diagnostic product according to claim 7, characterized in that, The product also includes reagents for processing biological samples selected from serum, plasma, whole blood, or saliva.

10. The application of human RSPO1 mutants in the preparation of ischemic cardiomyopathy models, characterized in that, The mutant of the human RSPO1 is the R219W point mutation of the human RSPO1.

Citation Information

Patent Citations

  • Application of IGSF1 protein as cardiac function recovery marker

    CN121027535A