Glucose metabolism reconstruction-based engineering bacterium for efficiently synthesizing rhamnolipid and construction method of engineering bacterium

By constructing a complete rhamnolipin synthesis module in *Pseudomonas putida* KT2440, weakening the glucose oxidation pathway, introducing a low-energy transport system, and enhancing glucose phosphorylation, the problem of low rhamnolipin synthesis efficiency was solved, enabling efficient and stable industrial production.

CN122012569APending Publication Date: 2026-05-12ZHEJIANG UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHEJIANG UNIV OF TECH
Filing Date
2026-02-28
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In the existing technology, the production of rhamnolipids synthesized by Pseudomonas aeruginosa fluctuates greatly and has potential pathogenicity, making it difficult to achieve stable and controllable large-scale production. Pseudomonas putida KT2440 lacks key functional genes for rhamnolipid synthesis, and it is necessary to reconstruct the glucose metabolism network through genetic engineering to improve the synthesis efficiency.

Method used

Heterologous expression of rhamnolipin synthesis-related genes in *Pseudomonas putida* KT2440 weakens the glucose oxidation pathway in the periplasmic space, introduces a low-energy glucose transport system, and enhances intracellular glucose phosphorylation capacity, thus constructing a complete rhamnolipin synthesis module.

Benefits of technology

It significantly improves the synthesis efficiency of rhamnolipids, reduces carbon source loss, lowers energy consumption, and achieves efficient and targeted allocation of glucose to the rhamnolipid synthesis pathway, making it suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012569A_ABST
    Figure CN122012569A_ABST
Patent Text Reader

Abstract

The invention discloses a glucose metabolism reconstruction-based engineering strain for efficiently synthesizing rhamnolipid and a construction method thereof, the construction method comprises the following steps: taking pseudomonas putida KT2440 or a flag gene cluster knockout strain thereof as an original strain, optimizing the genome of the original strain through gene modification, and introducing recombinant plasmids to obtain the engineering strain for efficiently synthesizing rhamnolipid; the modification comprises at least one of (1) to (6): (1) heterologous expression of rhamnolipid synthesis related genes; (2) replacing the rmlA gene with the gene rmlA *; (3) knocking out related genes for coding Gad; (4) heterologous expression of a galP gene encoding glucose transporter protein; (5) heterologous expression of the glf gene encoding the glucose transporter; and (6) overexpressing and coding the glk gene of glucokinase. The method disclosed by the invention has the beneficial effects that efficient directional distribution of glucose to a rhamnolipid synthesis route is realized, and the synthesis efficiency of the rhamnolipid is remarkably improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to an engineered bacterium that synthesizes rhamnolipin efficiently based on glucose metabolism reconstruction and its construction method. Background Technology

[0002] Rhamnolipids are a class of glycolipid biosurfactants composed of rhamnose groups linked to β-hydroxy fatty acids via glycosidic and ester bonds. They possess excellent surface and interfacial tension-reducing abilities, while also exhibiting good biodegradability, biocompatibility, and antibacterial activity. Due to their renewable and environmentally friendly origin, rhamnolipids have broad application prospects in food, pharmaceuticals, cosmetics, agriculture, oil extraction, and environmental remediation, making them one of the most extensively researched and applied biosurfactants. Currently, rhamnolipids are mainly obtained from *Pseudomonas aeruginosa* through fermentation. However, these strains have potential pathogenicity and low biosafety levels, severely limiting their application in industrial production and the food and pharmaceutical industries. Furthermore, rhamnolipid synthesis in *Pseudomonas aeruginosa* is influenced by a complex regulatory network, resulting in significant yield fluctuations, which is detrimental to stable and controllable large-scale production. Therefore, constructing engineered strains with high safety, clear genetic backgrounds, and suitability for industrial applications has become an important development direction for the green manufacturing of rhamnolipids.

[0003] *Pseudomonas putida* KT2440 is a widely studied and applied industrial chassis strain with advantages such as strong metabolic capacity, good environmental adaptability, a mature genetic manipulation system, and the absence of virulence factors, showing good potential in the synthesis of various bio-based chemicals and high-value-added products. However, *Pseudomonas putida* KT2440 is not a natural rhamnolipid-producing bacterium; its genome lacks the key functional genes and complete metabolic modules necessary for rhamnolipid synthesis, making it unable to synthesize rhamnolipids naturally. Therefore, if KT2440 is to be used as a host to achieve rhamnolipid biosynthesis, the relevant synthetic pathways must be introduced and reconstructed through genetic engineering.

[0004] The biosynthesis of rhamnolipids depends on three interconnected key metabolic modules: the glycoside module, the fatty acid module, and the rhamnolipid synthesis module. Glucose, as a carbon source, not only provides the carbon skeleton for the synthesis of rhamnosaccharide groups but also produces acetyl-CoA through central carbon metabolism, which further generates lipid precursors via the de novo fatty acid synthesis pathway. Therefore, the mode of glucose uptake and its metabolic allocation within the cell determine the efficiency of material and energy supply between the glycoside and fatty acid modules, with central carbon metabolism playing a pivotal regulatory role in the entire rhamnolipid synthesis network. In *Pseudomonas putida* KT2440, glucose is primarily metabolized via periplasmic oxidation and ATP-dependent active transport. A large amount of glucose is oxidized to gluconic acid and its derivatives before entering the cytoplasm, and a certain proportion of intermediate products are secreted extracellularly, resulting in carbon source loss. Simultaneously, the ATP-dependent glucose transport system significantly increases the cellular energy burden under high-flux metabolic conditions, reducing the allocation of carbon sources to the target product synthesis pathway. This glucose metabolism pattern, driven by environmental adaptation, shows significant shortcomings in engineering systems aimed at efficiently synthesizing rhamnolipids. Therefore, an engineered method is needed that uses the safe industrial chassis bacterium *Pseudomonas putida* KT2440 as a host, systematically reconstructing the glucose metabolism network to endow it with rhamnolipid synthesis capabilities while reducing carbon source loss and energy consumption, and improving the efficiency of the directed allocation of central carbon metabolism to the rhamnolipid synthesis pathway. This approach aims to overcome the aforementioned deficiencies in existing technologies.

[0005] Therefore, it is urgent to construct an engineered bacterium that synthesizes rhamnolipin efficiently based on glucose metabolism remodeling, break through existing technological bottlenecks, and promote the industrial production of rhamnolipin. Summary of the Invention

[0006] To address the problems of existing engineered strains that produce rhamnolipin, this invention provides an engineered bacterium for efficient rhamnolipin synthesis based on glucose metabolism remodeling and its construction method. By constructing a rhamnolipin synthesis module, reducing glucose oxidation in the periplasmic space, introducing a low-energy glucose transport system, and enhancing intracellular glucose phosphorylation capacity, efficient and directional allocation of glucose to the rhamnolipin synthesis pathway is achieved, thereby significantly improving the synthesis efficiency of rhamnolipin.

[0007] To solve the above problems, the technical solution adopted in this application is:

[0008] The first aspect of this invention is to provide a method for constructing an engineered bacterium for efficient rhamnolipid synthesis based on glucose metabolism remodeling. The method uses *Pseudomonas putida* KT2440 or a *flag* gene cluster knockout strain as the starting strain, optimizes the genome of the starting strain through genetic modification, and then introduces the recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C into the genetically modified strain to obtain the target engineered strain. The genetic modification includes at least one of the following (1) to (6):

[0009] (1) Heterologous expression of genes related to rhamnolipid synthesis;

[0010] (2) Replace the rmlA gene with the mutant rmlA*;

[0011] (3) Knock out genes encoding the gluconate-2-dehydrogenase complex enzyme system;

[0012] (4) Heterologous expression of the galP gene encoding the glucose transporter;

[0013] (5) Heterologous expression of the glf gene encoding the glucose transporter;

[0014] (6) Overexpression of the glk gene encoding glucokinase.

[0015] An engineered strain of *Pseudomonas putida* KT2440 capable of rhamnolipin synthesis was constructed using the construction method described in this invention. This engineered strain possesses the ability to synthesize rhamnolipin de novo. The construction method includes: using *Pseudomonas putida* KT2440 as the starting strain, and heterologously expressing rhamnolipin synthesis-related genes through gene modification (1); the genes include rhlA, rhlB, rmlB, rmlC and / or rmlD genes and (2) replacing the rmlA gene with the mutant rmlA*. Subsequently, the recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C was introduced into the genetically modified strain to obtain an engineered strain capable of efficiently synthesizing rhamnolipin.

[0016] Specifically, the construction method includes:

[0017] Using *Pseudomonas putida* KT2440 as the starting strain, key genes for rhamnolipid synthesis were heterologously expressed in the starting strain.

[0018] The rmlA gene in the rhamnose precursor synthesis pathway is replaced with a mutant rmlA*, which has enhanced catalytic performance and reduced feedback inhibition effect, thereby improving the synthesis efficiency of the rhamnose precursor dTDP-L-rhamnose and thus improving the synthesis efficiency of the rhamnose precursor.

[0019] A recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C for rhamnolipid synthesis was constructed and introduced into *Pseudomonas putida* KT2440 to obtain a recombinant genetically engineered strain capable of synthesizing rhamnolipids.

[0020] As a preferred embodiment of this application, the rhamnolipid synthesis-related genes are derived from Pseudomonas aeruginosa PAO1, including rhlA, rhlB, rmlB, rmlC and / or rmlD genes.

[0021] As a preferred embodiment of this application, the mutant rmlA* is derived from Salmonella enterica LT2.

[0022] As a preferred embodiment of this application, both the rhamnolipid synthesis-related gene and the mutant rmlA* are driven by the Lac promoter.

[0023] As a preferred embodiment of this application, the nucleotide sequence of the Lac promoter is shown in SEQ ID NO.1.

[0024] As a preferred embodiment of this application, the nucleotide sequence of the rhlA gene is shown in SEQ ID NO.2.

[0025] As a preferred embodiment of this application, the nucleotide sequence of the rhlB gene is shown in SEQ ID NO.3.

[0026] As a preferred embodiment of this application, the nucleotide sequence of the mutant rmlA* is shown in SEQ ID NO.4.

[0027] As a preferred embodiment of this application, the nucleotide sequence of the rmlB gene is shown in SEQ ID NO.5.

[0028] As a preferred embodiment of this application, the nucleotide sequence of the rmlC gene is shown in SEQ ID NO.6.

[0029] As a preferred embodiment of this application, the nucleotide sequence of the rmlD gene is shown in SEQ ID NO.7.

[0030] As a preferred embodiment of this application, the nucleotide sequence of the rhlAB gene is shown in SEQ ID NO.8.

[0031] As a preferred embodiment of this application, the nucleotide sequence of the rmlBDAC gene is shown in SEQ ID NO.9.

[0032] As a preferred embodiment of this application, the gene encoding the gluconate-2-dehydrogenase complex enzyme system is selected from at least one of the genes PP_3382, PP_3383, PP_3384, PP_3623, and PP_4232.

[0033] The engineered strain of *Pseudomonas putida* KT2440, which synthesizes rhamnolipids, was constructed using the construction method described in this invention. This engineered strain improves the efficient input of carbon sources to the center of metabolism by weakening the glucose oxidation pathway in the periplasmic space. The construction method includes: using *Pseudomonas putida* KT2440Δflag as the starting strain, knocking out the relevant gene encoding the gluconic acid-2-dehydrogenase complex enzyme system through gene modification (3), and then introducing the recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C into the gene-modified strain to obtain an engineered strain that weakens the glucose oxidation pathway in the periplasmic space.

[0034] Specifically, the construction method includes:

[0035] Using *Pseudomonas putida* KT2440Δflag as the starting strain, the genes encoding gluconate-2-dehydrogenase (Gad) PP_3382, PP_3383, PP_3384, PP_3623 and PP_4232 were knocked out in the genome to obtain engineered strains KTΔflagΔPP_3382, KTΔflagΔPP_3383, KTΔflagΔPP_3384, KTΔflagΔPP_3623 and KTΔflagΔPP_4232;

[0036] Using *Pseudomonas putida* KT2440Δflag as the starting strain, the genes encoding gluconate-2-dehydrogenase (Gad) PP_3382, PP_3383, PP_3384, PP_3623, and PP_4232 were knocked out in the genome to obtain engineered strains KTΔflagΔPP_4232ΔPP_3623, KTΔflagΔPP_4232ΔPP_3623ΔPP_3384, KTΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383, and KTΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382.

[0037] The recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C was introduced into the engineered strain to obtain a genetically engineered strain that weakens the glucose oxidation pathway in the periplasmic space.

[0038] As a preferred embodiment of this application, the nucleotide sequence of the gene PP_3382 is shown in SEQ ID NO.10.

[0039] As a preferred embodiment of this application, the nucleotide sequence of the gene PP_3383 is shown in SEQ ID NO.11.

[0040] As a preferred embodiment of this application, the nucleotide sequence of the gene PP_3384 is shown in SEQ ID NO.12.

[0041] As a preferred embodiment of this application, the nucleotide sequence of the gene PP_3623 is shown in SEQ ID NO.13.

[0042] As a preferred embodiment of this application, the nucleotide sequence of the gene PP_4232 is shown in SEQ ID NO.14.

[0043] The engineered strain of *Pseudomonas putida* KT2440, which synthesizes rhamnolipids, was constructed using the construction method described in this invention. This engineered strain reconstructs an efficient glucose transmembrane transport system by reducing energy consumption during glucose absorption. The construction method includes: using *Pseudomonas putida* KTΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 as the starting strain, and genetically modifying the genome of the starting strain by (4) heterologously expressing the galP gene encoding the glucose transporter and (5) heterologously expressing the glf gene encoding the glucose transporter. Then, the recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C was introduced into the genetically modified strain to obtain an engineered strain that reconstructs an efficient glucose transmembrane transport system.

[0044] Specifically, the construction method includes:

[0045] Using *Pseudomonas putida* KTΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 as the starting strain, the galP gene was inserted into the gtsABCD gene position on the genome of the starting strain to obtain the engineered strain KTΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP;

[0046] Using *Pseudomonas putida* KTΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP as the starting strain, the glf gene was inserted into the position between the PP_3304 gene and the PP_3304 gene on the genome of the starting strain to obtain the engineered strain KT ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf;

[0047] The recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C was introduced into the engineered strain to obtain the Pseudomonas putidae KT2440 engineered strain with a reconstructed efficient glucose transmembrane transport system.

[0048] As a preferred embodiment of this application, the galP gene is derived from Escherichia coli W3110, and its nucleotide sequence is shown in SEQ ID NO.15.

[0049] As a preferred embodiment of this application, the glf gene is derived from Zymomonas mobilis, and its nucleotide sequence is shown in SEQ ID NO.16.

[0050] The engineered strain of *Pseudomonas putida* KT2440, which is involved in rhamnolipid synthesis, was constructed using the construction method described in this invention. This engineered strain enhances the ability of intracellular glucose to rapidly phosphorylate, thereby improving its efficiency in introducing into the central carbon metabolism and rhamnolipid synthesis pathway. The construction method includes: using *Pseudomonas putida* KTΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf as the starting strain, overexpressing the glk gene encoding glucokinase through gene modification (6), and then introducing the recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C into the gene-modified strain to obtain an engineered strain with enhanced intracellular glucose rapid phosphorylation ability.

[0051] Specifically, the construction method includes:

[0052] Using *Pseudomonas putida* KTΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383 ΔPP_3382Δgts ABCD::galP::glf as the starting strain, the gene glk was inserted into the PP_4980 position on its genome to obtain the engineered strain KTΔflagΔPP_4232 ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 ΔgtsABCD::galP::glf::glk;

[0053] The fermentation plasmid pBBR1MCS5-rhlAB-rmlBDA*C was introduced into the engineered strain to obtain the Pseudomonas putidae KT2440 engineered strain, which enhances the ability of intracellular glucose to rapidly phosphorylate.

[0054] As a preferred embodiment of this application, the nucleotide sequence of the glk gene is shown in SEQ ID NO.17.

[0055] A second aspect of the present invention is to provide a genetically engineered bacterium obtained according to the construction method described above.

[0056] A third aspect of the present invention is to provide the application of genetically engineered bacteria in the fermentation preparation of rhamnolipids.

[0057] A fourth aspect of the present invention provides a method for producing rhamnolipin, comprising: fermenting and culturing the genetically engineered bacteria to obtain rhamnolipin.

[0058] As a preferred embodiment of this application, the production method includes:

[0059] Single colonies of the selected genetically engineered bacteria were inoculated into LB liquid medium and cultured at 30–37°C and 150–200 rpm for 12–15 h to serve as seed culture; and

[0060] The seed culture was inoculated into the fermentation medium at a 1% inoculum and cultured at 30-37℃ and 150-200 rpm for 2-4 days. The fermentation broth was then collected to detect the rhamnolipin yield.

[0061] In this invention, the term "enhancement" refers to increasing the activity of an enzyme encoded by a corresponding polynucleotide, which can be achieved through gene overexpression or replacement of the gene's expression regulatory sequence on the genome (promoter substitution, etc.). The vectors used in this invention are not specifically limited; any vector known in the art can be used as long as it is reproducible in the host.

[0062] Compared with the prior art, the present invention has at least the following beneficial effects:

[0063] (1) By constructing a complete rhamnolipin synthesis module in *Pseudomonas putida* KT2440, the efficient synthesis capability of this non-natural rhamnolipin-producing host was realized;

[0064] (2) By weakening the continuous oxidation pathway of glucose in the periplasmic space, carbon source loss is significantly reduced and the atom utilization efficiency of glucose is improved.

[0065] (3) By introducing a low-energy glucose transport system and replacing the high-energy ABC transport pathway, the energy consumption during glucose absorption is effectively reduced;

[0066] (4) By strengthening the intracellular glucose phosphorylation step, the efficient and targeted allocation of glucose to the central carbon metabolism and rhamnolipid synthesis pathway was achieved;

[0067] (5) The above-mentioned multi-level metabolic reconstruction strategies work synergistically to enable engineered strains to achieve efficient and stable synthesis of rhamnolipids under the condition that glucose is the only or main carbon source, which has good prospects for industrial application. Attached Figure Description

[0068] Figure 1 Rhamnose lipid production and OD of strains KT2440 / pBBR1MCS5-rhlAB-rmlBDA*C and KT2440 / pBBR1MCS5-rhlAB-rmlBDA*C 600 .

[0069] Figure 2 For strains KT2440Δflag / pBBR1MCS5-rhlAB-rmlBDA*C (W01 / pBABR), KT2440ΔflagΔPP_3382 / pBBR1MCS5-rhlAB- rmlBDA*C (W02-1 / pBABR), KT2440ΔflagΔPP_3383 / pBBR1MCS5-rhlAB-rmlBDA*C (W02-2 / pBABR), KT2440Δf Rhamnose lipid production and OD of lagΔPP_3384 / pBBR1MCS5-rhlAB-rmlBDA*C(W02-3 / pBABR), KT2440ΔflagΔPP_4232 / pBBR1MCS5-rhlAB-rmlBDA*C(W02-4 / pBABR), and KT2440ΔflagΔPP_3623 / pBBR1MCS5-rhlAB-rmlBDA*C(W02-5 / pBABR) 600 .

[0070] Figure 3For strains KT2440Δflag / pBBR1MCS5-rhlAB-rmlBDA*C (W01 / pBABR), KT2440ΔflagΔPP_4232ΔPP_3623 / pBBR1MCS5-rh lAB-rmlBDA*C (W03 / pBABR), KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384 / pBBR1MCS5-rhlAB-rmlBDA*C (W04 / pB Rhamnose lipid production and OD of ABR, KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383 / pBBR1MCS5-rhlAB-rmlBDA*C (W05 / pBABR), KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 / pBBR1MCS5-rhlAB-rmlBDA*C (W06 / pBABR) 600 .

[0071] Figure 4 Rhamnose lipid production and OD of strains KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 / pBBR1MCS5-rhlAB-rmlBDA*C(W06 / pBABR) and KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP / pBBR1MCS5-rhlAB-rmlBDA*C(W07 / pBABR) 600 .

[0072] Figure 5 Rhamnose lipid production and OD of strains KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP / pBBR1MCS5-rhlAB-rmlBDA*C(W07 / pBABR) and KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf / pBBR1MCS5-rhlAB-rmlBDA*C(W08 / pBABR) 600 .

[0073] Figure 6Rhamnose lipid production and OD of strains KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf / pBBR1MCS5-rhlAB-rmlBDA*C(W08 / pBABR) and KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf::glk / pBBR1MCS5-rhlAB-rmlBDA*C(W09 / pBABR) 600 . Detailed Implementation

[0074] The following specific examples illustrate the implementation of this application. Those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this specification. This application can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of this application.

[0075] It should be noted that the process equipment or apparatus not specifically mentioned in the following embodiments are all conventional equipment or apparatus in the art.

[0076] Furthermore, it should be understood that the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, does not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, unless otherwise stated. It should also be understood that the combined connection relationship between one or more devices / apparatus mentioned in this invention does not preclude the existence of other devices / apparatus before or after the combined devices / apparatus, or the insertion of other devices / apparatus between these explicitly mentioned devices / apparatus, unless otherwise stated. Moreover, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or limiting the scope of the invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the invention.

[0077] The parental strains *Pseudomonas putida* KT24400 and *Pseudomonas aeruginosa* PAO1, as well as the vector pBBR1MCS5, were all purchased from Hangzhou Hongsai Biotechnology Co., Ltd. The starting strain, *Pseudomonas putida* KT2440Δflag, was constructed using *Pseudomonas putida* KT2440 as the substrate strain, and has been disclosed in patent CN116355942A.

[0078] In the following examples, the final concentration of gentamicin in the culture medium was 50 mg / L, the final concentration of tetracycline in the culture medium for Escherichia coli was 15 mg / L, and the final concentration in the culture medium for Pseudomonas putida was 25 mg / L.

[0079] The composition of LB liquid medium is: yeast 5 g / L, peptone 10 g / L, NaCl 10 g / L, water as solvent, and natural pH.

[0080] LB solid plates are made by adding 20 g / L agar to LB liquid medium.

[0081] Fermentation medium composition: glucose 10 g / L, glycerol 10 g / L, yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, solvent is deionized water, pH is natural.

[0082] Example 1: Determination of rhamnolipid content

[0083] (1) Take 1 mL of bacterial culture into a 2 mL EP tube, centrifuge at 12000 rpm for 3 minutes, and separate the supernatant and precipitate. The supernatant is used for the detection of rhamnolipids and other metabolites.

[0084] (2) Dilute the sample to a concentration of 0-10 g / L, mix the sample and acetonitrile in a 1:1 ratio, shake well in a constant temperature shaker, and then place at 4 ℃ overnight. After processing, centrifuge the sample at 12000 rpm for 3 minutes, and then put the 0.22 μm organic membrane into a liquid chromatography bottle for analysis.

[0085] (3) The instrument was a Thermo Fisher UPLC ultra-high pressure liquid chromatograph. The chromatographic column was a C18 column (4.6×150 mm, 3 μm); the electrospray detector was used; the injection volume was 2 μL; the column temperature was 40 ℃; the flow rate was 1 mL / min; the mobile phase used was two phases, A and B, with phase A being pure acetonitrile and phase B being 0.2% formic acid water (v / v). The gradient elution program is shown in Table 1.

[0086] Table 1: Gradient elution procedure Serial number Time (min) A(%) B(%) 1 0 70 30 2 1 70 30 3 9 100 0 4 11 100 0 5 12 70 30 6 15 70 30 .

[0087] Example 2: Replacing the rmlA gene with rmlA*

[0088] (1) Using pBBR1MCS5 plasmid as a template and pBB-Line-F and pBB-Line-R as primers, PCR was performed to obtain a linearized vector. The PCR products were digested with DpnI. Using the Pseudomonas aeruginosa PAO1 genome as a template and rhlAB-F / R and rmlBDAC-F / R as primers, PCR amplification was performed. All PCR products were detected by 1.0% agarose gel electrophoresis and the PCR fragments were purified. The linearized vector was ligated with the gene fragments rhlAB and rmlBDAC according to the instructions of the One step clone kit (Vazyme Biotech, Nanjing, China), transformed into E. coli DH5α, plated on gentamicin-resistant plates, and single colonies were picked for colony PCR verification using primers pBB-VF and pBB-VR. Sequencing verification yielded the pBBR1MCS5-rhlAB-rmlBDAC plasmid.

[0089] (2) Using plasmid pBBR1MCS5-rhlAB-rmlBDAC as a template and pBABRline-F and pBABRline-R as primers, the linearized vector was amplified by PCR. The linearized vector was ligated with the synthetic gene fragment rmlA* from Salmonella enterica LT2 according to the instructions of the One step clone kit (Vazyme Biotech, Nanjing, China), transformed into E. coli DH5α, plated on gentamicin-resistant plates, and single colonies were picked for colony PCR verification using primers pBB-VF and pBB-VR. Sequencing verification yielded the plasmid pBBR1MCS5-rhlAB-rmlBDA*C containing the rmlA* gene.

[0090] (3) Preparation of competent cells of *Pseudomonas putida* KT2440: Take out *Pseudomonas putida* KT2440 from the -80℃ freezer, streak it on LB solid medium, and incubate overnight at 30℃. Pick a single colony and inoculate it into 10 mL of liquid LB medium. Incubate at 30℃ and 200 rpm for 12 h. Then, inoculate 1% of the inoculum into 50 mL of liquid LB medium and incubate at 30℃ and 200 rpm until OD. 600=0.8-1.2, immediately incubate on ice for 20 min. Transfer the bacterial culture to a pre-chilled 50 mL sterile centrifuge tube, centrifuge at 5000 rpm for 10 min, discard the supernatant, resuspend in 20 mL pre-chilled HEPES buffer, centrifuge at 5000 rpm for 10 min, repeat the washing three times, and finally resuspend in 1 mL 15% glycerol and aliquot into sterile 1.5 mL EP tubes, 100 μL per tube, and store at -80 ℃.

[0091] (4) Plasmids pBBR1MCS5-rhlAB-rmlBDAC and pBBR1MCS5-rhlAB-rmlBDA*C were electroporated into KT2440 competent cells at 2.5 kV. 1-2 mL of LB liquid medium was added, and the cells were thawed in a shaker at 30℃ and 200 rpm for 2 h. The bacterial culture was then spread on LB plates containing 25 mg / L tetracycline and cultured until a single colony grew to obtain recombinant bacteria KT2440 / pBBR1MCS5-rhlAB-rmlBDAC and KT2440 / pBBR1MCS5-rhlAB-rmlBDA*C containing recombinant plasmids.

[0092] (5) Inoculate strains KT2440 / pBBR1MCS5-rhlAB-rmlBDAC and KT2440 / pBBR1MCS5-rhlAB-rmlBDA*C into 10 mL of LB medium and incubate overnight at 30-37°C and 150-200 rpm. Inoculate 1 mL of the pre-culture into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 2-4 days. Analyze the fermentation broth according to the method in Example 1. OD 600 and the rhamnolipin content in the fermentation broth supernatant, such as Figure 1 As shown.

[0093] like Figure 1 As shown, replacing the rmlA gene in the rhamnose precursor synthesis pathway with the mutant rmlA*, which has enhanced catalytic performance and reduced feedback inhibition, increased rhamnose lipid yield by 14.2%. This indicates that improving the synthesis efficiency of the rhamnose precursor dTDP-L-rhamnose helps to enhance rhamnose synthesis.

[0094] Table 2: Primers for Example 2 Primer name Sequence (5'-3') pBB-Line-F CCTATAGTGAGTCGTATTACGCGC pBB-Line-R CAGCTTTTGTTCCCTTTAGTGAGG rhlAB-F TAAAGGGAACAAAAGCTGATGCGGCGCGAAAGTCTG rhlAB-R GCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAATCAGGACGCAGCCTTCAGC rmlBDAC-F TTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTGCTTGAACAAGGTATGACTC rmlBDAC-R TAATACGACTCACTATAGGTCAGGGGAAGCAGTCG pBB-VF GCTTCCATGTCGGCAGAATG pBB-VR CTGCGCAACTGTTGGGAAG pBABRline-F ATGAAAGCGACCCGCCTGG pBABRline-R TCATAGTGGTCCCTGCTCGCTC .

[0095] Example 3: Effects of individually knocking out the Gad-encoding gene on rhamnolipid synthesis

[0096] (1) Using pSEVA-gRic6T plasmid (Addgene Plasmid#106401) as a template, and ΔPP_3382-PSTB-F / R, ΔPP_3383-PSTB-F / R, ΔPP_3384-PSTB-F / R, ΔPP_3623-PSTB-F / R, and ΔPP_4232-PSTB-F / R as primers, PCR amplification was performed, and site-directed mutagenesis of the gRNA was carried out. The PCR product was digested with DpnI. The digested product was transferred into E. coli DH5α, plated on gentamicin plates, and single colonies were picked for sequencing verification (primers pS-VF and pS-VR) to screen for successfully mutated pSEVA plasmids. The successfully mutated pSEVA plasmids were linearized using linearization primer PSL-F / R, and the product was detected by 1.0% agarose gel electrophoresis. The PCR product was digested and purified with DpnI to obtain the linearized vector.

[0097] (2) Using the genome of Pseudomonas putida KT2440 as a template, and using ΔPP_3382-Up-F / R, ΔPP_3382-Down-F / R, ΔPP_3383-Up-F / R, ΔPP_3383-Down-F / R, ΔPP_3384-Up-F / R, ΔPP_3384-Down-F / R, ΔPP_3623-Up-F / R, ΔPP_3623-Down-F / R, ΔPP_4232-Up-F / R, and ΔPP_4232-Down-F / R as primers, PCR amplification was performed to obtain 500 bp upstream and downstream homologous arms of genes PP_3382, PP_3383, PP_3384, PP_3623, and PP_4232. DNA fragments from the upper and lower homologous arms were fused using fusion PCR to obtain fragments Donor-ΔPP_3382, Donor-ΔPP_3383, Donor-ΔPP_3384, Donor-ΔPP_3384, Donor-ΔPP_3623, and Donor-ΔPP_4232. All PCR products were detected and purified by 1.0% agarose gel electrophoresis.

[0098] (3) Following the instructions of the One-Step Cloning Kit (Vazyme Biotech, Nanjing, China), the linearized vector was ligated with the gene fragment Donor and transformed into E. coli DH5α. The transformed cells were plated on gentamicin-resistant plates, and single colonies were picked for colony PCR verification using primers pS-VF and pS-VR. Sequencing confirmed the presence of positive transformants. Plasmids PSD-ΔPP_3382, PSD-ΔPP_3383, PSD-ΔPP_3384, PSD-ΔPP_3623, and PSD-ΔPP_4232 were extracted from the positive transformants.

[0099] (4) Preparation of competent cells of *Pseudomonas putida* KT2440Δflag: Take out *Pseudomonas putida* KT2440Δflag strain from the -80℃ freezer, streak it on LB solid medium, and incubate overnight at 30℃. Pick a single colony and inoculate it into 10 mL of liquid LB medium. Incubate at 30℃ and 200 rpm for 12 h. Then, inoculate 1% of the inoculum into 50 mL of liquid LB medium and incubate at 30℃ and 200 rpm until OD. 600 =0.8-1.2, immediately incubate on ice for 20 min. Transfer the bacterial culture to a pre-chilled 50 mL sterile centrifuge tube, centrifuge at 5000 rpm for 10 min, discard the supernatant, resuspend in 20 mL pre-chilled HEPES buffer, centrifuge at 5000 rpm for 10 min, repeat the washing three times, and finally resuspend in 1 mL 15% glycerol and aliquot into sterile 1.5 mL EP tubes, 100 μL per tube, and store at -80 ℃.

[0100] (5) The plasmid pCAS-RK2T (Addgene Plasmid#106400) was electroporated into KT2440Δflag competent cells at 2.5 kV. 1-2 mL of LB liquid medium was added, and the cells were incubated in a shaker at 30℃ and 200 rpm for 2 h. The bacterial culture was then spread on LB plates containing 25 mg / L tetracycline and cultured until a single colony grew to obtain the recombinant bacteria KT2440Δflag / pCas containing the recombinant plasmid.

[0101] (6) Select a single colony of recombinant bacteria KT2440Δflag / pCas and inoculate it into 10 mL of liquid LB medium. Add tetracycline to a final concentration of 25 mg / L and 40 mM arabinose to induce pCas expression. Prepare electroporation competent cells of KT2440Δflag / pCas according to the method in (4). Electroporate plasmids PSD-ΔPP_3382, PSD-ΔPP_3383, PSD-ΔPP_3384, PSD-ΔPP_3623, and PSD-ΔPP_4232 into KT2440 / pCas competent cells at 2.5 kV. Add 1-2 mL of LB medium and revive in a shaker at 30℃ and 200 rpm for 2 h. Spread the bacterial culture on LB plates containing 50 mg / L gentamicin and 25 mg / L tetracycline and culture until a single colony grows to obtain recombinant bacteria containing recombinant plasmids. Single colonies were selected for colony PCR verification (primers ΔPP_3382-GVF / R, ΔPP_3383-GVF / R, ΔPP_3384-GVF / R, ΔPP_3623-GVF / R, ΔPP_4232-GVF / R). PCR products with the correct bands were selected for sequencing verification, and successfully edited strains were screened.

[0102] (7) Select a positive single colony and inoculate it into a 10 mL LB tube containing 10 mM L-Rha and 25 mg / L tetracycline. Incubate overnight at 30°C. Stir on an LB agar plate containing 25 mg / L tetracycline. Incubate at 30°C for 24 h. Select a single colony and print it on an LB agar plate containing 25 mg / L tetracycline. Stir on an LB agar plate containing 50 mg / L gentamicin. If a single colony cannot be printed on an LB agar plate containing gentamicin, its PSD plasmid has been successfully eliminated. Single colonies with successfully eliminated PSD plasmids were picked and placed in 10 mL LB liquid medium containing 5 g / L glucose and incubated overnight at 30°C. The next day, the bacterial culture was streaked onto LB agar plates containing 5 g / L glucose and 10 g / L sucrose and incubated at 30°C for 24 h. Single colonies were then picked and streaked onto LB solid plates containing 25 mg / L tetracycline. Single colonies that could not be streaked onto LB agar plates containing tetracycline had their pCas plasmids successfully eliminated, resulting in plasmid-free strains KT2440ΔflagΔPP_3382, KT2440ΔflagΔPP_3383, KT2440ΔflagΔPP_3384, KT2440ΔflagΔPP_4232, and KT2440ΔflagΔPP_3623.

[0103] (8) Plasmid-free strains KT2440ΔflagΔPP_3382, KT2440ΔflagΔPP_3383, KT2440ΔflagΔPP_3384, KT2440ΔflagΔPP_4232, and KT2440ΔflagΔPP_3623 were prepared into electroporation competent cells. The pBBR1MCS5-rhlAB-rmlBDA*C plasmid constructed in Example 2 was transformed into the above competent cells by electroporation to obtain strain KT2440ΔflagΔPP_3382 / pBBR 1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_3383 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_3384 / pBBR1MCS5-rhlA B-rmlBDA*C, KT2440ΔflagΔPP_4232 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_3623 / pBBR1MCS5-rhlAB-rmlBDA*C.

[0104] (9) Inoculate strains KT2440ΔflagΔPP_3382 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_3383 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_3384 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_4232 / pBBR1MCS5-rhlAB-rmlBDA*C, and KT2440ΔflagΔPP_3623 / pBBR1MCS5-rhlAB-rmlBDA*C into 10 mL of LB medium and incubate overnight at 30-37°C and 150-200 rpm. 1 mL of pre-culture was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium, and fermentation was carried out for 2–4 days. The fermentation broth was analyzed according to the method in Example 1, and the OD value was measured. 600 and the rhamnolipin content in the fermentation broth supernatant, such as Figure 2 As shown.

[0105] like Figure 2As shown, deleting the PP_3382 gene from strain KT2440Δflag did not significantly increase the rhamnolipin yield of the engineered strain; however, deleting the PP_3623 and PP_4232 genes increased rhamnolipin yield by 13.5% and 12.3%, respectively. Furthermore, deleting the PP_3383 and PP_3384 genes also resulted in a certain degree of increase in rhamnolipin yield. These results indicate that different subunits in the Gad complex enzyme system have different functional contributions in maintaining the activity of the gluconic acid to 2-ketoglucose oxidation pathway. By knocking out different coding genes of the Gad complex enzyme, the overall activity of this non-productive oxidation pathway can be weakened to varying degrees, thereby promoting more carbon flow into intracellular central carbon metabolism via glucose phosphorylation. This verifies the feasibility and effectiveness of redirecting carbon flow to improve the synthesis efficiency of target products by regulating the Gad complex enzyme system.

[0106] Table 3: Primers for Example 3 Primer name Sequence (5'-3') ΔPP_3382-PSTB-F taatgctagcGCTGACCCTGTGGTGAACCGgttttagagctagaaatagc ΔPP_3382-PSTB-R gctctaaaacCGGTTCACCACAGGGTCAGCgctagcattatacctaggac ΔPP_3383-PSTB-F taatgctagcACACAACGTGTTCGTTCCGGgttttagagctagaaatagc ΔPP_3383-PSTB-R gctctaaaacCCGGAACGAACACGTTGTGTgctagcattatacctaggac ΔPP_3384-PSTB-F taatgctagcACCGACATTCTTCAGCGCCGgttttagagctagaaatagc ΔPP_3384-PSTB-R gctctaaaacCGGCGCTGAAGAATGTCGGTgctagcattatacctaggac ΔPP_3623-PSTB-F taatgctagcGTCCAGGGCCCCGGACACTGgttttagagctagaaatagc ΔPP_3623-PSTB-R gctctaaaacCAGTGTCCGGGGCCCTGGACgctagcattatacctaggac ΔPP_4232-PSTB-F taatgctagcTCCCGTTCAATGTGCGCATGgttttagagctagaaatagc ΔPP_4232-PSTB-R gctctaaaacCATGCGCACATTGAACGGGAgctagcattatacctaggac pS-VF agggcggcggatttgtcc pS-VR gcggcaaccgagcgttc PSL-F gccgcgtcgtgactgggaaaacc PSL-R ggatccccgggtaccgagctcctcaa ΔPP_3382-Up-F cggtacccggggatccTGTCGATGGACGCCCAC ΔPP_3382-Up-R CTGAAAAACACGCGCTCCTCAAGCCTGG ΔPP_3382-Down-F TGAGGAGCGCGTGTTTTTCAGCGCCC ΔPP_3382-Down-R cccagtcacgacgcggcGCCATCTTGAGCAGGTCG ΔPP_3383-Up-F tcggtacccggggatccCGATGAGCTTGGCCCAG ΔPP_3383-Up-R ATGCTCATCGCTCCGCCTCAGGCCCTCTCAC ΔPP_3383-Down-F GGCCTGAGGCGGAGCGATGAGCATGAAG ΔPP_3383-Down-R cagtcacgacgcggcCAGGGCTTGGCCTCTG ΔPP_3384-Up-F agctcggtacccggggatccGTCCGGGTCGGCCGGGTA ΔPP_3384-Up-R TCGCCATGCCTGCGAATCCTCATCGGCTGTGG ΔPP_3384-Down-F ATGAGGATTCGCAGGCATGGCGACGGTGTTG ΔPP_3384-Down-R ccagtcacgacgcggcGCCTGGCCTGAAGTGCC ΔPP_3623-Up-F agctcggtacccggggatccTGTCCGGCGGCTGGAAGC ΔPP_3623-Up-R ACATGTGCCACTCCAATGAGGCGTCCCTTGTGCG ΔPP_3623-Down-F CTCATTGGAGTGGCACATGTACCG ΔPP_3623-Down-R tttcccagtcacgacgcggcGCGTCATCTGGGTGCG ΔPP_4232-Up-F agctcggtacccggggatccCTGACGCTCAACGGTCAACC ΔPP_4232-Up-R AGATGCTGCACGCTGTTCAACCCTCCTTGACCAGG ΔPP_4232-Down-F TTGAACAGCGTGCAGCATCTCGATC ΔPP_4232-Down-R tttcccagtcacgacgcggcAATAGCCGGCCAGCAGC ΔPP_3382-GVF ATTGCCGGTACCTCCAAC ΔPP_3382-GVR CCGTGGATTCCATGGCAAC ΔPP_3383-GVF CGCTTATCAAGGCCGCC ΔPP_3383-GVR CGCCACAATGCCCAAGG ΔPP_3384-GVF CTGGATGTTGGGCAGGTCATC ΔPP_3384-GVR GGGAACGGGTTGGAACGG ΔPP_3623-GVF ATGCTTGGTTACTGGCGC ΔPP_3623-GVR TGGTCACGAGCCCAGGAAG ΔPP_4232-GVF TCCAAGGGCATCGCCGAAG ΔPP_4232-GVR CTCGCGGCGCACCTCTATG .

[0107] Example 4: Effects of combined knockout of the Gad-encoding gene on rhamnolipid synthesis

[0108] (1) Using strain KT2440ΔflagΔPP_4232 as the starting strain, single colonies of KT2440ΔflagΔPP_4232 / pCas were picked and inoculated into 10 mL of liquid LB medium. Tetracycline with a final concentration of 25 mg / L and 40 mM arabinose were added to induce pCas expression. KT2440ΔflagΔPP_4232 / pCas were prepared into electrotransfer competent cells. Plasmid PSD-ΔPP_3623 was electrotransferred into KT2440Δflag competent cells at 2.5 kV. 1-2 mL of LB liquid medium was added, and the cells were incubated in a shaker at 30℃ and 200 rpm for 2 h. The bacterial culture was then spread on LB solid plates containing 50 mg / L gentamicin and 25 mg / L tetracycline and cultured until single colonies grew to obtain recombinant bacteria containing recombinant plasmids. Single colonies were selected for colony PCR verification (primer ΔPP_3623-GVF / R), and PCR products with correct bands were selected for sequencing verification to screen for successfully edited strains.

[0109] (2) Select positive single colonies and inoculate them into 10 mL LB tubes containing 10 mM L-Rha and 25 mg / L tetracycline. Incubate overnight at 30°C. Streak the colonies on LB plates containing 25 mg / L tetracycline and incubate at 30°C for 24 h. Select single colonies and imprint them on LB plates containing 25 mg / L tetracycline. Streak the colonies on LB plates containing 50 mg / L gentamicin. If a single colony cannot be found on an LB plate containing gentamicin, its PSD plasmid has been successfully eliminated. Single colonies with successfully eliminated PSD plasmids were picked and placed in 10 mL LB tubes containing 5 g / L glucose and incubated overnight at 30°C. The next day, the bacterial culture was streaked onto LB agar plates containing 5 g / L glucose and 10 g / L sucrose and incubated at 30°C for 24 h. Single colonies were then picked and streaked onto LB agar plates containing 25 mg / L tetracycline. Single colonies that could not be streaked onto LB agar plates containing tetracycline had their pCas plasmids successfully eliminated, resulting in the plasmid-free strain KT2440ΔflagΔPP_4232ΔPP_3623.

[0110] (3) Using strain KT2440ΔflagΔPP_4232ΔPP_3623 as the starting strain, PP_3384 was knocked out according to the above method to obtain strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384.

[0111] (4) Using strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384 as the starting strain, a new PP_3383 knockout plasmid needs to be constructed due to the knockout of PP_3384. Using plasmid PSD-ΔPP_3383 as a template, and PSL-R and ΔPP_3384-83-Down-F as linearization primers, a linearized vector was obtained by PCR. Using strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384 as a template, and ΔPP_3384-83-Up-F / R as primers, a new upper homologous arm fragment was obtained by PCR. Following the instructions of the One-Step Cloning Kit (Vazyme Biotech, Nanjing, China), the linearized vector was ligated with the upper homologous arm fragment and transformed into E. coli DH5α. The transformed cells were plated on gentamicin-resistant plates, and single colonies were picked for colony PCR verification using primers pS-VF and pS-VR. Sequencing confirmed the presence of positive transformants. The plasmid PSD-ΔPP_3384-83 was extracted from the positive transformants. Following the same method, PP_3383 was knocked out to obtain strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383.

[0112] (5) Using strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383 as the starting strain, PP_3382 was knocked out according to the above method to obtain strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382.

[0113] (6) Plasmid-free strains KT2440ΔflagΔPP_4232ΔPP_3623, KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384, KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383, and KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 were prepared into electroporation competent cells. The pBBR1MCS5-rhlAB-rmlBDA*C plasmid constructed in Example 2 was transformed into the above competent cells by electroporation to obtain strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382. PP_4232ΔPP_3623 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_4232ΔPP _3623ΔPP_3384ΔPP_3383 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 / pBBR1MCS5-rhlAB-rmlBDA*C.

[0114] (7) Inoculate strains KT2440ΔflagΔPP_4232ΔPP_3623 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384 / pBBR1MCS5-rhlAB-rmlBDA*C, KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383 / pBBR1MCS5-rhlAB-rmlBDA*C, and KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 / pBBR1MCS5-rhlAB-rmlBDA*C into 10 mL of LB medium and incubate at 30-37°C for 150-200 mL. Incubate overnight at rpm. Inoculate 1 mL of the pre-culture into a 500 mL shake flask containing 50 mL of fermentation medium and allow fermentation for 2–4 days. Analyze the fermentation broth according to the method in Example 1, OD... 600 and the rhamnolipin content in the fermentation broth supernatant, such as Figure 3 As shown.

[0115] like Figure 3 As shown, with the progressive knockout of genes encoding gluconate-2-dehydrogenase (Gad) in the genome, the rhamnolipid production of the engineered strain showed a gradual increasing trend. When all five Gad-related coding genes were knocked out, the rhamnolipid production of the engineered strain reached its highest level, 3.49 g / L. After complete knockout of the Gad complex enzyme coding genes, the metabolic pathway of non-productive oxidation of glucose to 2-ketoglucose in the periplasmic space was weakened, and more carbon flow entered the intracellular central carbon metabolism via glucose phosphorylation, thereby improving the efficient supply of carbon sources to downstream synthetic pathways. Therefore, comprehensive knockout of the Gad complex enzyme system can effectively redirect carbon flow, improve glucose utilization efficiency, and significantly promote the synthesis of target products such as rhamnolipids.

[0116] Table 4: Primers for Example 4 Primer Name Sequence (5'-3') ΔPP_3384-83-Down-F AGGATTCGCAGGAGCGATGAGCATGAAGAC ΔPP_3384-83-82-Down-F CAGCCGATGAGGATTCGCACGTGTTTTTCAGCGCCC ΔPP_3384-83-Up-F agctcggtacccggggatccGTCCGGGTCGGCCGGGTA ΔPP_3384-83-Up-R TGCGAATCCTCATCGGCTGTGG .

[0117] Example 5: Effect of replacing the ABC transport system with the glucose transporter Galp on rhamnolipid synthesis

[0118] (1) Using pSEVA-gRic6T plasmid (Addgene Plasmid#106401) as a template and galP-PSTB-F / R as primers, PCR amplification was performed, and site-directed mutagenesis of the gRNA was carried out. The PCR product was digested with DpnI. The digested product was transferred into E. coli DH5α, plated on gentamicin plates, and single colonies were picked for sequencing verification (primers pS-VF and pS-VR) to screen for successfully mutated pSEVA plasmids. The successfully mutated pSEVA plasmids were linearized using linearization primers PSL-F / R, and the product was detected by 1.0% agarose gel electrophoresis. The PCR product was digested and purified with DpnI to obtain the linearized vector.

[0119] (2) Using the genome of *Pseudomonas putida* KT2440 as a template, and galP-Up-F / R and galP-Down-F / R as primers, PCR amplification was performed to obtain the upstream and downstream homologous arms of the gene gtsABCD (500 bp). Using the genome of *Escherichia coli* W3110 as a template, and galP-F / R as primers, PCR amplification was performed to obtain the gene galP. The upstream and downstream homologous arm DNA fragments and the galP gene DNA fragment were fused by fusion PCR to obtain the fragment Donor-galP. All PCR products were detected by 1.0% agarose gel electrophoresis and the PCR fragments were purified.

[0120] (3) Following the instructions of the One-Step Cloning Kit (Vazyme Biotech, Nanjing, China), the linearized vector was ligated with the gene fragment Donor, transformed into E. coli DH5α, plated on gentamicin-resistant plates, and single colonies were picked for colony PCR verification using primers pS-VF and pS-VR. Sequencing confirmed the presence of positive transformants. The plasmid PSD-ΔgtsABCD::galP was extracted from the positive transformants.

[0121] (4) Using strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 as the starting strain, single colonies of KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 / pCas were picked and inoculated into 10 mL of liquid LB medium. Tetracycline with a final concentration of 25 mg / L and arabinose with 40 mM were added to induce pCas expression. The KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 / pCas were prepared as electrotransfer competent cells according to method (4). The plasmid PSD-ΔgtsABCD::galP was electrotransferred into the KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 / pCas competent cells at 2.5 kV. 1-2 mL LB was added, and the cells were incubated in a shaker at 30℃ and 200 rpm for 2 h. The bacterial culture was then spread on LB plates containing 50 mg / L gentamicin and 25 mg / L tetracycline and cultured until a single colony grew, thus obtaining recombinant bacteria containing the recombinant plasmid. Single colonies were selected for colony PCR verification (primers galP-GVF / R). PCR products with the correct bands were selected for sequencing verification, and successfully edited strains were screened. The PSD-ΔgtsABCD::galP and pCas plasmids were eliminated according to Example 3. This resulted in the plasmid-free strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP.

[0122] (5) Prepare electroporation competent cells from the plasmid-free strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383 ΔPP_3382ΔgtsABCD::galP. Transform the pBBR1MCS5-rhlAB-rmlBDA*C plasmid constructed in Example 2 into the above competent cells by electroporation to obtain strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP / pBBR1MCS5-rhlAB-rmlBDA*C.

[0123] (6) Inoculate strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 ΔgtsABCD::galP / pBBR1MCS5-rhlAB-rmlBDA*C into 10 mL of LB medium and incubate overnight at 30-37°C and 150-200 rpm. Inoculate 1 mL of the pre-culture into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 2-4 days. Analyze the fermentation broth according to the method in Example 1. OD 600 and the rhamnolipin content in the fermentation broth supernatant, such as Figure 4 As shown.

[0124] like Figure 4 As shown, by replacing the original ABC-type glucose transport system in the genome with the proton-driven glucose transporter GalP derived from *E. coli*, the rhamnolipin production of the engineered strain was significantly increased. The rhamnolipin production of the engineered strain after the reconstructed transport system increased from 3.49 g / L to 4.01 g / L, an increase of approximately 14.9%. This result indicates that by introducing a transmembrane glucose transport mechanism that does not directly consume ATP, the energy burden during glucose uptake can be effectively reduced, and the supply efficiency of carbon sources to central metabolism and downstream synthetic pathways can be improved, thereby promoting rhamnolipin synthesis. The glucose transport system constructed in this invention has a significant effect on increasing rhamnolipin production.

[0125] Table 5: Primers for Example 5 Primer Name Sequence (5'-3') galP-PSTB-F taatgctagcCAGCGCCATCCTGATGCTCGgttttagagctagaaatagc galP-PSTB-R gctctaaaacCGAGCATCAGGATGGCGCTGgctagcattatacctaggac galP-Up-F ctcggtacccggggatccTGCTGGCAAGGATTACC galP-Up-R GTTTTTTAGCGTCAGGCATGTATTGGATCCCGAGGTAG galP-Down-F ATTAACTCGTCTACACCATCAATAAG galP-Down-R cccagtcacgacgcggcGGGAAGCTGTTGAAGTC galP-F CCAATACATGCCTGACGCTAAAAAACAG galP-R GGTGTAGACGAGTTAATCGTGAGCGCCTATTTC galP-GVF CAAGGCGCTGACCGAGTTG galP-GVR GCCGGTTTCCAGGTTGGAAG .

[0126] Example 6: Effect of Glucose Transporter Glf Overexpression on Rhamnolipid Synthesis

[0127] (1) Using pSEVA-gRic6T plasmid (Addgene Plasmid#106401) as a template and glf-PSTB-F / R as primers, PCR amplification was performed, and site-directed mutagenesis of the gRNA was carried out. The PCR product was digested with DpnI. The digested product was transferred into E. coli DH5α, plated on gentamicin plates, and single colonies were picked for sequencing verification (primers pS-VF and pS-VR) to screen for successfully mutated pSEVA plasmids. The successfully mutated pSEVA plasmids were linearized using linearization primers PSL-F / R, and the product was detected by 1.0% agarose gel electrophoresis. The PCR product was digested and purified with DpnI to obtain the linearized vector.

[0128] (2) Using the genome of *Pseudomonas putida* KT2440 as a template, and with glf-Up-F / R and glf-Down-F / R primers, PCR amplification was performed to obtain 500 bp upstream and downstream homologous arms of the intergenic region of the PP_3304-PP_3305 gene. The DNA fragments of the upstream and downstream homologous arms and the DNA fragment of the synthetic gene glf were fused by fusion PCR to obtain the fragment Donor-glf. All PCR products were detected and purified by 1.0% agarose gel electrophoresis.

[0129] (3) Following the instructions of the One-Step Cloning Kit (Vazyme Biotech, Nanjing, China), the linearized vector was ligated with the gene fragment Donor, transformed into E. coli DH5α, plated on gentamicin-resistant plates, and single colonies were picked for colony PCR verification using primers pS-VF and pS-VR. Sequencing confirmed the presence of positive transformants. Plasmid PSD-glf was extracted from the positive transformants.

[0130] (4) Using strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 ΔgtsABCD::galP as the starting strain, single colonies of KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384 ΔPP_3383ΔPP_3382ΔgtsABCD::galP / pCas were picked and inoculated into 10 mL of liquid LB medium. Tetracycline with a final concentration of 25 mg / L and 40 mM arabinose were added to induce pCas expression. The KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP / pCas were prepared as electroporation competent cells according to method (4). The plasmid PSD-glf was electroporated into the KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP / pCas competent cells at 2.5 kV. 1-2 mL LB was added, and the cells were incubated in a shaker at 30℃ and 200 rpm for 2 h. The bacterial culture was then spread on LB plates containing 50 mg / L gentamicin and 25 mg / L tetracycline and cultured until a single colony grew to obtain recombinant bacteria containing the recombinant plasmid. Single colonies were selected for colony PCR verification (primers glf-GVF / R). PCR products with the correct bands were selected for sequencing verification, and successfully edited strains were screened. PSD-glf and pCas plasmids were eliminated according to Example 3. The resulting plasmid-free strain was KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf.

[0131] (5) The plasmid-free strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383 ΔPP_3382ΔgtsABCD::galP::glf was prepared into electroporation competent cells. The pBBR1MCS5-rhlAB-rmlBDA*C plasmid constructed in Example 2 was transformed into the above competent cells by electroporation to obtain strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 ΔgtsABCD::galP::glf / pBBR1MCS5-rhlAB-rmlBDA*C.

[0132] (6) Inoculate strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 ΔgtsABCD::galP::glf / pBBR1MCS5-rhlAB-rmlBDA*C into 10 mL of LB medium and incubate overnight at 30-37°C and 150-200 rpm. Inoculate 1 mL of the pre-culture into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 2-4 days. Analyze the fermentation broth according to the method in Example 1. OD 600 and the rhamnolipin content in the fermentation broth supernatant, such as Figure 5 As shown.

[0133] Further, the glucose-promoting transport protein Glf was introduced and overexpressed into the genome to reconstruct the glucose transmembrane transport system. For example... Figure 5 As shown, the experimental results indicate that, specifically, the engineered strain reconstructed by the aforementioned transport system exhibited a significantly higher rhamnolipin yield of 4.26 g / L compared to the control strain. These results demonstrate that enhancing glucose transmembrane transport capacity can effectively reduce energy consumption during glucose uptake and increase the intracellular glucose supply rate, thereby further promoting the metabolic flux of central carbon metabolism and rhamnolipin synthesis pathways. Therefore, introducing and overexpressing Glf to reconstruct the glucose transmembrane transport system is an effective engineering strategy to further improve carbon source utilization efficiency and rhamnolipin yield.

[0134] Table 6: Primer Table for Example 6 Primer Name Sequence (5'-3') glf-PSTB-F taatgctagcTAGGATTCAAGGCGTGAAAGgttttagagctagaaatagc glf-PSTB-R gctctaaaacCTTTCACGCCTTGAATCCTAgctagcattatacctaggac glf -Up-F gtacccggggatccACCAGCCTGCTGATGAGC glf -Up-R ctcacaattccacacattatacgagccgatgattaattgtcaaCGGGCCATGCAGTTGA glf -Down-F CCAGCGGCCGTAATTATTCAAG glf -Down-R agtcacgacgcggCTTTACTGCTTCGGCGCG glf -F tgtgtggaattgtgagcggataacaatttcacacaggaaacaatgtccagcgagtcgtc glf -R GAATAATTACGGCCGCTGGttacttctgcgagcgccac glf -GVF TTATTCGCCTCGTTCGCC glf -GVR CCTCGGGAGTTCCAGCACC .

[0135] Example 7: Effect of glucokinase Glk overexpression on rhamnolipid synthesis

[0136] (1) Using pSEVA-gRic6T plasmid (Addgene Plasmid#106401) as a template and glk-PSTB-F / R as primers, PCR amplification was performed, and site-directed mutagenesis of the gRNA was carried out. The PCR product was digested with DpnI. The digested product was transferred into E. coli DH5α, plated on gentamicin plates, and single colonies were picked for sequencing verification (primers pS-VF and pS-VR) to screen for successfully mutated pSEVA plasmids. The successfully mutated pSEVA plasmids were linearized using linearization primers PSL-F / R, and the product was detected by 1.0% agarose gel electrophoresis. The PCR product was digested and purified with DpnI to obtain the linearized vector.

[0137] (2) Using the genome of *Pseudomonas putida* KT2440 as a template, and with glk-Up-F / R and glk-Down-F / R primers, PCR amplification was performed to obtain the upstream and downstream homologous arms of gene PP_3384, each 500 bp in length. Using the genome of *Pseudomonas putida* KT2440 as a template, and with glk-F / R primers, PCR amplification was performed to obtain the DNA fragment of gene glk. The upstream and downstream homologous arm DNA fragments and the DNA fragment of gene glk were fused by fusion PCR to obtain fragment Donor-glk. All PCR products were detected by 1.0% agarose gel electrophoresis and the PCR fragments were purified.

[0138] (3) Following the instructions of the One-Step Cloning Kit (Vazyme Biotech, Nanjing, China), the linearized vector was ligated with the gene fragment Donor, transformed into E. coli DH5α, plated on gentamicin-resistant plates, and single colonies were picked for colony PCR verification using primers pS-VF and pS-VR. Sequencing confirmed the presence of positive transformants. The plasmid PSD-glk was extracted from the positive transformants.

[0139] (4) Using strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 ΔgtsABCD::galP::glf as the starting strain, a single colony of KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384 ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf / pCas was picked and inoculated into 10 mL of liquid LB medium. Tetracycline with a final concentration of 25 mg / L and 40 mM arabinose were added to induce pCas expression. KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf / pCas was prepared as electrotransfer competent cells. The plasmid PSD-glk was electrotransferred into KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf / pCas competent cells at 2.5 kV. 1-2 mL of LB liquid medium was added, and the cells were incubated for 2 h at 30℃ and 200 rpm in a shaker. The bacterial culture was then spread on LB solid plates containing 50 mg / L gentamicin and 25 mg / L tetracycline and cultured until single colonies grew, thus obtaining recombinant bacteria containing the recombinant plasmid. Single colonies were selected for colony PCR verification (primers glk-GVF / R). PCR products with the correct bands were selected for sequencing verification, and successfully edited strains were screened. PSD-::glk and pCas plasmids were eliminated according to Example 3. The resulting plasmid-free strains were KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf::glk.

[0140] (5) Plasmid-free strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf::glk was prepared into electroporation competent cells. The pBBR1MCS5-rhlAB-rmlBDA*C plasmid constructed in Example 2 was transformed into the above competent cells by electroporation to obtain strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382ΔgtsABCD::galP::glf::glk / pBBR1MCS5-rhlAB-rmlBDA*C.

[0141] (6) Inoculate strain KT2440ΔflagΔPP_4232ΔPP_3623ΔPP_3384ΔPP_3383ΔPP_3382 ΔgtsABCD::galP::glf::glk / pBBR1MCS5-rhlAB-rmlBDA*C into 10 mL of LB medium and incubate overnight at 30-37°C and 150-200 rpm. Inoculate 1 mL of the pre-culture into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 2-4 days. Analyze the fermentation broth according to the method in Example 1. OD 600 and the rhamnolipin content in the fermentation broth supernatant, such as Figure 6 As shown.

[0142] Based on the previously constructed engineered strain with a reconstructed glucose transmembrane transport system, glucokinase Glk was further overexpressed in the genome to enhance the rapid phosphorylation of intracellular glucose. Experimental results showed that the engineered strain, after synergistic reconstruction of the transport system and glucose phosphorylation pathway, exhibited a rhamnolipin yield of 4.56 g / L, a further improvement compared to the control strain. These results indicate that enhancing the phosphorylation rate of glucose after it enters the cell can effectively promote the conversion of glucose to central metabolic intermediates such as glucose-6-phosphate, thereby increasing its efficiency in transporting to central carbon metabolism and rhamnolipin synthesis pathways. Therefore, by weakening the periplasmic oxidation pathway and reconstructing an efficient glucose transmembrane transport system, further enhancing the phosphorylation capacity of intracellular glucose can achieve hierarchical optimization and redirection of carbon flow, representing an effective engineering strategy for significantly improving rhamnolipin synthesis.

[0143] Table 7: Primers for Example 7 Primer Name Sequence (5'-3') glk-PSTB-F taatgctagcGAGATCAAGAAATTCTCTGCgttttagagctagaaatagc glk-PSTB-R gctctaaaacGCAGAGAATTTCTTGATCTCgctagcattatacctaggac glk-Up-F agctcggtacccggggatccGGTACCGCTCTGCTCTCTG glk-Up-R tcacaattccacacattatacgagccgatgattaattgtcaaCCTCGGTTTTCAGCTGG glk -Down-F GTTGGATCACTGACAGCCCCCTCGGTACTTC glk-Down-R cccagtcacgacgcggcGCCGGACGACAAGGAAAAG glk-F tgtgtggaattgtgagcggataacaatttcacacaggaaacaATGAAGCACCTGCTGGT glk-R CCGAGGGGGCTGTCAGTGATCCAACGCCTGC glk-GVF CACAGGAAGGAACAGGATGTTG glk-GVR GCAAGGACAAAGGCAAGGAC .

[0144] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A method for constructing an engineered bacterium for efficient rhamnolipid synthesis based on glucose metabolism remodeling, characterized in that, Using *Pseudomonas putida* KT2440 or its flag gene cluster knockout strain as the starting strain, the genome of the starting strain was optimized by genetic modification, and then the recombinant plasmid pBBR1MCS5-rhlAB-rmlBDA*C was introduced into the genetically modified strain to obtain the target engineered strain; the genetic modification includes at least one of the following (1) to (6): (1) Heterologous expression of genes related to rhamnolipid synthesis; (2) Replace the rmlA gene with the mutant rmlA*; (3) Knock out genes encoding the gluconate-2-dehydrogenase complex enzyme system; (4) Heterologous expression of the galP gene encoding the glucose transporter; (5) Heterologous expression of the glf gene encoding the glucose transporter; (6) Overexpression of the glk gene encoding glucokinase.

2. The construction method according to claim 1, characterized in that, The rhamnolipid synthesis-related genes are derived from Pseudomonas aeruginosa PAO1, including rhlA, rhlB, rmlB, rmlC and / or rmlD genes; the rmlA* gene is derived from Salmonella enterica LT2, and both the rhamnolipid synthesis-related genes and the rmlA* gene are driven by the Lac promoter.

3. The construction method according to claim 2, characterized in that, The nucleotide sequence of the Lac promoter is shown in SEQ ID NO.1, the nucleotide sequence of the rhlA gene is shown in SEQ ID NO.2, the nucleotide sequence of the rhlB gene is shown in SEQ ID NO.3, the nucleotide sequence of the mutant rmlA* is shown in SEQ ID NO.4, the nucleotide sequence of the rmlB gene is shown in SEQ ID NO.5, the nucleotide sequence of the rmlC gene is shown in SEQ ID NO.6, the nucleotide sequence of the rmlD gene is shown in SEQ ID NO.7, the nucleotide sequence of the rhlAB gene is shown in SEQ ID NO.8, and the nucleotide sequence of the rmlBDAC gene is shown in SEQ ID NO.

9.

4. The construction method according to claim 1, characterized in that, The relevant gene encoding the gluconate-2-dehydrogenase complex enzyme system is selected from at least one of the genes PP_3382, PP_3383, PP_3384, PP_3623 and PP_4232.

5. The construction method according to claim 4, characterized in that, The nucleotide sequence of the gene PP_3382 is shown in SEQ ID NO.10, the nucleotide sequence of the gene PP_3383 is shown in SEQ ID NO.11, the nucleotide sequence of the gene PP_3384 is shown in SEQ ID NO.12, the nucleotide sequence of the gene PP_3623 is shown in SEQ ID NO.13, and the nucleotide sequence of the gene PP_4232 is shown in SEQ ID NO.

14.

6. The construction method according to claim 1, characterized in that, The galP gene is derived from Escherichiacoli W3110, and its nucleotide sequence is shown in SEQ ID NO.15; the glf gene is derived from Zymomonas mobilis, and its nucleotide sequence is shown in SEQ ID NO.16; the nucleotide sequence of the glk gene is shown in SEQ ID NO.

17.

7. A genetically engineered bacterium obtained by the construction method according to any one of claims 1-6.

8. The use of the genetically engineered bacteria obtained by the construction method of any one of claims 1-6 or the genetically engineered bacteria of claim 7 in the fermentation preparation of rhamnolipids.

9. A method for producing rhamnolipid, characterized in that, include: Rhamnose lipolipase is obtained by fermenting the genetically engineered bacteria obtained by the construction method of any one of claims 1-6 or the genetically engineered bacteria of claim 7.

10. The production method according to claim 9, characterized in that, include: The selected single colonies of the genetically engineered bacteria were inoculated into LB liquid medium and cultured at 30-37℃ and 150-200 rpm for 12-15 h to be used as seed culture. as well as The seed culture was inoculated into the fermentation medium at a 1% inoculum and cultured at 30-37℃ and 150-200 rpm for 2-4 days. The fermentation broth was then collected to detect the rhamnolipid yield.