Heparanase-loaded CAR-T exosome and application thereof

By using CAR-T exosomes loaded with HPSE, the problem of ECM barrier inhibition of CAR-T cells in the treatment of solid tumors has been solved, achieving local ECM remodeling and tumor killing, enhancing tumor infiltration and immune regulation, and is suitable for the treatment of solid tumors such as colorectal cancer, breast cancer, and ovarian cancer.

CN122060686APending Publication Date: 2026-05-19DONGGUAN SOUTHEAST CENTRAL HOSPITAL (DONGGUAN SOUTHEAST TRADITIONAL CHINESE MEDICINE MEDICAL SERVICE CENTER DONGGUAN FIRST HOSPITAL AFFILIATED TO GUANGDONG MEDICAL UNIVERSITY)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
DONGGUAN SOUTHEAST CENTRAL HOSPITAL (DONGGUAN SOUTHEAST TRADITIONAL CHINESE MEDICINE MEDICAL SERVICE CENTER DONGGUAN FIRST HOSPITAL AFFILIATED TO GUANGDONG MEDICAL UNIVERSITY)
Filing Date
2026-02-28
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Current CAR-T cell therapies for solid tumors are inhibited by the dense extracellular matrix barrier in the tumor microenvironment, resulting in low infiltration efficiency and limited therapeutic effects. At the same time, systemic expression of HPSE poses a toxicity risk, and exosomes lack ECM remodeling capabilities.

Method used

CAR-T exosomes loaded with heparanase (HPSE) were designed and anchored in the exosome lumen via pX-Δ1-30. They expressed CCR5 and CCR7 chemokine receptors and carried FasL and TRAIL apoptosis ligands to achieve local ECM remodeling and tumor killing.

Benefits of technology

It significantly enhances tumor-killing ability and immune regulation function, reduces T cell depletion, improves tumor infiltration ability, avoids systemic toxicity, and is suitable for the treatment of solid tumors such as colorectal cancer, breast cancer, and ovarian cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060686A_ABST
    Figure CN122060686A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of immune cell therapy, and particularly relates to a heparanase-loaded CAR-T exosome and application thereof. According to the invention, the HPSE-loaded exosome is secreted by the engineered CAR-T cell, and the activity of the HPSE is limited in a tumor microenvironment (TME) by utilizing an anchoring mechanism, so that systematic off-target toxicity is avoided. The result of the embodiment shows that the exosome shows remarkable ECM degradation capacity, tumor killing efficiency and immune regulation function in in-vitro and in-vivo models, has the characteristics of simplicity in preparation, high safety and remarkable curative effect, and provides a new solution for solid tumor immunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of immunocellular therapy technology, specifically relating to a CAR-T exosome loaded with heparanase and its application. Background Technology

[0002] CAR-T cell therapy has demonstrated significant efficacy in the treatment of hematological malignancies; however, its effectiveness in solid tumors (such as colorectal cancer) is severely limited by the dense extracellular matrix (ECM) within the tumor microenvironment (TME). This dense ECM acts as a physical barrier, significantly inhibiting the tumor infiltration efficiency of CAR-T cells and reducing their effective contact with tumor cells, thus limiting therapeutic efficacy. Among ECM components, heparin sulfate proteoglycan is highly expressed in tumor cells and related matrix, and its degrading enzyme HPSE has been proposed to relax this barrier and promote T cell entry into the tumor core. However, in current CAR-T cell manufacturing processes, HPSE expression often declines sharply during T cell expansion and effector differentiation, failing to maintain sufficient ECM degradation activity. Simultaneously, constitutive overexpression of HPSE carries a serious off-target risk. Since heparin sulfate proteoglycan is also widely present in vital organs such as the lungs, kidneys, and vascular basement membranes, free HPSE may cause systemic ECM damage, leading to toxicity.

[0003] Existing technologies attempt to improve T-cell infiltration and antitumor activity through various means: CAR-T cells directly overexpressing HPSE can enhance ECM degradation and tumor infiltration. However, this strategy fails to effectively limit HPSE activity at the tumor site, causing it to circulate systemically in a free form, easily leading to systemic toxicity. Furthermore, existing CAR-T cell therapies for solid tumors also suffer from T-cell exhaustion, limiting efficacy. In recent years, CAR-T-derived exosomes have been found to inherit tumor homing properties and carry CAR and apoptosis ligands (such as TRAIL and FasL), exhibiting certain tumor-killing and homing capabilities. However, existing exosome technologies lack engineered designs for ECM remodeling, failing to effectively address the physical barrier of the tumor matrix.

[0004] Therefore, developing a CAR-T exosome loaded with HPSE is crucial to overcoming the obstacles of CAR-T therapy for solid tumors and achieving efficient and low-toxicity immunotherapy for solid tumors. Summary of the Invention

[0005] The purpose of this invention is to provide a CAR-T exosome loaded with heparanase (HPSE) and its applications. The exosomes provided by this invention can achieve local ECM remodeling, enhance tumor killing, and modulate the immune system.

[0006] To achieve the above objectives, the present invention provides the following technical solution: The present invention provides a CAR-T exosome loaded with heparanase, wherein the heparanase is anchored in the exosome lumen via pX-Δ1-30; the gene sequence of pX-Δ1-30 is shown in SEQ ID NO:1.

[0007] Preferably, the exosomes express CCR5 and CCR7 chemokine receptors on their surface.

[0008] Preferably, the exosomes carry FasL and TRAIL apoptosis ligands.

[0009] This invention provides a method for preparing CAR-T exosomes, the method comprising the following steps: (1) Preparation of HPSE-pX-Δ1-30 CAR-T cells: A lentiviral vector containing HPSE-pX-Δ1-30 was constructed, and activated T cells were transduced using the lentiviral vector to obtain HPSE-pX-Δ1-30 CAR-T cells; the gene sequence of pX-Δ1-30 is shown in SEQ ID NO:1; (2) Exosome secretion and collection: HPSE-pX-Δ1-30 CAR-T cells were transferred to serum-free culture medium and cultured. The cell culture supernatant was collected and the cells and debris were removed by centrifugation. (3) Exosome isolation and purification: Exosomes were precipitated by centrifugation and their quality was assessed.

[0010] Preferably, the lentiviral vector in step (1) includes a single-chain variable fragment targeting mesothelin, a CD8α hinge / transmembrane domain, a 4-1BB co-stimulatory domain and a CD3ζ intracellular domain, and an HPSE-pX-Δ1-30 sequence linked by a 2A self-cleaving peptide; Preferably, the T cells in step (1) are obtained from peripheral blood mononuclear cells through negative selection.

[0011] Preferably, the centrifugation in step (3) is performed at 100,000 xg.

[0012] Preferably, the quality assessment in step (3) includes particle size and marker verification, wherein the particle size is 30–150 nm and the markers are CD9, CD63 and CD81.

[0013] The present invention also provides applications of the CAR-T exosomes: (1) Application in the preparation of drugs for treating solid tumors, wherein the solid tumors include: colorectal cancer, breast cancer, and ovarian cancer.

[0014] (2) Application in the preparation of T cell immune regulation reagents.

[0015] The beneficial effects of this invention are: This invention utilizes engineered CAR-T cells to secrete exosomes loaded with HPSE, employing an anchoring mechanism to limit HPSE activity in the tumor microenvironment (TME) and avoid systemic off-target toxicity. These exosomes exhibit significant ECM degradation capacity, tumor-killing efficacy, and immunomodulatory functions in in vitro and in vivo models. Furthermore, they are characterized by simple preparation, high safety, and significant therapeutic effects, providing a novel solution for immunotherapy of solid tumors. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1-4 Results of HPSE-loaded exosome isolation, purification, and quality assessment.

[0018] Figure 5-6 The results of in vitro tumor spheroid killing experiments using HPSE-loaded exosomes are presented.

[0019] Figure 7-10 The results show the effects of HPSE-loaded exosomes on T-cell immune regulation.

[0020] Figure 11 The results show the in vivo tumor-killing effects of HPSE-loaded exosomes. Detailed Implementation

[0021] This invention provides a CAR-T exosome loaded with heparanase (HPSE), which utilizes the interaction between the truncated hepatitis A virus structural protein pX domain (pX-Δ1-30) and the ESCRT-associated protein ALIX to achieve efficient protein loading into multivesicular bodies / exosomes. Simultaneously, it achieves ECM degradation, tumor killing, and T-cell immune regulation.

[0022] The exosomes described in this invention are derived from chimeric antigen receptor T cells (HPSE-pX-Δ1-30 CAR-T cells) expressing the HPSE-pX-Δ1-30 fusion protein. HPSE is anchored in the exosome lumen via pX-Δ1-30, enabling the degradation of the tumor extracellular matrix (ECM). The exosomes express CCR5 and CCR7 chemokine receptors on their surface and carry FasL and TRAIL apoptosis ligands, inheriting the immune function characteristics of CAR-T cells.

[0023] The exosomes of this invention exhibit the following characteristics: In in vitro models, these exosomes demonstrate dose-dependent tumor spheroid-killing activity, significantly reducing tumor spheroid size and ATP levels in HCT116 colorectal cancer cells, showcasing potent independent anti-tumor activity. Simultaneously, they promote T cell proliferation and longevity memory differentiation (CM / SCM subset), significantly reduce the expression of exhaustion markers PD-1 and CD57, and enhance T cell tumor infiltration. In an HCT116 colon cancer xenograft model, these exosomes significantly inhibit tumor growth, prolong survival, and promote intratumoral CD3+ cytotoxicity. + It showed T-cell infiltration and no systemic toxicity.

[0024] The method for preparing exosomes according to the present invention: The method for preparing HPSE-loaded CAR-T exosomes includes the following steps: (1) Preparation of HPSE-pX-Δ1-30 CAR-T cells: A lentiviral vector containing HPSE-pX-Δ1-30 was constructed, the vector comprising a single-chain variable fragment (scFv, such as anetumab) targeting mesothelin (MSLN), a CD8α hinge / transmembrane domain, a 4-1BB co-stimulatory domain and a CD3ζ intracellular domain, and an HPSE-pX-Δ1-30 sequence linked by a 2A self-cleaving peptide; peripheral blood mononuclear cells (PBMCs) were isolated from healthy donors, T cells were obtained by negative selection, activated and transduced using the lentiviral vector, and cultured for expansion; (2) Exosome secretion and collection: HPSE-pX-Δ1-30 CAR-T cells were transferred to serum-free culture medium and cultured. The cell culture supernatant was collected and cells and debris were removed by low-speed centrifugation. (3) Exosome isolation and purification: Exosomes were precipitated by ultracentrifugation (e.g., centrifugation at 100,000 xg) and quality assessment was performed, including verification of particle size (30–150 nm) and markers (CD9 / CD63 / CD81).

[0025] Applications: The HPSE-loaded CAR-T exosomes can be used to prepare drugs for treating solid tumors, particularly colorectal cancer, breast cancer, and ovarian cancer. Furthermore, these exosomes can be used to prepare reagents for T-cell immune regulation, achieving synergistic therapeutic effects by degrading ECM, reducing T-cell exhaustion, and enhancing T-cell anti-tumor immunity.

[0026] The sequence information involved in this invention is as follows: pX-Δ1-30 sequence: TGCAGGAAGCCATATAAAGAACTGAGATTAGAAGTTGGGAAACAAAGACTCAAGTATGCTCAGGAAGAATTGTCAAATGAAGTACTTCCACCCCCTAGGAAAATGAAGGGACTGTTTTCACAA (SEQ ID NO:1) CAR sequence: Scfv(MSLN-Anetumab)-2ndCAR-FT2A-3FLAG-HPSE(36-543AA)-pX(del1-30aa): To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0027] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0028] The various instruments, equipment, raw materials, or reagents used in the embodiments of this invention are not subject to any special restrictions on their source; they are all conventional products that can be purchased through legitimate commercial channels and can be prepared according to conventional methods well known to those skilled in the art. The main reagents used in the embodiments of this invention are as follows: I. Cell Culture and Basic Culture Medium Reagents 1. Culture medium (1) DMEM high glucose medium: used for HCT116 cell culture; (2) RPMI 1640 medium: used for T cell culture; (3) X-VIVO15 medium: used for primary T cell CAR-T cell culture; (4) 10% fetal bovine serum: added to DMEM and RPMI 1640 medium; (5) 1% penicillin / streptomycin mixture: used for aseptic treatment of all cell culture media; (6) Penicillin / streptomycin / glutamine mixture (100×): Added to X-VIVO15 medium for primary T cell culture.

[0029] 2. Cell digestion and processing reagents (1) Trypsin: used for passage of adherent cells; (2) 50 mmol / L β-mercaptoethanol: added to X-VIVO15 medium to maintain the activity of primary T cells; (3) Recombinant human IL-2: final concentration 10 ng / mL, used for T cell activation and CAR-T cell culture.

[0030] II. Cell Isolation and Activation Reagents 1. Primary cell separation reagents (1) Human peripheral blood lymphocyte separation solution: used for PBMC separation; (2) EasySep Human T Cell Negative Selection Kit: Isolate high-purity primary T cells from PBMCs; (3) T cell activation reagent: ImmunoCult HuCD3 / CD28 / CD2 T cell activator: used for the activation of primary T cells, activation time 24-72 hours.

[0031] III. Functional Testing and Staining Reagents 1. ECM Infiltration and 3D Tumor Spheroid Assay Reagents (1) Matrigel: used for ECM-mimicking coating of Transwell chambers to detect CAR-T cell infiltration ability; (2) 96-well U-shaped ultra-low adsorption (ULA) plate: used for the construction of 3D tumor spheres of HCT116 cells; (3) Breathe-Easy semipermeable membrane sealing film: used to prevent culture medium evaporation during 3D tumor spheroid culture.

[0032] (4) Red CellTracker: Used for marking T cells.

[0033] 2. Reagents for detecting cell viability and killing effect CellTiter-Glo 3D Cell Viability Assay Reagent: Used to detect ATP levels in tumor cells in 3D tumor spheroid models and assess CAR-T cell killing efficiency; IV. FCM Detection Reagents Surface marker antibodies: Anti-human CD3 antibody, anti-human CD4 antibody, anti-human CD8 antibody, anti-human CD45RA antibody, anti-human PD-1 antibody, anti-human CD57 antibody, anti-human TRAIL antibody, anti-human FasL antibody.

[0034] Anti-human CAR antibodies (specific antibodies against MSLN scFv, such as anti-Anetumab scFv antibody): used to detect the expression rate of CAR on the surface of T cells.

[0035] Example 1. Construction of Standard CAR-T and HPSE-pX-Δ1-30 CAR-T The CAR-T lentiviral vector used in this embodiment was purchased from Suzhou Genewiz Biotechnology. The viral titer of the standard CAR-T was 4.52 × 10⁻⁶. 8 Tu / mL; the viral titer of HPSE-pX-Δ1-30 CAR-T was 3.39 × 10⁻⁶. 9 Tu / mL.

[0036] I. Separation of PBMCs by Density Gradient Centrifugation 1. Collect fresh anticoagulated whole blood and infuse it into the anticoagulation tube using a disposable venous blood collection needle. Only 20ml of blood is needed. Collect and use the blood immediately. Perform intercellular experiments directly after blood collection to avoid affecting cell viability.

[0037] 2. Transfer the 20 ml of whole blood obtained in the previous step into a 50 mL centrifuge tube, add 20 mL of PBS solution at a 1:1 ratio to dilute the blood, and mix gently.

[0038] 3. Take two 50 mL centrifuge tubes and add 20 mL of human peripheral blood lymphocyte separation medium. Then, gently add 20 mL of diluted blood to the top layer of the human peripheral blood lymphocyte separation medium in each centrifuge tube. Be gentle to avoid mixing the two solutions and keep the interface between the two liquids clear. Use a 5 mL Pasteur tube to slowly add the blood to the tube wall. Now, each centrifuge tube contains 40 mL of diluted blood.

[0039] 4. Place the diluted blood into a centrifuge at 2000 rpm for 20 minutes. Note: The centrifuge can accelerate normally, but the deceleration should be slow. You can set it to no break or only 10% braking.

[0040] 5. After centrifugation, the liquid levels in the tube, from top to bottom, are: diluted plasma layer, PBMC layer, separation liquid layer, and red blood cell layer. After centrifugation, discard the plasma layer, carefully aspirate the PBMC layer (i.e., the white membrane layer) using a Pasteur tube, and transfer it to a 15mL centrifuge tube.

[0041] 6. Resuspend the cells in a centrifuge tube with 10 mL of PBS washing buffer, centrifuge at 250 g for 10 min at room temperature, discard the supernatant, and repeat this step 1-2 times. Add 1 mL (if the blood draw volume is less than 20 mL, it is recommended to resuspend in 500 μL) of RPMI 1640 medium, resuspend, and count and measure cell viability (counting refers to calculating the total cell count). Adjust the volume to 5 × 10⁻⁶ cells / mL. 7 Cell count per ml. Perform the following separation and activation.

[0042] II. Isolation of Pan T cells 1. Transfer 300 μL of PBMC to a 5 mL flow cytometry tube and add 15 μL of isolation cocktail. Mix and incubate at room temperature for 5 minutes.

[0043] 2. Vortex RapidSpheres™ 30s. (Note: The particles should appear to be uniformly dispersed.)

[0044] 3. Add 12ul RapidSpheres™ for sampling and mixing.

[0045] 4. Add the recommended RPMI 1640 medium to fill the sample to 2.5 ml. Gently pipette up and down 2-3 times to mix.

[0046] 5. Place the tube (without the cap) into the magnet and incubate at room temperature for 3-5 minutes.

[0047] 6. Pick up the magnet and pour the enriched cell suspension into a new test tube. (Note: Invert the magnet and tube for 2-3 seconds, then return them to an upright position.) III. T-cell activation 1. The separated T cells were divided into 1×10⁻⁶ cells. 6 / ml was inoculated into well plates.

[0048] 2. Add CD3 / CD28 T cell activator at a concentration of 25 μL / mL. Use for CAR-T construction 24-48 hours later.

[0049] IV. Construction of CAR-T 1. After approximately 48 hours of T cell activation, count the T cell concentration, obtaining 200,000-800,000 T cells. Centrifuge each sample and add 100 μL of IL-2-free, double-antibody X-VIVO15 medium. Select MOI=8 and add 4.2 μL of virus infection enhancement medium. V 病毒 =(8×N cell ) / V 病毒滴度 Calculate the volume of virus added, then centrifuge at 1000g and 37°C for 10 minutes.

[0050] 2. After 12 hours, add 100 μL of IL-2-free, double-antibody X-VIVO15 medium.

[0051] 3. After 24 hours, the culture was transferred to a 6-well plate for further culture, with a culture volume of 2 ml.

[0052] 4.2 days later, the culture was expanded. CAR expression levels were detected by flow cytometry 1-2 weeks later.

[0053] Example 2. Isolation and purification of HPSE-loaded exosomes This embodiment describes the preparation of HPSE-pX-Δ1-30 CAR-T exosomes loaded with heparanase.

[0054] 1. Exosome secretion induction: HPSE-pX-Δ1-30 CAR-T cells (with high expression rate) prepared and expanded in Example 1 were transferred to X-VIVO15 serum-free medium. The cells were cultured for another 24-72 hours to maximize exosome secretion.

[0055] 2. Collection and pretreatment of supernatant: Collect cell culture supernatant, remove cells by low-speed centrifugation (300g, 10 minutes), and then remove cell debris and large vesicles by medium-speed centrifugation (2,000g to 10,000g).

[0056] 3. Exosome purification: The pretreated supernatant is ultracentrifuged, for example, at 100,000 xg for 70-120 minutes, to precipitate the exosomes. Figure 1 ).

[0057] 4. Quality assessment: After resuspending the exosomes, the particle size was measured (approximately 30-150 nm). Figure 2 ), exosome markers (CD9, CD63, CD81, etc.) Figure 3 ) and confirming the enrichment of HPSE ( Figure 4 ).

[0058] Example 3. Application of HPSE-loaded exosomes in in vitro tumor killing Evaluation of the antitumor efficacy of HPSE-ΔpX1-30 CAR-T exosomes using 3D spheres: 1. Four groups were set up: control group, 5µg, 15µg, and 25µg.

[0059] 2. Six wells for each condition, with an initial seeding cell count of 1 × 10⁶ cells. 4 After 5 days of culture, the tumor spheroids can be considered to be 3 × 10⁻⁶. 4 Cells were cultured daily with PBS at doses of 5µg, 15µg, and 25µg of HPSE-ΔpX1-30 CAR-T exosomes for 72 hours.

[0060] 3. After photographing the tumor spheroids, wash them twice in PBS. Place them in a new 96-well plate and take photographs. Figure 5 Then, the ATP experiment was conducted.

[0061] 4. ATP assay (CellTiter-Glo® 3D cell viability assay) Incubate the CellTiter-Glo® 3D reagent at 37°C until it reaches room temperature (do not place it in an incubator, as this will affect the fluorescence signal). Use a pipette to transfer individual spheroids from the culture medium to a white 96-well microplate (using a white plate avoids interference from the fluorescence signal in other wells). Confirm that the spheroids have been successfully transferred (record the volume of culture medium transferred; in this step, the volume transferred is 60 µl). Add 60 µl of reagent to each well using a multichannel pipette. This procedure must be performed in a biosafety cabinet to prevent contamination of the CellTiter-Glo® 3D reagent.

[0062] Wrap the culture plate in aluminum foil to protect it from light, place it on a shaker, and shake at 120 rpm for 5 minutes to thoroughly mix the culture medium and reagents; then incubate at room temperature for 25 minutes. Spectroscopy was then measured. Results showed that HPSE-ΔpX1-30 CAR-T exosomes significantly reduced tumor size and viability. Figure 6 ).

[0063] Example 4. Application of HPSE-loaded exosomes in T cell immune regulation This embodiment aims to verify the unique function of exosome products as T-cell enhancers.

[0064] HPSE CAR-T exosomes were labeled with PKH26 according to the manufacturer's instructions. After staining, PBS was added to the exosomes, and the mixture was centrifuged at 10,000g for 10 minutes using a 100 kDa ultrafiltration tube. The cells were washed twice to remove excess dye. To determine the internalization of HPSE CAR-T exosomes by recipient cells, T cells (2 × 10⁶ cells) were... 5 Cells were stained with 5 μM CellTracker™ Green CMFDA and incubated at 37°C for 40 min. Excess dye was removed, and cells were gently washed twice with PBS. PKH26-labeled exosomes were then co-incubated with recipient cells. After 12 hours, the incubated cells were fixed with 4% paraformaldehyde and stained with DAPI. Confocal images were acquired using a Leica Stellaris 5. To assess the uptake efficiency of HPSE CAR-T exosomes, FCM was used to detect the uptake of recipient cells 12 hours after contact with PKH26-labeled exosomes. Figure 7 ).

[0065] In proliferation and phenotypic regulation assays, T cells were stained with 5 μM CellTracker™ Green CMFDA before incubation with exosomes, following the manufacturer's instructions. After 3 days of culture, phenotypic changes in T cells were measured using FCM. Figure 8 , Figure 9 ) and proliferation status ( Figure 10 ).

[0066] Example 5. Evaluation of the in vivo tumor-killing efficacy of HPSE-pX-Δ1-30 CAR-T exosomes (basic data on safety and invasion). This embodiment aims to provide basic data on the safety and high penetration potential of exosome products in vivo by evaluating the performance of exosomes in vivo.

[0067] NSG mice were implanted with tumors subcutaneously. Seven days later, they were treated with exosomes injected via the tail vein. Tumor growth was then monitored, and the mice's survival time was recorded.

[0068] 1. After expanding MSLN+-Fluc+-HCT116 cells to the required number, digest the cells, count and aspirate the cells, centrifuge at 950 rpm for 5 min, wash the cells twice with 1×PBS, and discard the supernatant. Resuspend the cells in 1×PBS at a density of 2.5×106 cells / mL for later use (Matrixgel concentration is 5.5 mg / ml).

[0069] 2. After feeding NSG mice for 1 week, 200 μL of cell suspension (5 × 10⁵ tumor cells) was drawn up with a syringe and slowly inoculated subcutaneously into the right hypochondrium on the back.

[0070] 3. Seven to 15 days after tumor injection, when the tumor tissue has grown to approximately 100-200 mm³, administer an equal volume of PBS or exosomes (100 μg per mouse) via tail vein injection every three days. Monitor disease signs (disheveled fur, weight loss, and decreased activity), tumor volume, and survival rate daily, or perform measurements at designated time points. Figure 11 ).

[0071] As can be seen from the above embodiments, the HPSE-pX-Δ1-30 CAR-T exosomes of the present invention can not only significantly reduce the size and activity of tumors in vitro, but also have significant ECM degradation ability, tumor killing efficacy and immune regulation function in vivo. In addition, it can also be used as a T cell enhancer.

[0072] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A CAR-T exosome, characterized in that, The exosomes are loaded with heparanase, which is anchored in the exosome lumen via pX-Δ1-30; the gene sequence of pX-Δ1-30 is shown in SEQ ID NO:

1.

2. The exosomes according to claim 1, characterized in that, The exosomes express CCR5 and CCR7 chemokine receptors on their surface.

3. The exosomes according to claim 1, characterized in that, The exosomes carry FasL and TRAIL apoptosis ligands.

4. A method for preparing CAR-T exosomes, characterized in that, The method includes the following steps: (1) Preparation of HPSE-pX-Δ1-30 CAR-T cells: A lentiviral vector containing HPSE-pX-Δ1-30 was constructed, and activated T cells were transduced using the lentiviral vector to obtain HPSE-pX-Δ1-30 CAR-T cells; the gene sequence of pX-Δ1-30 is shown in SEQ ID NO:1; (2) Exosome secretion and collection: HPSE-pX-Δ1-30 CAR-T cells were transferred to serum-free culture medium and cultured. The cell culture supernatant was collected and the cells and debris were removed by centrifugation. (3) Exosome isolation and purification: Exosomes were precipitated by centrifugation and their quality was assessed.

5. The method according to claim 4, characterized in that, The lentiviral vector in step (1) includes a single-chain variable fragment targeting mesothelin, a CD8α hinge / transmembrane domain, a 4-1BB co-stimulatory domain and a CD3ζ intracellular domain, and an HPSE-pX-Δ1-30 sequence linked by a 2A self-cleaving peptide.

6. The method according to claim 4, characterized in that, The T cells in step (1) are obtained from peripheral blood mononuclear cells through negative selection.

7. The method according to claim 4, characterized in that, The centrifugation in step (3) is performed at 100,000 xg.

8. The method according to claim 4, characterized in that, The quality assessment in step (3) includes particle size and marker verification, wherein the particle size is 30–150 nm and the markers are CD9, CD63 and CD81.

9. The use of the exosomes of claim 1 or the exosomes prepared by the method of claim 4 in the preparation of drugs for treating solid tumors.

10. The use of the exosomes of claim 1 or the exosomes prepared by the method of claim 4 in the preparation of T cell immune regulation reagents.