Recombinant strain for producing L-threonine and preparation method and application thereof

By reducing the malate synthase activity of recombinant Escherichia coli strains and overexpressing related genes, metabolic flux was optimized, solving the problem of low L-threonine yield and conversion rate in microbial fermentation and achieving efficient L-threonine production.

CN122128205APending Publication Date: 2026-06-02QIQIHAR LONGJIANG FUFENG BIOTECHNOLOGIES CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610567250.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-27
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing methods for producing L-threonine by microbial fermentation suffer from slow strain growth, numerous byproducts, and low conversion rates, making it difficult to further improve yield and conversion rates through metabolic engineering.

Method used

By weakening or inactivating the malate synthase activity in recombinant Escherichia coli strains, the glyoxylate cycle is blocked, promoting carbon flow to the PEP-pyruvate node and synthesizing oxaloacetate through the exogenous CO2 fixation pathway. Overexpression of related genes such as thrA, thrB, thrC, asd, ppc, aspC, and aspA optimizes the metabolic flow to the threonine synthesis pathway.

Benefits of technology

It increased the conversion rate of L-threonine by 11.0% and the yield by 7.8%, improved carbon utilization efficiency, and is suitable for the industrial production of L-threonine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128205A_ABST
    Figure CN122128205A_ABST
Patent Text Reader

Abstract

This invention discloses a recombinant bacterial strain for producing L-threonine, its preparation method, and its applications. The recombinant strain is obtained through genetic modification of a starting strain. Compared to the starting strain, the recombinant strain exhibits reduced or inactivated malate synthase activity. The malate synthase gene in the recombinant strain is partially or completely knocked out, and the amino acid sequence encoded by the malate synthase gene includes the sequence shown in SEQ ID NO.1. The recombinant strain of this invention increases L-threonine yield by 7.8% and conversion rate by 11.0%, making it suitable for industrial production of L-threonine with advantages such as high yield and high conversion rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a recombinant strain that produces L-threonine, its preparation method, and its application. Background Technology

[0002] L-Threonine is an essential amino acid for human and animal growth and development, widely used in feed, food additives, and pharmaceutical excipients. Its structure contains a hydroxyl group, which helps retain water in human skin. When combined with oligosaccharide chains, it plays a crucial role in protecting cell membranes and promotes phospholipid synthesis and fatty acid oxidation. As L-Threonine's market share continues to increase, its commercial value is receiving increasing attention. Currently, L-Threonine production methods mainly include chemical synthesis, protein hydrolysis, and microbial fermentation. Among these, microbial fermentation has become the primary method for industrial L-Threonine production due to its low cost and low pollution. However, traditional microbial fermentation methods suffer from problems such as strong randomness in mutagenesis breeding, slow strain growth, and the production of numerous byproducts, making it difficult to obtain high-yielding strains. Although the development of genetic engineering technology has been used to construct threonine-producing strains, challenges remain in further improving yield and conversion rate, as well as reducing production costs.

[0003] One important direction is to improve the yield and conversion rate of L-threonine by modifying *E. coli* through metabolic engineering. Anhui Huaheng Biotechnology Co., Ltd.'s Chinese patent CN117802172A, by introducing the xfspk and glpX genes into the strain, combined with four enzymes of *E. coli* (fbaA, rpi, rpe, and tpi), and other gene modifications, constructed a strain with a carbon-loss-free SBP cycle outside the EMP pathway, resulting in a significant improvement in substrate conversion rate after fermentation. However, this patent still faces the challenge of further optimizing the metabolic pathway and regulatory system to improve L-threonine production efficiency. How to ensure high yield while simultaneously considering carbon source utilization efficiency and energy balance remains a pressing issue.

[0004] Therefore, developing a recombinant strain that can effectively improve the conversion rate of L-threonine is of great significance for promoting the industrial production of L-threonine. Summary of the Invention

[0005] To address the shortcomings of existing technologies and practical needs, this invention provides a recombinant strain for producing L-threonine, its preparation method, and its applications. The recombinant strain of this invention increases the L-threonine yield by 7.8% and the conversion rate by 11.0%, and can be used for the industrial production of L-threonine, with advantages such as high yield and high conversion rate.

[0006] To achieve this objective, the present invention adopts the following technical solution: In a first aspect, the present invention provides a recombinant strain for producing L-threonine, wherein the recombinant strain is obtained by genetic modification of a starting strain, and compared with the starting strain, the malate synthase activity of the recombinant strain is weakened or inactivated; the malate synthase gene in the recombinant strain is partially or completely knocked out, and the amino acid sequence encoded by the malate synthase gene includes the sequence shown in SEQ ID NO.1.

[0007] Malate synthase (AceB) is the second key enzyme in the glyoxylate cycle, catalyzing the conversion of glyoxylate and acetyl-CoA to malate. Malate is then converted to oxaloacetate by malate dehydrogenase. In the glyoxylate cycle, carbon from one glucose molecule can ultimately convert two acetyl-CoA molecules into one oxaloacetate molecule. In the CO2 fixation pathway, phosphoenolpyruvate generates one pyruvate molecule and binds to one molecule of CO2 / HCO3 in the culture medium. - Ultimately, one molecule of oxaloacetate is generated. The resulting pyruvate can generate oxaloacetate carbon atoms exceeding its own carbon atoms, greatly improving carbon efficiency. Oxaloacetate is an important precursor in the threonine synthesis pathway and is crucial for threonine synthesis metabolism. This invention weakens the activity of malate synthase, blocks the glyoxylate cycle, forces the carbon flow to concentrate at the PEP-pyruvate node, and relies on the exogenous CO2 fixation pathway to synthesize oxaloacetate. This directs the metabolic flow from oxaloacetate more towards the biosynthetic precursors of aspartic acid family amino acids (especially threonine), improving carbon utilization efficiency and thus increasing the conversion rate of threonine.

[0008] In this invention, the weakening or inactivation of malate synthase gene activity can be achieved through any one or a combination of at least two of the following methods: partial or complete knockout of the aceB gene, frameshift mutation of the aceB gene, introduction of a stop codon in the aceB gene, or point mutation in the coding region of the aceB gene.

[0009] Preferably, the malate synthase gene includes the aceB gene or its homolog, and the nucleic acid sequence of the aceB gene includes the sequence shown in SEQ ID NO.2.

[0010] SEQ ID NO.1: MTEQATTTDELAFTRPYGEQEKQILTAEAVEFLTELVTHFTPQRNKLLAARIQQQQDIDNGTLPDFISETASIRDADWKIRGIPADLEDRRVEITGPVERKMVINALNANVKVFMADFEDSLAPDWNKVIDGQINLRDAVNGTISYTNEAGKIYQLKPNPAVLICRVRGLHLPEKHVTWRGEAIPGSLFDFALYFFHNYQALLAKGSGPYFYLPKTQSWQEAAWWSEVFSYAEDRFNLPRGTIKATLLIETLPAVFQMDEILHALRDHIVGLNCGRWDYIFSYIKTLKNYPDRVLPDRQAVTMDKPFLNAYSRLLIKTCHKRGAFAMGGMAAFIPSKDEEHNNQVLNKVKADKSLEANNGHDGTWIAHPGLADTAMAVFNDILGSRKNQLEVMREQDAPITADQLLAPCDGERTEEGMRANIRVAVQYIEAWISGNGCVPIYGLMEDAATAEISRTSIWQWIHHQKTLSNGKPVTKALFRQMLGEEMKVIASELGEERFSQGRFDDAARLMEQITTSDELIDFLTLPGYRLLA。

[0011] SEQ ID NO.2:

[0012] In one embodiment of the present invention, the recombinant strain also overexpresses operon genes thrA, thrB, and thrC.

[0013] In one embodiment of the present invention, the recombinant strain also overexpresses the aspartate semialdehyde dehydrogenase gene asd, the phosphopyruvate carboxylase gene ppc, the aspartate aminotransferase gene aspC, and the aspartate aminolyase gene aspA.

[0014] In this invention, the NCBI Gene IDs corresponding to each target gene (operon gene thrA, operon gene thrB, operon gene thrC, aspartate semialdehyde dehydrogenase gene asd, phosphopyruvate carboxylase gene ppc, aspartate aminotransferase gene aspC, and aspartate ammonia-lyase gene aspA) are as follows: Gene ID: 945803, Gene ID: 947498, Gene ID: 945198, Gene ID: 947939, Gene ID: 948457, Gene ID: 945553, and Gene ID: 948658.

[0015] Preferably, the starting strain includes Escherichia coli.

[0016] In a second aspect, the present invention provides a method for constructing the recombinant strain described in the first aspect, the method comprising: genetically modifying the starting strain to weaken or inactivate the malate synthase activity in the starting strain; the method for weakening or inactivating the malate synthase activity in the starting strain comprises any one of homologous recombination, CRISPR / Cas9, transposon mutation or chemical mutagenesis, wherein the amino acid sequence encoded by the malate synthase activity gene comprises the sequence shown in SEQ ID NO.1.

[0017] Preferably, the malate synthase gene includes the aceB gene or its homolog, and the nucleic acid sequence of the aceB gene includes the sequence shown in SEQ ID NO.2.

[0018] Thirdly, the present invention provides a method for producing L-threonine, the method comprising: culturing the recombinant strain described in the first aspect to obtain a fermentation broth; and recovering L-threonine from the fermentation broth.

[0019] Preferably, the culture is carried out in a fermentation medium containing a carbon source and a nitrogen source, wherein the carbon source includes glucose.

[0020] Preferably, the culture includes: controlling the dissolved oxygen level to be above 30%, the fermentation pH to be 6.5-7.5 (e.g., 6.5, 7.0 or 7.5), and the fermentation cycle to be 40-48 hours (e.g., 40 hours, 42 hours or 48 hours).

[0021] Fourthly, the present invention provides the application of the recombinant strain described in the first aspect or the recombinant strain constructed by the method described in the second aspect in the production of L-threonine.

[0022] Fifthly, the present invention provides the use of the recombinant strain described in the first aspect or the recombinant strain constructed by the method described in the second aspect in the preparation of products containing L-threonine.

[0023] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention confirms that the reduced activity of malate synthase in the recombinant strain leads to a greater shift of metabolic flux from oxaloacetate to the biosynthetic precursors of aspartic acid family amino acids (especially threonine), thereby improving carbon utilization efficiency and increasing the conversion rate of threonine by 11.0%. (2) Using the recombinant strain of the present invention that produces high threonine, the yield of threonine was increased by 7.8%. Attached Figure Description

[0024] Figure 1 This is a verification diagram of aceB gene knockout in Example 1.

[0025] Figure 2 This is a verification diagram of aceB gene knockout in Example 2. Detailed Implementation

[0026] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0027] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0028] The specific sequences of the primers used in the following examples are as follows: PthrABC-F (SEQ ID NO. 3):TCTAGACGCGTACAGGAAACACAGAAAAAAGCCC.

[0029] PthrABC-R(SEQ ID NO.4):GAGCTCTCATTTTTCTCCATAATTTCTTCATAAAAAAG。

[0030] Pasd-F(SEQ ID NO.5):CTAGAACTTTGGCTGCTTTTTGTATGGTGAAAGATG。

[0031] Pasd-TY-R(SEQ ID NO.6):AAGTATCGCATCCGTTACGCCAGTTGACGAAGC。

[0032] Pppc-TY-F(SEQ ID NO.7):GTCGGATGCTTCGTCAACTGGCGTAACGGATGCGA。

[0033] Pppc-TY-R(SEQ ID NO.8):AACAAAGAGGTGTGCTATTAGCCGGTATTACGCATAC。

[0034] PaspC-TY-F(SEQ ID NO.9):GGCAGGTATGCGTAATACCGGCTAATAGCACACCT。

[0035] PaspC-TY-R(SEQ ID NO.10):CTAATGACCACAATATTACAGCACTGCCACAATCGC。

[0036] PaspA-TY-F(SEQ ID NO.11):TGTGGCAGTGCTGTAATATTGTGGTCATTAGCAAA。

[0037] PaspA-R(SEQ ID NO.12):GAGCTCATTAGCCTTCCTTGTTTTTTAACAAGTTGATAT。

[0038] Pkan-TY-F-1(SEQ ID NO.13):CAATATAGGCATAGCGCACAGACAGATAAATACCGTTCGTATAGCATACATTATACGAAGTTATAGGAAGCGGAACACGTAGAA。

[0039] Pkan-TY-R-1 (SEQ ID NO. 14) GCATGGTTGTTACCTCGTTACCTTTGGTCGTACCGTTCGTATAATGTATGCTATACGAAGTTATTTAGAAGAACTCGTCAAGAAG.

[0040] Pkan-TY-F-2 (SEQ ID NO. 15): TCACAAGGCCGTATGGCGAGCAGGAGAAGCTACCGTTCGTATAGCATACATTATACGAAGTTATAGGAAGCGGAACACGTAGAA.

[0041] Pkan-TY-R-2 (SEQ ID NO. 16): GAAGTGGTGATCTGTTCCATCAAGCGTGCGTACCGTTCGTATAATGTATGCTATACGAAGTTATTTAGAAGAACTCGTCAAGAAG.

[0042] PthrL-F (SEQ ID NO. 17): ACGGGCAATATGTCTCTGTGTGGATTAA.

[0043] PthrL-R (SEQ ID NO. 18): CGCTAATGGTTTTTTCAATCATCGCCAC.

[0044] PaceB-F (SEQ ID NO. 19):TTTCCGAAACGTACCTCAGC.

[0045] PaceB-R (SEQ ID NO. 20): GTGTACGGTTTTCATGTGC.

[0046] Example 1 Construction of FFTHR-3 and its recombinant strains.

[0047] (1) Construction of FFTHR-3 strain To construct a strain capable of producing L-threonine, the thrL gene in *E. coli* strain MG1655 was knocked out using homologous recombination. The specific steps are as follows: Homologous arms were selected at both ends of the target gene. Using plasmid PKD13 as a template, primers Pkan-TY-F-1 / Pkan-TY-R-1 were designed to amplify the homologous arms of the kan gene containing the lox71 / lox66 sites. PCR amplification was performed to obtain the kan fragment containing the homologous arms and the lox71 / lox66 sites. Competent cells of *E. coli* were prepared, and the pKD46 plasmid was electroporated into *E. coli* MG1655. The resulting MG1655-pKD46 strain was cultured at 30°C. Competent cells of the MG1655-pKD46 strain were prepared, and the PCR product was electroporated into the MG1655-pKD46 strain. Homologous recombination was induced by adding 100 mg / mL arabinose inducer to the culture medium. The strain was cultured at 37°C to remove the pKD46 temperature-sensitive plasmid, plated on kan resistance plates, and screened. Subsequently, the pSC101-cre plasmid was transformed into the validated strain to express the flip recombinase gene, promoting site-specific recombination at the lox71 / lox66 sites, ultimately achieving thrL gene knockout (Gene ID: 944742). The strain was simultaneously cultured in LB medium and kanamycin-resistant medium. The strain that grew normally in LB medium and did not grow in resistant medium was the strain with successful thrL gene knockout. Finally, the pSC101-cre thermosensitive plasmid was removed by culturing at 37°C. Sequencing confirmed the thrL gene knockout, and the strain was named MG1655-△thrL.

[0048] Primers PthrABC-F and PthrABC-R were designed using the whole genome of *E. coli* as a template to amplify thrA (Gene ID: 945803), thrB (Gene ID: 947498), and thrC (Gene ID: 945198). The pACYC177 plasmid and the PCR product of this fragment were digested with Sac I and Xba I at 37℃ for 2 h 30 min. The completely digested linearized plasmid vector and the candidate fragment were ligated at 22℃ for 30 min to form a circular structure, and the plasmid was extracted. The pACYC177 plasmid was electroporated (electroplation parameters: 2.5 Kv, 5.8 ms) into the expression host strain MG1655-△thrL. The successfully transformed strain was named FFTHR-3.

[0049] (2) Construction of FFTHR-3-△aceB strain Homologous arms were selected at both ends of the target gene. Using plasmid PKD13 as a template, primers Pkan-TY-F-2 / Pkan-TY-R-2 were designed to amplify the homologous arms of the kan gene containing lox71 / lox66 sites. PCR amplification was performed to obtain the kan fragment containing the homologous arms and lox71 / lox66 sites. Competent cells of *E. coli* strain FFTHR-3 were prepared, and the pKD46 plasmid was electroporated into FFTHR-3 cells. The resulting MG1655-pKD46 strain was then cultured at 30°C. Competent cells of strain FFTHR-3-pKD46 were prepared, and the PCR product was electroporated into FFTHR-3-pKD46 cells. Homologous recombination was induced by adding 100 mg / mL arabinose to the culture medium. The cells were cultured at 37°C to remove the pKD46 temperature-sensitive plasmid, plated on kan resistance plates, and screened. Subsequently, the pSC101-cre plasmid was transformed into the correctly validated strain to express the flip recombinase gene, promoting site-specific recombination at the lox71 / lox66 loci, ultimately achieving aceB gene knockout. The strains were simultaneously cultured in LB medium and kanamycin-resistant medium. Strains that grew normally in LB medium but not in the resistant medium were considered to have successfully knocked out the aceB gene. Finally, the strains were cultured at 37°C to remove the temperature-sensitive pSC101-cre plasmid, ultimately achieving the knockout of a portion of the aceB gene (SEQ ID NO.2), including its functional domain, thus inactivating the aceB gene. PCR was performed using primer pairs PaceB-F / PaceB-R to verify the successful removal of the target gene. The verification results are as follows: Figure 1 As shown, M is the DNA marker, E1 represents the aceB gene amplification result, and E2 represents the aceB gene knockout verification result. The strain with partial aceB gene knockout was named FFTHR-3-△aceB.

[0050] Example 2 Construction of FFTHR-4 and its recombinant strain.

[0051] (1) Primers Pasd-F, Pasd-TY-R, Pppc-TY-F, Pppc-TY-R, PaspC-TY-F, PaspC-TY-R, PaspA-TY-F, and PaspA-R were designed using the whole genome of Escherichia coli as a template to amplify the genes asd (Gene ID: 947939), ppc (Gene ID: 948457), aspC (Gene ID: 945553), and aspA (Gene ID: 948658). The pACYC177 plasmid and the PCR product of this gene fragment were digested with enzymes according to the method described in Example 1 (1), ligated into a circular form, and the plasmid was extracted. The pACYC177 plasmid was electroporated into Escherichia coli MG1655, and the successfully transformed strain was named FFTHR-4.

[0052] (2) Referring to the method and primers described in Example 1(2), a portion of the aceB gene (SEQ ID NO.2) in strain FFTHR-4, including its functional domain, was knocked out by homologous recombination to inactivate the aceB gene. PCR was then performed using primer pair PaceB-F / PaceB-R to verify whether the target gene had been successfully removed. The verification results are as follows: Figure 2 As shown, M is the DNA marker, E1 is the aceB gene amplification result, and E2 is the aceB gene knockout verification result. The strain with partial aceB gene knockout was named FFTHR-4-△aceB.

[0053] Example 3 L-threonine was produced by fermentation using recombinant strains constructed in Examples 1-2.

[0054] The FFTHR-3-△aceB and FFTHR-4-△aceB strains obtained in Examples 1-2 were inoculated with threonine-producing strains FFTHR-3 and FFTHR-4 on seed culture medium to obtain seed solutions. The seed culture medium consisted of the following components at the following concentrations: corn steep liquor 4.2 g / L, glucose 10 g / L, yeast extract 2.5 g / L, KH2PO4 2 g / L, magnesium sulfate 1.2 g / L, FeSO4·7H2O 20 mg / L, MnSO4·H2O 20 mg / L, and biotin 30 mg / L. Each experiment was conducted in triplicate.

[0055] The seed culture obtained using the above cultivation method was transferred into fermentation medium at an inoculum size of 20%. 1. Process control of 5L seed tank (1) Set the temperature to 37℃, pH to 7.0, rotation speed to 500 rpm, and air volume to 0.3 m³. 3 / h, with the temperature controlled at 37℃ throughout the process, the tank pressure at 0.05~0.08 MPa, and the culture cycle at 10 h; (2) Transplantation criteria: OD 600 :12~15.

[0056] (3) The seed culture medium consisted of 5 g / L corn steep liquor powder, 20 g / L glucose, 5 g / L yeast powder, 2 g / L KH2PO4, 1 g / L magnesium sulfate, 20 mg / L FeSO4·7H2O, and 20 mg / L MnSO4·H2O. 2. Fermentation process control in a 5L fermenter (1) Set the temperature to 37℃, pH to 7.0, initial rotation speed to 300 rpm, and air volume to 0.3 m³. 3 / h, with the temperature controlled at 37℃ throughout the process and the tank pressure at 0.05~0.08 MPa; (2) DO control: At 0 h, the air volume is 0.3 m³. 3 / h, 300 rpm, tank pressure 0.05 MPa; (3) When the DO drops below 30%, the dissolved oxygen level is controlled at 30% by adjusting the aeration rate and stirring speed until the fermentation ends; (4) The fermentation medium consisted of 20 g / L glucose, 2 g / L potassium dihydrogen phosphate, 3 g / L yeast powder, 1 g / L betaine, 1 g / L magnesium sulfate, 10 mg / L FeSO4·7H2O, 10 mg / L MnSO4·H2O, 8 g / L corn steep liquor powder, and 10 mg / L vitamin B1.

[0057] 3. Determination of threonine (1) Sample preparation: Take 1 mL of fermentation broth after 48 h of fermentation, centrifuge at 12000 rpm for 10 min to remove the cells and collect the supernatant. Dilute the supernatant appropriately with deionized water and then filter it through a filter membrane with a pore size of 0.22 μm.

[0058] (2) Analysis method: OPA pre-column derivation.

[0059] (3) Chromatographic conditions: ①Chromatographic column: C18 (250×4.6) mm.

[0060] ② Column temperature: 40℃.

[0061] ③Mobile phase A: Weigh 3.01 g of anhydrous sodium acetate into a beaker, dissolve it in ultrapure water and bring the volume to 1 L, then add 200 μL of triethylamine, and adjust the pH to 7.20±0.05 with 5% acetic acid; after filtration, add 5 mL of tetrahydrofuran, mix and filter through a 0.22 μm inorganic filter membrane, then place in an ultrasonic cleaning pot to remove air for 20 min, and set aside.

[0062] Mobile phase B: Weigh 3.01 g of anhydrous sodium acetate into a beaker; dissolve in ultrapure water and bring the volume to 200 mL; adjust the pH to 7.20±0.05 with 5% acetic acid; then add 400 mL of acetonitrile and 400 mL of methanol to this solution, mix, filter, and then place in an ultrasonic cleaning pot to remove air for 20 min, and set aside.

[0063] ④ Flow rate: 1.0 mL / min; ⑤ Ultraviolet detector: 338 nm; ⑥ Column temperature: 40℃.

[0064] (4) The production performance of the recombinant strain in a 5 L fermenter was verified, and the results are shown in Table 1.

[0065] The conversion rate is calculated as follows: amino acids produced (g / L) / (g / L of glucose input - g / L of residual sugar) × 100%.

[0066] Table 1 As shown in Table 1, the L-threonine conversion rate of the strains with inactivated aceB gene (FFTHR-3-△aceB and FFTHR-4-△aceB) was significantly improved compared with the original strains (FFTHR-3 and FFTHR-4), with the percentage increases being 11.0% and 10.4%, respectively. The yield was also improved to some extent, with the percentage increases being 7.5% and 7.8%, respectively.

[0067] In summary, the L-threonine conversion rate and yield of the recombinant strain of this invention are significantly improved, making it suitable for the industrial production of L-threonine with advantages such as high yield and high conversion rate.

[0068] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A recombinant bacterial strain for producing L-threonine, characterized in that, The recombinant strain was obtained by genetic modification of the starting strain. Compared with the starting strain, the malate synthase activity of the recombinant strain is weakened or inactivated. The malate synthase gene in the recombinant strain is partially or completely knocked out, and the amino acid sequence encoded by the malate synthase gene includes the sequence shown in SEQ ID NO.

1.

2. The recombinant strain according to claim 1, characterized in that, The malate synthase gene includes the aceB gene or its homolog, and the nucleic acid sequence of the aceB gene includes the sequence shown in SEQ ID NO.

2.

3. The recombinant strain according to claim 1 or 2, characterized in that, The starting strain includes Escherichia coli.

4. A method for constructing the recombinant strain according to any one of claims 1-3, characterized in that, The method includes: genetically modifying the starting strain to weaken or inactivate the malate synthase activity in the starting strain; the method for weakening or inactivating the malate synthase activity in the starting strain includes any one of homologous recombination, CRISPR / Cas9, transposon mutation or chemical mutagenesis, and the amino acid sequence encoded by the malate synthase activity gene includes the sequence shown in SEQ ID NO.

1.

5. The method according to claim 4, characterized in that, The malate synthase gene includes the aceB gene or its homolog, and the nucleic acid sequence of the aceB gene includes the sequence shown in SEQ ID NO.

2.

6. A method for producing L-threonine, characterized in that, The method for producing L-threonine includes: culturing the recombinant strain according to any one of claims 1-3 to obtain a fermentation broth; and recovering L-threonine from the fermentation broth.

7. The method for producing L-threonine according to claim 6, characterized in that, The culture is carried out in a fermentation medium containing a carbon source and a nitrogen source, wherein the carbon source includes glucose.

8. The method for producing L-threonine according to claim 6 or 7, characterized in that, The cultivation process includes: controlling the dissolved oxygen level to above 30%, the fermentation pH to 6.5-7.5, and the fermentation cycle to 40-48 hours.

9. The use of the recombinant strain according to any one of claims 1-3 or the recombinant strain constructed by the method according to claim 4 or 5 in the production of L-threonine.

10. The use of the recombinant strain according to any one of claims 1-3 or the recombinant strain constructed by the method according to claim 4 or 5 in the preparation of products containing L-threonine.

Citation Information

Patent Citations

  • Method for increasing supply of acetyl coenzyme A precursor and application of method in improvement of threonine conversion rate

    CN117802172A