A dsRNA for the control of maize leaf spot disease and its application

Abstract

This invention discloses a dsRNA for controlling maize leaf spot and its application, belonging to the field of RNA biocontrol technology. This invention targets the cfem protein family of maize leaf spot pathogens. St003016 Genetically engineered dsRNA, whose nucleotide sequence is shown in SEQ ID No. 1, was experimentally demonstrated to significantly inhibit... St003016 Gene expression can reduce the pathogenicity of corn leaf blight pathogens and can be used as a product for the control of corn leaf blight, which provides a new target and theoretical basis for the development of biopesticides for the control of corn leaf blight.

Description

Technical Field

[0001] This invention relates to the field of RNA biocontrol technology, and in particular to a dsRNA for controlling maize leaf spot and its application. Background Technology

[0002] Maize leaf spot pathogen ( Setosphaeria turcica *Heterophyllum heliotropium* (HHH) is a significant pathogenic fungus affecting maize. The resulting northern corn leaf blight is widespread in maize-producing areas, damaging leaves, leaf sheaths, and husks, leading to reduced yield and quality, and ultimately causing severe economic losses. It has become one of the most important fungal diseases affecting maize. Current control measures mainly include disease-resistant breeding and chemical fungicide control. Disease-resistant breeding can fundamentally solve the northern corn leaf blight, with significant and environmentally friendly effects. However, it suffers from drawbacks such as long breeding cycles, difficulty in exploring breeding mechanisms, and a lack of breeding resources, making it difficult to implement in practice. Chemical fungicides offer rapid and obvious control, but their mechanisms of action are singular, and long-term use can lead to pathogen resistance, failing to address the root cause of the problem. Research progress on both methods has been slow. Therefore, achieving rapid and environmentally friendly control of northern corn leaf blight is crucial.

[0003] RNA pesticides are novel biopesticides developed based on RNA interference technology. Essentially, they work by binding small RNA molecules to complementary RNA, interfering with its function and promoting its degradation—a post-transcriptional gene silencing mechanism. Based on this mechanism, double-stranded RNA (dsRNA) targeting key pathogenic genes in pathogens has been designed and synthesized, effectively controlling various plant diseases.

[0004] RNAi biopesticides offer numerous advantages over traditional pesticides. Firstly, their selective targeting of specific pathogens reduces the ecological threat posed by pesticides. Secondly, their readily degradable nature alleviates concerns about pesticide residues. Furthermore, the targeted design of RNAi technology prevents the development of pesticide resistance in pathogens. Clearly, RNAi technology holds significant potential for disease control. Therefore, developing RNAi biopesticides for controlling maize leaf spot is of great importance. Summary of the Invention

[0005] The purpose of this invention is to provide a dsRNA for the prevention and control of maize leaf spot disease and its application, thereby solving the problems existing in the prior art. This dsRNA can significantly reduce the CFEM protein family of maize leaf spot pathogen. St003016 The expression of genes that reduce the pathogenicity of corn leaf blight can be used as a product for the control of corn leaf blight, which provides a new target and theoretical basis for the development of biological pesticides for the control of corn leaf blight.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a dsRNA for controlling maize leaf spot disease, wherein the dsRNA targets the maize leaf spot pathogen. St003016 The gene, with its nucleotide sequence shown in SEQ ID No. 1.

[0007] The present invention also provides the use of the dsRNA in the following (1) or (2): (1) Application in the preparation of biological pesticides for the prevention and control of maize leaf spot; (2) Application in the preparation of inhibitors of maize leaf spot pathogen.

[0008] The present invention also provides a biological pesticide for controlling maize leaf spot disease, the biological pesticide comprising the aforementioned dsRNA.

[0009] The present invention also provides an inhibitor of maize leaf spot pathogen, the inhibitor comprising the dsRNA described above.

[0010] This invention also provides a method for controlling maize leaf spot disease, comprising treating maize leaves with the aforementioned dsRNA or the aforementioned biopesticide to interfere with the maize leaf spot pathogen. St003016 The steps of gene expression.

[0011] Optionally, the treatment includes spraying or spot application.

[0012] The present invention also provides a method for inhibiting maize leaf spot pathogen, comprising treating maize leaf spot pathogen or its receptor with the said dsRNA or the said inhibitor to interfere with maize leaf spot pathogen. St003016 The steps of gene expression.

[0013] Optionally, the treatment includes spraying or spot application.

[0014] Optionally, the receptor is a corn leaf.

[0015] This invention also provides the target genes of the dsRNA. St003016 Applications in (1) or (2) below: (1) Application in the preparation of biological pesticides for the prevention and control of maize leaf spot; (2) Application in the preparation of inhibitors for maize leaf spot pathogen; Among them, the target gene St003016 The nucleotide sequence is shown in SEQ ID No. 10: ATGCTCTTCACAAAGGTTGCTTTCGTCTCCGCTCTTGCGGCGCTCGCTGCTGCCCAGGACACCAGCTTCAACACCGACAAGGTCCCGTCGGCGTGCAAAGACACATGCTCCAAGGTCGGCGACATTACCAAGACATGCAAGAACGACCATAACAACGACGCCTCGGCAGCACTCAAGTGCATCTGCACATCGACCGACGCAAACTCCATCATCCCGGACTGCGAGGCCTGCATCCGGTCC CACAACGACAACAAAACCGATGGCAACGACGCCGACGCTTACCGTCTCCTGACCGAGTGCTCGTACACCACTACCACGCTGGCTGCCAGCCAGGTCGCAAAGACAACCGTCACTGACACAACTACCTCGACCGACGTCACCACAACACACCACAAGACTAGCAACCCGGCTCCTATGAAGACGGCTGGTGCGGCTGTTGGTATTGGTGCTTTTGGCATTGCTGCTTTGGGTTTGTTGTAG.

[0016] The present invention discloses the following technical effects: This invention targets the cfem protein family genes of maize leaf spot pathogen. St003016 We designed and synthesized dsRNA based on specific fragments of the gene, and used the in vitro synthesized dsRNA to interfere with the target gene, achieving targeted gene silencing at the transcriptional level; further, we treated leaves infected with maize leaf spot fungus with dsRNA to target the gene silencing. St003016 The gene assay showed a significant reduction in the pathogenicity of maize leaf spot pathogen, indicating that the targeted gene design of this invention... St003016 The dsRNA of the gene has the potential for the research and application of targeted nucleic acid pesticides. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is an electrophoresis diagram of the transcription product provided by the present invention; M is a standard DNA molecule, and 1 and 2 are... dsSt003016 ; Figure 2 The silencing efficiency diagram of maize leaf spot pathogen provided by this invention; Figure 3 The diagram shows the effect of the present invention on the control of maize leaf spot disease; the left side is the control group and the right side is the experimental group. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] In this invention, unless otherwise specified, the materials, reagents and equipment used are all conventional selections.

[0025] In this invention, targeting St003016 dsRNA ( dsSt003016This is a double-stranded RNA, composed of a sense strand and an antisense strand. The nucleotide sequence of its sense strand is shown in SEQ ID. No. 1, and the nucleotide sequence of its antisense strand is the reverse complementary sequence of SEQ ID. No. 1. The nucleotide sequence of the sense strand of the dsRNA shown in SEQ ID. No. 1 is as follows: ATGCCTCTTCACAAAAGGTTGCTTTCGTCTCCGCTCTTGCGGCGCTCGCTGCTGCCCAGGACACCAGCTTCAACACCGACAAGGTCCCGTCGGCGTGCAAAGACACATGCTCCAAGGTCGGCGACATTACCAAGACATGCAAGAACGACCAT AACAACGACGCCTCGGCAGCACTCAAGTGCATCTGCACATCGACCGACGCAAACTCCATCATCCCGGACTGCGAGGCCTGCATCCGGTCCCACAACGACAACAAAACCGATGGCAACGACGCCGACGCTTACCGTCTCCTGACCGAGTGC.

[0026] Example 1: Synthesis and purification of dsRNA 1. Total RNA extraction and cDNA synthesis Preparation: Soak the experimental plastic products in 0.1% DEPC water overnight in a fume hood, then sterilize them together with the glass products at high temperature and high pressure for 3 hours, and dry them at 85°C for later use; pre-cool the experimental reagents at 4°C in advance.

[0027] (1) Scrape the mycelium of fresh corn leaf blight fungus that has grown for 7-10 days on PDA medium, grind it with liquid nitrogen and transfer it into a 1.5 mL centrifuge tube without RNase.

[0028] (2) Add 1 mL of Trizol, shake to mix, and let stand on ice for 5 minutes.

[0029] (3) Add 200 μL of chloroform and shake for 1 min. After standing on ice for 5 min, centrifuge at 4℃ and 12000 rpm for 10 min.

[0030] (4) Transfer the supernatant to a new tube, add an equal volume of isopropanol and mix well. Place at -20℃ for 20 min to precipitate RNA, and then centrifuge at 4℃ and 12000 rpm for 10 min.

[0031] (5) Discard the supernatant, wash the precipitate with 1 mL of 75% DEPC ethanol (75% ethanol + DEPC-treated ultrapure water), and then centrifuge at 4℃ and 12000 rpm for 5 min. Repeat the steps once.

[0032] (6) Discard the supernatant, absorb the remaining liquid, air dry on ice, add 20 μL of DEPC-treated ultrapure water, and dissolve the RNA in a 55°C water bath for 10 min.

[0033] (7) RNA was detected by electrophoresis on a 1% TAE agarose gel containing 0.1% DEPC, and the remainder was stored at -80℃.

[0034] (8) RNA was reverse transcribed into cDNA. The reaction system is shown in Table 1.

[0035] Table 1 Reverse transcription system PCR procedure: First, react at 42℃ for 30 min; then raise the temperature to 85℃ and hold for 5 s; finally, lower the temperature to 4℃ and maintain a constant temperature.

[0036] 2. Primer design Based on the gene sequence of *Heliotropium indicum* published in the National Center for Biotechnology Information (NCBI) database, primers were designed using Primer Premier 5.0 to amplify the *Heliotropium indicum*. St003016 The target gene fragment and primer sequences are shown in Table 2.

[0037] Table 2. Primer sequences for polymerase chain reaction 3. Synthesis of dsRNA dsRNA was synthesized in vitro using the T7 RiboMAX™ Express RNAi System from Promega (Beijing) Biotechnology Co., Ltd. The T7 RNA ploymerase recognizes DNA templates with a T7 promoter and, using four NTPs as substrates, dsSt003016 was synthesized via in vitro transcription. The specific method is as follows: (a) Prepare the reaction system as shown in Table 3.

[0038] Table 3 Reaction System Mix gently and incubate at 37°C for 30 minutes.

[0039] (b) Removal of DNA template, annealing of dsRNA and removal of ssRNA To anneal the RNA strands, first mix equal volumes of the in vitro transcribed positive and negative strand RNA reaction solutions, then incubate at 70°C for 10 min, followed by slow cooling to room temperature (approximately 20 min). This annealing process achieves double-stranded RNA annealing. Add 1 μL of RNase to 199 μL of nuclease-free water to dilute the accompanying RNase solution (1:200). For every 20 μL reaction volume, add 1 μL of freshly diluted RNase solution and 1 μL of RQ1 RNase-Free DNase, and incubate at 37°C for 30 min. This removes all residual single-stranded RNA and DNA template, leaving only double-stranded RNA.

[0040] 4. Purification of double-stranded RNA (a) Add 0.1 volume of 3M sodium acetate (pH 5.2) and 1 volume of isopropanol or 2.5 volumes of 95% ethanol. Mix well and place on ice for 5 min. The reaction solution will become cloudy during this stage. Place in a microcentrifuge and centrifuge at the highest speed for 10 min.

[0041] (b) A white precipitate should be visible at the bottom of the microcentrifuge tube. Carefully pour out or aspirate the supernatant and wash the precipitate with 0.5 mL of 70% cold ethanol, removing all ethanol after washing. Air dry the precipitate at room temperature for 15 min, then resuspend the RNA sample in nuclease-free water, at a volume 2-5 times the initial reaction volume. Store the purified product (i.e., […]) at -20°C or -70°C. dsSt003016 or dseGFP The electrophoresis results are shown in [link to electrophoresis results]. Figure 1 .

[0042] Example 2: In vitro RNAi against maize leaf spot pathogen St003016 Gene silencing effect 1. Quantitative primer design Using the stable gene Tubulin expressed in maize leaf spot fungus as an internal control, specific primers for RNAi were designed according to the primer design in Example 1. The primer sequences are shown in Table 4.

[0043] Table 4 Quantitative Primer Sequences 2. Sample collection: Using Example 1 dseGFP and dsSt003016 10 μL of each fungus was sprayed onto wild-type maize large leaf spot pathogen (WT) cultured on PDA medium for 7 days. Mycelia were collected from the treatment groups after 24 h and 48 h of culture. RNA was extracted and reverse transcribed into cDNA according to the method in Example 1.

[0044] 3. qPCR reaction system and procedure Table 5 qPCR reaction system Table 6 Two-step reaction procedure Use 2 -△△Ct The data results of qRT-PCR were analyzed by method, and plotted using GraphPad Prism 5 software after being repeated three times.

[0045] The results are as follows Figure 2 As shown, compared to WT, dsSt003016 The relative expression level of was significantly reduced, while dseGFP There was no significant difference compared to the expression level. dsSt003016 It can inhibit St003016 Gene expression.

[0046] Example 3: Verification of dsRNA interference effect (1) Experimental materials: Prepare 10 μL of maize leaf spot pathogen containing 500 ng / μL dsRNA and grown for 7 days. Take a 1×1 cm sample from the edge of the fungus. 2 The substrate trays and corn seedlings with 4-5 leaves are used.

[0047] (2) Preparation before the experiment: Inoculate corn seedlings with uniform growth with corn leaf blight.

[0048] (3) Adding dsRNA: Surfactant L-77 (Solepro) was added to dsRNA to increase cell membrane permeability. Two groups were formed: the control group received ddH2O + L-77 (as a control); the experimental group received... dsSt003016 +L-77.

[0049] (4) Inoculation: After inoculating the trays, the control group was given ddH2O+L-77, and the experimental group was given ddH2O+L-77. dsSt003016 +L-77. The culture was carried out at 25℃ with humidification for 24 hours. The resulting lesions were measured and photographed. Simultaneously, untreated material was used as a blank control.

[0050] (5) Observation: Observe the disease status and take photos after 3-7 days.

[0051] The results are as follows Figure 3 As shown, dsSt003016 Treatment significantly reduced lesions, indicating that it targets the CFE protein family. St003016 The dsRNA of the gene can significantly reduce the pathogenicity of maize leaf spot pathogen and can be used to control maize leaf spot disease.

[0052] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A dsRNA for controlling maize leaf spot disease, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID No.

1.

2. The use of the dsRNA as described in claim 1 in either (1) or (2): (1) Application in the preparation of biological pesticides for the prevention and control of maize leaf spot; (2) Application in the preparation of inhibitors of maize leaf spot pathogen.

3. A biological pesticide for controlling maize leaf spot disease, characterized in that, The biopesticide comprises the dsRNA as described in claim 1.

4. An inhibitor of maize leaf spot fungus, characterized in that, The inhibitor comprises the dsRNA as described in claim 1.

5. A method for controlling maize leaf spot disease, characterized in that, This includes treating maize leaves with the dsRNA described in claim 1 or the biopesticide described in claim 3 to interfere with maize leaf spot pathogens. St003016 The steps of gene expression.

6. The method as described in claim 5, characterized in that, The treatment includes spraying or spot application.

7. A method for inhibiting maize leaf spot pathogen, characterized in that, This includes treating maize leaf spot pathogen or its receptor with the dsRNA of claim 1 or the inhibitor of claim 4 to interfere with maize leaf spot pathogen. St003016 The steps of gene expression.

8. The method as described in claim 7, characterized in that, The treatment includes spraying or spot application.

9. The method as described in claim 7, characterized in that, The receptor is a corn leaf.

10. The target gene of the dsRNA as described in claim 1 St003016 Applications in (1) or (2) below: (1) Application in the preparation of biological pesticides for the prevention and control of maize leaf spot; (2) Application in the preparation of inhibitors for maize leaf spot pathogen; in, The target gene St003016 The nucleotide sequence is shown in SEQ ID No. 10.

Images