Rice selenium-rich heavy metal-reducing gene OsTCHQD1 and application of KASP marker thereof

Abstract

The application belongs to the technical field of molecular biology and crop breeding, and particularly relates to a rice selenium-rich heavy metal-reducing gene OsTCHQD1 and application of a KASP marker thereof. The application obtains the rice grain selenium content gene OsTCHQD1 through a map-based cloning technique, and verifies the function thereof with the aid of genetic transformation: the OsTCHQD1 gene is knocked out by using a CRISPR-Cas9 technology, and an overexpression material of the gene is constructed, it is confirmed that the gene can significantly improve the selenium content of rice grains, and it is also confirmed that the gene regulates the absorption and transport of selenium elements while reducing the absorption of other heavy metals. The application also provides a molecular marker closely linked to the OsTCHQD1, the marker can be used to detect OsTCHQD1 alleles and carry out gene selection, and the application of the marker in the cultivation of selenium-rich rice varieties is realized, and the application has a very high application value in improving rice varieties.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and crop breeding technology, specifically relating to the application of a rice selenium-enriched heavy metal-reducing gene OsTCHQD1 and its KASP marker. Background Technology

[0002] Selenium (Se) is an essential micronutrient for the human body, which cannot be synthesized within the body and must be obtained primarily through food. Rice is a core source of energy for humans, but its selenium content is relatively low. With the improvement of living standards, people's demand for high-nutrition, high-quality food is increasing, making selenium-enriched rice an important carrier for daily selenium supplementation. Adequate selenium supplementation can not only activate the body's immune system but also play a positive role in regulating brain function, preventing cardiovascular disease (CVD), inhibiting cancer, and alleviating heavy metal poisoning. Grains are one of the main dietary sources of selenium, and different rice varieties show significant differences in their ability to absorb and convert selenium. Traditional methods of hybridization and backcrossing to breed high-selenium rice varieties often require the construction of large-scale breeding populations, and the screening process is cumbersome, significantly increasing the workload and cost of breeding. Therefore, increasing the selenium content of rice grains through breeding technology is of vital importance to promoting the widespread use of selenium supplementation in grains.

[0003] The gene OsTCHQD1, which regulates selenium content in rice grains, is located on chromosome 4 of rice and encodes glutathione S-transferase. Variations in OsTCHQD1 may affect the pathway of selenium uptake and transport in rice, leading to increased selenium content in rice grains. Currently, there are no reports on the association between the OsTCHQD1 gene and selenium content in rice grains.

[0004] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by a single nucleotide variation at the gene level. SNP markers are characterized by their large number, wide distribution, high stability, ease of rapid and high-throughput genotyping, and the fact that functional variations in many alleles have been confirmed to be related to SNPs. Therefore, SNP markers show great promise for use in variety identification and breeding. Studies have found that two target gene sequences exhibit extensive natural variation, and their SNPs can classify core germplasm materials into two haplotypes, with significant differences in selenium content in rice grains corresponding to different haplotypes. This indicates that these SNPs are closely linked to the selenium content of rice grains.

[0005] Kompetitive Allele Specific PCR (KASP) genotyping is a unique competitive allele-specific PCR technique capable of high-precision bicelestem typing of SNPs in various genomic nucleic acid samples. This technique requires only a real-time quantitative PCR instrument to complete the detection of fluorescence signals after the experiment, exhibiting high stability and accuracy. KASP genotyping detects variant sites by calculating the fluorescence signals generated during PCR; the detection process does not require electrophoresis, reducing environmental pollution and harm to human health. Compared to DNA microarray technology, KASP technology offers lower SNP detection costs, and the detection cost is positively correlated with the number of SNP sites detected. Therefore, developing SNP markers based on KASP technology for rice variety identification can significantly improve identification efficiency and is of great significance for breeding selenium-enriched rice. Summary of the Invention

[0006] To overcome the shortcomings of the existing technology, this invention cloned the rice grain selenium content regulating gene OsTCHQD1. Genetic transformation experiments confirmed that this gene has a negative regulatory effect on rice grain selenium content. Further functional analysis showed that the OsTCHQD1 gene participates in the absorption and transport of selenium in rice. Simultaneously, this invention developed a specific molecular marker for the OsTCHQD1 gene, corresponding to the SNP variation site at position 18 of the OsTCHQD1 gene coding region, with a base polymorphism of G / A. Based on this SNP site, this invention also constructed a molecular marker detection system capable of accurately detecting the genotype at this site.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides the application of an agent for inhibiting the expression of the OsTCHQD1 gene in the cultivation of selenium-enriched rice varieties or in reducing the absorption of heavy metals in rice, characterized in that the amino acid sequence encoding the OsTCHQD1 gene is shown in SEQ ID NO:2.

[0008] This invention confirms that OsTCHQD1 is a negative regulator of selenium content in grains. Based on this discovery, those skilled in the art will understand that by using well-known knockout methods, such as CRISPR-Gas9 technology, by blocking or reducing the expression of OsTCHQD1, it is possible to increase the selenium content of plant seeds, enhance the plant's tolerance to high selenium stress, and improve the efficiency of selenium absorption and translocation in rice. Therefore, those skilled in the art will understand that the above applications are all negative regulatory applications of OsTCHQD1. Furthermore, this invention also discovers that while regulating the absorption and translocation of selenium in rice, this gene also reduces the absorption of other heavy metals, such as cadmium (Cd), chromium (Cr), lead (Pb), and arsenic (As). This holds promise for cultivating new rice varieties that combine selenium-rich nutritional characteristics with low heavy metal accumulation, thus meeting the human body's nutritional needs for selenium while ensuring the safety of rice for consumption.

[0009] In addition, the present invention also covers the application of the above-mentioned rice grain selenium content gene OsTCHQD1, or its encoded amino acid sequence, or biological materials containing the gene in plant breeding, germplasm resource improvement, or cultivation of selenium-enriched rice.

[0010] Preferably, the full-length sequence of the OsTCHQD1 gene is shown in SEQ ID NO:1.

[0011] The second aspect of this invention also provides the application of a primer combination for detecting the functional molecular marker OsTCHQD1-KASP in genotyping of selenium content in rice grains or in identifying selenium-enriched rice varieties. The functional molecular marker OsTCHQD1-KASP is an SNP marker located at position 18 of the coding region of the OsTCHQD1 gene, with alleles G / A. The full-length sequence of the OsTCHQD1 gene is shown in SEQ ID NO:1. The primer combination includes three primers: primer 1 is a specific primer carrying a FAM fluorescent tag sequence at its 5' end, corresponding to allele G; primer 2 is a specific primer carrying a VIC fluorescent tag sequence at its 5' end, corresponding to allele A; and primer 3 is a shared sequence.

[0012] Preferably, the primer combination includes OsTCHQD1-kasp-F1 as shown in SEQ ID NO:3, OsTCHQD1-kasp-F2 as shown in SEQ ID NO:4, and OsTCHQD1-kasp-R as shown in SEQ ID NO:5.

[0013] A third aspect of the present invention also provides a detection kit for genotyping of selenium content in rice grains, the kit comprising OsTCHQD1-kasp-F1 as shown in SEQ ID NO:3, OsTCHQD1-kasp-F2 as shown in SEQ ID NO:4, and OsTCHQD1-kasp-R as shown in SEQ ID NO:5.

[0014] A fourth aspect of the present invention also provides a method for identifying selenium-enriched rice varieties, the method comprising the following steps: S1. Extract DNA from the rice sample to be tested; S2. The template DNA, primer mixture, and KASP Mix are prepared into a PCR amplification reaction system. After the KASP reaction, the amplification products are detected and genotyped using a fluorescence signal detection instrument. The OsTCHQD1 gene can be divided into two haplotypes, OsTCHQD1A and OsTCHQD1B, in rice germplasm, and the selenium content in grains of OsTCHQD1A is significantly higher than that of OsTCHQD1B. The primer mixture includes OsTCHQD1-kasp-F1 as shown in SEQ ID NO:3, OsTCHQD1-kasp-F2 as shown in SEQ ID NO:4, and OsTCHQD1-kasp-R as shown in SEQ ID NO:5.

[0015] Preferably, the final concentrations of primers F1, F2, and R in the primer mixture are all 10 μM.

[0016] Preferably, the PCR amplification reaction system is 5 μL: template DNA 1.4 μL, primer mixture 0.35 μL, KASPMix 2.5 μL, and water added to 5 μL.

[0017] Preferably, the KASP reaction conditions are as follows: pre-denaturation at 95°C for 15 minutes; first-step amplification reaction: denaturation at 95°C for 20 seconds, gradient annealing at 65°C-57°C for 60 seconds, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle; second-step amplification reaction: denaturation at 95°C for 20 seconds, annealing at 57°C for 60 seconds, 35 cycles.

[0018] Compared with the prior art, the beneficial effects of the present invention are: This invention obtains the rice grain selenium content gene OsTCHQD1 using map-based cloning technology and verifies its function through genetic transformation: The OsTCHQD1 gene is knocked out using CRISPR-Cas9 technology, and overexpression materials of this gene are constructed. This demonstrates that the gene significantly increases the selenium content of rice grains, and also shows that while regulating the absorption and transport of selenium in rice, it also reduces the absorption of other heavy metals. This invention also provides a molecular marker closely linked to OsTCHQD1, which can be used to detect OsTCHQD1 alleles and conduct gene selection, enabling its application in the breeding of selenium-enriched rice varieties.

[0019] Compared with existing technologies, the molecular markers provided by this invention have the following advantages: (1) The complete set of KASP functional markers and primer combinations provided by the present invention can be used to quickly detect the OsTCHQD1 site of rice grain selenium-rich gene, and the detection results are accurate.

[0020] (2) The KASP molecular marker detection process developed in this invention does not require electrophoresis, which reduces the pollution to the environment and the harm to the human body during the experimental operation process. Moreover, the detection cost is low and it is suitable for high-throughput commercial detection.

[0021] (3) The detection primers and detection method provided by the present invention only require obtaining rice sample DNA to carry out detection, which reduces the field planting scale of the breeding population and eliminates the process of identifying the selenium content of rice grains after harvesting, thus greatly improving breeding efficiency. Attached Figure Description

[0022] Figure 1 The structure and mutation sites of the OsTCHQD1 gene (A); the total selenium content of grains from OsTCHQD1 knockout mutants over two years (B); the total selenium content of grains from OsTCHQD1 overexpression materials over two years (C).

[0023] Figure 2 The contents of Cd (A), Cr (B), Pb (C), and As (D) in seeds of OsTCHQD1 knockout mutants over two years.

[0024] Figure 3 This is a correlation analysis diagram of grain selenium content drawn after haplotype classification in core germplasm resources based on the SNP site of the OsTCHQD1 gene.

[0025] Figure 4 The results of OsTCHQD1 typing in the core germplasm (A) and the selenium content of the two haplotypes (B). Detailed Implementation

[0026] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0027] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0028] Example 1: Cloning and Phenotypic Analysis of OsTCHQD1, a Selenium Content Gene in Rice Grains After detecting the total selenium content in polished rice from 203 core germplasms (203 rice varieties from Huazhong Agricultural University, Table 1), genome-wide association analysis was used to identify 9 grain selenium content QTLs. OsTCHQD1 (LOC_Os04g35560) was one of the candidate genes (analysis method referred to the literature "Qiu Tianci, Li Jie, Cong Xin et al. Genome-wide association analysis of total selenium content in polished rice. Food Science and Technology [J]. 2021, 46(12): 21-5."). The gene knockout (Target site 1: CCACCCGTATTCGCTGGATAGTC; Target site 2: CCCATGTCATTTATCGGGCCTTC) and overexpression materials were used to verify the gene phenotype. The results are as follows. Figure 1 As shown in BC, L1, L2, and L3 are three gene knockout families, and their grain selenium content is significantly increased compared to WT. OE1 and OE2 are overexpression materials of this gene, and their grain selenium content is significantly lower than that of WT grains. Meanwhile, the heavy metal content in the grains of the gene knockout materials was measured and found to be (…). Figure 2 After OsTCHQD1 knockout, the heavy metal content in rice grains was significantly lower than that in WT grains. The contents of cadmium (Cd), chromium (Cr), lead (Pb), and arsenic (As) in the knockout material grains were significantly lower than those in WT grains. It is speculated that this gene, while regulating the absorption and transport of selenium in rice, also reduces the absorption of other heavy metals. Therefore, it is predicted that OsTCHQD1 negatively regulates the selenium accumulation capacity of rice grains. The structure of the OsTCHQD1 gene is as follows: Figure 1 As shown in Figure A, the OsTCHQD1 gene knockout target site is located in the first exon. In this study, we designed a dual-target site in the coding region of the target gene using CRISPR-Cas9 technology. Figure 1Three independent gene-edited lines (L1, L2, and L3) were successfully obtained. Sequence alignment results showed that all three gene knockout families experienced base insertion / deletion or sequence substitution at the target sites, and all induced frameshift mutations: L1 experienced large sequence variations at both target sites, resulting in a mutation of tyrosine (Y) at position 18 to serine (S) and causing a frameshift; L2 deleted 1 bp at target site 2, causing a mutation of valine (V) at position 161 to aspartic acid (D) and causing a frameshift; L3 deleted 2 bp at target site 1, causing a mutation of proline (P) at position 7 to leucine (L) and causing a frameshift. In addition, the total selenium content of brown rice from 176 core rice germplasms (different rice varieties from different countries and regions collected by the Hubei Academy of Agricultural Sciences, Table 4) was determined, and SNP detection and haplotype analysis of the OsTCHQD1 gene were carried out simultaneously. The resequencing information of 533 core rice germplasms from the RiceVarMap website (http: / / ricevarmap.ncpgr.cn) was used to analyze the sequence variation (SNP analysis) and haplotype of the LOC_Os04g35560 gene. Figure 3 As shown in Figure A, there are 6 key SNP sites in the coding region of this gene (labeled as vg0421664339 (21st position of gene sequence), vg0421663324 (18th position of gene sequence), vg0421664179 (183rd position of gene sequence), vg0421662399 (1962nd position of gene sequence), vg0421662377 (1984th position of gene sequence), and vg0421662145 (2216th position of gene sequence)), which are functional variant sites. The alleles of haplotype OsTCHQD1A are: T, G, G, T, A, T; and the alleles of haplotype OsTCHQD1B are: G, A, T, C, C, C. Furthermore, there were significant differences in the total selenium content of brown rice corresponding to different haplotypes. The total selenium content of grains in haplotype OsTCHQD1A was significantly higher than that in haplotype OsTCHQD1B. Figure 3 B).

[0029] Table 1: Total selenium content in polished rice from 203 core rice germplasms Continued from the previous table: Continued from the previous table: Example 2: Development of functional markers for selenium-rich genes in rice grains The candidate gene OsTCHQD1, LOC_Os04g35560, encodes glutathione S-transferase, which catalyzes the synthesis of cysteine ​​in rice, thereby increasing the selenium accumulation capacity of rice and thus increasing the selenium content in its grains. Using resequencing information from 533 core rice accessions on RiceVarMap (http: / / ricevarmap.ncpgr.cn), linkage analysis was performed on the sequence variations of the LOC_Os04g35560 gene and the selenium content in rice grains. The analysis revealed that a variation at position 18 of the coding region of the LOC_Os04g35560 gene led to differences in gene function (Table 2) and was closely linked to grain selenium content. The gene sequence of LOC_Os04g35560 was downloaded from the MSU website (http: / / rice.plantbiology.msu.edu / ). 200bp sequences upstream and downstream of this SNP were extracted, and KASP primers were designed using the SNP Way website (http: / / www.snpway.com / login / ): primer 1, primer 2, and primer 3. Primer 1 is a specific primer with a FAM fluorescent tag sequence at the 5' end and a G base corresponding to the LOC_Os04g35560 site; primer 2 is a specific primer with a VIC fluorescent tag sequence at the 5' end and an A base corresponding to the LOC_Os04g35560 site; primer 3 is a shared sequence. Primer 1 corresponds to a favorable haplotype, and rice grains carrying this haplotype have significantly higher selenium content. The primers were synthesized by Wuhan Shuanglvyuan Innovation Technology Research Institute Co., Ltd., and the primer information is shown in Table 3.

[0030] The full-length sequence of OsTCHQD1 (SEQ ID NO:1) is shown below: ATGCAGCTATATCACCACCCGTATTCGCTGGATAGTC AGAAAGTGCGGATGGCACTGGAAGAGAAGGGTATTGACTACACCTCATACCATGTCAATCCACTGACCGGGAAGAA CATGAACGTGGCCTTCTTTCGCATGAACCCTTCTGCGAAACTCCCCGTCTTCCAGAACGGCGCCCATGTCATTTAT CGGGCCTTCGATATAATTCAG TATGTTTCCTCATTCACATCGCGGGTTCAAAGATGATGGCCATGTTTAACTTTGCTGATCAGGCATGACATATGAATGCTCATTTATCTGTTTCGATGTTGTCATAGG TACCTTGACAGGCTTTCGGTGCA TTTAAGTGGTGAAATCGTCCCTGTGAACACTGAGGTTTACCAATGGATGCAGAAAGTTGATAGTTGGAATCCGAAG ATGTTCACTCTCACTCACACCCCGATCAAGTACCGCACGTTTGTCTCCAAGTTCATACGGCGAGTGCTGATTGCTC GCATGGCTGAAGCCCCAGATTTAGCCAGCATGTACCATGCTAAGCTCCGTGAGGCTTATGAGACCGAAGACAAATT GAAGGATCCTGACATTATGAAGCAAAGCGAGGAGGAGCTGAGCAAACTCCTCGATGATGTTGAAGCACAGCTCAAC AATGGCAAATACCTTGCTGGCGATGAATTCTCGCCTGCGGATTCGGTGTTCATTCCTATCCTCGCACGCATCACTC TTTTGGACCTTGATGAGGAATACATCAACTGCAGACCTAGGTTACTCGAGTACTACACATTGGTGAAGCAGAGGCC CAGCTACAAGGTTGCAATTGGCAAGTTCTTCGGTGGGTGGAAGAAGTACCGAACTCTCTTCAAGACCTCGTTCTTC CTTTGTGTCCGAACCTTGTTCAGGAAATACTAG GTGGTTCAGCAGACAGCAATGTGTACAGTGAATTCAACCTGAATATACGACCACTACATCTTGATGTGTTTTCTGCCGAGGGGTTGTGGTTGATGGCTCCTGATAGTTTTCGTTTTAGTTTGTGAAATCAAATGCGTTTGTTTCCTTATATGTCTCTCTGCTTGCATGCTCCTGTCCACAGCTCAGAACTTGTACATCATAATGCTTACACAATACATATACATTTTGGTTTTGTTTATTTAGCTCATATGGAATTGGAATATCTCTAATCAGGGTTGTTTCTTGAAACAATTCATGTCTTGAGTACCTTGTATTCTGTTCTATTTTCTGCTATCAAAAGGGGTAATTTTCACTGCAA (The underlined sequence is the coding region).

[0031] The amino acid sequence encoded by the OsTCHQD1 gene (SEQ ID NO:2) is: MQLYHHPYSLDSQKVRMALEEKGIDYTSYHVNPLTGKNMNVAFFRMNPSAKLPVFQNGAHVIYRAFDIIQYLDRLSVHLSGEIVPVNTEVYQWMQKVDSWNPKMFTLTHTPIKYRTFVSKFIRRVLIARMAEAPDLASMYHAKLREAYETEDKLKDPDIMKQSEEELSKLLDDVEAQLNNGKYLAGDEFSPADSVFIPILARITLLDLDEEYINCRPRLLEYYTLVKQRPSYKVAIGKFFGGWKKYRTLFKTSFFLCVRTLFRKY.

[0032] Table 2: Information on functional molecular markers Table 3: Primer sequences for functional molecular markers Note: OsTCHQD1-kasp-F1 has a FAM tag at its 5' end, and OsTCHQD1-kasp-F2 has a VIC tag at its 5' end; the nucleotide sequence of the FAM tag is GAAGGTGACCAAGTTCATGCT; the nucleotide sequence of the VIC tag is GAAGGTCGGAGTCAACGGATT.

[0033] Example 3: Classification Application of OsTCHQD1 Functional Markers KASP reaction was performed on 176 rice germplasm materials (different rice varieties from different countries and regions collected by Hubei Academy of Agricultural Sciences; Table 4) to test the marker genotyping of functional sites of OsTCHQD1.

[0034] The PCR amplification reaction system consisted of 5 μL: 1.4 μL template DNA (extracted from leaves of 1-week-old hydroponically grown rice), 0.35 μL primer mixture (primer F1 + primer F2 + primer R), 2.5 μL 2×KASP Master Mix, and water to a final volume of 5 μL. The final concentrations of primers F1, F2, and R in the primer mixture were all 10 μM.

[0035] The PCR amplification reaction conditions were as follows: pre-denaturation at 95℃ for 15 minutes; first step amplification reaction: denaturation at 95℃ for 20 seconds, gradient annealing and extension at 65℃-57℃ for 60 seconds, 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ in each cycle; second step amplification reaction: denaturation at 95℃ for 20 seconds, annealing and extension at 57℃ for 60 seconds, 35 cycles.

[0036] After the PCR reaction was completed, the fluorescence data of the KASP reaction products were read using the FLUOstar Omega SNP genotyping instrument. The fluorescence scan results were exported in a list format, and the genotyping results in Table 5 were obtained.

[0037] The results showed that OsTCHQD1 can be divided into two haplotypes, OsTCHQD1A and OsTCHQD1B, in the core germplasm, and the selenium content of grains in OsTCHQD1A was significantly higher than that in OsTCHQD1B. Figure 4Among the primers, OsTCHQD1B showed higher fluorescence intensity and was located higher up, while OsTCHQD1A showed lower fluorescence intensity and was located lower down. This indicates that this primer combination can effectively identify favorable haplotypes of rice selenium-rich genes and has great application value in the breeding of selenium-enriched rice varieties.

[0038] Table 4: Typing results and total selenium content of OsTCHQD1 in core germplasm Continued from the previous table: Continued from the previous table: Continued from the previous table: The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. The application of a reagent for inhibiting OsTCHQD1 gene expression in the breeding of selenium-enriched rice varieties or in reducing the absorption of heavy metals in rice, characterized in that, The amino acid sequence encoded by the OsTCHQD1 gene is shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that, The full-length sequence of the OsTCHQD1 gene is shown in SEQ ID NO:

1.

3. The application of primer combinations for detecting the functional molecular marker OsTCHQD1-KASP in genotyping or identifying selenium-enriched rice varieties in rice grains, characterized in that... The functional molecular marker OsTCHQD1-KASP is an SNP marker located at position 18 of the coding region of the OsTCHQD1 gene, with alleles G / A. The full-length sequence of the OsTCHQD1 gene is shown in SEQ ID NO:

1. The primer combination includes three primers, wherein primer 1 is a specific primer carrying a FAM fluorescent tag sequence at its 5' end and corresponding to allele G. Primer 2 is a specific primer that carries a VIC fluorescent tag sequence at its 5' end and corresponds to allele A; Primer 3 is a shared sequence.

4. The application according to claim 3, characterized in that, The primer combinations include OsTCHQD1-kasp-F1 as shown in SEQ ID NO:3, OsTCHQD1-kasp-F2 as shown in SEQ ID NO:4, and OsTCHQD1-kasp-R as shown in SEQ ID NO:

5.

5. A detection kit for genotyping selenium content in rice grains, characterized in that, The kit includes OsTCHQD1-kasp-F1 as shown in SEQ ID NO:3, OsTCHQD1-kasp-F2 as shown in SEQ ID NO:4, and OsTCHQD1-kasp-R as shown in SEQ ID NO:

5.

6. A method for identifying selenium-enriched rice varieties, characterized in that, Includes the following steps: S1. Extract DNA from the rice sample to be tested; S2. The template DNA, primer mixture, and KASP Mix are prepared into a PCR amplification reaction system. After the KASP reaction, the amplification products are detected and genotyped using a fluorescence signal detection instrument. The OsTCHQD1 gene can be divided into two haplotypes, OsTCHQD1A and OsTCHQD1B, in rice germplasm, and the selenium content in grains of OsTCHQD1A is significantly higher than that of OsTCHQD1B. The primer mixture includes OsTCHQD1-kasp-F1 as shown in SEQ ID NO:3, OsTCHQD1-kasp-F2 as shown in SEQ ID NO:4, and OsTCHQD1-kasp-R as shown in SEQ ID NO:

5.

7. The method for identifying selenium-enriched rice varieties according to claim 6, characterized in that, The final concentrations of primers F1, F2, and R in the primer mixture were all 10 μM.

8. The method for identifying selenium-enriched rice varieties according to claim 6, characterized in that, The PCR amplification reaction system consisted of 5 μL: 1.4 μL template DNA, 0.35 μL primer mixture, 2.5 μL KASP Mix, and water added to a final volume of 5 μL.

9. The method for identifying selenium-enriched rice varieties according to claim 6, characterized in that, The KASP reaction conditions are as follows: pre-denaturation at 95℃ for 15 minutes; first step amplification reaction: denaturation at 95℃ for 20 seconds, gradient annealing and extension at 65℃-57℃ for 60 seconds, 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ in each cycle; second step amplification reaction: denaturation at 95℃ for 20 seconds, annealing and extension at 57℃ for 60 seconds, 35 cycles.

Images