A method and kit for evaluating bovine body color traits

By detecting the genotype of the rs14643255 locus of the bovine FANCA gene, amplifying and sequencing it using specific primer pairs, the problem of insufficient data in bovine coat color research was solved, the efficiency of coat color breed identification and molecular breeding was improved, the correlation of economic traits was realized, and economic benefits were enhanced.

CN122189206APending Publication Date: 2026-06-12JIANGSU ACAD OF AGRI SCI +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGSU ACAD OF AGRI SCI
Filing Date
2026-05-15
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Existing technologies have limited SNP-related studies on bovine coat color, resulting in limited data and hindering the efficiency of coat color breed identification and molecular breeding.

Method used

By detecting the genotype of the rs14643255 locus of the bovine FANCA gene, amplifying and sequencing this locus using specific primer pairs (SEQ ID NO:1 and SEQ ID NO:2), the primary coat color of the bovine body can be determined to be black (TC or TT) or red (CC), and corresponding kits are provided for detection.

Benefits of technology

This has improved the efficiency of cattle coat color identification and molecular breeding, enabled the study of economic traits related to coat color, and enhanced economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189206A_ABST
    Figure CN122189206A_ABST
Patent Text Reader

Abstract

The application discloses a method and a kit for evaluating body main hair color traits of cattle, and belongs to the technical field of gene detection and genetic breeding. The method is to detect the genotype of a FANCA gene rs14643255 site in the genome DNA of a to-be-tested cattle; when the genotype of the rs14643255 site is TC or TT, it is determined that the body main hair color of the to-be-tested cattle is black; when the genotype of the rs14643255 site is CC, it is determined that the body main hair color of the to-be-tested cattle is red; wherein the base polymorphism of the rs14643255 site is defined on the positive strand of a cattle reference sequence NC_037345.1. The kit comprises a complementary strand-specific primer pair for detecting the rs14643255 site. Through the application, the cattle hair color identification and molecular breeding can be accurately performed, and the breeding efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of gene detection and genetic breeding technology, specifically to a method and kit for evaluating the main coat color trait of cattle. Background Technology

[0002] Among the many physical characteristics of animals, coat color plays an important role in livestock breeding, pet development, and animal survival and communication in the wild due to its intuitiveness, diversity, and genetic stability. In cattle (Bos taurus), coat color serves as a key indicator for breed identification. It is not only an important basis for evaluating genetic resources but also an ideal model for studying the relationship between animal adaptive evolution, gene regulatory networks, and economic traits. Research on coat color-related genes contributes to cattle breed identification, molecular breeding, and studies on the association of economic traits. Summary of the Invention

[0003] This invention addresses the problem that existing research on SNPs in bovine coat color studies is limited, resulting in scarce reference data and restricting practical applications. It provides a method and kit for evaluating the main coat color traits of bovine bodies, which is beneficial for improving the efficiency of coat color breed identification and molecular breeding.

[0004] The technical solution of this invention is as follows: In a first aspect, the present invention provides a method for evaluating the main coat color trait of a bovine body, comprising the following steps: The genotype of the FANCA gene at the rs14643255 locus in the genomic DNA of the cattle to be tested is detected. When the genotype of the rs14643255 locus is TC or TT, the main coat color of the cattle to be tested is determined to be black; when the genotype of the rs14643255 locus is CC, the main coat color of the cattle to be tested is determined to be red. The base polymorphism of the rs14643255 locus is defined on the positive strand of the reference sequence NC_037345.1 (NC_037345.1: g.14643255 T>C), and the bovine reference genome version is ARS-UCD2.0.

[0005] The fragment containing the rs14643255 site can be the sequence shown in SEQ ID NO:4: GGGCTTAGACGATGGTTAACATTTTTAGCAATAAAGTCTTTTTTAAATTTTAGCAGTAGAGCATGTTCTAATTCAGGTATGCACACTGTTCTTTTAGACATAATGCTGTTGCACACTTAGTAGATTACAGTGTCATGTAAATGTAACATTTTTATGCACCAGGAAATGAAAAAATTTGTGGGACTT GCTTGCCTGCAACACTGGCTTCCCAGCAGTGGCCCAGGGCAGCCTTCATCTCCAGCTGCCTTCTGCTCTCCCTACCCAGCACGGCCTGTTCCCACCACTTCCAGAAACGAGGACCATATTTCTGTCCCATCTTCCCAAGGGTCACTTAGGT, where the 175th position in bold is rs14643255, and the polymorphism is T or C.

[0006] Optionally or preferably, the detection step is performed by amplifying the DNA fragment containing the rs14643255 site and sequencing it; the primer pair used for amplification is designed for the complementary strand of the fragment containing the rs14643255 site, and its nucleotide sequence is shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] Upstream primer: 5'-TCGGGCTCAGAACAGTAGGA-3' (SEQ ID NO: 1); Downstream primer: 5'-CAGAGATTATGGCTCTCTGA-3' (SEQ ID NO: 2).

[0008] Optionally or preferably, the cattle are Montberia-Holstein crossbred cattle.

[0009] Secondly, the present invention provides a kit for evaluating the primary coat color trait of cattle, comprising reagents for detecting the genotype of the FANCA gene rs14643255 locus; the reagents contain primer pairs for specifically amplifying DNA fragments containing the rs14643255 locus; the nucleotide sequences of the primer pairs are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0010] Optionally or preferably, the kit further includes an indicator (Taq enzyme + dNTPs + buffer + ROX reference dye) for reading the base type at position 183 of the sequence shown in SEQ ID NO:3; wherein SEQ ID NO:3 is the complementary strand sequence of the fragment containing the rs14643255 site, corresponding to the A / G polymorphism at position 183 of the complementary strand (SEQ ID NO:3). The complementary strand sequence of SEQ ID NO:3 is as follows: TCGGGCTCAGAACAGTAGGA ACCTAAGTGACCCTTGGGAAGATGGGACAGAAATATGGTCCTCGTTTCTGGAAGTGGTGGGAACAGGCCGTGCTGGGTAGGGAAGAGCAGAAGGCAGCTGGAGATGAAGGCTGCCCTGGGCCACTGCTGGGAAGCCAGTGTTGCAGGCAAGCAAGTCCCACA A ATTTTTTCATTTCCTGGTGCATAAAAATGTTACATTTACATGACACTGTAATCTACTAAGTGTGCAACAGCATTATGTCTAAAAGAACAGTGTGCATACCTGAATTAGAACATGCTCTACTGCTAAAATTTAAAAAAGACTTTATTGCTAAAAATGTTAACCATCGTCTAAGCCC TCAGAGAGCCATAA TCTCTG (SEQ ID NO: 3).

[0011] The 183rd position of the SEQ ID NO:3 sequence is the A / G polymorphism site (corresponding to the base type of the complementary strand), and this sequence was detected in the experiment.

[0012] Compared with the prior art, the present invention has the following beneficial effects: This invention utilizes GWAS analysis to screen and obtain the SNP molecular marker rs14643255 of the FANCA gene, which serves as an evaluation marker for the primary coat color of cattle. The bases are T or C. When the SNP molecular marker genotype is TC or TT, the primary coat color of the cattle is black; when the genotype is CC, the primary coat color is red. The provided primer pair (SEQ ID NO:1-2) can specifically amplify the fragment containing the polymorphic site at position 183 of SEQ ID NO:3, and is suitable for PCR and genotyping platforms. By detecting this molecular marker polymorphism, effective methods can be used for cattle breed identification, molecular breeding based on coat color, and studies on the association of economic traits, thereby improving economic benefits. Attached Figure Description

[0013] Figure 1 A Manhattan plot is used to visualize the GWAS association analysis results of all SNPs in Example 1.

[0014] Figure 2 A QQ plot is used to visualize the GWAS association analysis results of all SNPs in Example 1.

[0015] Figure 3 The image shows the haplotype heatmap from 14.32 Mb to 14.82 Mb in Example 1. Detailed Implementation

[0016] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.

[0017] Example 1: Screening and identification of SNP molecular markers related to the main coat color of the body 1.1 Phenotypic Data Collection Forty-eight Montberia-Holstein crossbred cattle were collected (“Montberia ♂ × Holstein ♀”). According to the standard coat color classification method, the primary body coat color was defined as a binary trait, meaning the coat color of the main body area was either black or red, coded as 0 and 1 respectively in subsequent analysis.

[0018] Table 1. Statistics on the number of coat colors in third-generation crossbred cattle The main coat color of the 448 crossbred cattle is shown in Table 1 above. In the F1 generation, black was the dominant color (225 head), while red was very rare (13 head). With each generation, the number and proportion of black individuals decreased, while the number of red individuals increased significantly. In the F3 generation, the number of red individuals (21 head) exceeded that of black individuals (18 head).

[0019] 1.2 Genotype Data Acquisition and Quality Control Blood samples were collected from 448 hybrid cattle via tail vein puncture and placed in EDTA-K2 anticoagulant blood collection tubes. Blood spot cards were then prepared and air-dried at room temperature for at least 24 hours. Genotyping was performed by Wuhan Shadow Gene Technology Co., Ltd., and whole-genome resequencing (average coverage depth 10×) was conducted using the BGI T7 platform to obtain SNP data.

[0020] The SNP data were quality controlled using Plink software. The exclusion criteria were: deletion rate > 20%, MAF < 0.01 (SNPs with a minor allele frequency below 0.01 in the reference population), and deviation from the HWE (P < 0.001, i.e., SNPs without location information). After quality control screening, 448 individuals and 12,916,030 SNPs were ultimately retained for subsequent genome-wide association analysis.

[0021] 1.3 Genome-wide association analysis Based on the coat color phenotype, the remaining 448 crossbred cattle were divided into a black group (n=336) and a red group (n=112) with the main coat color of the body. The red and black coat colors were used as phenotypes for genome-wide association analysis (GWAS) of the traits.

[0022] This study used quality-controlled SNP genotype data from genome-wide association analysis based on a mixed linear model. A genome-wide association matrix was constructed using the gmatrix module of the GMAT software package to quantify genetic similarity among individuals, and this matrix was incorporated as a random effect into the model to correct for false positives caused by population stratification and kinship. Subsequently, association analysis was performed using the uvlmm module of the GMAT software package. For the binary trait of primary coat color (black / red), the following mixed linear model was fitted: Formula: y = Xβ + Zu + g + ε Where y is the coat color phenotype vector (0 or 1), Xβ is the fixed effect term (including the intercept), Z is the SNP genotype design matrix, u is the random SNP effect vector (its variance-covariance structure is defined by the random individual effects corrected for kinship), g is the individual polygenic background effect, and ε is the random residual vector, representing the random effect. The --repeat parameter is used to ensure model iteration convergence. The genome-wide significance threshold is determined using the Bonferroni correction method, i.e., p < 0.05 / N, where N is the number of independent SNPs used for analysis after quality control. A suggested significance level is also set to screen for potential association signals.

[0023] The association analysis results of all SNPs were visualized using Manhattan plots and QQ plots via the R language package. Manhattan plot ( Figure 1 This shows the -log for each SNP. 10 The relationship between (P-value) and genomic location, where the red horizontal line represents the Bonferroni-corrected genome-wide significance threshold (P = 7.11 × 10⁻⁶). -8 ), QQ pictures ( Figure 2 The diagonal line is used to evaluate the model fit. The diagonal line represents the consistency between the expected P-value and the observed P-value. Areas deviating from the diagonal line indicate potential systematic errors.

[0024] Genome-wide association analysis (GWAS) identified 1465 significant loci associated with coat color traits, annotating 35 genes. GWAS results showed that all loci significantly associated with primary body coat color were enriched on chromosome 18. (See [link to GWAS]). Figure 1 , Figure 2 And Table 2.

[0025] Table 2. SNPs and related genes associated with the main coat color trait of the body. 1.4 Fine-grained location and annotation of related regions Significant loci were concentrated in the 14.32–14.82 Mb region of chromosome 18. To further pinpoint key regions, region association analysis was performed using LocusZoom software, and the results were compared with linkage disequilibrium (LD) results. Genomic regions with significant association signals and strong linkage disequilibrium with the peak SNP (r²>0.8 in the LD heatmap) were screened, revealing several linked blocks, including the 14.40–14.49 Mb and 14.61–14.64 Mb regions.

[0026] 1.5 Haplotype Analysis and Allele Analysis From 448 individuals, 105 individuals were selected. Using VCFtools software v0.1.16, haplotype heatmaps were plotted using the pheatmap package in R, with rows for the 105 individuals and SNP loci as columns, from the quality-controlled genotype data. Ten significant loci were found in the 14.61Mb-14.64Mb range. Figure 3 Wald test was performed on 10 SNP loci to verify significance. The most significant locus was found to be rs14643255 (Table 3). Genotypes of 448 cattle at this locus were calculated. The TT / TC genotype accounted for 95.75% in the black phenotype population and the CC genotype accounted for 98.48% in the red phenotype population. Given the high consistency between the rs14643255 locus and the coat color phenotype, it was established as the core molecular marker for subsequent coat color verification.

[0027] Table 3. Statistical results of the association between the rs14643255 molecular marker genotype and the main coat color in 448 cattle. Example 2: Functional verification of SNP sites in coat color-related genes In addition, 46 Holstein and Montberia crossbred cattle (35 F2 and 11 F3) were selected as the validation group. Blood samples were collected and the main coat color was recorded. The products were sequenced by Wuhan Shadow Gene Technology Co., Ltd. to obtain SNP molecular marker genotypes. The coat color categories of each genotype were counted. The results are shown in Table 4.

[0028] Table 4. Statistics on SNP genotypes and main coat colors in the verification herd. Example 3 In this invention, the T / C polymorphism at the rs14643255 site is defined on the positive strand (reference genome NC_037345.1).

[0029] The sequence shown in SEQ ID NO:3 is the complementary strand of this site. At position 183 of the sequence shown in SEQ ID NO:3, there is a T / C site corresponding to the positive strand (i.e., A / G on the complementary strand).

[0030] Specific primer design: The primer pair was designed for SEQ ID NO:3 (complementary strand), and its sequence is as follows: Upstream primer (SEQ ID NO: 1): 5'-TCGGGCTCAGAACAGTAGGA-3', Downstream primer (SEQ ID NO: 2): 5'-CAGAGATTATGGCTCTCTGA-3'.

[0031] Using the above primers to perform PCR amplification of bovine DNA, and after sequencing the product, the base information at position 183 of the region corresponding to SEQ ID NO:3 can be read to determine the coat color genotype of the bovine being tested.

[0032] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. A method for evaluating the main coat color trait of cattle, characterized in that, Includes the following steps: The genotype of the FANCA gene at the rs14643255 locus in the genomic DNA of the cattle to be tested is detected; when the genotype of the rs14643255 locus is TC or TT, the main coat color of the cattle to be tested is determined to be black; when the genotype of the rs14643255 locus is CC, the main coat color of the cattle to be tested is determined to be red; wherein, the base polymorphism of the rs14643255 locus is defined on the positive strand of the bovine reference sequence NC_037345.

1.

2. The method according to claim 1, characterized in that, The detection step is achieved by amplifying the DNA fragment containing the rs14643255 site and sequencing it; the primer pair used for amplification is designed for the complementary strand of the fragment containing the rs14643255 site, and its nucleotide sequence is shown in SEQ ID NO:1 and SEQ ID NO:

2.

3. The method according to claim 1, characterized in that, The cattle in question are Montberia-Holstein crossbred cattle.

4. A kit for evaluating the primary coat color trait of cattle, characterized in that, The reagent includes a reagent for detecting the genotype at the rs14643255 locus of the FANCA gene; the reagent contains primer pairs that specifically amplify DNA fragments containing the rs14643255 locus; the nucleotide sequences of the primer pairs are shown in SEQ ID NO:1 and SEQ ID NO:

2.

5. The reagent kit according to claim 4, characterized in that, It also includes an indicator for reading the base type at position 183 of the sequence shown in SEQ ID NO:3; wherein SEQ ID NO:3 is the complementary strand sequence of the fragment containing the rs14643255 site, corresponding to the A / G polymorphism at position 183 of the complementary strand SEQ ID NO:3.