SNP molecular marker related to spinach downy mildew resistance and application thereof
By developing the T/A polymorphic SNP molecular marker DM-12903 at 1083010bp on spinach chromosome 1 and combining it with KASP technology, high-throughput and accurate identification of spinach downy mildew resistance was achieved, solving the problem of slow spinach breeding progress in existing technologies and significantly accelerating the breeding process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2026-04-30
- Publication Date
- 2026-06-12
AI Technical Summary
Current technology has failed to effectively identify the downy mildew resistance gene RPF1 in spinach, resulting in slow spinach breeding progress and difficulty in quickly breeding high-quality varieties resistant to downy mildew.
A KASP-based SNP molecular marker, DM-12903, was developed. The T/A polymorphism at 1083010 bp on spinach chromosome 1 was used to identify spinach plants resistant to downy mildew. PCR amplification and fluorescence detection were performed using a specific KASP primer combination to achieve high-throughput and accurate identification of spinach resistance to downy mildew.
This approach enables early identification and efficient screening of spinach resistance to downy mildew, significantly accelerating the breeding process of downy mildew-resistant spinach varieties and improving breeding efficiency.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetic breeding technology, specifically, it relates to SNP molecular markers related to spinach downy mildew resistance and their applications. Background Technology
[0002] spinach( Spinacia oleracea Spinach (L., 2n = 2x = 12) is an annual or biennial herbaceous plant belonging to the genus Spinach in the subfamily Chenopodiaceae of the family Amaranthaceae. It is a popular economic leafy vegetable worldwide. It is rich in nutrients, has high economic benefits, and its planting area is increasing year by year. Downy mildew is one of the major diseases in spinach production, seriously affecting the yield and quality of spinach and causing huge economic losses to producers. Large-scale protected cultivation of spinach is susceptible to downy mildew (L., 2n = 2x = 12). Peronospora effusa It provides an environment for growth, reproduction, and variation, enabling new physiological races to emerge continuously. RPF1 (Resistance against) Peronospora farinosa 1. Downy mildew resistance loci 1) possess multiple physiological race resistances ( Pe 1–7, Pe 9, Pe 11, Pe 13, Pe 15, Pe 16, Pe 18 and Pe (20) is of great significance for breeding spinach varieties resistant to downy mildew.
[0003] Irish et al. (2008) first identified the spinach downy mildew resistance gene as a single dominant gene on chromosome 3 and developed the marker Dm-1. Feng et al. (2015) used homozygous Dm-1 to further investigate the gene. RPF1 A bacterial artificial chromosome (BAC) library of spinach was constructed using single spinach plants, and the marker 5B14r was developed. XU et al. (2017) identified five ( ) genes through genome sequencing, assembly, and annotation. Spo12736 , Spo12784 , Spo12821 , Spo12903 and Spo12905 Genes whose physical location is close to that of the Dm-1 marker are NBS-LRR type genes are considered to be... RPF1 Potential candidates for genes. She et al. (2018) used a combination of BSA and specific-locus amplified fragment sequencing (SLAF-seq) to identify potential candidates for genes. RPF1The gene was located within a 0.34–1.23 Mb region on chromosome 3, and 14 candidate R genes were screened. Further analysis using quantitative real-time PCR confirmed the presence of the R gene. Spo12784 and Spo12903 yes RPF1 Candidate genes were identified (see link http: / / www.spinachbase.org / , corresponding to the genomic literature Cai X, Sun X, Xu C, Sun H, Wang X, Ge C, Zhang Z, Wang Q, Fei Z, Jiao C, Wang Q. Genomicanalyses provide insights into spinach domestication and the genetic basis of agronomic traits. Nat Commun. 2021 Dec 13;12(1):7246. doi: 10.1038 / s41467-021-27432-z). Subsequent genome-wide association studies (GWAS) and k-mer-based GWAS further confirmed the reliability of these candidate genes, particularly emphasizing the Spo12903 The importance of this research (Bhattarai et al., 2020; She et al., 2026) is significant. These studies have greatly advanced the breeding process for spinach resistant to downy mildew; however... RPF1 The final identification and functional verification of the device have not been reported to date. Summary of the Invention
[0004] The purpose of this invention is to provide SNP molecular markers related to spinach downy mildew resistance and their applications.
[0005] To achieve the objectives of this invention, in a first aspect, this invention provides an SNP molecular marker (marker name DM-12903) related to spinach downy mildew resistance, wherein the SNP molecular marker contains a nucleotide sequence with a polymorphism of T / A at position 1083010 bp on spinach chromosome 1; wherein spinach plants with the base T are downy mildew resistant plants, and spinach plants with the base A are downy mildew susceptible plants.
[0006] The location information of this marker was determined based on the spinach T2T genome sequence published by She et al. (2025) (https: / / zenodo.org / records / 15395809).
[0007] Furthermore, the genotype of the site with the aforementioned polymorphism is TT or TA, corresponding to spinach resistant to downy mildew; the genotype of the site with the aforementioned polymorphism is AA, corresponding to spinach susceptible to downy mildew.
[0008] Secondly, the present invention provides primer combinations for amplifying the molecular marker, including forward primer 1, forward primer 2 and universal reverse primer, the sequences of which are shown in SEQ ID NO:1-3 respectively.
[0009] Furthermore, the primer combination is a KASP primer combination, wherein the 5' end of the forward primer 1 is connected to a tag sequence corresponding to the first fluorescent label; the 5' end of the forward primer 2 is connected to a tag sequence corresponding to the second fluorescent label, and the first fluorescent label and the second fluorescent label are different.
[0010] Preferably, the nucleotide sequence of the forward primer 1 with the tag sequence is shown in SEQ ID NO:4; and the nucleotide sequence of the forward primer 2 with the tag sequence is shown in SEQ ID NO:5.
[0011] Thirdly, the present invention provides detection reagents or kits containing the primer combinations described above.
[0012] Fourthly, this invention provides a method for identifying downy mildew resistance and / or downy mildew resistance genes in spinach. RPF1 The fractal method includes the following steps: (1) Provide a DNA sample of the spinach to be tested; (2) The DNA sample was amplified by PCR using the KASP primer combination; (3) Determine the downy mildew resistance and / or downy mildew resistance genes of the spinach to be tested based on the amplification results of step (2). RPF1 Fractal
[0013] In this invention, a gene for spinach resistance to downy mildew is present. RPF1 The nucleotide sequence is as follows: i) The nucleotide sequence shown in SEQ ID NO:6; ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:6 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; iii) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:6 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS, followed by washing the membrane with the solution; iv) nucleotide sequences that have more than 90% homology with i), ii), or iii) and express the same functional protein; or, v) A nucleotide sequence that is completely complementary to the nucleotide sequences of i), ii), iii) or iv).
[0014] Preferably, the PCR reaction conditions are as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 61-55℃ for 60 seconds (decreasing by 0.6℃ per cycle), 10 cycles; 94℃ for 20 seconds, 55℃ for 60 seconds, 26 cycles.
[0015] Furthermore, when a primer combination with a fluorescent tag is used in step (2), step (3) makes a judgment by detecting the fluorescent signal; The criteria for determination are as follows: if only the first fluorescent marker signal corresponding to allele T is detected, the genotype is determined to be TT, corresponding to spinach resistant to downy mildew; if only the second fluorescent marker signal corresponding to allele A is detected, the genotype is determined to be AA, corresponding to spinach susceptible to downy mildew; if both the first and second fluorescent marker signals are detected simultaneously, the genotype is determined to be TA, corresponding to spinach resistant to downy mildew.
[0016] Fifthly, the present invention provides any of the following applications of the molecular marker, the primer combination, or the detection reagent or kit: 1) Used for identifying or assisting in the identification of downy mildew resistance genes in spinach; preferably used for identifying the characteristics of downy mildew resistance genes in spinach during the seedling stage; 2) Used for early prediction of spinach downy mildew resistance; 3) Used in molecular breeding of spinach; 4) Used for spinach germplasm improvement; 5) Genes for resisting downy mildew in spinach RPF1 Fractal
[0017] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention demonstrates, through virus-induced gene silencing (VIGS) technology, that... Spo12903 It is a gene that resists downy mildew. RPF1 Combining antibody and infective resequencing data, the location located at... Spo12903 The key SNPs (single nucleotide polymorphisms) in the coding region were identified, and based on these, a gene for spinach resistance to downy mildew was developed. RPF1 The KASP functional marker. This marker is located in the downy mildew resistance gene. RPF1 The encoding area is therefore more accurate than the previous chained markings.
[0018] This invention relates to a gene for spinach resistance to downy mildew, developed based on KASP (Kompetitive Allele Specific PCR) technology. RPF1The KASP functional marker provided in this invention is named DM-12903. Using the KASP primers provided by this invention, resistance to downy mildew in spinach can be detected at the seedling stage with high throughput and accuracy. The co-dominant KASP marker provided by this invention is beneficial for screening disease-resistant spinach varieties, greatly accelerating the breeding of downy mildew-resistant spinach varieties. Attached Figure Description
[0019] Figure 1 In this embodiment of the invention, the seeding was performed using... Pe Disease resistance grading phenotypes of spinach plants treated with different VIGS after 9 months.
[0020] Figure 2 The results are from the population haplotype analysis of 79 resequencing materials in Example 2 of this invention.
[0021] Figure 3 The results of typing 48 spinach samples using the KASP marker DM-12903 in Example 3 of this invention are shown. Detailed Implementation
[0022] This invention aims to provide a gene for spinach resistance to downy mildew. RPF1 The KASP functional marker DM-12903 is used to breed high-quality spinach varieties resistant to downy mildew, shortening the breeding cycle.
[0023] The present invention adopts the following technical solution: This invention utilizes KASP technology to develop SNP markers for identifying spinach downy mildew resistance. The site location information is as follows:
[0024] The marker DM-12903 of this invention is located on chromosome 1 of spinach, at a physical location of 1083010 bp, and the base at the SNP site is T / A (i.e., this SNP site is located in the gene). RPF1 As shown in SEQ ID NO:6, at position 2570bp (n is t or a), spinach plants with base T are resistant to downy mildew, and spinach plants with base A are susceptible to downy mildew.
[0025] The location information of this marker was determined based on the spinach T2T genome sequence published by She et al. (2025) (https: / / zenodo.org / records / 15395809).
[0026] This invention also provides a KASP primer combination for amplifying the molecular marker, comprising three sequences, two of which are forward primers and one is a universal reverse primer, as follows: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCT GAAGATTGTTGAAAAAATGTTATAACATTCCA-3' (SEQ ID NO: 4); in GAAGGTGACCAAGTTCATGCT For general label A; Forward primer 2: 5'- GAAGGTCGGAGTCAACGGATT GAAGATTGTTGAAAAAATGTTATAACATTCCT-3' (SEQ ID NO: 5); in GAAGGTCGGAGTCAACGGATT For the general label B; Reverse primer: 5'-CAAATAGAAGACTTCCTACCACCTTTATAG-3' (SEQ ID NO: 3).
[0027] The DM-12903 marker and KASP primer combination provided by this invention can be used to identify the resistance of spinach to downy mildew during the seedling stage.
[0028] Includes the following steps: (1) Extract DNA from the spinach sample to be tested; (2) Dilute the DNA in step (1) to 20 ng / µL, and add specific KASP Primer mix and universal KASP Master mix to it for PCR amplification; PCR products are analyzed by fluorescence detection at below 40℃.
[0029] The aforementioned specific KASP Primer mix contains the sequences shown in SEQ ID NO:3-5; The aforementioned universal KASP Master mix contains the following components: universal TRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl2.
[0030] The PCR reaction system is shown in Table 1: Table 1 PCR reaction system
[0031] PCR reaction conditions are shown in Table 2: Table 2 PCR reaction conditions
[0032] If the genotyping results are unsatisfactory after fluorescence detection, PCR reactions as shown in Table 3 can be performed again: Table 3 PCR reaction conditions
[0033] Fluorescence detection and analysis can be performed again after the second PCR reaction.
[0034] The KASP genotyping method provided by this invention has high throughput and is simple to operate. It only requires adding a specific KASP Primer mix and a universal KASP Master mix to a PCR microplate containing a DNA sample for PCR amplification. The final results can be analyzed using a fluorescence detector.
[0035] The KASP Primer mix contains three specific primers: forward primers 1 and 2, each bearing universal tags A and B, and a reverse primer.
[0036] The KASP Master mix contains universal FRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl2, pre-prepared in an optimized buffer. Fluorescent reporter A is FAM, and fluorescent reporter B is HEX. The KASP Master mix was purchased from LGC Ltd., UK, catalog number KBS-1016-002.
[0037] This invention also provides a spinach downy mildew resistance gene. RPF1 Application of the KASP functional marker DM-12903 in molecular-assisted breeding.
[0038] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0039] Example 1 Spinach downy mildew lesions RPF1 Functional verification 1. Seedling management and VIGS silencing treatment will resist Pe 9. Materials 12S3 and susceptible materials 12S4 (the above materials are from the Spinach Research Group of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. See reference: She H, Qian W, Zhang H, Liu Z, Wang X, Wu J, Feng C, Correll JC, Xu Z. Fine mapping and candidate gene screening of the downymildew resistance gene). RPF1In Spinach. Theor Appl Genet. 2018 Dec;131(12):2529-2541. doi: 10.1007 / s00122-018-3169-4.) Seeds were sown separately in an experimental greenhouse. The greenhouse had 8-meter-long beds with 3 furrows per bed, and one seed was sown every 5 centimeters. Two beds were sown in 12S3, and the VIGS gene was silenced in each bed. Spo12784 and Spo12903 ; Sow 12S4 seeds in one bed, as Pe 9 (The pathogen of downy mildew, which was obtained from the Spinach Research Group of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. Reference: Fan Guiyan, Zhe Hongbing, Zhang Helong, et al. Preliminary report on the physiological race identification of downy mildew pathogen in spinach in Beijing, Shandong and Shanxi [J]. China Vegetables, 2017, (06): 56-58. DOI: 10.19928 / j.cnki.1000-6346.2017.06.013.) Control group inoculated. When the 12S3 seedlings grew to two true leaves, VIGS infection was performed. Ten seedlings were selected from each bed and injected with TRV2- SpoPDS For the infection solution, select two-thirds of the remaining seedlings in each row and inject them with TRV2- Spo12784 / TRV2- Spo12903 One-third of the seedlings were injected with the infection solution, and the remaining one-third were injected with the empty infection solution as a wild-type control. Seedlings of 12S4 were not infected.
[0040] 2. Inoculation in an artificial greenhouse Waiting to observe the injection containing TRV2- SpoPDS When seedlings exhibited a pale green phenotype after VIGS treatment (14 days post-VIGS treatment), all seedlings were artificially inoculated in a greenhouse with a concentration of 2.5 × 10⁻⁶. 5 cfu / mL Pe A fine, even spray of spore suspension of 9 was applied to the underside of the leaves. A small arched structure, 9 m long, 1.5 m wide, and 0.5 m high, was constructed. A layer of white transparent plastic film was placed over the structure to retain moisture, followed by a layer of black plastic film to block light. The black plastic film was removed after 24 hours. The white transparent plastic film was kept on for moisture retention, except for being removed between 10 AM and 3 PM each day, for a total of 5 days. After 5 days, both the white and black plastic films were placed back on, and the films were removed after 24 hours to assess disease incidence.
[0041] 3. Phenotypic identification to determine downy mildew resistance genes RPF1 During vaccination Pe On day 7, susceptible strain 12S4 was found to be diseased. Figure 1 B), indicating Pe The viability and disease management of strain 9 were correct, meeting the conditions for the development of spinach downy mildew. Silent behavior was observed on day 8 after inoculation. Spo12903The 12S3 plants also showed symptoms of downy mildew. Figure 1 C), the lesion area accounts for about 50% of the total leaf area, and the disease resistance level is classified as susceptible; while the silent one... Spo12784 Neither the 12S3 plants nor the wild-type 12S3 plants showed symptoms of downy mildew. Figure 1 (D and A), the disease resistance level is classified as disease resistant. Therefore, it is inferred that... Spo12903 It's the gene that makes spinach resistant to downy mildew. RPF1 .
[0042] Example 2 Spinach downy mildew resistance gene RPF1 Development of KASP functional tags 1. Perform high-multiplier resequencing on resistant and susceptible strains. Seventy-nine high-generation spinach inbred lines were used as the resequencing population, of which 16 were disease-resistant materials (carrying...). RPF1 (Location), 63 samples were infected materials (not carrying) RPF1 The plants were grown at the experimental base of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. Young leaves were collected 25 days after sowing, and DNA was extracted using the CTAB method. The extracted DNA samples were quality-checked using 1.0% agarose gel electrophoresis and a Themo NanoDrop 2000 spectrophotometer, and then re-sequencing was performed by Berry Genomics using the Illumina platform. The sequenced read length was 150 bp, and the sequencing depth was 10×.
[0043] 2. Specific sequence analysis of resistant and susceptible strains The raw data was filtered using fastq (v0.23.4) software, and then compared with the spinach genome Sp_YY_V2 using BWA (Burrows-Wheeleralignment) software (v0.7.17-r1188). Based on the sequence alignment results, sequences specific to disease-resistant strains were screened.
[0044] 3. Population haplotype analysis and development of KASP markers Combining resequencing data, in RPF1 A SNP was found in the coding region, and population haplotype analysis showed that the SNP separated with respect to the material's resistance and susceptibility. Figure 2Based on the characteristics of SNP mutation information, a set of competitive allele-specific PCR primers were designed, including forward primer 1 (GAAGATTGTTGAAAAATGTTATAACATTCCA, SEQ ID NO:1), forward primer 2 (GAAGATTGTTGAAAAATGTTATAACATTCCT, SEQ ID NO:2), and reverse primer (CAAATAGAAGACTTCCTACCACCTTTATAG, SEQ ID NO:3). The two forward primers have T / A allelic variants at their ends, and the reverse primer sequence was selected to ensure that the amplified fragment is between 60-120 bp. A fluorescent tag sequence was attached to the 5' end of the forward primers. Specifically, the 5' end of forward primer 1 was attached to the FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3', resulting in the forward primers shown in SEQ ID NO:4. The 5' end of forward primer 2 was attached to the HEX fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3', resulting in the forward primers shown in SEQ ID NO:5.
[0045] The primer sequences are as follows:
[0046] The primer sequences mentioned above were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0047] Example 3: Validation of the DM-12903 marker The specific method is as follows: 1. Material phenotyping and genomic DNA extraction Forty-eight plants were randomly selected from the resequencing population and used when they had 1-2 true leaves. Pe 9. After inoculation, the resistance and susceptibility of individual plants were statistically analyzed. Simultaneously, whole-genome DNA was extracted using the CTAB method.
[0048] 2. Dilute DNA The genomic DNA extracted in step 1 was diluted to a concentration of 20 ng / µl.
[0049] 3. Preparation of KASP Primer mix Take 12 μl (100 μM) of the forward primer and 30 μl (100 μM) of the reverse primer, and add sterile ultrapure water to make up to 100 μl.
[0050] 4. PCR amplification reaction system and reaction conditions The PCR amplification reaction system is shown in Table 1. A blank control (NTC) without template DNA was also included in the experiment, with one blank control per plate.
[0051] The PCR reaction conditions are shown in Table 2. If the genotyping results are unsatisfactory after fluorescence detection, the PCR reaction shown in Table 3 can be repeated.
[0052] Fluorescence detection and analysis can be performed again after the second PCR reaction.
[0053] 5. Fluorescence scanning of PCR amplification products PCR amplification products were scanned using an Applied Biosystems QuantStudio 6 Flex scanner. Genotyping was achieved based on the different excitation and emission wavelengths of the two fluorescence spectra (FAM and HEX). The genotypes aggregated on the vertical axis represent the alleles linked to the FAM fluorescent tag sequence, i.e., TT; the genotypes aggregated on the horizontal axis represent the alleles linked to the HEX fluorescent tag sequence, i.e., AA; the black sample shown in the lower left corner represents NTC. Figure 3 ).
[0054] 6. Validation of Results The typing results of the KASP marker DM-12903 were consistent with the inoculation identification results, indicating that the DM-12903 marker was effective.
[0055] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. SNP molecular markers associated with spinach downy mildew resistance, characterized in that, The SNP molecular marker contains a nucleotide sequence with a polymorphism of T / A at position 1083010 bp on chromosome 1 of spinach; spinach plants with the base T are downy mildew resistant plants, and spinach plants with the base A are downy mildew susceptible plants.
2. The molecular marker according to claim 1, characterized in that, The genotype of the site with the polymorphism is TT or TA, corresponding to spinach resistant to downy mildew; the genotype of the site with the polymorphism is AA, corresponding to spinach susceptible to downy mildew.
3. A primer combination for amplifying the molecular marker of claim 1 or 2, characterized in that, It includes forward primer 1, forward primer 2 and universal reverse primer, with sequences shown in SEQ ID NO:1-3, respectively.
4. The primer combination according to claim 3, characterized in that, The primer combination is a KASP primer combination, wherein the 5' end of the forward primer 1 is connected to a tag sequence corresponding to the first fluorescent label; the 5' end of the forward primer 2 is connected to a tag sequence corresponding to the second fluorescent label, and the first fluorescent label and the second fluorescent label are different.
5. The primer combination according to claim 4, characterized in that, The nucleotide sequence of the forward primer 1 with the tag sequence is shown in SEQ ID NO:4; the nucleotide sequence of the forward primer 2 with the tag sequence is shown in SEQ ID NO:
5.
6. A detection reagent or kit containing the primer combination according to any one of claims 3-5.
7. A method for identifying downy mildew resistance and / or anti-downy mildew genes in spinach. RPF1 The fractal method is characterized by... Includes the following steps: (1) Provide a DNA sample of the spinach to be tested; (2) The DNA sample is amplified by PCR using the primer combination according to any one of claims 3-5; (3) Determine the downy mildew resistance and / or downy mildew resistance genes of the spinach to be tested based on the amplification results of step (2). RPF1 Fractal; Among them, the spinach downy mildew resistance gene RPF1 The nucleotide sequence is as follows: i) The nucleotide sequence shown in SEQ ID NO:6; ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:6 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; iii) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:6 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS, followed by washing the membrane with the solution; iv) nucleotide sequences that have more than 90% homology with i), ii), or iii) and express the same functional protein; or, v) A nucleotide sequence that is completely complementary to the nucleotide sequences of i), ii), iii) or iv).
8. The method according to claim 7, characterized in that, The PCR reaction conditions were as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 61-55℃ for 60 seconds (decreasing by 0.6℃ per cycle), 10 cycles; 94℃ for 20 seconds, 55℃ for 60 seconds, 26 cycles.
9. The method according to claim 7 or 8, characterized in that, When the primer combination of claim 4 or 5 is used in step (2), step (3) is determined by detecting the fluorescence signal; The criteria for determination are as follows: if only the first fluorescent marker signal corresponding to allele T is detected, the genotype is determined to be TT, which corresponds to spinach resistant to downy mildew; if only the second fluorescent marker signal corresponding to allele A is detected, the genotype is determined to be AA, which corresponds to spinach susceptible to downy mildew. If both the first and second fluorescent marker signals are detected simultaneously, the genotype is determined to be TA, corresponding to spinach resistant to downy mildew.
10. Any of the following applications of the molecular marker of claim 1 or 2, the primer combination of any one of claims 3-5, or the detection reagent or kit of claim 6: 1) Used for identifying or assisting in the identification of downy mildew resistance genes in spinach; preferably used for identifying the characteristics of downy mildew resistance genes in spinach during the seedling stage; 2) Used for early prediction of spinach downy mildew resistance; 3) Used in molecular breeding of spinach; 4) Used for spinach germplasm improvement; 5) Genes for resisting downy mildew in spinach RPF1 Fractal; in, Spinach downy mildew resistance gene RPF1 The same gene as described in claim 7.