SNP molecular marker combination for identifying plant height of gossypium barbadense and application thereof
By identifying SNP molecular markers significantly associated with plant height on chromosome A05 of sea island cotton, and combining PCR and fluorescence detection, the problem of identifying plant height traits in sea island cotton was solved, enabling early prediction and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2026-05-14
- Publication Date
- 2026-06-12
AI Technical Summary
Existing technologies are insufficient to effectively identify and utilize the plant height trait of sea island cotton, which affects cotton plant type optimization and breeding efficiency.
Three SNP molecular markers on the A05 chromosome of Sea Island cotton that are significantly associated with plant height were provided. These SNP sites were amplified and detected by PCR technology, and combined with a fluorescence detection platform, to achieve early identification of Sea Island cotton plant height and genetic background analysis.
It enables rapid, large-scale, and automated screening of plant height traits in island cotton, improving the efficiency and accuracy of cotton breeding and supporting the fine localization of plant height-related genes and the selection of breeding materials.
Smart Images

Figure CN122189239A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and relates to a combination of SNP molecular markers for identifying the plant height of island cotton and its application. Background Technology
[0002] cotton( Gossypium hirsutum Cotton (L.) is an important economic crop, crucial to the national economy. In agricultural production, a suitable cotton plant type not only benefits rational dense planting to increase yield but also simplifies cotton planting and facilitates mechanized operations, thus saving costs (Wen et al., 2023). Plant type is mainly composed of vertical plant height (PH) and horizontal branching (Wang et al., 2018), therefore, strengthening research on the genetics of plant height has significant theoretical and practical implications.
[0003] Genome-wide association analysis (GWAS) is a powerful genetic research method used to identify genetic variations (usually SNPs) that are significantly associated with important phenotypic traits in plants, such as yield, stress resistance, and quality. The advantage of GWAS is that it does not require pre-constructed genetic populations, can simultaneously scan the entire genome, and locate multiple candidate genes or loci with different effects, providing crucial information for elucidating the genetic basis of complex traits, developing molecular markers, and accelerating molecular design breeding of plants.
[0004] Identifying SNP molecular markers associated with cotton plant height using genome-wide association analysis will provide strong technical support for analyzing and screening the genetic background related to cotton plant height, as well as for marker-assisted selection breeding at cotton plant height loci. Summary of the Invention
[0005] The purpose of this invention is to provide SNP molecular markers that are significantly associated with the A05 chromosome of Sea Island cotton and its plant height trait, and their applications, in order to solve the problems existing in the prior art. The SNP molecular markers provided by this invention are associated with the plant height trait of Sea Island cotton and can be used to identify the plant height trait of Sea Island cotton, and realize early prediction of the utilization potential of Sea Island cotton plant type.
[0006] To achieve the above objectives, the present invention provides the following solution: The first aspect of this invention provides three SNP molecular markers on the A05 chromosome of sea island cotton that are significantly associated with plant height. All SNP sites are located on the A05 chromosome of the sea island cotton reference genome (Wang et al., Nature Genetics, 2019). The locations and polymorphism information of each SNP site are shown in Table 1. Table 1 SNP molecular marker information
[0007] The second aspect of this invention provides the application of the above-mentioned SNP molecular marker combination in marker-assisted selection of plant height trait in sea island cotton.
[0008] The third aspect of this invention provides the application of primer pairs for amplifying the above-mentioned SNP molecular marker combinations in the preparation of products for identifying the plant height trait of sea island cotton.
[0009] Furthermore, the product includes a cotton island genome detection reagent or a cotton island genome detection kit or a cotton island whole genome SNP chip.
[0010] A fourth aspect of the present invention provides a product for identifying the plant height trait of sea island cotton, comprising a primer pair combination for amplifying the above-mentioned SNP molecular marker combination.
[0011] Furthermore, the product includes a cotton island genome detection reagent or a cotton island genome detection kit or a cotton island whole genome SNP chip.
[0012] The fifth aspect of this invention provides an application of the product described above in identifying plant height traits in sea island cotton, or in marker-assisted breeding or genome-wide association analysis.
[0013] The sixth aspect of this invention provides a method for identifying the height of sea island cotton plants, the method comprising the following steps: (1) Genomic DNA was extracted from the leaves of the sea island cotton sample; (2) Using genomic DNA as a template, amplify the DNA fragment containing the SNP site by PCR technology to obtain the PCR product; (3) The PCR products were detected using a fluorescence detection platform, and the plant height of the island cotton was determined based on the polymorphism of the SNP molecular markers reflected by the obtained fluorescence signals. (4) When the base of the SNP molecular marker is one of the bases in the 51st position of SEQ ID NO.1-3, the sea island cotton plant is tall; when the base of the SNP molecular marker is one of the bases in the 51st position of SEQ ID NO.4-6, the sea island cotton plant is short.
[0014] The beneficial effects of this invention are: The SNP molecular markers significantly associated with plant height in Island cotton provided by this invention are directly expressed in DNA form and can be detected in all tissues and developmental stages of cotton. They are not limited by environment or season, and are not affected by expression status or other issues. They do not require fragment length analysis, making them suitable for rapid, large-scale, and automated screening. The SNP molecular markers provided by this invention can be used to identify plant height traits in Island cotton, enabling early prediction of the utilization value of Island cotton plant type. They can also be used for genetic background analysis and screening related to cotton plant height, as well as marker-assisted selection breeding at plant height loci, showing broad application prospects. The SNP loci provided by this invention can be applied to the fine mapping and cloning of genes related to plant height traits, and to the whole-genome selection of breeding materials, improving the efficiency and accuracy of cotton molecular breeding. Attached Figure Description
[0015] Figure 1 This is a Manhattan plot obtained from a genome-wide association analysis of plant height.
[0016] Figure 2 This section presents linkage disequilibrium analysis, haplotype analysis, and phenotypic comparison based on SNPs associated with plant height on chromosome A05. A shows the linkage disequilibrium heatmap of SNPs within the candidate interval. B shows the haplotype classification results constructed based on SNPs within the candidate interval. C compares the plant height of the two haplotypes (Hap1 and Hap2) in two ecological environments: Anyang and Xinjiang. ***P<0.001, **P<0.01. Detailed Implementation
[0017] Exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the invention, but rather as a more detailed description of certain aspects, features, and embodiments of the invention. It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, for numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0018] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0019] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0020] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0021] Explanation of the sequence listing: Bold underlined bases indicate polymorphic SNP sites. SEQ ID NO.1: CACTGAAAGATTTATAAAAGCACGATAAATATAATAAGCTTAAAAATTAT C CAAACAAGCAAAGCTAAACTAAAATTTATCATTTCACGAAATTTCGCAAT SEQ ID NO.2: CTTCAAAATGCACATCATTGAGCAAAGCCATTGGTTCCCTAGAGACCTCC G ACACTCTCAAGGGATGCTCGATTCCATTCTGATCATCTAATTTTGTGAAT SEQ ID NO.3: TCTGTAGGTTCCCAAAATAGTTTGCTCTATCTTCTGCCGCATCAATTAAT G GACTTGAAGTAGGCCATGAGAAGTAGGCAGCATTGCTCTCAGGATGCTGA SEQ ID NO.4: CACTGAAAGATTTATAAAAGCACGATAAATATAATAAGCTTAAAAATTAT T CAAACAAGCAAAGCTAAACTAAAATTTATCATTTCACGAAATTTCGCAAT SEQ ID NO.5: CTTCAAAATGCACATCATTGAGCAAAGCCATTGGTTCCCTAGAGACCTCC A ACACTCTCAAGGGATGCTCGATTCCATTCTGATCATCTAATTTTGTGAAT SEQ ID NO.6: TCTGTAGGTTCCCAAAATAGTTTGCTCTATCTTCTGCCGCATCAATTAATC GACTTGAAGTAGGCCATGAGAAGTAGGCAGCATTGCTCTCAGGATGCTGA Example 1
[0022] 1. Investigation of cotton experimental materials and plant height traits The natural cotton germplasm used was provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences, including 326 accessions of Sea Island cotton cultivars.
[0023] All 326 germplasm accessions were planted in an ecological site in Anyang, Henan Province in 2015 and in Xinjiang in 2016, following a randomized block design, with two replicates for each material. Field management, including irrigation, pesticide spraying, and pruning of cotton fruiting branches, was conducted according to the standard management practices for cotton growth stages at each ecological site. Plant height was surveyed at maturity, measured using a measuring tape from the cotyledonary node to the upper meristem. Ten plants were measured in each plot. Plant height was measured for all samples in the natural population using this method.
[0024] 2. Whole genome resequencing and SNP detection Total genomic DNA was extracted from young leaves of each germplasm using the CTAB method. The DNA was then sent to a biotechnology company for sequencing, and a 150-bp paired-end sequencing library was constructed according to the manufacturer's instructions. Sequencing was performed using the Illumina HiSeq platform. After filtering out low-quality paired-end reads, high-quality sequencing data (clean data) of 3.17 Tb were obtained, with an average genome coverage of ~15.6 X.
[0025] High-quality reads were aligned to the reference genome of *Cotton Island* 3-79 using BWA software (Wang et al., *Nature Genetics*, 2019). Based on the BAM files generated during alignment, SNP detection was performed at the population level using GATK software. Finally, 6,025,575 high-quality SNPs (deletion rate ≤ 20% and minimum allele frequency (MAF) ≥ 0.05) were retained for subsequent analysis. Annotation information for the SNPs was obtained using the ANNOVAR software package.
[0026] 3. Genome-wide association analysis of plant height in sea island cotton Genome-wide association analysis was performed based on plant height phenotypic data of 326 sea island cotton accessions and high-quality SNP (MAF>0.05, deletion rate≤0.2) genotypic data, using -log10( PThe Bonferronni correction threshold was approximately 6; loci greater than 6 were considered significant. Significantly associated SNPs were screened across the entire genome. Three SNPs significantly associated with cotton plant height were identified on chromosome A05 within the interval from 12,875,887 bp to 13,299,925 bp (Table 2). The Manhattan plot obtained from the genome-wide association analysis is shown below. Figure 1 As shown.
[0027] Table 2. SNP markers significantly associated with plant height of sea island cotton
[0028] Note: Hap1 base refers to materials carrying this type of base at the SNP site and are classified as Hap1, and Hap2 base is classified as such; Hap1 quantity refers to the number of materials carrying the Hap1 base at the SNP site, and Hap2 quantity is classified as such; Hap1 phenotype refers to the plant height of materials carrying the Hap1 base at the SNP site, and Hap2 phenotype refers to the plant height of materials carrying the Hap2 base at the SNP site, which is relatively short.
[0029] 4. Analysis of Chained Unbalanced Blocks (LD blocks) Using Tassel 5.0, linkage disequilibrium analysis was performed on the candidate interval (A05:2875887-13299925) containing the SNP sites. The analysis revealed that the SNPs within this interval formed a strongly linkage disequilibrium block (LDblock), with an LD coefficient (R05). 2 Higher (>0.8) Figure 2 (A) Molecular phylogenetic analysis and haplotype analysis were performed on the SNPs within the interval. Based on the typing results, the experimental material was divided into two haplotypes, Hap1 and Hap2. Figure 2 (B in the middle).
[0030] In the Anyang environment, the mean plant height of materials carrying Hap1 was 77.70 cm, and the mean plant height of materials carrying Hap2 was 73.91 cm. In the Xinjiang environment, the mean plant height of materials carrying Hap1 was 75.06 cm, and the mean plant height of materials carrying Hap2 was 71.68 cm. A significance test (two-tailed t-test) comparing plant heights among different haplotypes revealed that the plant height of Hap1 was significantly greater than that of Hap2 (P < 0.01). Figure 2 (C in the middle). Example 2
[0031] Application of SNP markers significantly associated with plant height in segregating populations The cross between GB0123 long-staple cotton (average plant height 107.34 cm) and GB0220 VIR-53TV (average plant height 53.72 cm) was performed. 2:3 The plant height trait of the offspring was identified. When the SNP molecular marker base was one of the bases at position 51 of SEQ ID NO.1-3, the offspring plants were taller; when the SNP molecular marker base was one of the bases at position 51 of SEQ ID NO.4-6, the offspring plants were shorter. This indicates that the SNP molecular marker can identify the plant height trait of Sea Island cotton in the early generations of the segregating population, and marker-assisted selection can be applied.
[0032] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of SNP molecular marker combinations associated with plant height in the identification of plant height trait in Island cotton, characterized in that, The SNP molecular marker combination consists of 3 SNP sites, which are shown in the table below: , The physical location of the SNP sites was determined based on chromosome A05 of the reference genome version of sea island cotton, G. barbadense AD2 '3-79 'HAU_v2. When the base of the SNP site is Hap1, the plant height of sea island cotton is relatively high, and when the base of the SNP site is Hap2, the plant height of sea island cotton is relatively short.
2. The application of primer pairs for amplifying SNP molecular marker combinations in identifying the plant height trait of Island cotton or in preparing products for identifying the plant height trait of Island cotton, characterized in that, The SNP molecular marker combination consists of 3 SNP sites, which are shown in the table below: , The physical location of the SNP sites was determined based on chromosome A05 of the reference genome version of sea island cotton, G. barbadense AD2 '3-79 'HAU_v2. When the base of the SNP site is Hap1, the plant height of sea island cotton is relatively high, and when the base of the SNP site is Hap2, the plant height of sea island cotton is relatively short.
3. The application according to claim 2, characterized in that, The products include a genome detection kit for sea island cotton or a whole genome SNP chip for sea island cotton.
4. A product for identifying the plant height trait of sea island cotton, characterized in that, Includes the primer pair combination described in claim 2.
5. The product according to claim 4, characterized in that, The products include a genome detection kit for sea island cotton or a whole genome SNP chip for sea island cotton.
6. The application of the product as described in claim 4 or 5 in identifying the plant height trait of sea island cotton.
7. A method for determining the plant height of sea island cotton, characterized in that, The method includes the following steps: (1) Genomic DNA was extracted from the leaves of the sea island cotton sample; (2) Using genomic DNA as a template, amplify the DNA fragment containing the SNP site described in claim 1 by PCR technology to obtain the PCR product; (3) The PCR products were detected using a fluorescence detection platform, and the plant height of the island cotton was determined based on the polymorphism of the SNP molecular markers reflected by the obtained fluorescence signals. (4) When the base at the SNP site is Hap1, the plant height of the sea island cotton is relatively high; when the base at the SNP site is Hap2, the plant height of the sea island cotton is relatively short. The SNP sites are shown in the table below: 。