Application of lprK gene in regulating the predation ability of streptomyces hygroscopicus
By inhibiting or reducing the activity or expression of LprK protein in Stenotrophomonas maltophilia, the problem of unclear regulatory mechanism of predatory behavior of Stenotrophomonas maltophilia was solved, the predatory ability under oligotrophic conditions was improved, and a new strategy for microbial management was provided.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF MICROBIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-03-26
- Publication Date
- 2026-06-16
AI Technical Summary
In the existing technology, the regulatory mechanism of the predatory behavior of Stenotrophomonas maltophilia is unclear, and there is a lack of target genes that can precisely regulate the predatory interaction between bacteria. This makes it difficult to use such genes to regulate microbial behavior in a targeted manner, which limits their applicability in different microbial regulation scenarios.
The predatory ability of Stenotrophomonas maltophilia is regulated by inhibiting or reducing the content or activity of LprK protein, or by inhibiting or reducing the expression of LprK protein-encoding genes, including knocking out or dephosphorylating LprK protein-encoding genes in the Stenotrophomonas maltophilia genome.
This study significantly enhances the predation ability of Stenotrophomonas maltophilia under oligotrophic conditions, particularly its predation ability against Xanthomonas, providing a strategy for precise regulation of bacterial predation interactions and laying a theoretical foundation for its application in microbial governance scenarios.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to... lprK Application of genes in regulating the predatory ability of Stenotrophomonas maltophilia. Background Technology
[0002] Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia Stenotrophomonas maltophilia, belonging to the genus Stenotrophomonas, is a common group of Gram-negative bacteria. It is widely distributed, commonly found in natural environments such as soil and water, and can also colonize the surface and interior of plants and animals. As a typical opportunistic pathogen, it usually does not cause infection in healthy hosts, only inducing infection when the host's immune function is impaired or weakened. Notably, Stenotrophomonas maltophilia also possesses predatory characteristics, capable of preying on various microorganisms, including bacteria and fungi, thus possessing potential for development and application. However, current research on the predation process, regulatory mechanisms, and specific modes of action of this bacterium remains relatively scarce. Therefore, screening and identifying predation-related genes related to the predation phenomenon of Stenotrophomonas maltophilia, and exploring its related functional and regulatory genes, is of great significance for filling the research gaps in this field.
[0003] To elucidate the regulatory mechanisms of predatory behavior in *Stenotrophomonas maltophilia*, environmental signal perception and response are core research directions. Lysine, an essential amino acid for bacterial growth and metabolism, is not only a key raw material for protein synthesis but also a signaling molecule sensed by bacteria, thereby regulating the expression of genes related to physiological metabolism, population behavior, and environmental adaptation. Previous studies have shown that various bacteria can recognize changes in lysine concentration through specific signaling systems, adjusting their survival strategies and interspecies interaction patterns. As a predatory environmental and opportunistic pathogen, the initiation and regulation of predatory behavior in *Stenotrophomonas maltophilia* inevitably depends on the precise perception of surrounding environmental signals. Therefore, investigating whether *Stenotrophomonas maltophilia* can sense lysine signals and how lysine regulates the expression of predatory-related genes and the formation of predatory phenotypes through signal transduction pathways will not only help reveal the molecular regulatory network of this bacterium's predatory behavior but also provide a new perspective on understanding the role of amino acid signaling in interspecies bacterial interactions. Furthermore, it will lay a theoretical foundation for optimizing its potential for biocontrol applications by regulating signaling molecules.
[0004] In existing technologies, research on bacterial two-component regulatory systems mostly focuses on broad signal transduction functions. lprK The gene was previously named rstBThese genes are only classified as "regulatory sensing transduction factors," and their specific response signals and core roles in specific processes such as bacterial predation behavior remain unclear. Furthermore, current research on genes regulating bacterial predation ability is scarce. There is a lack of target genes that can precisely regulate the predation interaction of Stenotrophomonas maltophilia, and no correlation has been found between gene function and nutritional environment. This makes it impossible to precisely regulate bacterial predation ability in microbial management scenarios under different nutritional conditions. At the same time, the understanding of regulatory system genes remains at a broad functional level, without clarifying their response signals (such as lysine) and predation inhibition mechanisms. This makes it difficult to use these genes to regulate microbial behavior in a targeted manner. These problems together limit the applicability of these genes in different microbial regulation scenarios. Summary of the Invention
[0005] The technical problem solved by this invention is to provide lprK Application of genes in regulating the predatory ability of Stenotrophomonas maltophilia.
[0006] To address this technical problem, the first aspect of the present invention provides a substance that inhibits, reduces, or downregulates the content or activity of LprK protein, or a substance that inhibits, reduces, or downregulates the expression of LprK protein-encoding genes, in any of the following applications:
[0007] A1) Enhance the predatory ability of Stenotrophomonas maltophilia; A2) Prepare products that enhance the predatory ability of Stenotrophomonas maltophilia; The LprK protein is any one of the following: The protein shown in B1 includes the amino acid residues shown in sequence 2; The protein shown in B2) has more than 80% amino acid sequence identity with the protein shown in B1) and has the same function; The protein shown in B3) includes the protein shown in B1) or B2) by attaching a tag to its N-terminus and / or C-terminus to obtain the protein with the sequence shown.
[0008] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0009] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0010] In the above-described applications, the substance is a reagent that knocks out the LprK protein-coding gene in the genome of Stenotrophomonas maltophilia or a reagent that dephosphorylates the LprK protein-coding gene in the genome of Stenotrophomonas maltophilia.
[0011] In the application described above, the knockout of the Stenotrophomonas maltophilia genome lprK The gene reagent is any one of the following: C1) Inhibits, reduces, or downregulates the expression of the LprK protein-encoding gene in the first aspect, C2) expresses the gene encoding the nucleic acid molecule described in C1). C3) contains the expression cassette of the gene described in C2). C4) A recombinant vector containing the gene described in C2), or a recombinant vector containing the expression cassette described in C3). C5) A recombinant microorganism containing the gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).
[0012] In some embodiments, C1) the nucleotide sequence of the nucleic acid molecule that inhibits, reduces, or downregulates the expression of the LprK protein-encoding gene in the first aspect is sequence 3.
[0013] In the above-described application, the reagent that dephosphorylates the LprK protein encoding gene in the Stenotrophomonas maltophilia genome is a reagent that causes a mutation at position 230H of the LprK protein amino acid sequence.
[0014] In some embodiments, the reagent that causes the mutation at position 230H of the LprK protein amino acid sequence is a reagent that causes the mutation at position 230H of the LprK protein amino acid sequence (Sequence 2) to be A.
[0015] In some embodiments, the reagent that mutates H to A at position 230 of the LprK protein amino acid sequence (Sequence 2) includes: lprK H230A -A: AACAGCTATGACATGATTACGAATTCTGCTGGCCAGATCCTGGA lprK H230A -B: GGCCGCCACTGCCTGGGCCAGCACGCGCTGG lprK H230A -C: CTGGCCCAGGCAGTGGCGGCCGAAGTCCGCA lprK H230A -D: GTAAAACGACGGCCAGTGCCAAGCTTCGCGCGACGTGGAGAGAA.
[0016] In the above-described application, the enhancement of Stenotrophomonas maltophilia's predatory ability refers to enhancing Stenotrophomonas maltophilia's predatory ability against Xanthomonas.
[0017] In some embodiments, the enhancement of Stenotrophomonas maltophilia’s predation ability on Xanthomonas maltophilia is to enhance Stenotrophomonas maltophilia’s predation ability on Xanthomonas maltophilia under oligotrophic conditions (natural or organic conditions).
[0018] In a second aspect, the present invention provides substances that inhibit, reduce, or downregulate the content or activity of LprK protein as described in the first aspect, or substances that inhibit, reduce, or downregulate the expression of LprK protein-encoding genes.
[0019] Thirdly, the present invention provides a method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: inhibiting or reducing or downregulating the content or activity of the LprK protein described in the first aspect in Stenotrophomonas maltophilia, or inhibiting or reducing or downregulating the expression of the LprK protein encoding gene described in the first aspect in Stenotrophomonas maltophilia, thereby improving the predatory ability of Stenotrophomonas maltophilia.
[0020] Fourthly, the present invention provides a method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: knocking out the full length or part of the LprK protein encoding gene in Stenotrophomonas maltophilia as described in the first aspect to inhibit, reduce or downregulate the expression of the LprK protein encoding gene in Stenotrophomonas maltophilia as described in the first aspect, thereby improving the predatory ability of Stenotrophomonas maltophilia.
[0021] Fifthly, the present invention provides a method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: dephosphorylating the LprK protein encoding gene described in the first aspect in the Stenotrophomonas maltophilia genome to improve the predatory ability of Stenotrophomonas maltophilia.
[0022] In some implementations, the method is carried out under natural or organic conditions, or in a oligotrophic system or under starvation conditions.
[0023] In some embodiments, the oligotrophic system may be an oligotrophic culture medium.
[0024] In some embodiments, the oligotrophic medium is MMX medium.
[0025] This study found that *Stenotrophomonas maltophilia* Sma CGMCC1.1788 exhibits significant predatory activity against various bacteria, including Staphylococcus aureus, Escherichia coli, Xanthomonas, and Bacterium tumefaciens, the causal agent of rice bacterial blight. This strain effectively preys on its target bacteria in both solid and liquid culture systems. This invention is the first to clearly demonstrate... lprK Gene (original) rstB The core function of the gene is that it encodes a histidine kinase that participates in the formation of a bacterial two-component regulatory system, negatively regulating the predatory ability of Stenotrophomonas maltophilia. This was achieved through double-crossover homologous recombination technology. lprK Gene deletion mutant (Δ) lprK -EV), in oligotrophic MMX medium, this mutant is effective against... Xcc The predatory ability of 8004 and other prey bacteria was significantly enhanced, specifically manifested in the enlargement of colony cavities and an increase in the predation index in mixed cultures; however, the rate of decline in viable cell count in mutants was faster than that in wild-type cultures when cultured alone, while the Δ value obtained through plasmid-mediated gene complementation experiments was significantly higher. lprK - lprK The strain's predation ability and survival ability both recovered to wild-type levels, confirming the gene's negative regulatory role in predation and its positive maintenance function in strain survival. It was also found that in nutrient-rich NYG medium, lprK The gene has no significant effect on predation ability, demonstrating its function's correlation with the nutritional environment. This invention provides... lprK The application of genes as target genes in regulating bacterial predator-prey interactions and optimizing microbial ecosystems provides a new strategy for the precise regulation of bacterial behavior. Attached Figure Description
[0026] Figure 1 A shows the secondary structure of the LprK protein and the mutant phenotype; A is the secondary structure diagram of the LprK protein; B is the wild-type, lprK Plate phenotypes of five genetic strains, including mutants and complementary strains; C represents wild-type strains all carrying the overexpression vector. lprK Quantitative results of the mutant and complementary strains in MMX liquid medium; D represents the quantitative results of the wild-type, mutant, and complementary strains in NYG liquid medium. Unpaired two-tailed Student's t-test was used, where "ns" indicates no significant difference; "Indicates a highly significant difference with a p-value less than 0.001;" "" indicates that the difference is significant and the P value is less than 0.1.
[0027] Figure 2 for lprK The point mutant strain phenotype was determined; an unpaired two-tailed Student's t-test was used, in which " "" indicates that the difference is extremely significant and the P value is less than 0.001.
[0028] Figure 3 Wild-type cells, all carrying the overexpression vector lprK Growth counting curves of mutant and complementary three strains. Detailed Implementation
[0029] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0031] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0032] The maltophilic stenotrophomonas strain used in the following examples S. maltophilia CGMCC 1.1788 originates from the Microbial Culture Collection Center of the Institute of Microbiology, Chinese Academy of Sciences, and its strain number is CGMCC 1.1788 (hereinafter referred to as CGMCC 1.1788). Sma CGMCC1.1788).
[0033] The following examples are of Xanthomonas aeruginosa ( Xanthomonas campestris pv. campestris 8004, hereinafter referred to as Xcc 8004) is recorded in the following literature: Wang H, Shi C, Xie Q, Wang Y, Liu S, Li C, HeC, Tao J. Genome-wide analysis of β-Galactosidases in Xanthomonas campestris pv. campestris8004. Front Microbiol. 2018 May 11;9:957. doi:10.3389 / fmicb.2018.00957. PMID: 29867862; PMCID: PMC5958218. The name of this material in the literature is... Xanthomonas campestris pv. campestris 8004.
[0034] The following examples describe liquid culture medium components in 1 L of solution with pH adjusted to 7.0. If a solid culture medium is required, add 15 g of agar powder.
[0035] LB medium: 10 g peptone, 5 g yeast extract, 10 g sodium chloride, and the remainder is water.
[0036] 210 medium: 5 g sucrose, 8 g enzymatically hydrolyzed casein, 4 g yeast extract, 3 g K2HPO4, 0.3 g MgSO4·7H2O, balance water; MMX medium: 4 g K2HPO4, 6 g KH2PO4, 2 g (NH4)2SO4, 1 g trisodium citrate, 0.2 g MgSO4·7H2O, 5 g Glucose, balance water.
[0037] NYG medium: 5 g peptone, 3 g yeast extract, 20 ml glycerol, 2 g K2HPO4, 0.5 g KH2PO4, and the remainder is water.
[0038] Example 1: Application of reducing LprK protein activity in enhancing the predatory ability of Stenotrophomonas maltophilia Stenotrophomonas maltophilia Sma CGMCC 1.1788 exhibits significant predatory activity against various bacteria, including Staphylococcus aureus, Escherichia coli, Xanthomonas, and Bacterium tumefaciens, the causal agent of rice bacterial blight. Predatory-related genes were identified through screening a Tn5 transposon mutant library and TAIL-PCR identification. lprK This gene encodes histidine kinase LprK.
[0039] lprK The nucleotide sequence of the gene is sequence 1, and the amino acid sequence of the protein LprK it encodes is sequence 2. Figure 1 A is a secondary structure of LprK.
[0040] one, lprK In-frame deletion of mutant strain Δ lprK and its functional verification 1.lprK In-frame deletion of mutant strain Δ lprK Construction (1) Extracted Sma Using CGMCC 1.1788 genomic DNA as a template, the gene to be deleted was amplified by PCR. lprK The DNA sequences flanking the fragment were purified by agarose gel to obtain the up fragment (726 bp) and the down fragment (780 bp). The primers for amplifying the above-mentioned up fragment are as follows: Primers lprK -A:AACAGCTATGACATGATTACGAATTCGCACGGCTATCTGGAAA; Primers lprK -B:TTGCTGATCGTGGTCGAAGTAACCGATTCGGAGCTG; The primers for amplifying the down fragment are as follows: Primers lprK -C:GGTTACTTCGACCACGATCAGCAACAGATGGGCAAC; Primers lprK -D: GTAAAACGACGGCCAGTGCCAAGCTTCGTACTGGTCGAAGACGAT; (2) Using the Seamless Cloning Kit (Kangrun Biotechnology, catalog number T197) 100) The upstream homologous arm (up fragment) and the downstream homologous arm (down fragment) were ligated into the pK18mobSacB vector digested with EcoRI and HindIII (Kangrun Biotechnology, catalog number T185). 100), construct recombinant plasmid pK18mobSacB up The ligation product was transformed into DH5α competent cells, positive clones were picked and plasmids were extracted, and sequenced using M13 primers for verification.
[0041] The recombinant plasmid pK18mobSacB-up-down is a vector obtained by replacing the DNA fragment shown in sequence 3 with the fragment between the EcoRI and HindIII restriction sites of the suicide vector pK18mobSacB.
[0042] In the DNA fragment shown in Sequence 3, positions 1-714 are the up fragment, and positions 715-1482 are the down fragment.
[0043] (3) The recombinant plasmid pK18mobSacB-up-down was converted to [a specific plasmid] by electroporation. Sma CGMCC 1.1788 competent cells were cultured at 28℃ (Note: the growth temperature for culturing the two bacteria separately) for 2-3 days, and single clones that could grow on LB plates containing 50 μg / mL kanamycin were selected.
[0044] PCR amplification was performed using outer primers (primer VF and primer VR) for the up and down sequences of the gene fragment to be deleted. Strains that did not amplify the corresponding wild-type band (2878 bp) were selected as first-time exchange positive strains. Sma CGMCC 1.1788 is the wild-type control.
[0045] VF:CATCCAGGCCTTTGACA VR: AGGCCTTGAAAATGCTGG.
[0046] (4) Inoculate the positive strain of the first exchange into 10 mL of LB (LK) liquid medium containing 50 μg / mL kanamycin and culture overnight at 28°C and 230 rpm with shaking. Take 1 mL of the overnight bacterial culture, centrifuge at 6000 rpm for 2 minutes to collect the bacterial cells, wash 3 times with LB medium, and resuspend in 10 mL of LB liquid medium. Culture at 28°C and 230 rpm with shaking for 2-4 hours to induce the second exchange. (5) The bacterial culture was serially diluted, and 100 μL of each was spread on LB plates containing 20% sucrose and incubated at 28°C for 2-3 days. (6) Pick single clones from LB plates containing 20% sucrose and inoculate them into LB (LK) plates and LB plates containing 50 μg / mL kanamycin, respectively, and screen for single clones that cannot grow on LK plates but can grow on LB plates.
[0047] Genomic DNA was extracted from the above monoclonal strains, and colony PCR was performed using outer primers (primer VF and primer VR) to verify the positive strains. The strains with a length of 1720 bp were identified.
[0048] Positive strains and Sma Sequencing results of CGMCC 1.1788 (wild type) PCR products showed that the length of the PCR products of the positive strain was reduced compared to the wild type by the size of the corresponding deleted fragment.
[0049] Therefore, the above-mentioned positive strains are recorded as lprK Delete mutant strain Δ within the read frame lprK .
[0050] lprK Delete mutant strain Δ within the read framelprK To be Sma In the CGMCC 1.1788 genome lprK The strain was obtained by knocking out bases 73-1230 of gene (sequence 1) while leaving the other base sequences unchanged.
[0051] 2. Construction of complementary strains 1) Construct complementary plasmids pBBR1MCS2- lprK To make the sequence shown in Sequence 1 lprK The vector was obtained by replacing the fragment between the KpnI and HindIII restriction sites of the pBBR1MCS2 vector (Newp Biotech, V000592).
[0052] 2) Complementary strains The above complementary plasmid pBBR1MCS2- lprK The mutant strain Δ was prepared by introducing the above method 1. lprK In this process, complementary strain Δ was obtained. lprK - lprK .
[0053] To eliminate the interference of the complementary plasmid itself on the experimental results, the pBBR1MCS2 plasmid was transformed into both the wild-type strain and the constructed deletion mutant strain to observe the phenotypic changes, as detailed below: The mutant strain Δ was prepared by introducing the complementary plasmid backbone pBBR1MCS2 into the above-mentioned step. lprK In the process, complementary control strain Δ was obtained. lprK -EV.
[0054] The complementary plasmid backbone pBBR1MCS2 was introduced into the wild-type strain. Sma In CGMCC 1.1788, the complementary control strain WT-EV was obtained.
[0055] 3. Detect and delete lprK Gene pair Sma CGMCC 1.1788: Adjusting Predation Effects To observe the predation extent of bacteria, this study used the mixed plaque culture method on solid culture medium: The bacteria to be tested and the prey bacteria Xcc 8004 was cultured overnight in NYG liquid medium at 28°C to obtain bacterial suspensions of the test bacteria and prey bacteria. The OD values of all bacterial suspensions were then measured using a UV spectrophotometer. 600The value was uniformly adjusted to 0.4, and then the bacterial suspension of the test bacteria and the bacterial suspension of the prey bacteria were mixed at a volume ratio of 1:3 to obtain a mixed bacterial suspension. 5 μL of the mixed bacterial suspension was spotted onto MMX solid medium (oligotrophic medium, simulating natural conditions). After the bacterial suspension was dried in a clean bench, the plate was placed in an incubator at 30℃ (Note: this is the growth temperature of the predator-prey environment for the mixed culture of the two bacteria).
[0056] The bacteria to be tested are Sma CGMCC 1.1788 Wide Type (WT), WT-EV, Δ lprK , Δ lprK -EV and Δ lprK - lprK .
[0057] With prey Xcc 8004, Predator Sma CGMCC 1.1788 (referred to in the image) Sma They were cultured separately as controls.
[0058] The results of a spot experiment in which prey and predators were cultured together in MMX medium at a ratio of 3:1 are as follows: Figure 1 As shown in B, in the left figure Xcc Group 8004 represents prey Xcc 8004 cultured separately. Sma Group representation Sma CGMCC 1.1788 (predator) cultured alone, it can be seen that... Sma and Xcc The growth of 8004 on MMX medium showed significant differences: Xcc 8004 can grow in large quantities, while Sma There was virtually no growth; in the right figure, the WT-EV group represents WT-EV and... Xcc 8004 mixed culture, Δ lprK -EV group represents Δ lprK -EV and Xcc 8004 mixed culture, Δ lprK - lprK Group represents Δ lprK - lprK and Xcc 8004 mixed culture. It can be seen that, with a high prey ratio, only a small amount of prey was observed after WT-EV mixed culture. Xcc 8004 was preyed upon, creating a void in the middle; this state can serve as a reference point for subsequent observations; Δ lprK -EV and Xcc Colony morphology of 8004 mixed culture and WT-EVXcc The colony morphology of the 8004 mixed culture showed significant differences, exhibiting the following characteristics: Xcc 8004 was clearly preyed upon, and the mixed colonies showed obvious cavities. This indicates that... lprK Gene deletions all lead to S. maltophilia Their predatory abilities are significantly enhanced. And Δ lprK - lprK ( lprK Missing strain replacement lprK Because the target gene was reintroduced, the colony morphology of the bacteria recovered to a state close to that of WT-EV, further validating the role of this gene in regulation. S. maltophilia It plays an important role in predation ability.
[0059] lprK The enhanced predatory ability induced by gene deletion, and the restoration of the phenotype after replacement, strongly suggest... lprK Genes in S. maltophilia It plays a negative regulatory role in the predation control network.
[0060] 4. Observation of predator-prey interaction counting in liquid culture medium To achieve the control of Stenotrophomonas maltophilia ( S. maltophilia For quantitative analysis of liquid environments, this study employed the gradient dilution plate method. S. maltophilia The number of viable bacteria in the prey is counted. The specific procedure is as follows: Strain pretreatment: Predatory bacteria and prey bacteria to be tested are mixed together. Xcc 8004 cells were inoculated into the corresponding NYG liquid medium and incubated overnight at 28°C. After incubation, the cells were washed three times with the corresponding medium, and finally resuspended in MMX liquid medium by centrifugation to obtain the bacterial suspension. The OD of the bacterial suspension was measured using a UV spectrophotometer. 600 The OD values of all bacterial cultures were determined using MMX liquid medium. 600 The value has been uniformly adjusted to 0.4.
[0061] Mixed bacterial suspensions: Subsequently, the bacterial suspensions of the test bacteria and the prey bacteria were mixed at a volume ratio of 1:1. Xcc Mix 8004 bacterial suspensions (200 μL of test bacteria suspension: 200 μL of prey bacteria suspension).
[0062] Control group bacterial culture: The test bacterial culture or the prey bacterial culture was mixed with MMX liquid medium at a ratio of 1:1 (200 μL test bacterial culture: 200 μL corresponding medium), and the treatment method was the same as that of the mixed group.
[0063] The bacteria tested were WT-EV and Δ. lprK-EV and Δ lprK - lprK .
[0064] The mixed group and control group bacterial cultures were incubated in a shaker at 30°C for 24 hours, and samples were taken for testing. The liquid cultures to be tested were serially diluted 10-fold using sterile physiological saline or the appropriate liquid culture medium, successively diluted to 10⁻⁶. - ¹ to 10 -7 Different concentrations (the specific dilution factor can be adjusted flexibly according to the estimated bacterial density in the sample to ensure that the number of colonies growing on the subsequent plates is within the suitable counting range of 30-300). Then, take 0.1 mL of bacterial solution from each dilution and spread it evenly on an NYG plate; if it is necessary to distinguish between the two for counting, a selective medium can be used (such as a medium containing a specific antibiotic for the bacteria to be tested, or a corresponding medium selected according to the difference in nutritional requirements of the two). At least 3 parallel plates should be set up for each dilution to reduce experimental error.
[0065] After plating, the plates were inverted and incubated at 28°C. Once clearly identifiable single colonies had grown on the plates, the number of colonies on each plate was counted. Finally, the logarithm of the viable cell concentration (CFU / mL) was calculated to determine the number of test bacteria and prey bacteria in the liquid environment, and the ratio of the counts of the two bacteria in the mixed group to the counts of their respective control groups was statistically analyzed.
[0066] prey Xcc 8004 and S. maltophilia The quantitative results of the survival index of co-cultured in MMX liquid medium are as follows: Figure 1 As shown in C, the left figure shows the bacteria to be tested, which are predators (labeled as predators in the figure). Sma The right figure uses prey as the target to reflect the survival ratio of "co-culture / iso-culture" (i.e., predation index, number of bacteria in the mixed group / number of bacteria in the test bacteria culture alone); Xcc 8004 is the target (referred to as prey in the diagram). Xcc 8004), reflecting its survival index (i.e., survival index, number of bacteria in the mixed group / ) in "co-culture / iso-culture". Xcc (Number of bacteria cultured in 8004 culture alone). It can be seen that, compared to the wild-type empty vector group (WT-EV), Δ lprK -EV ( lprK The survival index of gene-deleted strains transformed with empty vectors was significantly altered, and predator-measured Δ... lprK The predation index of the -EV group increased significantly, while the survival index of prey in this group decreased significantly, indicating that... [[ID=13 Gene deletion affects predator-prey interactions; while gene replacement strains (Δ) - The survival index of the group approached that of the WT-EV group, echoing the phenotype observed in the aforementioned dot experiment, thus quantitatively verifying the role of this gene in... It fosters the core function of negative regulation of predation ability.
[0067] 5. Nutritional environment / R Effects of gene function The only difference from method 4 above is as follows: Strain pretreatment: The bacteria to be tested are mixed with the prey bacteria. 8004 was inoculated into the corresponding NYG liquid medium and incubated overnight at 28°C to obtain bacterial suspensions. The OD of the bacterial suspensions was measured using a UV spectrophotometer. 600 Value, the OD of all bacterial cultures 600 The value has been uniformly adjusted to 0.4.
[0068] Mixed bacterial suspensions: Subsequently, the bacterial suspensions of the test bacteria and the prey bacteria were mixed at a volume ratio of 1:1. 8004 bacterial suspension mixture (200 μL of test bacteria suspension: 200 μL of prey bacteria suspension).
[0069] Control group bacterial suspension: The test bacterial suspension or the prey bacterial suspension alone was mixed with NYG liquid medium at a ratio of 1:1 (200 μL test bacterial suspension: 200 μL corresponding medium), and the treatment method was the same as that of the mixed group.
[0070] prey 8004 and The quantitative results of the survival index of co-cultured in NYG liquid medium are as follows: As shown in D. It can be seen that the left figure uses predator-type bacteria as the test subject (denoted as predator in the figure). The predation index (Δ) is used to reflect the survival ratio of bacteria in co-culture / iso-culture (i.e., the predation index, the number of bacteria in the mixed culture group / the number of bacteria in the test bacteria cultured alone); compared with the WT-EV group, Δ -EV and Δ - There were no significant differences between the groups. The right figure shows prey. 8004 is the target (referred to as prey in the diagram). 8004), reflecting its survival index (i.e., survival index, number of bacteria in the mixed group / ) in "co-culture / iso-culture". (Number of bacteria in 8004 culture alone); compared with the WT-EV group, Δ -EV and Δ There were no significant differences in the -lprK group.
[0071] The above results indicate that LprK does not significantly regulate interspecific interaction survival in a nutrient-rich environment (NYG medium), which is significantly different from that in a low-nutrient environment (MX medium, simulating the natural environment). This suggests that rich nutrition may compensate for the effects of gene loss, demonstrating that gene function may be environmentally dependent on nutritional conditions.
[0072] II. Dynamic Regulation of LprK Phosphorylation The impact of predation ability 1. Point mutant strains Point mutant strains, including constitutive activated phosphorylation mutants ( H230D Simulating a persistent phosphorylation state) and removing phosphorylation mutants ( H230A (Blocks phosphorylation transmission).
[0073] 1) Preparation of point mutant plasmids Extracted Using CGMCC 1.1788 genomic DNA as a template, the following primers were used. H230A -A / H230A -B and H230A -C / H230A -D was used for amplification, yielding fragments AB (750 bp) and CD (780 bp); these were then processed using a seamless cloning kit (Kangrun Biotechnology, catalog number T197). 100) Ligate AB and CD to the pK18mobSacB vector digested with EcoRI and HindIII (Kangrun Biotechnology, catalog number T185) 100), resulting in plasmid pK18mobSacB- H230A .
[0074] H230A -A: AACAGCTATGACATGATTACGAATTCTGCTGGCCAGATCCTGGA H230A -B: GGCCGCCACTGCCTGGGCCAGCACGCGCTGG H230A -C: CTGGCCCAGGCAGTGGCGGCCGAAGTCCGCA H230A -D: GTAAAACGACGGCCAGTGCCAAGCTTCGCGCGACGTGGAGAGAA PK18mobSacB- H230A To be H230A The mutant encoding gene replaced the fragment between the EcoRI and HindIII restriction sites of the PK18mobSacB vector to obtain the vector.
[0075] H230A The amino acid sequence of the mutant is obtained by mutating H at position 230 of sequence 2 to A.
[0076] H230A The nucleotide sequence of the gene encoding the mutant is that CA at positions 688-689 of sequence 1 is mutated to GC.
[0077] Extracted Using CGMCC 1.1788 genomic DNA as a template, the following primers were used. H230D -A / H230D -B and H230D -C / H230D -D was used for amplification, yielding fragments AB (750 bp) and CD (780 bp); these were then amplified using a seamless cloning kit (Kangrun Biotechnology, catalog number T197). 100) Ligate AB and CD to the pK18mobSacB vector digested with EcoRI and HindIII (Kangrun Biotechnology, catalog number T185) 100), resulting in pK18mobSacB- H230D .
[0078] H230D -A: AACAGCTATGACATGATTACGAATTCTGCTGGCCAGATCCTGGA H230D -B: GTTCGCCACTGCCTGGGCCAGCACGCGCTGG H230D -C: CTGGCCCAGGCAGTGGCGAACGAAGTCCGCA H230D -D: GTAAAACGACGGCCAGTGCCAAGCTTCGCGCGACGTGGAGAGAA pK18mobSacB- H230D To be H230D The mutant encoding gene was replaced by a fragment between the EcoRI and HindIII restriction sites in the pK18mobSacB vector to obtain the vector.
[0079] H230D The amino acid sequence of the mutant is obtained by mutating H at position 230 of sequence 2 to D.
[0080] H230D The nucleotide sequence of the gene encoding the mutant is that the C nucleotide at position 688 of sequence 1 is mutated to an A nucleotide.
[0081] 2) Preparation of point mutant strains The above-mentioned vector pK18mobSacB- H230A and pK18mobSacB- H230D Transfer to each In CGMCC1.1788, point mutant strains were obtained through secondary homologous recombination, plate screening, and PCR verification. H230A and point mutant strains H230D .
[0082] 2. The predatory ability of the point mutant strain was determined. Strain pretreatment: The bacteria to be tested are mixed with the prey bacteria. 8004 cells were inoculated into the corresponding NYG liquid medium and cultured overnight at 28°C. After culturing, the cells were washed three times with MMX liquid medium, and finally resuspended in MMX liquid medium by centrifugation to obtain the bacterial suspension. The OD of the bacterial suspension was measured using a UV spectrophotometer. 600 Value, the OD of all bacterial cultures 600 The value was uniformly adjusted to 0.4.
[0083] Mixed bacterial suspensions: Subsequently, the bacterial suspensions of the test bacteria and the prey bacteria were mixed at a volume ratio of 1:1. 8004 bacterial suspension mixture (200 μL of test bacteria suspension: 200 μL of prey bacteria suspension).
[0084] Control group bacterial culture: The test bacterial culture or the prey bacteria culture was mixed with MMX liquid medium at a ratio of 1:1 (200 μL test bacterial culture: 200 μL corresponding medium), and the treatment method was the same as that of the mixed group.
[0085] The bacteria to be tested are CGMCC 1.1788 (denoted as WT in the figure), point mutant bacteria H230A and point mutant bacteria H230D .
[0086] The mixed group and control group bacterial cultures were incubated in a shaker at 30°C for the set time, and samples were taken for testing. The liquid cultures to be tested were serially diluted 10-fold using sterile physiological saline or the appropriate liquid culture medium, successively diluted to 10-fold... - ¹ to 10 -7 Different concentrations (the specific dilution factor can be adjusted flexibly according to the estimated bacterial density in the sample to ensure that the number of colonies growing on the subsequent plates is within the suitable counting range of 30-300). Then, take 0.1 mL of bacterial solution from each dilution and spread it evenly on an NYG plate; if it is necessary to distinguish between the two for counting, a selective medium can be used (such as a medium containing a specific antibiotic for the test bacteria, or a corresponding medium selected according to the difference in nutritional requirements of the two). At least 3 parallel plates should be set up for each dilution to reduce experimental error.
[0087] After plating, the plates were inverted and incubated at 28°C. Once clearly identifiable single colonies had grown on the plates, the number of colonies on each plate was counted. Finally, the logarithm of the viable cell concentration (CFU / mL) was calculated to determine the viable cell count in the liquid environment. The number of bacteria in the prey was compared with the count of each type of bacteria in the mixed group and the ratio of the count of each type of bacteria to the count of their respective control groups.
[0088] The results are as follows As shown in the figure, the left figure shows the bacteria to be tested, which are predators (denoted as predators in the figure). The image on the right shows the prey as the subject. 8004 is the target (referred to as prey in the diagram). 8004), and wild-type strain Compared to CGMCC1.1788 (WT), the phosphorylation-removed point mutant strain H230A The mutant exhibited significantly enhanced predatory ability, while prey survival was reduced, consistent with the knockout mutant phenotype, directly verifying that the phosphorylation process of LprK plays an important inhibitory role in predatory behavior. Constitutive activated phosphorylation mutant strains H230D Its predatory ability is lower than that of the phosphorylation-removed mutant. H230A However, its predation index is still higher than that of the wild type, which indicates that even when the constitutive activating mutant is in a hyperphosphorylated state, it does not produce the strongest inhibitory effect.
[0089] This phenomenon indicates that, The inhibitory effect is not necessarily stronger at higher phosphorylation levels; on the contrary, it may be more effective at inhibiting predation behavior at lower phosphorylation levels. This characteristic of "strong inhibition at low phosphorylation" may be closely related to the dynamic balance of phosphorylation and dephosphorylation in wild-type strains: in wild-type strains... Phosphorylation levels fluctuate with environmental signals, remaining within a moderately low range, perfectly matching the optimal state for its inhibitory function; while constitutive activating mutants, due to persistently high phosphorylation, deviate from this range, thus weakening the inhibitory effect and resulting in a higher predation index than the wild type. This suggests that in the natural state, The system's phosphorylation is not a simple "continuous activation" mode, but rather a dynamic switching between phosphorylation and dephosphorylation to achieve fine-grained regulation of predation ability: when prey signals are present in the environment, the system may enhance phosphorylation, causing LprK to enter a hyperphosphorylation state, temporarily weakening the inhibitory effect, allowing... The predatory ability is moderately enhanced to obtain nutrients; when predation reaches a certain level or environmental signals change, LprK enters a hypophosphorylated state by removing phosphorylation, thus avoiding the adverse effects of over-predation on its own survival within the ecological niche.
[0090] three, Effect on population size As The core signaling pathway genes regulating predation behavior in this bacterium, through precise regulation via phosphorylation dynamic balance, are likely key to maintaining the stability of its populations and the rational allocation of biomass among other microorganisms in its niche. Specifically... In predator-prey relationships, the proper functioning of this system may directly impact the ebb and flow of population size and the dynamic balance of biomass accumulation. For example, its influence on... If the inhibition of predation behavior exists, it can prevent the predator population from over-proliferating and the prey population from declining sharply; otherwise, it may disrupt the interspecific balance.
[0091] To explore lprK Gene system in regulation S. maltophilia This study investigated the ecological functions of predation, particularly the impact of its absence on the dynamic balance of predator-prey communities, in MMX liquid medium.S. maltophilia Long-term culture experiments.
[0092] Strain pretreatment: The bacteria to be tested were inoculated into NYG liquid medium and cultured overnight at 28°C. After culture, the bacterial cells were washed three times with MMX liquid medium, and finally resuspended in MMX liquid medium to obtain the bacterial suspension. The OD of the bacterial suspension was measured using a UV spectrophotometer. 600 Value, the OD of all bacterial cultures 600 The value has been uniformly adjusted to 0.4.
[0093] Mixed bacterial suspensions: Subsequently, the bacterial suspensions of the test bacteria and the prey bacteria were mixed at a volume ratio of 1:1. Xcc Mix 8004 bacterial suspensions (200 μL of test bacteria suspension : 200 μL of prey bacteria suspension).
[0094] Control group bacterial suspension: The test bacterial suspension or the prey bacteria suspension alone was mixed with the culture medium at a ratio of 1:1 (200 μL test bacterial suspension: 200 μL corresponding culture medium), and the treatment method was the same as that of the mixed group.
[0095] The bacteria to be tested were WT-EV and Δ lprK -EV and Δ lprK - lprK Mutant strain.
[0096] The mixed group and control group bacterial cultures were incubated in a shaker at 28°C for the set time, and samples were taken for testing. The liquid cultures to be tested were serially diluted 10-fold using sterile physiological saline or the appropriate liquid culture medium, successively diluted to 10⁻⁶. - ¹ to 10 -7 Different concentrations were used (the specific dilution factor can be adjusted flexibly according to the estimated bacterial density in the sample to ensure that the number of colonies growing on the subsequent plates is within the suitable counting range of 30-300). Then, 0.1 mL of bacterial solution from each dilution was taken and evenly spread on an NYG plate. At least 3 parallel plates were set up for each dilution to reduce experimental error.
[0097] By taking samples at regular intervals and counting viable bacteria, the system tracked the dynamic changes in the population size of wild-type and mutant strains during 120 hours of co-culture.
[0098] The individual growth dynamics of the test bacteria in MMX liquid medium were evaluated to investigate lprK Self-sustaining functions in the absence of prey.
[0099] The results are as follows Figure 3As shown, in the initial stage of culture (0–24 hours), the population sizes of different genotypes were basically the same, indicating that wild-type and mutant strains had similar growth initiation capabilities in the relatively nutrient-rich initial stage, and MMX medium could support different strains to enter the growth state simultaneously. With prolonged culture time (24–120 hours), during continuous culture under oligotrophic conditions, the wild-type strain carrying the empty vector (WT-EV) showed a slow but stable population decline trend, maintaining a relatively constant level overall, reflecting its strong environmental adaptability. This result suggests that complete... lprK The system works synergistically with other regulatory networks to help the strain optimize metabolic allocation and regulate energy consumption in nutrient-deprived environments, thereby achieving dynamic balance in population size. Notably, after gene complementation expression, Δ lprK - lprK The growth dynamics of all strains recovered to near-wild-type levels to varying degrees, indicating that exogenous expression of LprK protein is sufficient to effectively rebuild regulatory function. This result further confirms... lprK The functional integrity of the system is important S. maltophilia Long-term survival in oligotrophic environments is crucial.
[0100] therefore, lprK The system not only regulates the intensity of predation in the predator-prey interaction, but also... S. maltophilia It plays a central role in coping with oligotrophic stress and maintaining population stability. The LprK protein, by sensing signals from the internal and external environment, coordinates metabolic and survival strategies, enhancing the strain's adaptability under resource-limited conditions, demonstrating the important biological functions of this two-component system at both the individual survival and interspecies interaction levels.
[0101] Correlation analysis between single-strain growth data and predator-prey co-culture experiment results reveals... lprK right S. maltophilia The regulation of this process has a "dual nature": it acts on both the balance regulation of interspecific predation behavior, influencing the population distribution within a community, and the survival adaptation of individual strains in the trophic environment, maintaining their own population stability. This multi-dimensional regulatory model is crucial for a deeper understanding of... S. maltophilia Niche adaptation mechanisms in complex micro-ecosystems, and lprK The expansion of the system's functionality provides crucial evidence.
[0102] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A substance that inhibits, reduces, or downregulates the content or activity of LprK protein, or a substance that inhibits, reduces, or downregulates the expression of the LprK protein-encoding gene, in any of the following applications: A1) Enhances the predatory ability of Stenotrophomonas maltophilia; A2) Prepare products that enhance the predatory ability of Stenotrophomonas maltophilia; The LprK protein is any one of the following: The protein shown in B1 includes the amino acid residues shown in sequence 2; The protein shown in B2) has more than 80% amino acid sequence identity with the protein shown in B1) and has the same function; The protein shown in B3) includes the protein shown in B1) or B2) by attaching a tag to its N-terminus and / or C-terminus to obtain the protein with the sequence shown.
2. The application according to claim 1, characterized in that: The substance is a reagent that knocks out the LprK protein-encoding gene in the genome of Stenotrophomonas maltophilia or a reagent that dephosphorylates the LprK protein-encoding gene in the genome of Stenotrophomonas maltophilia.
3. The application according to claim 2, characterized in that: The reagent used to knock out the LprK protein-encoding gene in the genome of Stenotrophomonas maltophilia is any one of the following: C1) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of the LprK protein-encoding gene in claim 1. C2) expresses the gene encoding the nucleic acid molecule described in C1). C3) contains the expression cassette of the gene described in C2). C4) A recombinant vector containing the gene described in C2), or a recombinant vector containing the expression cassette described in C3). C5) A recombinant microorganism containing the gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4).
4. The application according to claim 2, characterized in that: The reagent used to dephosphorylate the LprK protein encoding gene in the Stenotrophomonas maltophilia genome is a reagent that causes a mutation at position 230 (H) of the LprK protein amino acid sequence.
5. The application according to any one of claims 1-4, characterized in that: The improvement of Stenotrophomonas maltophilia's predation ability refers to enhancing Stenotrophomonas maltophilia's predation ability against Xanthomonas.
6. The substance that inhibits, reduces, or downregulates the content or activity of LprK protein as described in any one of claims 1-5, or the substance that inhibits, reduces, or downregulates the expression of the LprK protein encoding gene.
7. A method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: inhibiting or reducing or downregulating the content or activity of the LprK protein as described in claim 1 in Stenotrophomonas maltophilia, or inhibiting or reducing or downregulating the expression of the LprK protein encoding gene as described in claim 1 in Stenotrophomonas maltophilia, thereby improving the predatory ability of Stenotrophomonas maltophilia.
8. A method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: knocking out the full length or part of the LprK protein encoding gene of Stenotrophomonas maltophilia as described in claim 1 to inhibit, reduce or downregulate the expression of the LprK protein encoding gene of Stenotrophomonas maltophilia as described in claim 1, thereby improving the predatory ability of Stenotrophomonas maltophilia.
9. A method for improving the predatory ability of Stenotrophomonas maltophilia, comprising the following steps: dephosphorylating the LprK protein encoding gene as described in claim 1 in the Stenotrophomonas maltophilia genome to improve the predatory ability of Stenotrophomonas maltophilia.