Application of soybean AP2 / ERF transcription factor ENS1 in improving nodule nitrogen fixation capacity under high temperature stress
By overexpressing the AP2/ERF transcription factor ENS1 protein in soybean root nodules, the problem of low nitrogen fixation efficiency in soybean root nodules under high temperature was solved, thus improving the nitrogen fixation capacity of root nodules and the heat resistance of plants under high temperature conditions.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CROP RES INST OF JIANGXI ACAD OF AGRI SCI
- Filing Date
- 2026-04-14
- Publication Date
- 2026-06-16
AI Technical Summary
Under high temperature conditions, the nitrogen fixation efficiency of soybean root nodules decreases, and existing technologies have failed to effectively regulate nitrogen fixation function, resulting in inhibited plant growth and reduced nitrogen fixation capacity.
By overexpressing the AP2/ERF transcription factor ENS1 protein in soybean, the development of root nodules and nitrogen fixation efficiency can be regulated. Specifically, this includes overexpressing the gene encoding soybean ENS1 protein in soybean root nodules to improve nitrogen fixation efficiency and promote root nodule development under high temperature.
It enhanced the nitrogen fixation capacity of soybeans under high temperature conditions, promoted root nodule development, improved root nodule nitrogen fixation efficiency, and enhanced the plant's heat resistance and nitrogen fixation capacity.
Smart Images

Figure CN122214404A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, and more specifically to the application of soybean AP2 / ERF transcription factor ENS1 in improving the nitrogen fixation capacity of root nodules under high temperature stress. Background Technology
[0002] Soybeans Glycine max (L.) Merr) is an important dual-purpose crop for grain, oil, and feed, playing a vital role in my country's food structure and national production. Through long-term evolution, soybean has developed a root nodule symbiotic nitrogen fixation mechanism, which can effectively alleviate nitrogen deficiency and is an important biological basis for promoting green and low-nitrogen agriculture.
[0003] In recent years, global warming and frequent extreme heat events have led to a 3.1% reduction in soybean yield for every 1°C increase in global average temperature. High temperatures not only inhibit plant growth and development but also directly interfere with the symbiotic signaling exchange between the host and rhizobia, reducing nodulation and nitrogen fixation efficiency. Therefore, there is an urgent need for soybean varieties with high nitrogen fixation efficiency under high-temperature conditions. Discovering genes that are highly efficient at nitrogen fixation under high-temperature stress and elucidating their functional mechanisms are key to promoting the breeding of new soybean varieties with high nitrogen fixation efficiency under high-temperature stress. However, research on the regulation of nitrogen fixation function under high-temperature stress has not yet been reported.
[0004] Therefore, discovering genes that are highly efficient at nitrogen fixation under high temperature stress is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0005] In view of this, the present invention provides the application of soybean AP2 / ERF transcription factor ENS1 in improving the nitrogen fixation capacity of root nodules under high temperature stress.
[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:
[0007] Application of soybean AP2 / ERF transcription factor ENS1 in improving nitrogen fixation capacity of root nodules under high temperature stress, the CDS sequence of the gene encoding the transcription factor ENS1 is shown in SEQ ID NO.2.
[0008] Application of ENS1 protein in improving nitrogen fixation capacity of root nodules under high temperature stress, wherein the amino acid sequence of the ENS1 protein is shown in SEQ ID NO.1.
[0009] Application of the above-mentioned transcription factor ENS1 or the above-mentioned ENS1 protein-related biomaterials in improving the nitrogen fixation capacity of root nodules under high temperature stress, wherein the biomaterials are any one of the following: A: Nucleic acid molecules with nucleotide sequences as described above or nucleic acid molecules encoding the proteins described above; B: An expression cassette containing the nucleic acid molecule described in A; C: An expression vector containing the nucleic acid molecule described in A, or a recombinant vector containing the expression cassette described in B; D: Recombinant microorganisms containing the nucleic acid molecules described in A, or recombinant microorganisms containing the expression cassette described in B, or recombinant microorganisms containing the recombinant vector described in C.
[0010] Furthermore, it is used to increase nitrogenase activity in root nodules and increase the number of infected cells within the nodules.
[0011] Furthermore, the high-temperature stress is a treatment at 40±1.4℃.
[0012] Furthermore, the root nodule is a soybean root nodule.
[0013] A method for cultivating transgenic plants with improved nitrogen fixation efficiency under high temperature stress involves transferring the AP2 / ERF transcription factor ENS1 into plant tissues or plant cells.
[0014] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: This invention provides the application of soybean ENS1 protein in regulating root nodule development and / or improving root nodule nitrogen fixation efficiency. The regulation of root nodule development includes promoting root nodule development under high-temperature stress. The amino acid sequence of the ENS1 protein is shown in SEQ ID NO. 1. This invention, by overexpressing the gene encoding soybean ENS1 protein in soybean root nodules, has determined that soybean ENS1 protein can regulate plant root nodule development and / or root nodule nitrogen fixation efficiency under high temperature, specifically including improving root nodule nitrogen fixation efficiency and promoting root nodule development under high temperature. This demonstrates that soybean… ENS1 The gene is a positive regulator of root nodule development and nitrogen fixation efficiency under high temperature. Therefore, the gene can be overexpressed through transgenic means to improve the nitrogen fixation capacity of plants under high temperature. This has important application prospects for the study of nitrogen fixation mechanism of leguminous crops under high temperature and for the breeding of high-temperature resistant and efficient soybean varieties in agricultural production. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0016] Picture 1 This is a schematic diagram of the amino acid sequence and conserved domains of the ENS1 protein in Example 1 of the present invention.
[0017] Picture 2 In Embodiment 2 of the present invention ENS1A diagram showing the growth status of transgenic plants overexpressing the gene.
[0018] Picture 3 In Embodiment 4 of the present invention ENS1 Morphology and sections of overexpressing root nodules.
[0019] Picture 4 In Embodiment 4 of the present invention ENS1 Overexpression of the morphology of cells invading the root nodules.
[0020] Picture 5 In Embodiment 4 of the present invention ENS1 Statistical analysis of the number of infected cells in root nodules overexpressing the gene at different temperatures. Detailed Implementation
[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0022] Example 1 ENS1 (Glyma.10G186800) protein sequence comparison The protein sequence of ENS1 (Glyma.10G186800) was obtained from the soybean database Phytozome (https: / / phytozome.jgi.doe.gov / ). Conserved domains were aligned using the NCBI Conserved Domain Database (CDD) (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi), and the results are as follows: Picture 1 As shown, the ENS1 protein contains only one conserved AP2 domain. Based on the key residue characteristics of alanine (A) at position 14 and aspartic acid (D) at position 19 within this domain, the ENS1 protein is determined to belong to the ERF subfamily of the AP2 / ERF transcription factor family.
[0023] The amino acid sequence of the ENS1 protein is shown in SEQ ID NO.1, specifically: MDSPSSFFNSPSSGFCSESSSPEAFSWEGYLPFNENDPEEMLLYGMIAGATTEEHSGERASSEESAAARKEKSYRGVRRRPWGKFAAEIRDSTRHGMRVWLGTFDSAEAAALAYDQAAFSMRGSAAILNFPAEIVRESLKEMNYAHDDSNNEEGCSPVVALKRKHSLRRKINVRKKKNNNNNSKLQSSTVDNAVVFEDLGPDYLEQLLMSSDHHIPTTF, SEQ ID NO.1.
[0024] The CDS sequence encoding the ENS1 protein is shown in SEQ ID NO.2, specifically: ATGGATTCACCTTCCTCCTTCTTCAACTCACCCTCTTCCGGTTTCTGCTCCGAATCTTCCTCTCCGGAAGCCTTCTCGTGGGAAGGGTACCTACCCTTCAACGAGAACGACCCGGAGGAGATGCTTCTATACGGCATGATCGCCGGCGCGACAACCGAGGAGCACTCCGGCGAGAGGGCGAGCTCGGAGGAGAGTGCTGCAGCACGGAAGGAGAAGTCGTACCGCGGCGTACGGCGGCGGCCGTGGGGGAAGTTCGCGGCGGAGATAAGGGACTCCACGCGCCACGGGATGAGGGTGTGGCTGGGGACATTCGACAGCGCCGAAGCCGCGGCTCTGGCTTACGACCAAGCCGCGTTCTCCATGCGCGGCTCGGCGGCGATTCTCAACTTCCCCGCGGAGATCGTTAGAGAGTCGCTTAAAGAGATGAACTACGCTCATGATGATTCCAACAACGAAGAAGGGTGCTCCCCTGTTGTCGCTCTCAAGAGGAAACACTCTTTGAGAAGGAAAATTAACGTCAGGAAGAAGAAGAACAACAATAACAATAGCAAACTACAAAGTAGTACCGTAGACAATGCTGTCGTGTTTGAAGACCTTGGTCCTGATTACTTGGAACAGCTGTTGATGTCCTCTGATCATCATATTCCCACCACCTTCTGA, SEQ ID NO.2.
[0025] Example 2 ENS1 Overexpression affects the phenotype of plants under different temperature conditions 1. Carrier Construction according to ENS1 Primers were designed using soybean cDNA (Glyma.10G186800) as a template, and primers were used to design primers. ENS1 - Xba I(Gibson)-F and ENS1 - Bam HI(Gibson)-R was used for PCR amplification to obtain ENS1 The fragment, with its nucleotide sequence as shown in SEQ ID NO.3: , SEQ ID NO.3.
[0026] The nucleotide sequence of the primer is as follows: ENS1 - Xba I (Gibson)-F (forward primer): GATGTGATTACAGtctagaATGGATTCACCTTCCTCCTTC, SEQ ID NO.4; ENS1 - Bam HI (Gibson)-R (reverse primer): tatagtcggtaccGGATCCGAAGGTGGTGGGAATATGATG, SEQ ID NO. 5.
[0027] The PCR amplification system consisted of (20 μL): 10 μL of 2×Phanta Max Buffer, 0.5 μL of dNTPs (each dNTP concentration was 10 mM), 0.5 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase (Vazyme), 1 μL of template cDNA, and 7 μL of ddH2O.
[0028] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 40 s, 33 cycles; 72℃ reaction for 5 min; 18℃ for 5 s.
[0029] use Pme I. The pZY101 vector (Addgeneplasmid #73932) was digested with a restriction endonuclease (Thermo, FD1334), and the... MtLb 2 pro The fragment was ligated via a Gibson reaction to obtain the recombinant vector pZY101-MtLb2pro, which was then used... Bam HⅠ (Thermo, FD0054) and Asc Ⅰ (Thermo, ER1892) will 3XFLAG The fragment was ligated to obtain the pZY101-MtLb2pro-C'3xFLAG vector.
[0030] 3XFLAG The fragment sequence is shown in SEQ ID NO.6: gactataaggaccacgacggagactacaaggatcatgatattgattacaaagacgatgacgataagtag, SEQ ID NO. 6.
[0031] MtLb 2 pro The fragment sequence is shown in SEQ ID NO.7:
[0032] pZY101-MtLb2pro-C'3xFLAG carrier Xba Ⅰ (Thermo, FD0684) and Bam Double digestion with HI (Thermo, FD0054), followed by Gibson reaction with... ENS1 The recombinant vector is obtained by connecting the two.
[0033] The double digestion system is 50 μL: 2 μg vector, Xba Ⅰ 1.5 μL, Bam 1.5 μL of HI, 5 μL of 10× buffer, and the remainder ddH2O.
[0034] The Gibson reaction kit was purchased from ABclonal, catalog number RK21020.
[0035] The Gibson reaction system consisted of 6 μL of 2×MultiF Seamless Assembly Mix 3 μL, gene fragment 100 ng, vector 300 ng, and the remainder ddH2O.
[0036] The Gibson reaction conditions were: 50℃ for 1 h.
[0037] After obtaining the recombinant vector, it was introduced into Agrobacterium tumefaciens (Gastrointestinal rust) of soybean. A. tumefaciens In EHA105, we obtained a solution containing... ENS1 Agrobacterium soybean EHA105.
[0038] 2. Stable conversion of soybeans The germination (GM) medium formula is: 3.1 g B5 Basal Salt, 20 g sucrose, adjusted to 1 L with ddH2O. For solid medium, add 7.2 g / L agar and sterilize at 121℃ for 20 min.
[0039] The co-culture (CCM) medium formula is as follows: 2.215 g MS Basal Salt (1 / 2), 30 g sucrose, 3.9 g MES, ddH2O adjusted to 1 L, pH adjusted to 5.4 with KOH, 8 g / L agar added to solid medium, and sterilized at 121℃ for 20 min.
[0040] The bud induction (SI) medium formula is as follows: 3.1 g B5 Basal Salt, 30 g sucrose, 0.98 g MES, ddH2O adjusted to 1 L, pH adjusted to 5.7 with KOH, solid medium with 7.2 g / L agar, sterilized at 121℃ for 20 min.
[0041] The bud elongation (SE) medium formula is as follows: 4 g MS Basal Salt, 30 g sucrose, and 0.6 g MES are added to 1 L of medium. The medium is adjusted to pH 5.6 with KOH. 7.2 g / L agar is added to the solid medium. The medium is then sterilized at 121℃ for 20 min.
[0042] The rooting (RM) medium formula is: 2.215 g MS Basal Salt (1 / 2), 20 g sucrose, 0.6 g MES, and ddH2O adjusted to 1 L.
[0043] The formulation of FM (Fahraeus medium) liquid medium for resuspending rhizobia is as follows: 0.5 mM (final concentration) MgSO4·H2O, 0.7 mM (final concentration) KH2PO4, 0.8 mM (final concentration) Na2HPO4·2H2O, 50 μM (final concentration) Fe-EDTA (prepared with FeSO4 and disodium EDTA), 0.1 μg MnSO4, 0.1 μg CuSO4, 0.1 μg ZnSO4, 0.1 μg H3BO3, 0.1 μg Na2MoO4, adjust to 1 L with ddH2O, adjust pH to 6.5, sterilize, and store at room temperature for 6 months. For solid medium, add 1% (w / v) agar.
[0044] The formulation of HM liquid medium for culturing slow-growing rhizobia in soybean is as follows: 0.125 g Na2HPO4, 0.25 g Na2SO4, 0.32 g NH4Cl, 0.18 g MgSO4·7H2O, 0.25 g yeast extract, 1 g D-arabinose, 1 g sodium gluconate, 0.004 g FeCl3, 0.001 g CaCl2, 1.30 g HEPES and 1.10 g MES. Adjust the volume to 1 L with ddH2O and adjust the pH to 6.6 with NaOH.
[0045] HM solid medium: Add 1.5% (w / v) agar to the aforementioned HM liquid medium.
[0046] The LB medium formula is: 10 g peptone, 5 g yeast extract, 10 g NaCl, ddH2O adjusted to 1 L, pH adjusted to 7.2 with NaOH, and 1.5% (w / v) agar added to the solid medium.
[0047] 1) Soybean Seed Sterilization and Germination: Seed sterilization was performed using sodium hypochlorite in a fume hood. Seeds were placed in petri dishes, and a conical flask containing 90-100 mL of sodium hypochlorite was placed in a desiccator. 6 mL of concentrated hydrochloric acid was poured along the flask wall, and the desiccator was sealed. Sterilization with chlorine gas was carried out for 16-20 hours. After sterilization, the seeds were placed in a clean bench to release residual chlorine. 20-25 sterilized seeds were inoculated onto germination (GM) medium with the hilum facing down. The petri dish was covered and sealed with sealing film. The seeds were then incubated in the dark at 25°C for approximately 15 hours.
[0048] 2) Preparation of bacterial culture: Prepare the bacterial culture (containing...) stored at -80℃. ENS1 Agrobacterium soybean strain EHA105 was streaked onto LB agar containing the appropriate antibiotics (Kanamycin + Rifampicin, 50 μg / mL + 25 μg / mL) for activation. After incubation at 28°C for approximately 2 days, the activated Agrobacterium was plated onto fresh LB agar and incubated overnight (12 h). The culture was then resuspended in co-culture medium (CCM) at an OD500 concentration. 600 =0.6. After completion, place the CCM bacterial suspension on ice for about 1 hour before transformation to improve the transformation efficiency of Agrobacterium.
[0049] 3) Infection and Culture: Place 30 mL of the above-mentioned bacterial suspension in an Erlenmeyer flask as the infection solution. Take uncontaminated, well-grown seeds, carefully remove the seed coat with tweezers, and cut off the radicle and most of the hypocotyl, leaving the hypocotyl as short as possible. Carefully separate the cotyledons of the soybean seeds, discarding the part of the cotyledon not connected to the hypocotyl. Carefully remove the first pair of true leaves from the remaining cotyledons, make 3-5 cuts at the tip of the plumule (the triangular area where the true leaf and hypocotyl connect), and then remove the lower half of the cotyledons. Place the cotyledons connected to the hypocotyl in the infection solution and soak for at least 3 hours. After infection, pour off the infection solution, transfer the explants to sterile filter paper to absorb and dry the bacterial solution on the surface of the explants. After completion, place the explants flat on a co-culture medium with sterile filter paper on the surface, with the explant buds facing upwards, seal the culture dish, and place it in an incubator for co-culture at 24°C in the dark for 3-5 days.
[0050] 4) Bud Induction: Remove explants from CCM medium, removing any excessively long hypocotyls, leaving 3-5 mm. Insert the explants at a 45° angle onto bud induction medium (SI), bud point facing upwards and downwards. Place 10-12 explants per dish. Culture at 24°C under a light / dark ratio of 18 / 6 for one week. After seven days, remove the explants, removing any excessively large hypocotyls, plumules, and cotyledons. Then, insert them into bud induction medium (SI) containing glufosinate (10 mg / mL) in the same manner, ensuring the bud point is completely submerged. Culture 7-8 explants per dish. Culture at 24°C under a light / dark ratio of 18 / 6 for three weeks. When pouring the plates, ensure the medium depth is approximately 2 / 3 full to facilitate explant insertion.
[0051] 5) Bud elongation: Select well-differentiated explants, remove dead and large buds, cut off the cotyledons, and perform a cross-section on the ground surface of the explant to expose fresh tissue. Transfer the explants to bud elongation medium (SE), maintain a light / dark ratio of 18 / 6 at 24°C, and subculture every two weeks. In this step, after the first subculture, the explants need to be transferred from the culture dish to a glass bottle for further culture. As the explants continue to grow, they may need to be transferred to 250 mL Erlenmeyer flasks.
[0052] 6) Rooting culture: When the regenerated buds reach 5-8 cm during the bud elongation period, rooting treatment can be carried out; cut off the elongated buds and transfer them to rooting medium (RM) to induce rooting, and culture at 24℃ for 18 h light / 6 h dark until sufficient roots are regenerated (1-2 weeks); transplant them into small flower pots containing soil:vermiculite = 1:2, and when they grow well, transplant them into larger flower pots; if IBA is not added to the rooting medium, soak the stems in IBA 1 mg / mL for 1 min before rooting.
[0053] 7) Identification of positive transgenic plants: Plants with significantly upregulated target gene expression levels were screened using PCR and quantitative real-time PCR. Two positive plants produced from different explants were selected and labeled as follows: ENS1 -OE#1 and ENS1 -OE#2. (This will...) ENS1 -OE#1 and ENS1 -OE#2 lines were self-crossed to the T2 generation to obtain genetically stable homozygous overexpression lines. Two lines... ENS1 -OE#1 and ENS1 -OE#2 ENS1 Gene expression levels increased by 2.67-fold and 2.31-fold, respectively, and can be used for subsequent nitrogen fixation phenotypic analysis at high temperatures.
[0054] 8) Rhizobium inoculation: Rhizobium ( Bradyrhizobium JaponicumAfter USDA110 was activated on HM solid plates, rhizobia were picked and placed in HM liquid medium, and cultured at 28°C with shaking for 3 days. The cells were then collected by centrifugation at 7000 r / min for 5 min, resuspended in FM medium, and the concentration adjusted to OD. 600 ≈0.02, inoculated at the root of soybean seedlings.
[0055] Two weeks later, the patient was treated with high temperature for 5 days (temperature treatment conditions: 40.0 ± 1.4 ℃), while the control group did not express the gene. ENS1 Wild-type Wm82 plants were included, along with a control group treated at room temperature (25.0 ± 2.0 ℃). Phenotypic observations were performed, and the results are as follows: Picture 2 As shown.
[0056] Depend on Picture 2 It can be seen that after high-temperature treatment, the leaves of the wild-type Wm82 plants showed obvious yellowing, the plant growth was significantly weakened, and the plant size was stunted, indicating a prominent phenotype of high-temperature damage. Overexpression ENS1 The plants also exhibited some degree of yellowing and growth inhibition, but the damage was significantly less than that of the wild type. The leaves were greener, the plants were relatively robust, and their overall heat tolerance was significantly stronger than that of the wild type. This indicates that the gene enhances the soybean's tolerance to high-temperature stress.
[0057] Example 3 ENS1 Effect of overexpression on nitrogenase activity The stable transformed plants obtained in Example 2 were inoculated with soybean rhizobium USDA110 for two weeks and then subjected to high-temperature treatment for 5 days (high-temperature treatment conditions: 40.0 ± 1.4 ℃). The control group consisted of plants without overexpression. ENS1 Plants were tested, and a control group was set up under normal temperature (25.0±2.0 ℃).
[0058] 1. Assay of nitrogenase activity in soybean root nodules The underground parts of soybeans were placed in a 40 mL glass bottle. 3.4 mL of air was first extracted from the bottle using a syringe, followed by the injection of 3 mL of acetylene gas. The bottle was then placed in a plastic container filled with water and reacted at 28°C for 2 hours. The mixture was then removed and analyzed using a gas chromatograph.
[0059] 2. Preparation of Ethylene Standard Curve A certain volume of ethylene standard gas was injected into a glass vial using a microsyringe. Three replicates were set for each concentration. The ethylene peak was detected using a gas chromatograph, and a standard curve of ethylene volume versus ethylene peak area was plotted as y = 2107.2x - 19.167.
[0060] 3. Calculation of nitrogenase activity Nodule nitrogenase activity, also known as acetylene reduction activity (ARA), can be expressed as the number of moles of acetylene reduced per unit weight of nodule per unit time. The calculation formula is as follows: Acetylene reduction activity = number of moles of ethylene / (fresh root nodule weight × reaction time) (the unit of enzyme activity is: μmol / g / h).
[0061] Based on the relationship between the number of moles of a gas and its volume, temperature, and pressure, the number of moles can be determined from the volume of ethylene: C2H4 (μmol) = C2H4 volume (μL) × 1 / 2 2.4 × 273 / (273 + t℃) × P / 760, where: t℃: reaction temperature (air temperature in Celsius, 28 degrees Celsius); P: gas pressure, usually taken as 760 mmHg; 22.4: the volume of 1 mol of gas under standard conditions is 22.4 L; 273: absolute temperature.
[0062] The fresh weight of root nodules of each plant was measured, and the nitrogenase activity of each treatment was calculated. The results are shown in Table 1.
[0063] Table 1. Control plants and ENS1 Results of nitrogenase activity assay in overexpressing plants
[0064] As shown in Table 1, compared with the control at room temperature, ENS1 Overexpression of root nodule nitrogenase reduces activity, while at high temperatures ENS1 The nitrogen fixation efficiency of overexpressing plants was significantly higher than that of the control, indicating that... ENS1 Gene function depends on environmental temperature, meaning that functional conversion occurs at high temperatures.
[0065] Example 4 Preparation of soybean root nodule resin sections and toluene blue staining The stable transformed plants obtained in Example 2 were inoculated with soybean rhizobium USDA110 for two weeks and then subjected to high-temperature treatment for 5 days (high-temperature treatment conditions: 40.0 ± 1.4 ℃). The control group consisted of plants without overexpression. ENS1 Plants were tested, and a control group was set up under normal temperature (25.0±2.0 ℃).
[0066] Sampling: Cut off the root nodule with a scalpel, leaving a little root attached (for aesthetic purposes), and clean the surface of the nodule with a small brush.
[0067] Fixation: Place the root nodules into a 1.5 mL EP tube, add FAA fixative to cover the nodules, vacuum for 30 min, and then place for 1-2 h. Wash the nodules twice with phosphate buffer (PBS, pH 7.2), soaking for 10 min each time. If the soybean nodules are large, a small piece can be cut off from the surface of the nodule with a double-edged blade to facilitate the penetration of fixative and subsequent resin.
[0068] Dehydration: Prepare gradient ethanol solutions of 30%, 50%, 70%, and 100%, soaking for 10-30 minutes at each concentration, and repeat the 100% ethanol soaking three times.
[0069] SolA formulation: 100 mL Technovit 7100, 1 pack Hardener 1, 2.5 mL PEG400.
[0070] Resin replacement: SolA to anhydrous ethanol volume ratio 1:3, 2~3 h; SolA to anhydrous ethanol volume ratio 1:1, 2~3 h; SolA to anhydrous ethanol volume ratio 3:1, 2~3 h; SolA soaking for 1 h, this step can be overnight.
[0071] Embedding: Place the nodules into the mold, each mold can hold 3-5 nodules. The embedding solution is SolA to Hardener 11 in a volume ratio of 15:1, and the preparation process is completed on ice. Each sample tube requires 400 µL of embedding solution. Prepare a sealing film that just covers the size of the mold.
[0072] Slowly add the prepared embedding solution along the mold to prevent the nodules from floating. Seal the mold with sealing film to prevent air bubbles from forming during the solidification process. Place the mold in a fume hood for a few moments to allow it to solidify.
[0073] After solidification, place the mold in a 37°C incubator and wait for the resin to fully cure. Once cured, remove the sealing film, clean any residual resin around the mold, and prepare for demolding.
[0074] Demolding: Place the base on the mold in advance, with the cross-shaped groove facing down. Prepare the glue according to Technovit 3040: Technovit universal liquid = 1.5 mL : 1 mL (volume ratio). Approximately 5 samples can be added per batch.
[0075] Prepare a 1 mL pipette tip in advance, cut off about 5 mm from the tip, and use the pipette tip to add glue through the hole in the base. Add 300 µL to each sample. The whole process is done in a fume hood. Let it stand for 1 hour.
[0076] Sectioning: Turn on the drying machine and the spreading machine, fix the mold, and try to make the vertical surface of the resin sample flush with the blade. First, use the trim mode to adjust the thickness to 20 µm for trimming. When you can cut the nodule, switch the mode to the sect mode to start slicing.
[0077] Scoop out the slices and dry them.
[0078] After staining with toluidine blue solution for 5 minutes, the stain was decolorized with tap water and ethanol, respectively.
[0079] Toluidine blue staining solution formula: 1.155 g citric acid, 1.3275 g sodium citrate (pH=4.5), 0.25 g toluidine blue, and finally diluted to volume with 50 mL ddH2O.
[0080] Microscopic observation and photography were performed, and the number of cells infecting the root nodules was counted.
[0081] Picture 3 for ENS1 Morphology and sections of overexpressing root nodules.
[0082] Depend on Picture 3 It can be seen that at room temperature, the wild type of Wm82 and ENS1 The root nodules of overexpressing plants showed a normal pink color in longitudinal section, and the nitrogen-fixing tissue was developed normally. After high-temperature treatment, the number of root nodules in wild-type plants increased significantly, the cut surface was noticeably whitened, and the structure of the nitrogen-fixing zone was severely damaged; while the overexpressing plants showed... ENS1 The number of root nodules showed little change, and the internal color remained distinctly pink, with relatively intact nodule structure. This indicates that high temperature significantly inhibited root nodule development in wild-type soybean and disrupted nitrogen-fixing tissues, and that overexpression of nitrogen-fixing compounds was also observed. ENS1 It can alleviate the damage of high temperature to root nodules, maintain the structural and functional stability of root nodules, and enhance the high temperature resistance of root nodules.
[0083] Table 2 ENS1 Statistics on the number of root nodule-infected cells in transgenic plants at different temperatures
[0084] From Table 2 and Picture 4 , Picture 5 It can be seen that at room temperature ENS1 Compared with the Wm82 control, there was no significant difference in the number of infected cells in root nodules after overexpression; however, under high temperature stress, ENS1 The number of infected cells in root nodules was significantly increased by overexpression compared to the wild-type control Wm82, confirming that ENS1 underwent a functional transformation under high temperature conditions, which resulted in an increase in the number of infected cells under high temperature stress, thereby enhancing the nitrogen fixation capacity of plants.
[0085] In summary, this invention, through overexpression of the soybean ENS1 protein encoding gene in soybean root nodules, has determined that the soybean ENS1 protein can regulate plant root nodule development and / or root nodule nitrogen fixation efficiency under high-temperature environments, specifically including improving root nodule nitrogen fixation efficiency and promoting root nodule development. This demonstrates that soybean… ENS1 The gene undergoes a functional transformation under high temperatures, exhibiting enhanced nitrogen fixation capacity compared to the control, thus acting as a positive regulator of nodule development and nitrogen fixation efficiency under high temperatures. Therefore, overexpression of this gene through transgenic methods can improve the nitrogen fixation capacity of plants under high-temperature environments, which holds promise for applications in research on nitrogen fixation mechanisms in legumes under stress and in agricultural production.
[0086] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.
[0087] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. The application of soybean AP2 / ERF transcription factor ENS1 in improving nitrogen fixation capacity of root nodules under high temperature stress, characterized in that, The CDS sequence of the gene encoding the transcription factor ENS1 is shown in SEQ ID NO.
2.
2. The application of ENS1 protein in enhancing nitrogen fixation capacity of root nodules under high-temperature stress, characterized in that, The amino acid sequence of the ENS1 protein is shown in SEQ ID NO.
1.
3. The application of biomaterials related to the transcription factor ENS1 as described in claim 1 or the ENS1 protein as described in claim 2 in improving the nitrogen fixation capacity of root nodules under high temperature stress, characterized in that... The biomaterial is any one of the following: A: The nucleotide sequence is the nucleic acid molecule as described in claim 1 or the nucleic acid molecule encoding the protein as described in claim 2; B: An expression cassette containing the nucleic acid molecule described in A; C: An expression vector containing the nucleic acid molecule described in A, or a recombinant vector containing the expression cassette described in B; D: Recombinant microorganisms containing the nucleic acid molecules described in A, or recombinant microorganisms containing the expression cassette described in B, or recombinant microorganisms containing the recombinant vector described in C.
4. The application according to any one of claims 1 to 3, characterized in that, It is used to increase nitrogenase activity in root nodules and increase the number of infected cells in root nodules.
5. The application according to any one of claims 1 to 3, characterized in that, The high-temperature stress was a treatment at 40±1.4℃.
6. The application according to any one of claims 1 to 3, characterized in that, The root nodule is a soybean root nodule.
7. A method for cultivating transgenic plants with improved nitrogen fixation efficiency under high temperature stress, characterized in that, The AP2 / ERF transcription factor ENS1 was transferred into plant tissues or plant cells.