A rapid on-site detection product for flavidobacterium columnare of rainbow trout origin

The RPA-LFD method, utilizing primer pairs and fluorescently labeled probes to detect Flavobacterium columnare from rainbow trout, addresses the need for rapid, convenient, sensitive, and specific detection in rainbow trout farming, improving detection efficiency and safety.

CN122214520APending Publication Date: 2026-06-16XINJIANG AGRI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
XINJIANG AGRI UNIV
Filing Date
2026-05-18
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

Existing technologies make it difficult to detect Flavobacterium columnare quickly, easily, sensitively, specifically, and with low risk of contamination at rainbow trout farming sites, resulting in difficulties in early diagnosis and control, which affects the safety and economic benefits of seedling production.

Method used

The recombinant polymerase isothermal amplification reagent (RPA) combined with lateral flow chromatography strips (LFD) is used with specific primer pairs and fluorescently labeled probes for rapid detection via a portable thermostat or body temperature device.

Benefits of technology

It achieves test results within 20 minutes, with a sensitivity of 1 ng/μL, high specificity, simple operation, low equipment investment, applicability to multiple scenarios, and reduced risk of false positives.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122214520A_ABST
    Figure CN122214520A_ABST
Patent Text Reader

Abstract

The application provides a field rapid detection product of Flavobacterium columnare of rainbow trout source, and belongs to the technical field of pathogenic microorganism detection. The detection product comprises a specific primer pair, a probe, a recombinant enzyme polymerase constant temperature amplification reagent and a lateral flow chromatography test strip. The application screens the specific sequence of the ISR region between 16S-23S rRNA of Flavobacterium columnare of rainbow trout source, establishes a RPA-LFD field rapid detection system, can complete the detection under the condition of 38 DEG C for 20 min, and reads the result within 5 min through the test strip. The method has the advantages of fast detection speed, high sensitivity, strong specificity, simple operation, low equipment requirement and the like, and the minimum detection concentration is 1 ng / µL, and there is no cross reaction with other common bacteria. The detection system is suitable for the rapid screening and early warning of Flavobacterium columnare in the field of rainbow trout culture, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pathogen detection technology, and in particular relates to a rapid on-site detection product for Flavobacterium columnare from rainbow trout. Background Technology

[0002] rainbow trout ( Oncorhynchus mykiss As an important cold-water economic fish, the rainbow trout is characterized by its tender flesh, high nutritional value, and good market acceptance, making it a key species for freshwater aquaculture in my country and many other countries and regions worldwide. With the continuous development of cold-water resources, recirculating aquaculture systems, and intensive seedling breeding technologies, the rainbow trout industry has been expanding, gradually forming a relatively complete industrial chain encompassing seedling production, adult fish rearing, and deep processing. Rainbow trout farming not only meets the growing consumer demand for high-quality aquatic products but also plays a vital role in promoting fishery efficiency, increasing farmers' income, and boosting local economic development in mountainous and cold-water areas. Therefore, the healthy and stable development of rainbow trout seedling production is directly related to the overall production efficiency, economic benefits, and sustainable development capacity of the rainbow trout industry.

[0003] However, in the intensive breeding and farming of rainbow trout, disease problems have always been one of the key factors restricting their healthy development. Among them, Flavobacterium columnare (… Flavobacterium columnare Flavobacterium columnare infection, caused by *Flavobacterium columnare*, is considered a significant bacterial disease in rainbow trout farming due to its rapid spread, wide range of infection, and high pathogenicity. This pathogen is widespread in freshwater environments, especially under conditions of suitable water temperature, high stocking density, and high water quality management pressure, where it easily multiplies rapidly and causes epidemics. *Flavobacterium columnare* can infect multiple developmental stages of rainbow trout, including eggs, embryos, larvae, juveniles, and even adults, often leading to increased white and dead eggs, decreased hatching rates, and symptoms such as whitening and ulceration of the body surface, abnormal swimming, and reduced feeding in larvae and juveniles. In severe cases, it can further damage tissues such as gills, skin, fins, and lips, causing typical lesions such as gill rot, body rot, and fin rot. Because of its strong environmental adaptability and infectious spread, an outbreak at the fry stage often causes large-scale infection and even significant mortality in a short period, resulting in substantial economic losses for aquaculture production. Especially in the fry production stage, the small size and weak resistance of individuals, coupled with the rapid spread of the disease, often lead to death before obvious clinical symptoms are observed, increasing the difficulty of early detection and timely control.

[0004] Currently, the detection of Flavobacterium columnare mainly includes traditional bacterial isolation and culture identification, PCR and its derivative molecular biology methods, and amplification detection technologies such as LAMP. While traditional bacterial culture and identification methods have certain classic diagnostic value, they typically require long culture times, generally 3-5 days or even longer, and are highly dependent on culture conditions, professional operators, and the microbiology laboratory environment. This not only results in low detection efficiency but also makes it difficult to meet the needs of rapid diagnosis and early warning in aquaculture. PCR methods have high sensitivity and specificity, but usually require sophisticated instruments, nucleic acid extraction procedures, and strict experimental conditions, making the detection process relatively cumbersome and hindering its widespread application in grassroots farms or field environments. LAMP technology, while possessing advantages such as isothermal amplification and relatively simple operation, produces a large amount of amplified products, easily leading to product contamination. It also has relatively poor tolerance to impurities in the sample, requires high-level sample pretreatment, and is prone to false positive results due to aerosol diffusion in open systems, thus affecting the accuracy and reliability of the detection results.

[0005] Therefore, given the high risk, rapid spread, and serious harm of Flavobacterium columnare infection during rainbow trout seedling production, developing a rapid, simple, sensitive, specific, and low-contamination-risk detection method at the aquaculture site is of great significance for achieving early screening, rapid diagnosis, and precise control of this pathogen. It will also help reduce disease losses during rainbow trout farming, improve the safety level of seedling production, and enhance the economic benefits of the industry. Summary of the Invention

[0006] The purpose of this invention is to provide a rapid on-site detection product for Flavobacterium columnaris from rainbow trout, which can enable rapid on-site detection of Flavobacterium columnaris from rainbow trout.

[0007] The present invention first provides a primer pair for detecting Flavobacterium columnare from rainbow trout, wherein the target DNA fragment detected by the primer pair has the sequence of SEQ ID NO: 1; CTTACTCTCGCTGTTAATTCAAAAAAAAGAAAAGGCTTAAAATACAGAGTCTCGTAGCTCAGCTGGTTAGAGTACTACACTGATAATGTAGGGGTCGGCAGT (103bp) Furthermore, the sequence information of the primer pair is as follows: RPA-F5: 5′-TAAATTAAAAAAACTTACTCTCGCTGTTAA-3′ (SEQ ID NO: 2), RPA-R5: 5′-GATGACCTCCTGCGTGCAAGGCAGGCGCTC-3′ (SEQ ID NO: 3); Preferably, the downstream primer of the primer pair is modified with biotin at the 5' end.

[0008] The present invention also provides a probe for detecting the amplification products of the above primer pair, wherein the probe... FAM fluorescent labeling was added to the 5' end, and a tetrahydrofuran (THF) was labeled 30 bp from the 5' end. A C3-spacer modification group was labeled to the 3' end; its sequence information is as follows: ZH-P: AGGCTTAAAATACAGAGTCTCGTAGCTCAGTGG TTAGAGTACTAC (SEQ ID NO: 4).

[0009] In another aspect, the present invention also provides the use of the primer pairs and probes for preparing molecular detection products for detecting Flavobacterium; More specifically, the molecular detection product comprises a recombinase polymerase isothermal amplification reagent (RPA) and a lateral flow chromatography strip (LFD); wherein the recombinase polymerase isothermal amplification reagent contains the aforementioned primer pair, and the lateral flow chromatography strip has the aforementioned probe immobilized on it.

[0010] The present invention also provides a method for detecting Flavobacterium for non-disease diagnosis and treatment purposes, which uses the above-mentioned molecular detection product for detection.

[0011] The beneficial effects of this invention are as follows: ① This invention features an extremely short detection time. Compared to traditional PCR, which requires sophisticated instruments and over 2 hours of amplification and electrophoresis, this invention only requires 20 minutes of constant-temperature incubation, followed by 5 minutes of testing with the test strip. ② This invention boasts high sensitivity and specificity, with a minimum detection concentration of 1 ng / μL. Furthermore, it exhibits high specificity. The probe (labeled with FAM and biotin) binds to the colloidal gold lateral chromatography test strip (LFD), further enhancing detection specificity through double antibody labeling and antigen-antibody binding principles. No false positives were observed in specific tests against other common bacteria.

[0012] ③ This invention is simple to operate and easy to promote on a large scale. DNA is extracted using a rapid nucleic acid lysis buffer, and the RPA reaction produces a lyophilized powder. The operation is simple, and the test strip detection is even more convenient. No professional molecular biology background is required; farm technicians with simple training can master it. ④ This invention has low equipment investment: the equipment only requires a portable thermostat, or even a body temperature / warmer (the cost is far lower than PCR instruments and electrophoresis instruments). ⑤ This invention has low requirements for the operating environment and can be flexibly applied to various scenarios. Attached Figure Description

[0013] Figure 1 PCR results of TonB (iron complex outer membrane protein) from Flavobacterium columnare; Figure 2 Electrophoresis results of ISR region-specific primer amplification between 16S and 23S rRNA of Flavobacterium columnare from rainbow trout; Figure 3 : Homology alignment results of the detected sequences; Figure 4 Sensitivity detection was performed using RPA-AGE (A) and RPA-LFD (B) methods. In the figures, RPA-AGE (A): M.DL2000 DNA maker; 1-5: 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, and 10 pg / μL; 6. Negative control; RPA-LFD (B): 1-5: 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, and 10 pg / μL; 6. Negative control. Figure 5 Image of the F1R1-P1 RPA amplification test strip results; Figure 6 Image of the F2R2-P1 RPA amplification test strip results; Figure 7 Image of the results from the F3R3-P1 RPA amplification test strip; Figure 8 Image of F3R1-P1 RPA amplification test strip results; Figure 9 Image of the F3R2-P1 RPA amplification test strip results; Figure 10 Image of the F4R4-P2 RPA amplification test strip results; Figure 11 Image of the results from the F5R5-P2 RPA amplification test strip; Figure 12 Image of F5R5-P2 AGE amplification results; Figure 13 The reaction temperature optimization diagrams were created using RPA-AGE (A) and RPA-LFD (B) methods. In the diagrams: RPA-AGE (A): M.DL 2000 DNA maker; 1-5: 30℃, 33℃, 35℃, 38℃, and 40℃; 6. Negative control; RPA-LFD (B): 1-5: 40℃, 38℃, 35℃, 33℃, and 30℃; 6. Negative control; Figure 14The reaction time optimization diagram was generated using electrophoresis (A) and rapid detection (B). In the diagram: Electrophoresis (A): M.DL2000 DNA maker; 1-5: 10 min, 15 min, 20 min, 25 min and 30 min; 6. Negative control; Rapid detection (B): 1-5: 30 min, 25 min, 20 min, 15 min and 10 min; 6. Negative control; Figure 15 : Results of RPA-LFD detection of Flavobacterium columnar conjugate in adult rainbow trout at a farm in July; Figure 16 : Results of RPA-LFD detection of Flavobacterium columnar conjugate in adult rainbow trout at a farm in September; Figure 17 : Results of rapid on-site detection system for Flavobacterium columnare in juvenile rainbow trout at a farm in July; Figure 18 A technical route for rapid on-site detection of Flavobacterium columnare from rainbow trout. Detailed Implementation

[0014] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0015] Example 1: Primer and probe specificity screening for rapid on-site detection of Flavobacterium columnare from rainbow trout 1.1 Iron-containing outer membrane protein of Flavobacterium columnare from rainbow trout ( TonB Primer design and PCR amplification 1.1.1 Primer Design By detecting the iron complex outer membrane protein (TonB) of *Flavobacterium columnare* derived from rainbow trout, primer pairs were obtained through primer design and optimization. Flavobacterium columnare TonB The gene sequence is: ATGAAAAAAAATAATCCTACTTTAGTTGCTGCTTTAGCATTAGCATTAGCAGCTGGTATCTTGACAACAGCAGCTGGTGGTGGTAGCGGTGGTGGTAGCGGCGGTAGCGGTGGTAGCGGCGGTAGCGGTGGTAGCGGTGGTAGCGGTGGT AGCGGTGGTAGCGGTAGCGGTAGCGGTAGCAAAGACAAAAACGGTAAAGCTGAAGCACAAGTTGATGCAGCTGAAGCTGAAGCAGAAGCTGAAGCTGAAGCTGAAGCAGAAGCTGAAGCTGAAGCAGAAGCTGAAGCTGAAGCAGAAGCT; The specific primers were designed as follows: F:5'-GGAAATGGAGCAAGAGGGACT-3'; R:5'-CCCGCAATGGCTAATCCGTAT-3'.

[0016] 1.1.2 PCR amplification Using columnar Flavobacterium iron complex outer membrane protein ( TonB No single bright band appeared after using primers and multiple PCR reaction systems and reaction times, indicating that the primers were not effective in detection. Figure 1 ).

[0017] 1.2 Flavobacterium columnare 16S-23S rRNA Primer design and PCR amplification of inter-ISR region 1.2.1 Primer Design 16S-23S rRNA The inter-ISR region sequence is as follows: TCGGCTGGATCACCTCCTTTCTAGAGACAAAAAAGAAGCTATTTTTTAATTTAGATACTAAATTAAAAAAACTTACTCTCGCTGTTAATTCAAAAAAAAGAAAAGGCTTAAAATACAGAGTCTCGTAGCT CAGCTGGTTAGAGTACTACACTGATAATGTAGGGGTCGGCAGTTCGAGTCTGCCCGGGACTACTTTTTAAAGCACAAGGAAATTCTAGAAGCGAATTTTGAATTATAAATTTTAAATGATGAATTTGAAAA ATAATTCAAAAAAATAATTCAACATCCAAAATAGAAAAAAGATTGGGGGATTAGCTCAGCTGGCTAGAGCGCCTGCCTTGCACGCAGGAGGTCATCGGTTCGACTCCGATATTCTCCACCAAATTGATTTGAAAATGAATTGATTTGAAAATTTGAAAATGATCATCATTTTCAAATTAACGAATCTTAAAATCTTCAAATTGAGTAAAGTTCATTGACATATTGAGATAAACATACAAACAAGTAGAAAAAACACTTTAA The specific primers were designed as follows: F:5'-CGGCTGGATCACCTCCTTTCTAG-3' R:5'-TAAAGTGTCTTTCTACTTGTTTG-3' 1.2.2 PCR amplification Primers for the ISR region between 16S and 23S rRNA of Flavobacterium columnare were used, along with the PCR reaction system and reaction time shown in Table 1. Detection was performed by 1.5% agarose gel electrophoresis. All four groups showed a single bright band (see Table 1). Figure 2 ).

[0018] Table 1. Flavobacterium columnaris from rainbow trout 16S-23S rRNA Specific primer reaction system and conditions

[0019] according to 16S-23S rRNA Based on the sequencing results of the ISR region amplification products, the following sequences were selected as the primer and probe combination for isothermal amplification of rainbow trout-derived Flavobacterium columnar recombinase polymerase.

[0020] CTTACTCTCGCTGTTAATTCAAAAAAAAGAAAAGGCTTAAAATACAGAGTCTCGTAGCTCAGCTGGTTAGAGTACTACACTGATAATGTAGGGGTCGGCAGT (103bp) The homology alignment results of the detected sequences prove that the fragment has high homology. Figure 3 ).

[0021] To screen primer pairs and probes for detecting the above fragments, five sets of primers (RPA-F1 / R1~RPA-F5 / R5) and two probes (RPA-P1, RPA-P2) were designed (Table 2). Table 2. Primer and probe sequence information for isothermal amplification of recombinase polymerase from *Flavobacterium columnare* derived from rainbow trout. Primer / Probename Primer / probe sequence (5'–3') Base number RPA-F1 TAATTCAACATCCAAAATAGAAAAAAGATTG 31 RPA-R1 TGATATTTTCAAATTTTCAAATCAATTCAT 31 RPA-F2 GGGATTAGCTCAGCTGGCTAGAGCGCCTGC 30 RPA-R2 TTTAAGATTCGTTAATTTGAAAATGATGAT 30 RPA-F3 TAGCTCAGCTGGCTAGAGCGCCTGCCTTGCACG 33 RPA-R3 TCAATATGTCAATGAACTTTACTCAATTTGAAG 33 RPA-P1 [FAM]AGGAGGTCATCGGTTCGACTCCGATATTCT[THF]CACCAAATTGATTTG[c3spacer] 65 RPA-F4 CAAAAAAGAAGCTATTTTTTAATTTAGATA 30 RPA-R4 CCCGGGCAGACTCGAACTGCCGACCCTAC 30 RPA-F5 TAAATTAAAAAAACTTACTCTCGCTGTTAA 28 RPA-R5 GATGACCTCCTGCGTGCAAGGCAGGCGCTC 28 RPA-P2 [FAM]AGGCTTAAAATACAGAGTCTCGTAGCTCAG[THF]TGGTTAGAGTACTAC[c3spacer] 65 RPA-F5: 5′-TAAATTAAAAAAACTTACTCTCGCTGTTAA-3′, RPA-R5: 5′-GATGACCTCCTGCGTGCAAGGCAGGCGCTC-3′; The probe used to detect the amplification products of the above primer pairs, wherein the probe FAM fluorescent labeling was added to the 5' end, and a tetrahydrofuran (THF) was labeled 30 bp from the 5' end. A C3-spacer modification group was labeled to the 3' end; its sequence information is as follows: AGGCTTAAAATACAGAGTCTCGTAGCTCAGTGG TTAGAGTACTAC.

[0022] Example 2: Performance evaluation of a rapid on-site detection system for Flavobacterium columnare derived from rainbow trout RPA reaction conditions were optimized using temperature gradient experiments at 30℃, 33℃, 35℃, 38℃, and 40℃. The optimal primers RPA-F3 / RPA-R3 obtained through screening were used to amplify genomic DNA of Flavobacterium columnare using RPA-AGE, with a reaction time of 15 min. Results showed that the amplified bands were brightest and clearest at 38℃. Further RPA-LFD amplification was performed using the same primer pairs and probes, and after temperature gradient verification, 38℃ was determined to be the optimal reaction temperature for RPA-LFD. Figure 13 , Figure 14 ).

[0023] The effects of different reaction times (10 min, 15 min, 20 min, 25 min, and 30 min) on rapid amplification were investigated at 38℃. Electrophoresis results showed that clear bands were obtained at 10 min and 25 min. Rapid detection indicated that the color development of the detection line gradually increased with increasing reaction time, and obvious results could be observed at 20 min. Therefore, 20 min was selected as the optimal reaction time for subsequent experiments.

[0024] 1. Sensitivity detection DNA from the standard strain of Flavobacterium columnare was serially diluted 10-fold (10... 2 ~10 6 RPA reactions were performed using DNA at various dilutions as templates. The reaction products were amplified under optimized reaction conditions and then detected by test strips (RPA-LFD) and gel electrophoresis (RPA-AGE). The results showed that the brightness decreased sequentially, and the lowest detection concentration was 1 ng / μL. Figure 4 Compared to the RPA-AGE method, the established RPA-LFD method has the highest sensitivity and is faster.

[0025] 2. Specific detection Seven primer-probe combinations were specifically detected using RPA-AGE and RPA-LFD methods. No obvious bands were amplified in any of the five bacteria—Aeromonas hydrophila, Aeromonas vesiculosus, Vibrio cholerae, Aeromonas tempera, and Escherichia coli—resulting in negative results. The F5R5-P2 primer-probe combination did not produce any false positives and showed no cross-reactivity with the other five bacteria (Table 3). Figure 5-12 Therefore, F5R5-P2 was determined as the optimal primer-probe combination for the rapid on-site detection system, and subsequent performance testing and verification were conducted.

[0026] Table 3. Primer and probe specificity screening table for the rapid on-site detection system of Flavobacterium columnare from rainbow trout. Primer-probe combination Aeromonas hydrophila Aeromonas vilvae Aeromonas tempera Vibrio cholerae E. coli Positive control negative control F1R1—P1 + + - + - + - F2R2—P1 + + - - - + - F3R3—P1 + - - - - + - F3R1—P1 + - + + - + - F3R2—P1 + - - - - + - F4R4—P2 + - + - - + - F5R5—P2 - - - - - + - Note: Positive: +, Negative: -.

[0027] Example 3: Rapid on-site sample DNA testing Take 0.1g of fresh gill and organ tissue samples and place them in a sterile centrifuge tube. Add 16ul LD-1 and 4ul LD-2, mix well, and incubate at 38°C for 5min. Aspirate the supernatant and place it in a collection tube (to be tested).

[0028] Table 4. Recombinase Polymerase Isothermal Amplification System

[0029] Add 29.4 μL of A Buffer, 2 μL each of the upstream and downstream primers of the invention core, and 0.6 μL of gene probe to the lyophilized enzyme tube. Add 10.5 μL of ddH2O and 3 μL of DNA sample. Start the reaction with 2.5 μL of B Buffer (magnesium acetate) and incubate at a constant temperature for 20 minutes.

[0030] After the detection method was established, the rapid detection system for Flavobacterium columnare was validated at rainbow trout farming sites in July and September 2025. The results are shown in […]. Figures 15-17 The results showed that a total of 5 positive samples were detected, with a positive rate of 17.9% and a negative rate of 82.1%. The results were completely consistent with those of PCR-electrophoresis and RPA-electrophoresis, and the concordance rate of the three methods was 100%. This indicates that the established rapid on-site detection system for Flavobacterium columnare has good market potential.

[0031] Table 5. Results of Clinical Sample Testing Testing items positive number Positive rate Compliance rate RPA-LFD 5 17.9% 100% RPA-AGE 5 17.9% 100% PCR-AGE 5 17.9% 100% The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, are covered within the scope of protection of the present invention.

Claims

1. A primer pair for detecting *Flavobacterium columnare* from rainbow trout, characterized in that, The primer pair is used to detect the sequence of the target DNA fragment as follows; CTTACTCTCGCTGTTAATTCAAAAAAAAGAAAAGGCTTAAAATACAGAGTCTCGTAGCTCAGCTGGTTAGAGTACTACACTGATAATGTAGGGGTCGGCAGT.

2. The primer pair as described in claim 1, characterized in that, The sequence information of the primer pair is as follows: Upstream primer: 5′-TAAATTAAAAAAACTTACTCTCGCTGTTAA-3′, Downstream primer: 5′-GATGACCTCCTGCGTGCAAGGCAGGCGCTC-3′.

3. The primer pair as described in claim 2, characterized in that, The downstream primer of the primer pair is modified by adding biotin to the 5' end.

4. A probe for detecting the amplification product of the primer pair of claim 1, characterized in that, The probe is labeled with FAM fluorescent label at the 5' end, and with a tetrahydrofuran (THF) 30 bp from the 5' end. A C3-spacer modification group is labeled at the 3' end. Its sequence information is as follows: AGGCTTAAAATACAGAGTCTCGTAGCTCAGTGGTTAGAGTACTAC.

5. The use of the primer pair of claim 1 and the probe of claim 4 in the preparation of molecular detection products for detecting Flavobacterium.

6. A molecular diagnostic product for detecting Flavobacterium, characterized in that, The molecular detection product contains reagent components of recombinant polymerase isothermal amplification reagent RPA, wherein the primer pair used is the primer pair described in claim 1.

7. The molecular detection article as described in claim 6, characterized in that, The molecular detection product also includes a lateral flow chromatography test strip.

8. The molecular detection article as described in claim 7, characterized in that, The probe described in claim 4 is fixed on the lateral flow chromatography test strip.

9. A method for detecting Flavobacterium for non-disease diagnosis and treatment purposes, characterized in that, The method involves using the molecular detection article as described in claim 7 for detection.