Wheat curl mite resistance gene, resistance protein, molecular marker and application thereof
By cloning and verifying the wheat curling mite resistance gene Cmc4 using map-based cloning and gene editing technologies, the cloning and identification challenges in existing technologies have been solved, enabling precise screening of resistant materials and variety improvement, and enhancing breeding efficiency and the accuracy of resistance identification.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANDONG AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-04-29
- Publication Date
- 2026-06-19
AI Technical Summary
Existing technologies make it difficult to accurately clone and verify the function of the wheat curlworm resistance gene Cmc4, limiting its application in molecular design breeding and genetic engineering improvement. Furthermore, existing linkage markers are insufficient for accurately identifying resistant materials.
The Cmc4 gene was cloned from the wheat curling mite resistance material OK05312 using map-based cloning technology, and its biological function was verified using transgenic and gene editing technologies. Molecular markers were designed for rapid identification of the resistance material.
This study enabled precise cloning and biological function verification of the Cmc4 gene, improved the screening efficiency of resistant Curlicter's mite materials and the accuracy of molecular breeding, and promoted the cultivation of resistant varieties and the analysis of resistance mechanisms.
Smart Images

Figure CN122235166A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of plant molecular biology and crop genetics and breeding technology, specifically to a wheat curlworm resistance gene, resistance protein, molecular marker, and their applications. Background Technology
[0002] Wheat curl mite is a major global pest of wheat. Adults are only about 200 micrometers in size, making them difficult to spot with the naked eye. They are widely distributed in major wheat-growing regions worldwide, including South America, North America, Asia, and Oceania. It is estimated that approximately 90 herbaceous plant species can serve as hosts for the wheat curl mite, including various gramineous crops and wild weeds. This pest reproduces parthenogenetically; at 25°C, it takes only 8-10 days for an egg to develop into an adult. Theoretically, a single female mite can produce over 3 million offspring within 60 days, resulting in rapid population expansion. Wheat curl mites primarily inhabit the curled parts of wheat leaves and leaf sheaths, making conventional chemical control methods ineffective. Furthermore, their eggs can be spread through seeds, further increasing the difficulty of control and the potential risk of large-scale outbreaks.
[0003] Wheat curl mites not only directly impact wheat yield by feeding on the sap of young leaves, but more importantly, they are the sole or primary vector for at least four plant viruses, including Wheat streak mosaic virus (WSMV), High Plains wheat mosaic virus (HPWMoV), Brome streak mosaic virus (BrSMV), and Triticum mosaic virus (TriMV). Among these, WSMV is the most widespread and damaging viral disease globally, causing severe yield reductions and even complete crop failure. In recent years, global warming has further accelerated the rapid expansion of wheat curl mite populations, increasing the frequency and severity of virus transmission.
[0004] Due to the biological characteristics of the wheat curl mite, chemical control is ineffective, and planting resistant varieties is considered the most effective and environmentally friendly strategy for controlling this pest. However, the resources of wheat curl mite-resistant genes available for wheat breeding are extremely scarce. To date, only four curl mite colonization genes have been reported internationally, and none of them are derived from common wheat: Cmc1 and Cmc4 Derived from Aegilops serratus, Cmc2 Derived from tall ice grass, Cmc3 It originated from the rye-wheat 1AL-1RS translocation line. Among them, Cmc4The gene exhibits long-term stable resistance to wheat curlworms and is one of the most important resistance genes currently known, possessing significant research and application value. Currently, it is being used to... Cmc4 High-yielding and high-quality wheat varieties such as TAM112, TAM204, and OK05312 have been successfully bred from germplasm materials of the gene, and no obvious linkage burden phenomenon has been found. Although Cmc4 Genes have significant breeding value, but their molecular identity has long been unknown.
[0005] Existing research has used genetic mapping and molecular marker analysis to... Cmc4 The gene was located in a specific region on the short arm of wheat chromosome 6D, and several KASP markers closely linked to the resistance phenotype were developed. However, these markers mainly reflect the linkage between the resistance haplotype and the target region and cannot directly reveal the specific region. Cmc4 The complete functional gene sequence and its coding products. Because common wheat is an allohexaploid, there are numerous homologous and repetitive sequences among the A, B, and D subgenomes, and... Cmc4 The resistance allele originates from an exogenous *Aegilops spp.* fragment. Its sequence structure, copy status, regulatory regions, and candidate gene composition in the common wheat reference genome may differ from those of the resistance donor material, making it difficult to accurately obtain the complete polynucleotide sequence of the target gene relying solely on the reference genome or linkage markers. Furthermore, Cmc4 The localization region may still contain multiple candidate genes, structural variation sites, or regulatory elements. Resistance differences may also originate from various forms of genetic variation, such as coding region mutations, promoter differences, copy number changes, or large-segment insertions and deletions. Furthermore, the small size, rapid reproduction, and concealed feeding habits of *Russula pulcherrima* make resistance identification susceptible to interference from factors such as mite biotype, inoculation density, environmental conditions, and viral transmission. This results in a long functional verification cycle and high reproducibility requirements for candidate genes. Therefore, while existing technologies can utilize linkage markers to assist in screening for... Cmc4 Wheat materials with resistance sites, but it is still difficult to achieve resistance. Cmc4 The precise cloning of the functional gene, the complete analysis of the polynucleotide sequence, and the direct verification of the anti-mite function have limited the further application of this resistance gene in molecular design breeding, genetic engineering improvement, and the analysis of resistance mechanisms. Summary of the Invention
[0006] In view of the above-mentioned prior art, the purpose of this invention is to provide a wheat curling mite resistance gene, resistance protein, molecular marker, and their applications. This invention is the first to achieve [the following is a complete translation of the original text:] Cmc4 The precise cloning of functional genes and the verification of their biological functions through transgenic and gene editing technologies have important application value for the breeding of grass varieties resistant to scabies.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a wheat curling mite resistance gene, wherein the wheat curling mite resistance gene is Cmc4 A gene is a nucleic acid molecule as shown in (i), (ii), (iii), or (iv) below: (i) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.1; (ii) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.2; (iii) Nucleic acid molecules that encode the amino acid sequence shown in SEQ ID NO.3, except for (i) or (ii); (iv) A nucleic acid molecule that has 90% or more identity with the nucleic acid molecule defined in (i) or (ii) and whose encoded protein is functionally equivalent to the protein shown in SEQ ID NO.3.
[0008] This invention utilizes map-based cloning technology to successfully clone the resistance gene from the wheat curlworm resistance material OK05312. Cmc4 They demonstrated the gene's resistance to wheat curlworms using both transgenic and gene-editing technologies, respectively, in both positive and negative directions.
[0009] The nucleic acid molecules in this invention can be either deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). DNA includes complementary DNA (cDNA), genomic DNA, recombinant DNA, artificially synthesized DNA, vector DNA, expression cassette DNA fragments and their functional variants, but is not limited to these types. RNA includes guide RNA (gRNA), messenger RNA (mRNA), RNA precursors, transcript RNA, and other RNA molecules with biological functions or gene regulatory roles.
[0010] The sequence "identity" mentioned in this invention specifically refers to the degree of matching and sequence similarity of the nucleotide bases between the nucleic acid sequence to be tested and the reference natural nucleic acid sequence, wild-type nucleic acid sequence, or target nucleic acid sequence. Sequence identity detection and analysis can be performed using conventional sequence alignment methods in the art, with the mainstream analysis method utilizing the BLAST algorithm for sequence alignment and homology assessment. Besides the BLAST algorithm, other mature sequence alignment software, analysis tools, and computational algorithms in the art, as long as they can accurately characterize the homology and similarity between different nucleic acid sequences, can be used for sequence identity detection in this application.
[0011] In some embodiments of the present invention, the nucleic acid molecule has a sequence identity of not less than 90% with the natural original nucleic acid sequence. Specifically, the sequence identity range may be limited to at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In a preferred embodiment, the nucleic acid molecule maintains a high degree of sequence consistency with the natural homologous nucleic acid sequence while stably retaining the intended biological function, regulatory activity, expression characteristics, or gene editing activity.
[0012] Without departing from the core technical solution and inventive concept of this invention, nucleic acid molecules possessing the above-defined sequence identity also include mutant variant sequences formed by nucleotide substitution, deletion, insertion, or single- or multi-base modification. These variant nucleic acid sequences must meet functional limitations: they must be able to achieve technical functions that are substantially identical to, similar to, or equivalently substitutes for the original target sequence. For example, the modified variant nucleic acid molecules must fully retain core functions such as target recognition, gene expression, transcriptional regulation, protein translation, and gene editing to ensure that practical application effects are not affected.
[0013] In a second aspect, the present invention provides the application of the above-mentioned wheat curling mite resistance gene in the following (1) or (2): (1) Improve plant resistance to mites; (2) Cultivate plant varieties resistant to mites.
[0014] In the above applications, the wheat curling mite resistance gene is overexpressed in plants to improve plant resistance to curling mites or to cultivate plant varieties resistant to curling mites.
[0015] In some preferred embodiments of the present invention, overexpression of the wheat curlworm resistance gene in plants is achieved using the following substance: C1) contains Cmc4 Gene expression cassettes; C2) contains Cmc4 Recombinant vectors of genes, or recombinant vectors containing the expression cassette described in C1); C3) contains Cmc4 Recombinant microorganisms containing genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2); C4) contains Cmc4 Transgenic plant cell lines containing the gene, or transgenic plant cell lines containing the expression cassette described in C1); C5) contains Cmc4 Transgenic plant tissue containing the gene, or transgenic plant tissue containing the expression cassette described in C1).
[0016] In the above applications, the plant is preferably a grass, including but not limited to: wheat, barley, and goatgrass.
[0017] A third aspect of the present invention provides a resistance protein, said resistance protein being any of the proteins shown in (A1)-(A3) below: (A1) A protein with the amino acid sequence shown in SEQ ID NO.3; (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1); (A3) A protein having the same function as the amino acid sequence shown in SEQ ID NO.3, by substitution and / or deletion and / or addition of one or more amino acid residues.
[0018] In the aforementioned proteins, the protein tag refers to a polypeptide or protein sequence fused with the target protein using in vitro DNA recombination technology. This tag is used to improve the expression of the target protein and / or facilitate its detection, tracking, and purification. The tag can be Poly-Arg (typically 6 RRRRR), Poly-His (typically 6 HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), or c-myc (EQKLISEEDL).
[0019] A fourth aspect of the present invention provides the use of the above-mentioned resistance protein in either (1) or (2) below: (1) Improve plant resistance to mites; (2) Prepare drugs for the prevention and treatment of curl mites.
[0020] In the above applications, the resistance of plants to the mites is improved by overexpressing the resistance protein or by applying the resistance protein exogenously.
[0021] In the above applications, the drug for controlling curling mites can use the aforementioned resistance protein as the sole active ingredient; or the resistance protein can be used in combination with other substances for controlling curling mites.
[0022] In a fifth aspect, the present invention provides a molecular marker, the nucleotide sequence of which is shown in SEQ ID NO. 4.
[0023] This invention is based on Cmc4 Molecular markers were designed in the coding region of the gene to distinguish between plant varieties resistant to and susceptible to the leafroller mite. If a plant contains these molecular markers, it is identified as resistant to the leafroller mite; if it does not contain these molecular markers, it is identified as susceptible to the leafroller mite.
[0024] In a sixth aspect, the present invention provides the use of the above-mentioned molecular marker as a target in at least one of the following (1)-(3): (1) Identification of wheat curl mite resistance genes; (2) Identification of plant materials resistant to the curling mite; (3) Cultivate plant varieties resistant to mites.
[0025] In the above applications, primer pairs for detecting the aforementioned molecular markers are used to identify wheat curl mite resistance genes or to identify plant materials resistant to curl mites.
[0026] In some preferred embodiments of the present invention, the nucleotide sequences of the primer pairs for detecting the molecular markers are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0027] The beneficial effects of this invention are: The invention first cloned and obtained Cmc4 The complete nucleotide sequence of the gene allows for a shift from existing technologies that rely solely on phenotypic identification or linkage markers to infer resistance sites, to precise identification and utilization based on functional gene sequences. On one hand, the aforementioned... Cmc4 Gene sequences can be used to clarify the genetic basis of resistance to wheat curlee mite, analyze its encoded proteins, key variation sites, and anti-mite mechanisms, providing direct evidence for elucidating the molecular response of wheat to the feeding, colonization, and reproduction of curlee mite. Furthermore, based on this sequence, specific primers, probes, or molecular markers can be designed to determine whether wheat and its closely related materials carry the functional trait. Cmc4 Rapid and accurate detection of alleles avoids the problems of long cycles and great influence from the environment and mite biotype that exist in the identification of mite inoculation alone, which are solely based on field or artificial mite inoculation. This improves the efficiency of screening materials resistant to tufted mites and molecular-assisted breeding.
[0028] Meanwhile, the Cmc4 Gene sequences can also be used to construct expression vectors, conduct transgenic introduction, gene editing, allele replacement, or aggregation breeding, so that they can be used in conjunction with other disease-resistant, insect-resistant, or stress-resistant genes to obtain new varieties or germplasm with more stable resistance to wheat curling mites and their transmitted viral diseases.
[0029] Therefore, this invention is made by cloning and disclosing. Cmc4 Gene sequences not only provide directly operable functional gene resources for resistance to curly mite traits, but also improve the accuracy of resistance identification, the pre-selection of breeding, and the controllability of resistance improvement, thus having the beneficial effect of promoting molecular design breeding for wheat resistance to insects and diseases and reducing the combined damage caused by curly mites. Attached Figure Description
[0030] Figure 1Phenotypic identification of resistance to wheat curlifex mite in near-isogenic wheat lines; In the figure, A, Cmc4 Plants inoculated with the susceptible near-isogenic line 21 days later exhibited leaf curling, with new leaves being clamped together to form leaf rings, and a huge population of leaf curling mites; B, Cmc4 Plants inoculated with near-isogenic resistant lines 21 days after inoculation showed normal growth, flat leaves, and a small population of curling mites.
[0031] Figure 2 Wheat curl mite resistance gene Cmc4 Transgenic validation results of candidate genes; in the figure, Bobwhite is the transgenic recipient material, which is susceptible to Curvularia fusiformis; Bob-Cmc4- represents the negative control produced through the transgenic process that does not carry the Cmc4 gene, and is susceptible to Curvularia fusiformis. MubiP-Cmc4 + and NP-Cmc4 + respectively represent by Cmc4 Transgenic positive materials transformed by gene gun method from overexpression vector pAHC17-Cmc4 and self-promoter expression vector pCam3301-Cmc4 showed resistance to Curvularia pulmonata.
[0032] Figure 3 Wheat curl mite resistance gene Cmc4 The results of CRISPR-Cas9-mediated gene editing validation are shown in the figure; sgRNAsite1 and sgRNAsite2 represent two gene editing sites, respectively. KO-1 and KO-2 are two independent gene editing lines with different mutation types.
[0033] Figure 4 Phenotypic identification results of KO-1 and KO-2 for two independent gene-edited lines and WT (resistant wheat parent OK05312) for resistance to the curling mite. Detailed Implementation
[0034] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0035] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.
[0036] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein: The susceptible parent SD06165 and the resistant parent OK05312 are described in a journal article (Zhao L., Liu S., Abdelsalam N., Carver BF, Bai G. 2021. Characterization of wheat curl miteresistance gene). Cmc4 In OK05312. Theoretical and Applied Genetics, 134:993–1005. The susceptibility material for the wheat curl mite, Bobwhite, is described in the journal article (Weeks, JT, Anderson, OD, & Blechl, AE 1993. Rapid Production of Multiple Independent Lines of Fertile Transgenic Wheat). Triticumaestivum (Plant Physiology, 102(4):1077–1084.). The above-mentioned wheat material is available to the public from the applicant for use in replicating this experiment.
[0037] Example 1: Cmc4 Map-based cloning of candidate genes Cmc4 The gene originates from *Aegilops ta2397* and has been transferred to the short arm of chromosome 6D in common wheat. Based on previous research, we used a RIL population constructed using Jerry / OK05312 to... Cmc4 Gene localization on molecular markers 370SNP7523 and 370SNP1639 The genetic distance between them was ~3.3 cM (~1.7 Mb), and this gene locus explained 71% of the phenotypic variation, indicating it was a single-gene control locus. Subsequently, we used another RIL population (SD06165 / OK05312) to further investigate... Cmc4 The repositioning was performed, and the results showed that... Cmc4 Gene localization on molecular markers SDOKSNP6314 and SDOKSNP2805 The physical distance between them is ~523kb, and this gene locus can explain 68% of the phenotypic variation.
[0038] Subsequently, using flanking molecular markers, we screened for heterozygotes from two RIL populations (Jerry / OK05312 and SD06165 / OK05312), identifying 12 heterozygous lines. We then performed individual screening on these lines and propagated the heterozygous lines to construct a residual value population (~5000 lines). Furthermore, to ensure sufficient recombinants could be screened, we reconstructed an F2 population of over 10,000 lines using the susceptible parent SD06165 and the resistant parent OK05312.
[0039] For the F2 positioning group Cmc4 Sensitive near-isogenic line materials (NIR-S) and Cmc4 Phenotypic identification of resistance to wheat curlworm was performed on near-isogenic resistance lines (NIR-R). Results are as follows: Figure 1 As shown, the results indicate that: Cmc4 Twenty-one days after inoculation with the susceptible near-isogenic line, the leaves of the plants were curled, new leaves were clamped together to form leaf rings, and the population of leaf-curling mites was enormous; while Cmc4 Plants inoculated with near-isogenic resistant lines 21 days after inoculation showed normal growth, flat leaves, and a small population of curling mites.
[0040] To further densify the marker density of gene mapping regions, we developed a series of KASP markers using gene-capture data. With the help of newly screened key recombinants and the *Aegilops ta1695* reference gene assembled in this experiment, we ultimately... Cmc4 The candidate genes were finely mapped, with a physical region of approximately 364.4 kb containing only five candidate genes. Combined with transcriptome data analysis, one gene encoding the CC-NB-LRR protein was identified (named...). chr6D- 481510.TA1695 The expression of this substance differed significantly among the resistant materials and was identified as... Cmc4 The most likely candidate gene.
[0041] Cloned Cmc4 The full-length CDS sequence of the candidate gene is shown in SEQ ID NO.1; the genome sequence is shown in SEQ ID NO.2; and the amino acid sequence of the encoded resistance protein is shown in SEQ ID NO.3.
[0042] Example 2: Development of molecular markers and detection primers associated with resistance to wheat curlee mite 1. Development of molecular markers associated with resistance to wheat curlee mite: Based on the map-based cloning in Example 1 Cmc4Based on the coding region sequence of the candidate gene, molecular markers related to resistance to wheat curlworm were further designed, and the nucleotide sequence of the molecular markers is shown in SEQ ID NO.4.
[0043] The molecular marker is a PCR marker that exists only in wheat materials resistant to the curling mite and can be used to distinguish between different wheat varieties that are resistant to and susceptible to the curling mite.
[0044] 2. Primer design for detecting molecular markers: Based on the aforementioned molecular markers, primer pairs for detecting these markers were further designed. The specific sequences are as follows: Cmc4_CDS-F:5'-ATGGAGGTGGTGACCGGTGCC-3'; (SEQ ID NO.5) Cmc4-1317bp-R:5'- CCATTGCCATATCAATTTGT-3'. (SEQ ID NO.6) The method for identifying whether wheat materials have resistance to the curling mite using the above molecular markers and detection primers is as follows: (1) Genomic DNA was extracted from the samples using the CTAB method; Wheat leaves, 2-3 cm long, were harvested at the two-leaf stage and placed in 2 mL centrifuge tubes. After being frozen in liquid nitrogen, the leaves were rapidly ground into powder. 650 μL of preheated (65°C) CTAB extraction buffer was added, and the mixture was incubated at 65°C for 45 min. Then, 300 μL of chloroform:isoamyl alcohol (24:1, V:V) was added, and the mixture was slowly mixed and allowed to stand for 15 min, with 2-3 slow mixing cycles. After centrifugation at 12000 rpm for 10 min, 450 μL of the supernatant was extracted. An equal volume of ice-cold isopropanol was added, and the mixture was incubated at 4°C for 30 min or overnight. Subsequently, the mixture was centrifuged at 12000 rpm for 45 min, and the supernatant was discarded, resulting in genomic DNA precipitate. The precipitate was washed twice with 500 μL of 70% ethanol, dried, and dissolved in TE buffer or sterile water. The concentration was then diluted to 20 ng / μL and stored at low temperature for later use.
[0045] (2) PCR amplification; The PCR reaction system used was as follows: 2 μL DNA template, 7.5 μL 2×Taq Master Mix, 1 μL each of primers Cmc4-CDS-F and Cmc4-1317bp-R with a concentration of 10 μmol / L, and water added to make up to 15 μL.
[0046] The PCR reaction conditions used were: 95℃ pre-denaturation for 5 min; 94℃ annealing for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 2 min, 35 cycles; 72℃ extension for 10 min.
[0047] (3) Detection of PCR products using 1% agarose gel electrophoresis: If a target band of 2061 bp can be amplified, the plant can be identified as a positive transgenic plant carrying [the target band]. Cmc4 The gene, manifested as resistance to wheat curlew mites; if the target band cannot be amplified, it indicates that the plant is a transgenic negative plant and does not carry the gene. Cmc4 Genes that manifest as susceptibility to wheat curlworms.
[0048] Example 3: Cmc4 Transgenic validation of candidate genes The image-based cloning obtained in Example 1 Cmc4 The CDS expression cassettes of candidate genes were linked to the Ubi overexpression promoter and its original promoter, respectively, to construct plant expression vectors. Details are as follows: Using primers Cmc4_CDS-BamHI-F and Cmc4_CDS-BamHI-R (Table 1) in Cmc4 Add to the ends of the start and stop codons of the candidate gene BamHI Enzyme cleavage sites and CDS fragment amplification, PCR amplification products are then processed. BamHI Enzyme digestion and T4 ligase were used to ligate the target fragment to the pAHC17 vector. Cmc4 The gene overexpression construct pAHC17-Cmc4, consisting of the full-length coding region, the maize ubiquitin promoter (MubiP), and the maize alkaloid synthase terminator (tNOS), was used. Two pairs of specific primers, namely Cmc4-5UTR-EcoR-F1 / Cmc4-ATG-100bp-R and Cmc4-3UTR-Hind-R3 / Cmc4-TGA-100bp-F (Table 1), were used to express the gene. Cmc4 The 5' and 3' untranslated regions (UTRs) of the gene were amplified and cloned. Cmc4-ATG-100bpR and Cmc4-TGA-100bpF are located at... Cmc4 The candidate gene is located 100 base pairs downstream of the start codon and 100 base pairs upstream of the stop codon. Therefore, the amplified fragment is... Cmc4 The coding regions (CDS) of the candidate genes each overlap by 100 base pairs, and DNA fragment ligation is performed via homologous recombination. Primers Cmc4_5UTR_EcoR-F1 and Cmc4_3UTR_Hind-R3 contain... EcoRI and HindR3 Restriction endonuclease sites and homologous sequences of the target vector pCam3301 (ThermoFisher Scientific). The linearized pCam3301 vector was mixed with three... Cmc4Fragment fusion. The sequence of the overexpression construct pCam3301-Cmc4 was validated by Sanger sequencing and used to generate transgenic plants.
[0049] Cmc4 The overexpression vector pAHC17-Cmc4 and the self-promoter expression vector pCam3301-Cmc4 were transformed into the wheat curl mite susceptible receptor material Bobwhite using the gene gun method to obtain transgenic plants.
[0050] Table 1: Primer sequences Note: The underlined sequence represents a restriction endonuclease site or a linker in the vector construction.
[0051] The molecular markers and detection primers from Example 2 were used to identify the resistance of wheat curlifex mite in transgenic plants. Progeny of homozygous transgenic plants identified as resistant to wheat curlifex mite were screened, and their resistance was then verified by inoculation with wheat curlifex mite. The specific method is as follows: Wheat curl mites were preserved on seedlings of the susceptible wheat variety Jagger, which were grown in a plant incubator. Before inoculation, highly curled infected leaves were examined using a stereomicroscope to determine the mite density per curled leaf. Based on the mite density, infected leaves were cut into segments approximately 0.5 cm long, ensuring at least 30 wheat curl mites per segment. These segments were then inoculated onto the two-leaf stage wheat variety to be tested, at the angle between the emerging new leaf and the adjacent unfolded true leaf. After inoculation, the plants were kept as still as possible to prevent leaf segment loss. Twelve hours after inoculation, the inoculated plants were transferred to a plant incubator at 22 ± 2 °C for further cultivation. Phenotypic identification was performed 12–14 days post-inoculation, with the susceptible wheat variety Jagger serving as a control.
[0052] Plants with normal, flat leaves and normal growth are classified as resistant plants; while plants with curled leaves and new leaves forming leaf rings by the curled leaves are classified as susceptible plants.
[0053] The results showed that the two transgenic plants ( MubiP-Cmc4 + and NP-Cmc4 All showed stable resistance to wheat curl mite (+) Figure 2 ), to prove that Cmc4 Candidate genes are Cmc4 Gene.
[0054] Example 4: Cmc4 Gene editing validation of candidate genes To further verify the resistance of candidate genes to wheat curlworm, we... Cmc4The coding region of the candidate base is designed with two edit sites, namely: sgRNA site1:CTGCCCTTGTCAAGGTGGCGGG; sgRNA site2:CCTATGACATGGAGGATGTTG.
[0055] Subsequently, CRISPR-Cas9-mediated gene editing technology was used in the resistant wheat parent OK05312 to... Cmc4 Candidate genes are used for gene editing, Cmc4 Candidate gene knockout. Gene-edited plants were identified using next-generation sequencing technology. Results are as follows: Figure 3 As shown, two were obtained. Cmc4 Candidate gene knockout lines (Cmc4-KO-1 and Cmc4-KO-2).
[0056] Following the method in Example 3, the phenotypic resistance to wheat curling mites was identified by inoculation with these mites. The results are as follows: Figure 4 As shown, the results indicated that the gene-edited plants lost their resistance to wheat curlworms and exhibited a phenotype similar to that of the susceptible parent, thus further validating the function of the gene.
[0057] Example 5: Validation of the effect of molecular markers associated with resistance to wheat curlee mite 1. Test Methods DNA was extracted from 371 collected wheat samples, and the molecular markers described in Example 2 were used to analyze the DNA. Cmc4 Genotyping. Molecular marker identification method is the same as in Example 2; phenotypic identification method is the same as in Example 3.
[0058] 2. Experimental Results The experimental results are shown in Table 2.
[0059] Table 2: Wheat materials Cmc4 Genotype and phenotypic data of the identification line Note: A "+" genotype indicates a carrier. Cmc4 Gene.
[0060] The results showed that, using marker-assisted selection, 11 out of 371 wheat accessions from the natural wheat population RGON2020 were detected to carry [the marker]. Cmc4The genes are KS19H9, KS19H74, TX18A001109, TX18A001196, TX18A001281, TX18A001282, CO15D098R, CO14A136-135, CO14A055-258, CO13007-F6R, and CO16R302.
[0061] Phenotypic identification results showed that all 11 materials exhibited stable resistance to wheat curlee mite. The phenotypic identification results were consistent with the molecular marker identification results, proving that the molecular markers of this invention are accurate and reliable for identifying the resistance of wheat materials to wheat curlee mite.
[0062] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. A wheat curl mite resistance gene, characterized in that, The wheat curl mite resistance gene is Cmc4 a gene, is a nucleic acid molecule as shown in (i) or (ii) or (iii) or (iv) below: (i) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.1; (ii) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.2; (iii) Nucleic acid molecules that encode the amino acid sequence shown in SEQ ID NO.3, except for (i) or (ii); (iv) A nucleic acid molecule that has 90% or more identity with the nucleic acid molecule defined in (i) or (ii) and whose encoded protein is functionally equivalent to the protein shown in SEQ ID NO.
3.
2. The use of the wheat curling mite resistance gene according to claim 1 in either (1) or (2) below: (1) Improve plant resistance to mites; (2) Cultivate plant varieties resistant to mites.
3. Use according to claim 2, characterized in that, By overexpressing the wheat curling mite resistance gene in plants, the resistance of plants to curling mites can be improved or plant varieties resistant to curling mites can be bred.
4. Use according to claim 3, characterized in that, Overexpression of the wheat curlworm resistance gene in plants is achieved using the following substance: C1) contains Cmc4 expression cassette of a gene; C2) comprises Cmc4 a recombinant vector of a gene, or a recombinant vector comprising the expression cassette of C1). C3) contains Cmc4 Recombinant microorganisms containing genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2); C4) contains Cmc4 Transgenic plant cell lines containing the gene, or transgenic plant cell lines containing the expression cassette described in C1); C5) contains Cmc4 Transgenic plant tissue containing the gene, or transgenic plant tissue containing the expression cassette described in C1).
5. The application according to claim 2, characterized in that, The plant in question is a member of the Poaceae family.
6. A resistance protein, characterized in that, The resistance protein is any one of the proteins shown below (A1)-(A3): (A1) A protein with the amino acid sequence shown in SEQ ID NO.3; (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1); (A3) A protein having the same function as the amino acid sequence shown in SEQ ID NO.3, by substitution and / or deletion and / or addition of one or more amino acid residues.
7. The use of the resistance protein of claim 6 in either (1) or (2): (1) Improve plant resistance to mites; (2) Prepare drugs for the prevention and treatment of curl mites.
8. A molecular marker, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
4.
9. The use of the molecular marker of claim 8 as a target in at least one of (1)-(3) below: (1) Identification of wheat curl mite resistance genes; (2) Identification of plant materials resistant to the curling mite; (3) Cultivate plant varieties resistant to mites.
10. The application according to claim 9, characterized in that, The primer pairs used to detect the molecular markers were used to identify wheat curl mite resistance genes or to identify plant materials resistant to curl mite. The nucleotide sequences of the primer pairs for detecting the molecular markers are shown in SEQ ID NO.5 and SEQ ID NO.6.