Diagnostic KASP marker for detecting anti-curry mite gene Cmc4 of wheat and application of diagnostic KASP marker

Abstract

The invention discloses a diagnostic KASP marker for detecting a wheat anti-curry mite gene Cmc4 and application of the diagnostic KASP marker, and belongs to the technical field of wheat molecular breeding. According to the invention, firstly, an SNP locus is found through exon capture data, and the SNP locus is located in a positioning interval of an anti-curly mite gene Cmc4, is closely associated with the Cmc4 gene, and can be used for diagnostic marker development of the Cmc4. Based on flanking sequence information of the SNP, the invention further develops and designs a diagnostic KASP marker for specifically detecting the anti-curly mite gene Cmc4 of the wheat, and by utilizing the diagnostic KASP marker, the anti-curly mite function of the Cmc4 gene can be efficiently and accurately detected and utilized, so that the application of the gene in wheat resistance breeding is promoted.

Description

Technical Field

[0001] The invention relates to the technical field of wheat molecular breeding, and in particular to a diagnostic KASP marker for detecting a wheat curl mite resistance gene Cmc4 and an application thereof. Background Art

[0002] Wheat curl mite (WCM) is a major global wheat pest that not only seriously affects wheat yield and quality, but also spreads a variety of plant viruses, especially wheat streak mosaic virus. In 1955, Slykhuis first reported wheat curl mite in common wheat. Now wheat curl mite is widely distributed in major wheat-growing areas such as South America, North America, Asia and Oceania. According to statistics, about 90 herbaceous plants can serve as hosts for wheat curl mite, including a variety of grass crops and wild weeds. Wheat curl mite will occupy hidden positions on plants, such as curled leaves, leaf sheaths, new leaves and leaf axils, thereby effectively weakening the effect of chemical agents, making the prevention and control of wheat curl mite difficult.

[0003] Planting wheat varieties resistant to the wheat curl mite-virus complex is considered to be the most effective and environmentally friendly way to control the damage of wheat curl mites. However, resistance resources that can be used in wheat breeding are very scarce. To date, only four genes for resistance to curl mite colonization have been identified and used in wheat breeding, none of which are from common wheat. The Cmc4 gene is a resistance gene transferred from Aegilops tauschii to the end of the short arm of chromosome 6D of wheat (Triticum aestivum). This gene shows long-term and stable resistance to wheat curl mite (WCM). It is currently the most important resistance gene and has very high research and application value. The existence of this gene provides an important genetic resource for breeding wheat varieties resistant to curl mites, which is expected to effectively solve the yield and quality loss problems faced by current wheat production due to curl mites. However, since the Cmc4 gene has not yet been cloned, its gene sequence is still unknown, which has brought great difficulties to the genetic application of this resistance gene and the development of diagnostic markers. At present, no diagnostic molecular markers for this gene have been developed, which seriously restricts the application of this gene in wheat breeding. Summary of the invention

[0004] In view of the above-mentioned prior art, the purpose of the present invention is to provide a diagnostic KASP marker for detecting the wheat curl mite resistance gene Cmc4 and its application. The diagnostic KASP marker of the present invention can efficiently and accurately diagnose and utilize the curl mite resistance function of the Cmc4 gene, thereby promoting the application of the gene in wheat resistance breeding.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] In a first aspect of the present invention, a SNP marker associated with wheat curl mite resistance is provided. The nucleotide sequence of the SNP marker is shown in SEQ ID No. 1. The 26th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, and its base is C or G.

[0007] gaaag acaaattgat atggcagtgg ytagccgaag gtttcgtcaa taaggaaccaggggtaagtt tatatgagac cggagaaaga. (SEQ ID No.1)

[0008] Note: The nucleotides in bold shade in the sequence are SNP sites, and the nucleotide polymorphism is C / G, which is represented by "y" in the sequence table.

[0009] The American wheat variety TAM112 is a winter wheat variety with hard, red grains, carrying the wheat curl mite resistance gene Cmc4, and has good resistance to wheat curl mites ('TAM 112' Wheat, Resistant to Greenbug and Wheat Curl Mite and Adapted to the Dryland Production System in the Southern High Plains; https: / / acsess.onlinelibrary.wiley.com / doi / full / 10.3198 / jpr2014.03.0016crc). The present invention uses the exon capture sequencing data of the curl mite-resistant wheat variety TAM112, and compares it with the wheat Chinese Spring reference genome (IWGSC RefSeq v2.1) to obtain the SNP site information between it and the Chinese Spring variety. Combining the results of fine positioning and association analysis of the gene, a SNP site related to resistance to wheat curl mite gene Cmc4 was found. It is located at base 2,306,478 on the short arm of chromosome 6D of the Chinese spring wheat reference genome, within the annotation gene TraesCS6D03G0012600.1, and has a specific C / G polymorphism with the wheat reference genome. The haplotype of this locus of wheat curl mite resistance gene Cmc4 is C / C, which shows resistance to wheat curl mite; the other haplotypes are G / G, which shows susceptibility to wheat curl mite.

[0010] The second aspect of the present invention provides the use of the above-mentioned SNP marker in any one of the following (1)-(3):

[0011] (1) Develop diagnostic markers for the wheat curl mite resistance gene Cmc4;

[0012] (2) Identify plant germplasm resources for resistance to wheat curl mite;

[0013] (3) Breeding plant varieties resistant to wheat curl mites.

[0014] In the above application, the plant species are grass plants, including but not limited to wheat and Aegilops tauschii.

[0015] The third aspect of the present invention provides a KASP molecular marker primer combination for specifically detecting the wheat curl mite resistance gene Cmc4, including: primers shown in SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4; specifically as follows:

[0016] Cmc4-KASP-FAM:

[0017] 5'-GAAGGTGACCAAGTTCATGCTGACAAATTGATATGGCAGTGGG-3'; (SEQ ID No. 2)

[0018] Cmc4-KASP-HEX:

[0019] 5'-GAAGGTGACCAAGTTCATGCTGACAAATTGATATGGCAGTGGC-3'; (SEQ ID No. 3)

[0020] Cmc4-KASP-R:

[0021] 5'-CCCCTGGTTCCTTATTGACG-3'. (SEQ ID No.4)

[0022] Among the above primers, Cmc4-KASP-FAM and Cmc4-KASP-HEX are upstream typing primers, and Cmc4-KASP-R is a downstream universal primer. Cmc4-KASP-FAM, Cmc4-KASP-HEX and Cmc4-KASP-R are dissolved to 100 μM with TE (pH 8.0) or sterilized ultrapure water, and then mixed at a volume ratio of 2:2:5 for later use.

[0023] Based on the SNP molecular marker associated with wheat curl mite resistance of the present invention, the present invention designs a KASP molecular marker primer combination for specifically detecting the wheat curl mite resistance gene Cmc4, which can perform genotype analysis on the SNP difference at the 26th position of the exon capture sequence. The C / C genotype is a Cmc4 resistance haplotype, which shows a wheat curl mite resistance reaction; the G / G genotype is a Cmc4 sensitive haplotype, which shows a wheat curl mite sensitive reaction; and the C / G genotype is a Cmc4 gene heterozygous type.

[0024] The fourth aspect of the present invention provides the use of the above-mentioned KASP molecular marker primer combination in the following (1) or (2):

[0025] (1) Identify plant germplasm resources for resistance to wheat curl mite;

[0026] (2) Breeding plant varieties resistant to wheat curl mites.

[0027] A fifth aspect of the present invention provides a method for identifying or assisting in identifying wheat resistance to curl mite, comprising the following steps:

[0028] The genotyping of the wheat to be tested based on SNP markers is detected, and the resistance of the wheat to curl mites is determined according to the genotyping: the wheat with haplotype CC is curl mite resistant; the wheat with haplotype GG is curl mite susceptible;

[0029] The nucleotide sequence of the SNP marker is shown in SEQ ID No. 1. The 26th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, and its base is C or G.

[0030] Preferably, the above KASP molecular marker primer combination is used to detect the genotyping of the wheat to be tested based on SNP markers. Specifically as follows:

[0031] The genomic DNA of the wheat to be tested was used as a template and PCR amplification was performed using the KASP molecular marker primer combination. After the amplified product was centrifuged, fluorescence data was collected and genotyping was performed based on the fluorescence data.

[0032] Furthermore, the PCR reaction system was: 2 μL of DNA template, 1.94 μL of 2×KASP Master Mix, and 0.06 μL of a mixture of primers shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4.

[0033] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing and extension at 60-55°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.5°C each cycle; annealing at 94°C for 20 sec, annealing and extension at 55°C for 60 sec, 30 cycles.

[0034] After centrifugation of the PCR products, fluorescence data were collected using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization analysis.

[0035] Beneficial effects of the present invention:

[0036] (1) Exon capture technology can effectively sequence exon regions, greatly reducing sequencing costs, increasing sequencing coverage and accuracy, and providing a large amount of SNP data for gene localization and marker development. The present invention first discovered a SNP marker in an exon capture data. The SNP marker is located in the localization interval of the anti-curl mite gene Cmc4 and is closely associated with the Cmc4 gene, and can be used for the development of diagnostic markers for Cmc4.

[0037] (2) Based on the SNP marker of the present invention, the present invention further developed and designed a diagnostic KASP marker for specifically detecting the wheat curl mite resistance gene Cmc4. The diagnostic KASP marker of the present invention is used to efficiently and accurately detect and utilize the anti-curl mite function of the Cmc4 gene, thereby promoting the application of this gene in wheat resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 : Development of the molecular marker Cmc4-KASP and its sequence information.

[0039] Figure 2 :The phenotypic identification results of wheat curl mite in Cmc4 near-isogenic line materials. The Cmc4 susceptible near-isogenic line does not carry the Cmc4 gene (A), and the Cmc4 resistant near-isogenic line carries the Cmc4 gene (B).

[0040] Figure 3 : Genotyping of the molecular marker Cmc4-KASP in natural populations of Aegilops tauschii collected worldwide. "Cmc4+" indicates homozygous Cmc4 disease-resistant haplotype, and "Cmc4-" indicates homozygous Cmc4 disease-susceptible haplotype. Black dots represent negative water controls without PCR amplification; green dots represent Cmc4 homozygous resistant genotypes (C / C); pink dots represent Cmc4 homozygous susceptible genotypes (G / G); yellow dots represent Cmc4 positive control resistant parent OK05312; blue dots represent Cmc4 negative control susceptible parent SD06165. DETAILED DESCRIPTION

[0041] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0042] As mentioned above, wheat curl mite is a pest that seriously threatens wheat production. It not only directly affects wheat yield but also spreads a variety of plant viruses, which seriously threatens wheat production. The biological characteristics of wheat curl mite result in poor chemical control of it. Therefore, planting wheat varieties resistant to wheat curl mite-virus complex is considered to be the most effective and environmentally friendly way to control the damage of wheat curl mite. However, the resistance resources that can be used for wheat breeding are very scarce. So far, only four genes for anti-curl mite colonization have been identified and used in wheat breeding. Among them, the Cmc4 gene shows long-term and stable resistance to wheat curl mite. It is currently the most important resistance gene and has very high research and application value.

[0043] However, since the Cmc4 gene comes from Aegilops truncatula, a close relative of wheat, and no such resistance gene has been cloned yet, we know very little about the types and mechanisms of wheat curl mite resistance genes, which has brought great difficulties to the development of diagnostic markers for this gene. In the early stage, a recombinant inbred line population (SD06165 / OK05312) was used to finely locate Cmc4, and the results showed that the Cmc4 gene was located between the molecular markers SDOKSNP6314 (2,000,396bp) and SDOKSNP2805 (2,523,431bp), with a physical distance of ~523kb (https: / / link.springer.com / article / 10.1007 / s00122-020-03737-3).

[0044] In view of this, the present invention uses exon capture technology to sequence the exon region of the wheat curl mite resistant variety TAM112. By comparing the SNP differences of its exon capture data with the wheat reference genome and combining the previous positioning results of the Cmc4 gene, it is finally found that the 26th base in an exon capture sequence has a specific polymorphism with the wheat D chromosome group, which can specifically detect the Cmc4 gene ( Figure 1 ), and the number of SNPs near this site is relatively small, which is suitable for the development of KASP markers.

[0045] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0046] The test materials used in the examples of the present invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions are carried out according to conventional test methods or the operating instructions recommended by the supplier.

[0047] Example 1: Development of SNP markers associated with wheat curl mite resistance

[0048] The wheat variety TAM112 carrying the wheat curl mite gene Cmc4 was used as the test material, exon capture was performed on TAM112, and the sequencing results were compared with the wheat Chinese spring reference genome for SNP. The results showed that an exon capture sequencing sequence was located at bases 2,306,419-2,306,503 on the short arm of chromosome 6D of the Chinese spring wheat reference genome, located in the annotation gene TraesCS6D03G0012600.1, with a length of 85 bp, and its nucleotide sequence is shown in SEQ ID No. 1; there is a specific C / G nucleotide polymorphism at 26 bp, and the Cmc4 resistance haplotype is C while its susceptible haplotype is G.

[0049] Combined with the current positioning results of the wheat curl mite gene Cmc4, it was found that the SNP site is located in the positioning interval of the gene Cmc4 and is closely related to wheat curl mite resistance, and can be used for the development of diagnostic markers for Cmc4.

[0050] Example 2: Development of a diagnostic KASP marker for specific detection of the wheat curl mite resistance gene Cmc4

[0051] Based on the SNP markers of Example 1, the present invention further developed and designed diagnostic KASP markers for specifically detecting the wheat curl mite resistance gene Cmc4, specifically:

[0052] Primer3 v4.1.0 online primer design software ( https: / / bioinfo.ut.ee / primer3- 0.4.0 / ) for primer design.

[0053] The KASP marker primer sequence combination is as follows:

[0054] Cmc4-KASP-FAM: The underlined part is the FAM fluorescent tag sequence

[0055] 5'- GAAGGTGACCAAGTTCATGCT GACAAATTGATATGGCAGTGGG-3'; (SEQ ID No. 2)

[0056] Cmc4-KASP-HEX: The underlined part is the HEX fluorescent tag sequence

[0057] 5'- GAAGGTCGGAGTCAACGGATT GACAAATTGATATGGCAGTGGC-3'; (SEQ ID No. 3)

[0058] Cmc4-KASP-R: 5'-CCCCTGGTTCCTTATTGACG-3'. (SEQ ID No.4)

[0059] The primers were dissolved to 100 μM with sterilized ultrapure water, and then mixed in a volume ratio of upstream typing primer Cmc4-KASP-FAM: upstream typing primer Cmc4-KASP-HEX: downstream universal primer Cmc4-KASP-R = 2:2:5, and stored at -20°C for future use.

[0060] Example 3: Genotypic and phenotypic identification of near-isogenic line materials for resistance to wheat curl mite

[0061] 1. Test method:

[0062] A pair of wheat near-isogenic lines with Cmc4 gene were selected, which were the hybrid offspring of wheat varieties SD06165 and OK05312. SD06165 was susceptible to wheat curl mite and did not carry Cmc4 gene, while OK05312 was resistant to wheat curl mite and carried Cmc4 gene.

[0063] (1) Genotype detection:

[0064] DNA was extracted from wheat near-isogenic materials of Cmc4 gene, and genotype analysis was performed using the Cmc4-KASP marker primer combination (SEQ ID No. 2-SEQ ID No. 4) developed in Example 2. The details are as follows:

[0065] 1) Extract sample genomic DNA using the CTAB method;

[0066] The CTAB method is used to extract DNA from wheat samples, and the specific steps are as follows:

[0067] For the above materials, 2-3 cm wheat leaves were cut at the 2-leaf stage and placed in a 2 mL centrifuge tube. The leaves were quickly ground into powder after being frozen with liquid nitrogen, and 650 μL of CTAB extraction buffer preheated to 65°C was added, and the mixture was placed in a water bath at 65°C for 45 min. Then, 300 μL of chloroform: isoamyl alcohol = 24:1 (V:V) was added, and the mixture was slowly mixed and allowed to stand for 15 min. During this period, the mixture was slowly mixed 2-3 times, and 450 μL of supernatant was extracted after centrifugation at 12000 rpm for 10 min. After mixing, an equal volume of ice isopropanol was added and allowed to stand at 4°C for 30 min or overnight. Subsequently, the mixture was centrifuged at 12000 rpm for 45 min, the supernatant was discarded, and genomic DNA was precipitated. After washing twice with 500 μL of 70% ethanol, the precipitate was dissolved in TE solution or sterile water after drying, and the concentration was diluted to 20 ng / μL, and stored at low temperature for later use.

[0068] 2) PCR amplification;

[0069] The PCR reaction system used was: 2 μL DNA template, 1.94 μL 2×KASP Master Mix, and 0.06 μL primer mixture.

[0070] The PCR reaction conditions used were: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing and extension at 60-55°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.5°C each cycle; annealing at 94°C for 20 sec, annealing and extension at 55°C for 60 sec, 30 cycles.

[0071] PCR products can be stored at room temperature but need to be kept away from light.

[0072] 3) Analysis of KASP labeling results.

[0073] After centrifugation of the PCR products, fluorescence data were collected using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization analysis.

[0074] (2) Phenotypic identification:

[0075] Wheat curl mite (TWCMC1) was maintained on seedlings of susceptible wheat variety Jagger, which were grown in a plant incubator. Before inoculation, highly curled infected leaves were examined using a stereomicroscope to determine the mite density per curled leaf. According to the density of wheat curl mites, the infected leaves were cut into 0.5 cm leaf segments, ensuring that there were at least 30 mites on each leaf segment. The prepared leaf segments were inoculated on the two-leaf wheat variety to be tested, and the inoculation site was the angle between the emerging new leaf and the adjacent unfolded true leaf. Try not to move the plants after inoculation to avoid the shedding of the inoculated leaf segments. The inoculated plants were placed in a plant incubator at 22±2℃ for incubation. Phenotypic identification was performed 12-14 days after inoculation. The susceptible wheat variety Jagger was used as a susceptible control.

[0076] 2. Test results:

[0077] The identification results of genotype and phenotype of wheat near-isogenic line materials are as follows Figure 2 As shown, the results showed that the genotype detection results of the molecular marker Cmc4-KASP were consistent with the situation that the wheat material actually carried the Cmc4 gene; the genotype detection results were also consistent with the identification results of the curl mite resistance phenotype.

[0078] Example 4: Detection of Cmc4 gene in natural populations of Aegilops tauschii and identification of wheat curl mite resistance

[0079] 1. Test method:

[0080] The Cmc4-KASP marker primer combination (SEQ ID No. 2-SEQ ID No. 4) developed in Example 2 was used to perform Cmc4 gene detection and curl mite resistance identification on 81 goat materials collected worldwide. The detection and identification methods were the same as those in Example 3.

[0081] 2. Test results:

[0082] The results are shown in Table 1 and Figure 3 .

[0083] Table 1: Genotypes of molecular marker Cmc4-KASP and phenotypes for identification of resistance to curl mite in natural populations of Aegilops tauschii

[0084]

[0085]

[0086]

[0087] Note: The genotype R in the table represents the homozygous resistant genotype of Cmc4 (C / C); S represents the homozygous susceptible genotype of Cmc4 (G / G). The identification of wheat curl mites in the table is evaluated by visual scoring from 0 to 4, where 0 means no symptoms and 1 to 4 means the curl degree gradually increases. "-" means no phenotypic data.

[0088] The results of the natural population test of Aegilops tauschii showed that the marker Cmc4-KASP was clearly genotyped in the population ( Figure 3 ), and the Cmc4 disease-resistant homozygous type (C / C) showed good resistance to wheat curl mite, and the phenotypic identification grade was mostly ≤1; while the resistance of its susceptible type (G / G) to wheat curl mite was quite different (1-4) (Table 1). Therefore, the KASP marker of the present invention can accurately diagnose the Cmc4 gene.

[0089] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A SNP marker associated with the wheat curl mite resistance gene Cmc4, characterized in that: The nucleotide sequence of the SNP marker is shown in SEQ ID No.

1. The 26th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, and its base is C or G.

2. Use of the SNP marker according to claim 1 in any one of the following (1) to (3): (1) Develop diagnostic markers for the wheat curl mite resistance gene Cmc4; (2) Identify plant germplasm resources for resistance to wheat curl mite; (3) Breeding plant varieties resistant to wheat curl mites.

3. The use according to claim 2, characterized in that: The plant species is a grass family plant.

4. The use according to claim 3, characterized in that: The plant species are wheat and Aegilops tauschii.

5. A KASP molecular marker primer combination for specific detection of wheat curl mite resistance gene Cmc4, characterized in that: include: Primers shown in SEQ ID No.2, SEQ ID No.3 and SEQ ID No.

4.

6. Use of the KASP molecular marker primer combination according to claim 5 in the following (1) or (2): (1) Identify plant germplasm resources for resistance to wheat curl mite; (2) Breeding plant varieties resistant to wheat curl mites.

7. A method for identifying or assisting in identifying wheat resistance to curl mite, characterized in that: The following steps are involved: The genotyping of the wheat to be tested based on SNP markers is detected, and the resistance of the wheat to curl mites is determined according to the genotyping: the wheat with haplotype CC is curl mite resistant; the wheat with haplotype GG is curl mite susceptible; The nucleotide sequence of the SNP marker is shown in SEQ ID No.

1. The 26th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, and its base is C or G.

8. The method according to claim 7, characterized in that The KASP molecular marker primer combination of claim 5 is used to detect the genotyping of the wheat to be tested based on the specific SNP loci, as follows: The genomic DNA of the wheat to be tested was used as a template and PCR amplification was performed using the KASP molecular marker primer combination. After the amplified product was centrifuged, fluorescence data was collected and genotyping was performed based on the fluorescence data.

Images