Diagnostic kasp marker for detecting wheat anti-curly mite gene cmc4 and application thereof

Abstract

The application discloses a diagnostic KASP marker for detecting a wheat anti-curl mite gene Cmc4 and application thereof, and belongs to the technical field of wheat molecular breeding. The application first discovers a SNP site through exon capture data, the SNP site is located in a positioning interval of the anti-curl mite gene Cmc4, is closely related to the Cmc4 gene, and can be used for developing a diagnostic marker of the Cmc4. Based on flanking sequence information of the SNP, the application further develops and designs a diagnostic KASP marker for specifically detecting the wheat anti-curl mite gene Cmc4. The diagnostic KASP marker can be used for efficiently and accurately detecting and utilizing the anti-curl mite function of the Cmc4 gene, and promotes application of the gene in wheat resistance breeding.

Description

Technical Field

[0001] This invention relates to the field of wheat molecular breeding technology, specifically to a diagnostic KASP marker for detecting the wheat resistance mite gene Cmc4 and its application. Background Technology

[0002] Wheat curl mite (WCM) is a major global pest of wheat, severely impacting yield and quality, and also transmitting various plant viruses, especially wheat stripe mosaic virus. It was first reported in common wheat by Slykhuis in 1955. Now, the wheat curl mite is widely distributed in major wheat-growing regions of South America, North America, Asia, and Oceania. Approximately 90 herbaceous plant species can serve as hosts for the wheat curl mite, including many gramineous crops and wild weeds. The wheat curl mite occupies concealed locations on plants, such as curled leaves, leaf sheaths, new leaves, and leaf axils, effectively reducing the effectiveness of chemical pesticides and making its control challenging.

[0003] Planting wheat varieties resistant to the wheat curl mite-virus complex is considered the most effective and environmentally friendly method for controlling wheat curl mite infestation. However, resistance resources available for wheat breeding are extremely scarce. To date, only four curl mite colonization genes have been identified and used in wheat breeding, none of which originate from common wheat. The Cmc4 gene, a resistance gene transferred from Aegilops tauschii to the short arm of chromosome 6D in wheat (Triticum aestivum), exhibits long-term stable resistance to wheat curl mite (WCM) and is currently the most important resistance gene with significant research and application value. The existence of this gene provides an important genetic resource for breeding curl mite-resistant wheat varieties, potentially effectively addressing the yield and quality losses currently faced in wheat production due to curl mite infestation. However, since the Cmc4 gene has not yet been cloned and its sequence is unknown, this presents significant challenges to the genetic application of this resistance gene and the development of diagnostic markers. Currently, there are no diagnostic molecular markers for this gene, which severely restricts its application in wheat breeding. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a diagnostic KASP marker for detecting the wheat resistance mite gene Cmc4 and its application. The diagnostic KASP marker of this invention enables efficient and accurate diagnosis and utilization of the Cmc4 gene's resistance to wheat mites, promoting the application of this gene in wheat resistance breeding.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides an SNP marker associated with resistance to wheat curlworm, the nucleotide sequence of which is shown in SEQ ID No. 1, wherein the 26th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, and the base is C or G.

[0007] gaaag acaaattgat atggcagtgg ytagccgaag gtttcgtcaa taaggaaccaggggtaagtt tatatgagac cggagaaaga. (SEQ ID No.1)

[0008] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, and the nucleotide polymorphism is C / G, which is represented by "y" in the sequence listing.

[0009] TAM112, an American wheat variety, is a hard, red-grained winter wheat variety that carries the Cmc4 gene, which provides excellent resistance to the wheat curl mite ('TAM 112' Wheat, Resistant to Greenbug and Wheat Curl Mite and Adapted to the Dryland Production System in the Southern High Plains; https: / / acsess.onlinelibrary.wiley.com / doi / full / 10.3198 / jpr2014.03.0016crc). This invention utilizes exon capture sequencing data of the mite-resistant wheat variety TAM112 and compares it with the wheat Chinese spring reference genome (IWGSC RefSeq v2.1) to obtain SNP information between it and Chinese spring varieties. Based on the fine mapping and association analysis results of this gene, a SNP site associated with resistance to wheat curlee mite (Cmc4) was identified. This site is located at bases 2,306,478 on the short arm of chromosome 6D of the Chinese spring wheat reference genome, within the annotation gene TraesCS6D03G0012600.1, and exhibits a specific C / G polymorphism with the wheat reference genome. The haplotype of this site in the wheat curlee mite resistance gene Cmc4 is C / C, indicating resistance to wheat curlee mite; other haplotypes are G / G, indicating susceptibility to wheat curlee mite.

[0010] A second aspect of the invention provides the application of the above-mentioned SNP marker in any of the following (1)-(3):

[0011] (1) Develop a diagnostic marker for the wheat resistance mite gene Cmc4;

[0012] (2) Identify the resistance of plant germplasm resources to wheat curl mite;

[0013] (3) Select plant varieties resistant to wheat curl mite.

[0014] In the above applications, the plant species are grasses; including but not limited to: wheat and goatgrass.

[0015] A third aspect of the present invention provides a KASP molecular marker primer combination for specific detection of the wheat curl mite resistance gene Cmc4, comprising the primers shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4; specifically as follows:

[0016] Cmc4-KASP-FAM:

[0017] 5'-GAAGGTGACCAAGTTCATGCTGACAAATTGATATGGCAGTGGG-3'; (SEQ ID No. 2)

[0018] Cmc4-KASP-HEX:

[0019] 5'-GAAGGTGACCAAGTTCATGCTGACAAATTGATATGGCAGTGGC-3'; (SEQ ID No. 3)

[0020] Cmc4-KASP-R:

[0021] 5'-CCCCTGGTTCCTTATTGACG-3'. (SEQ ID No.4)

[0022] Of the primers mentioned above, Cmc4-KASP-FAM and Cmc4-KASP-HEX are upstream genotyping primers, and Cmc4-KASP-R is a downstream universal primer. Cmc4-KASP-FAM, Cmc4-KASP-HEX, and Cmc4-KASP-R were dissolved to 100 μM in TE (pH 8.0) or sterile ultrapure water, and then mixed at a volume ratio of 2:2:5 for later use.

[0023] Based on the SNP molecular markers related to resistance to wheat curlee mite of the present invention, the present invention designed a combination of KASP molecular marker primers specifically for detecting the wheat curlee mite resistance gene Cmc4. It can perform genotyping analysis on the SNP difference at position 26 of the exon capture sequence. The C / C genotype is the Cmc4 resistance haplotype, which shows the wheat curlee mite resistance response; the G / G genotype is the Cmc4 susceptibility haplotype, which shows the wheat curlee mite susceptibility response; and the C / G genotype is the Cmc4 gene heterozygote.

[0024] In a fourth aspect, the present invention provides the application of the above-described KASP molecular marker primer combination in the following (1) or (2):

[0025] (1) Identify the resistance of plant germplasm resources to wheat curl mite;

[0026] (2) Select plant varieties resistant to wheat curl mite.

[0027] A fifth aspect of the present invention provides a method for identifying or assisting in the identification of wheat resistance to the tufted mite, comprising the following steps:

[0028] The genotyping of wheat samples based on SNP markers was detected, and the resistance of wheat to the curling mite was determined according to the genotyping: wheat with haplotype CC was resistant to the curling mite; wheat with haplotype GG was susceptible to the curling mite.

[0029] The nucleotide sequence of the SNP marker is shown in SEQ ID No. 1. The 26th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, and its base is C or G.

[0030] Preferably, the above-mentioned KASP molecular marker primer combination is used to detect the SNP-based genotyping of the wheat sample. Details are as follows:

[0031] Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using a combination of KASP molecular marker primers. After centrifugation of the amplification products, fluorescence data were collected, and genotyping was performed based on the fluorescence data.

[0032] Furthermore, the PCR reaction system consisted of: 2 μL DNA template, 1.94 μL 2×KASP Master Mix, and 0.06 μL primer mixture as shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4.

[0033] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 sec, 60-55℃ annealing extension for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.5℃ per cycle; 94℃ annealing for 20 sec, 55℃ annealing extension for 60 sec, 30 cycles.

[0034] After centrifugation, the PCR products were used to acquire fluorescence data using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization.

[0035] The beneficial effects of this invention are:

[0036] (1) Exon capture technology can effectively sequence exon regions, greatly reducing sequencing costs and increasing sequencing coverage and accuracy, providing a large amount of SNP data for gene localization and marker development. This invention first discovered an SNP marker in an exon capture dataset. This SNP marker is located within the localization region of the anti-Cmc4 gene and is closely associated with the Cmc4 gene, and can be used for the development of diagnostic markers for Cmc4.

[0037] (2) Based on the SNP marker of the present invention, the present invention further developed and designed a diagnostic KASP marker for the specific detection of the wheat anti-curly mite gene Cmc4. The diagnostic KASP marker of the present invention is used to efficiently and accurately detect and utilize the anti-curly mite function of the Cmc4 gene, thereby promoting the application of this gene in wheat resistance breeding. Attached Figure Description

[0038] Figure 1 Development and sequence information of the molecular marker Cmc4-KASP.

[0039] Figure 2 Phenotypic identification results of wheat curling mite in Cmc4 near-isogenic lines. Cmc4 susceptible near-isogenic lines do not carry the Cmc4 gene (A), while Cmc4 resistant near-isogenic lines carry the Cmc4 gene (B).

[0040] Figure 3 The molecular marker Cmc4-KASP was used for genotyping in natural populations of Aegilops rubrum collected worldwide. "Cmc4+" indicates a homozygous Cmc4 resistant haplotype, and "Cmc4-" indicates a homozygous Cmc4 susceptible haplotype. Black dots represent negative water controls with no PCR amplification; green dots represent homozygous resistant Cmc4 genotypes (C / C); pink dots represent homozygous susceptible Cmc4 genotypes (G / G); yellow dots represent the Cmc4 positive control resistant parent OK05312; and blue dots represent the Cmc4 negative control susceptible parent SD06165. Detailed Implementation

[0041] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0042] As mentioned earlier, the wheat curl mite is a serious pest threatening wheat production, directly affecting wheat yield and transmitting various plant viruses, severely impacting wheat production. The biological characteristics of the wheat curl mite render chemical control ineffective; therefore, cultivating wheat varieties resistant to the wheat curl mite-virus complex is considered the most effective and environmentally friendly method for controlling wheat curl mite damage. However, resistance resources available for wheat breeding are extremely scarce. To date, only four wheat curl mite colonization genes have been identified and used in wheat breeding. Among them, the Cmc4 gene exhibits long-term stable resistance to the wheat curl mite and is currently the most important resistance gene, possessing very high research and application value.

[0043] However, since the Cmc4 gene originates from *Aegilops scabra*, a close relative of wheat, and no such resistance gene has yet been cloned, our understanding of the type and mechanism of action of wheat curlworm resistance genes is very limited, which poses a significant challenge to the development of diagnostic markers for this gene. Previously, a recombinant inbred line population (SD06165 / OK05312) was used to perform fine mapping of Cmc4, which located the Cmc4 gene between molecular markers SDOKSNP6314 (2,000,396 bp) and SDOKSNP2805 (2,523,431 bp), with a physical distance of ~523 kb (https: / / link.springer.com / article / 10.1007 / s00122-020-03737-3).

[0044] In view of this, this invention utilizes exon capture technology to sequence the exon regions of the wheat curly-mange resistant variety TAM112. By comparing the SNP differences between its exon capture data and the wheat reference genome, combined with previous Cmc4 gene localization results, it was finally discovered that the 26th base in an exon capture sequence has a specific polymorphism with the wheat D chromosome set, which can specifically detect the Cmc4 gene. Figure 1 Furthermore, the number of SNPs near this site is relatively small, making it suitable for the development of KASP markers.

[0045] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0046] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0047] Example 1: Development of SNP markers associated with resistance to wheat curlworm

[0048] Using the wheat variety TAM112 carrying the wheat curlworm gene Cmc4 as the experimental material, exon capture was performed on TAM112, and the sequencing results were compared with the SNP of the Chinese spring wheat reference genome. The results showed that an exon capture sequence was located at bases 2,306,419-2,306,503 on the short arm of chromosome 6D of the Chinese spring wheat reference genome, within the annotation gene TraesCS6D03G0012600.1, with a length of 85 bp, and its nucleotide sequence is shown in SEQ ID No. 1; among them, a specific C / G nucleotide polymorphism was found at bp 26, where the Cmc4 resistance haplotype is C and the susceptible haplotype is G.

[0049] Based on the current results of the localization of the wheat curl mite gene Cmc4, this SNP site was found to be located in the localization region of the Cmc4 gene and is closely associated with wheat curl mite resistance, and can be used for the development of diagnostic markers for Cmc4.

[0050] Example 2: Development of a diagnostic KASP marker for specific detection of the wheat curlee mite resistance gene Cmc4

[0051] Based on the SNP marker in Example 1, this invention further developed and designed a diagnostic KASP marker specifically for detecting the wheat resistance mite gene Cmc4, specifically as follows:

[0052] Using Primer3 v4.1.0 online primer design software ( https: / / bioinfo.ut.ee / primer3- 0.4.0 / Primer design was carried out.

[0053] The KASP-labeled primer sequence combination is as follows:

[0054] Cmc4-KASP-FAM: The underlined part is the FAM fluorescent tag sequence.

[0055] 5'- GAAGGTGACCAAGTTCATGCT GACAAATTGATATGGCAGTGGG-3'; (SEQ ID No. 2)

[0056] Cmc4-KASP-HEX: The underlined part is the HEX fluorescent tag sequence.

[0057] 5'- GAAGGTCGGAGTCAACGGATT GACAAATTGATATGGCAGTGGC-3'; (SEQ ID No. 3)

[0058] Cmc4-KASP-R: 5'-CCCCTGGTTCCTTATTGACG-3'. (SEQ ID No.4)

[0059] The primers were dissolved in sterile ultrapure water to 100 μM, and then mixed in a volume ratio of upstream genotyping primer Cmc4-KASP-FAM: upstream genotyping primer Cmc4-KASP-HEX: downstream universal primer Cmc4-KASP-R = 2:2:5. The mixture was stored at -20℃ for later use.

[0060] Example 3: Genotypic and phenotypic identification of resistance to wheat curlee mite in near-isogenic lines

[0061] 1. Test method:

[0062] One pair of near-isogenic wheat lines with the Cmc4 gene were selected, which were offspring of the cross between wheat varieties SD06165 and OK05312. SD06165 showed susceptibility to wheat curlworms and did not carry the Cmc4 gene; OK05312 showed resistance to wheat curlworms and carried the Cmc4 gene.

[0063] (1) Genotyping:

[0064] DNA was extracted from near-isogenic wheat materials containing the Cmc4 gene, and genotyping was performed using the Cmc4-KASP marker primer combination (SEQ ID No. 2-SEQ ID No. 4) developed in Example 2. Details are as follows:

[0065] 1) Genomic DNA was extracted from the samples using the CTAB method;

[0066] The specific steps for extracting DNA from wheat samples using the CTAB method are as follows:

[0067] For the materials used above, wheat leaves of 2-3 cm were cut at the 2-leaf stage and placed in 2 mL centrifuge tubes. After being frozen in liquid nitrogen, the leaves were quickly ground into powder. 650 μL of preheated CTAB extraction buffer (65°C) was added, and the mixture was incubated at 65°C for 45 min. Then, 300 μL of chloroform:isoamyl alcohol (24:1, V:V) was added, and the mixture was slowly mixed and allowed to stand for 15 min, with 2-3 slow mixing cycles. After centrifugation at 12000 rpm for 10 min, 450 μL of the supernatant was extracted. An equal volume of ice-cold isopropanol was added, and the mixture was incubated at 4°C for 30 min or overnight. Subsequently, the mixture was centrifuged at 12000 rpm for 45 min, the supernatant was discarded, and the precipitate was genomic DNA. After washing twice with 500 μL of 70% ethanol and drying, the precipitate was dissolved in TE buffer or sterile water and diluted to a concentration of 20 ng / μL. The precipitate was then stored at low temperature for later use.

[0068] 2) PCR amplification;

[0069] The PCR reaction system used was as follows: 2 μL DNA template, 1.94 μL 2×KASP Master Mix, and 0.06 μL primer mixture.

[0070] The PCR reaction conditions used were: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 sec, 60-55℃ annealing extension for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.5℃ per cycle; 94℃ annealing for 20 sec, 55℃ annealing extension for 60 sec, 30 cycles.

[0071] PCR products can be stored at room temperature, but need to be protected from light.

[0072] 3) KASP tagging result analysis.

[0073] After centrifugation, the PCR products were used to acquire fluorescence data using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization.

[0074] (2) Phenotypic identification:

[0075] Wheat curl mite (TWCMC1) was preserved on seedlings of the susceptible wheat variety Jagger, which were grown in a plant culture incubator. Before inoculation, highly curled infected leaves were examined using a stereomicroscope to determine the mite density on each curled leaf. Based on the mite density, infected leaves were cut into 0.5 cm segments, ensuring at least 30 mites on each segment. These segments were then inoculated onto the two-leaf stage wheat variety to be tested, at the angle between the emerging new leaf and the adjacent unfolded true leaf. After inoculation, the plants were kept as still as possible to prevent leaf segment loss. The inoculated plants were cultured in a plant culture incubator at 22±2℃. Phenotypic identification was performed 12-14 days post-inoculation. The susceptible wheat variety Jagger was used as a control.

[0076] 2. Test Results:

[0077] The results of genotypic and phenotypic identification of near-isogenic wheat lines are as follows: Figure 2 As shown, the results indicate that the genotype detection results of the molecular marker Cmc4-KASP are consistent with the actual Cmc4 gene carried by wheat materials; the genotype detection results are also consistent with the identification results of the anti-C. curly mite phenotype.

[0078] Example 4: Detection of Cmc4 gene and identification of wheat curl mite resistance in natural populations of Aegilops rubra.

[0079] 1. Test method:

[0080] The Cmc4 gene and resistance to Curvature mite were detected in 81 goat samples collected worldwide using the Cmc4-KASP marker primer combination (SEQ ID No. 2-SEQ ID No. 4) developed in Example 2. The detection and identification methods were the same as in Example 3.

[0081] 2. Test Results:

[0082] The results are shown in Table 1 and... Figure 3 .

[0083] Table 1: Cmc4-KASP genotype and Curvular mite resistance phenotype in natural populations of Aegilops rubra.

[0084]

[0085]

[0086]

[0087] Note: In the table, genotype R represents the homozygous resistant genotype of Cmc4 (C / C); S represents the homozygous susceptible genotype of Cmc4 (G / G). The identification of wheat curl mite in the table was assessed using a 0-4 level visual scoring system, where 0 indicates no symptoms and 1-4 indicate progressively increasing curl severity. "-" indicates no phenotypic data.

[0088] Natural population analysis of *Aegilops rubra* showed that the Cmc4-KASP marker exhibited clear genotyping in this population. Figure 3 Furthermore, the Cmc4 resistant homozygous type (C / C) showed good resistance to wheat curlworm, with the vast majority having a phenotypic grade ≤1; while the susceptible type (G / G) showed significantly different resistance to wheat curlworm (1-4) (Table 1). Therefore, the KASP marker of this invention can accurately diagnose the Cmc4 gene.

[0089] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. Use of the SNP marker in any one of (1)-(3) below: (1) Development of diagnostic markers for wheat resistance to curl mite Cmc4 genes (2) identifying plant germplasm resources for resistance to wheat curl mite; (3) breeding plant varieties resistant to wheat curl mite; The nucleotide sequence of the SNP marker is shown as SEQ ID No. 1, and the 26th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, which is C or G; genotyping of the SNP marker is detected, and the crinkled mite resistance is determined according to the genotyping: the haplotype of CC is a plant variety with crinkled mite resistance; the haplotype of GG is a plant variety with crinkled mite susceptibility. The plant variety is wheat or Aegilops tauschii.

2. Use of the KASP molecular marker primer combination in (1) or (2) below: (1) identifying plant germplasm resources for resistance to wheat curl mite; (2) breeding plant varieties resistant to wheat curl mite; The KASP molecular marker primer combinations include: the primers shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4; Genotyping of the SNP marker of claim 1 is detected using the KASP molecular marker primer combination, and the criniform mite resistance is determined according to the genotyping: the plant variety with haplotype CC is criniform mite resistance; the plant variety with haplotype GG is criniform mite susceptibility; The plant variety is wheat or Aegilops tauschii.

3. A method of identifying or assisting in the identification of wheat resistance to C. hippodrome, characterized in that, comprising the following steps: Detecting genotyping of the wheat to be tested based on the SNP marker, determining the resistance of the wheat to the curled mite according to the genotyping: the haplotype of CC wheat is resistant to the curled mite; the haplotype of GG wheat is susceptible to the curled mite; The nucleotide sequence of the SNP marker is shown in SEQ ID No. 1, and the 26th base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, which is C or G.

4. The method of claim 3, wherein, The KASP molecular marker primer combination in claim 2 is used to detect the genotyping of the test wheat based on the specific SNP site, specifically as follows: The genomic DNA of the test wheat is used as a template, and the KASP molecular marker primer combination is used for PCR amplification. After centrifugation of the amplification product, fluorescence data is collected, and genotyping is performed according to the fluorescence data.

Images