A molecular marker combination for identifying river carp breeds and application thereof
By employing PCR amplification methods combining molecular markers and primers, and incorporating Bayes' theorem, the Hetian chicken breed can be accurately identified. This approach addresses the subjectivity and environmental influences inherent in traditional identification methods, reduces the error rate, and improves identification accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
- Filing Date
- 2026-04-28
- Publication Date
- 2026-06-19
Smart Images

Figure CN122235320A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of poultry breed identification technology, specifically relating to a molecular marker combination for identifying the Hetian chicken breed and its application. Background Technology
[0002] Hetian chicken originated in Hetian Town, Changting County, Longyan City, Fujian Province. Its central production area covers Hetian Town and 17 surrounding townships including Cewu, Nanshan, and Datong. It is a renowned high-quality yellow-feathered broiler chicken breed in my country. Hetian chicken meat is characterized by its freshness, aroma, and tenderness, and is rich in amino acids and proteins, especially taurine, making it highly popular with consumers. Known for its delicious meat, thin skin, and fine bones, it is listed in the National Livestock and Poultry Genetic Resources List, holding an important and protected status.
[0003] The traditional method for identifying the Hetian chicken breed is based on appearance (morphology). This is the most traditional and intuitive method, which involves observing physical characteristics such as body shape, feather color, comb shape, skin color, beak color, and earlobes, combined with local breeding experience, to determine whether it is a purebred Hetian chicken. However, this method has drawbacks: it is highly subjective, relying on experience, and different people have different evaluation standards; it has high phenotypic similarity, as other local chicken breeds (such as Xiangdong chicken and Huiyang bearded chicken) may look similar to Hetian chickens, making accurate differentiation difficult; and it is greatly affected by the environment, as feed, management methods, and growing environment can affect feather color and body shape, leading to misjudgments. Therefore, the traditional method has a high error rate, and there is an urgent need for a stable and accurate method for identifying the Hetian chicken breed. Summary of the Invention
[0004] The purpose of this invention is to accurately identify the breed of Hetian chicken and reduce the error rate.
[0005] This invention provides a molecular marker combination for identifying the Hetian chicken breed, wherein the molecular markers are as follows: the gene of molecular marker 1 is shown in SEQ ID NO.9, with a base of G or A at position 25; the gene of molecular marker 2 is shown in SEQ ID NO.10, with a base of C or T at position 66; the gene of molecular marker 3 is shown in SEQ ID NO.11, with a base of G or A at position 105; and the gene of molecular marker 4 is shown in SEQ ID NO.12, with a base of C or T at position 93.
[0006] The present invention provides primer pairs for amplifying the above-mentioned molecular markers. The primer pairs for amplifying molecular marker 1 are shown in SEQ ID NO.1 and SEQ ID NO.2; the primer pairs for amplifying molecular marker 2 are shown in SEQ ID NO.3 and SEQ ID NO.4; the primer pairs for amplifying molecular marker 3 are shown in SEQ ID NO.5 and SEQ ID NO.6; and the primer pairs for amplifying molecular marker 4 are shown in SEQ ID NO.7 and SEQ ID NO.8.
[0007] This invention provides a kit for identifying Hetian chicken breeds, the kit containing the above-mentioned primer combination.
[0008] Further specifying, it also includes 10×PCR buffer, dNTPs, and Taq DNA polymerase.
[0009] This invention provides the application of the above-mentioned molecular marker combination, primer combination, or kit in the identification of Hetian chicken breeds.
[0010] This invention provides the application of the above-mentioned molecular marker combination, primer combination, or kit in the auxiliary identification, auxiliary breeding, and screening of Hetian chicken breeds.
[0011] This invention provides a method for identifying the breed of Hetian chicken, the steps of which are as follows: (1) Extract total DNA from the chicken genome to be tested; (2) Perform PCR amplification using the primer combination described in claim 2; (3) Sequencing the PCR amplification products to determine the genotype; (4) Based on the genotype results, determine whether the chicken to be tested belongs to the Hetian chicken breed.
[0012] To further specify, the sample extracted in step (1) is venous blood from chicken wings.
[0013] Further specifying, if the genotype is GG, CC, GG, or CC, then it is the Hetian chicken breed.
[0014] To further specify, if the genotype is any three of the following: GG, CC, GG, and CC, then it is the Hetian chicken breed.
[0015] Beneficial effects: This invention provides four SNP molecular markers. A chicken breed can be identified as Hetian chicken if it contains any three of these three SNP loci (GG, CC, GG, and CC genotypes) or a combination of four SNP loci (GG, CC, GG, and CC genotypes). If there are no more than three loci, it is not considered a Hetian chicken. Attached Figure Description
[0016] Figure 1 Agarose gel electrophoresis was used to identify the PCR products of four primer pairs for Hetian chicken. Figure 2 Gene frequency distribution and sequencing at locus 17168861 on chromosome 2; Figure 3 Gene frequency distribution and sequencing data at locus 6518083 on chromosome 20; Figure 4 Gene frequency distribution and sequencing data at locus 6518186 on chromosome 20; Figure 5 The gene frequency distribution and sequencing data at locus 6518180 on chromosome 20. Detailed Implementation
[0017] Example 1. Using microarrays, 15.73 million SNP loci from six chicken breeds (Hetian chicken, Silkie chicken, Jinhu Wufeng chicken, Minqing Maojiao chicken, Dehua black chicken, and Xiangdong chicken) were screened and identified. The set of loci with the greatest differences was selected based on comparisons between Hetian chicken and the other five breeds. Priority was given to selecting reference genome loci in Hetian chicken with allele frequencies of 1 or 0. Then, the mean allele frequencies of different loci in the other five breeds were determined. These mean allele frequencies were then compared with the allele frequencies of each locus in Hetian chicken to screen for SNP loci with significant allele frequency differences and those whose allele frequencies in other populations were close to 0 or 1. Finally, four SNP loci were determined for Hetian chicken breed identification.
[0018] Four SNP sites that influence the phenotype of Hetian chicken were identified, namely HTC1P to HTC4P sites in Table 1.
[0019] Table 1. Four SNP sites affecting the phenotype of Hetian chicken.
[0020] The screening method for the above SNP sites is as follows: First, identify Fujian local chicken breeds that are similar in appearance and widely circulated in the market, such as Hetian chicken, white-feathered black-boned chicken, Jinhu black-feathered chicken, Minqing hairy-legged chicken, Dehua black chicken, and Xiangdong chicken, and divide them into two groups: Hetian chicken and other chickens. Primer combinations for identifying Hetian chicken breeds were designed, and the primer combinations include any 1-4 primer pairs in Table 2: PCR reaction conditions: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, annealing for 30 s (annealing temperature see Table 2), 72℃ extension for 60 s, for a total of 34 cycles; 72℃ total extension for 10 min, and storage at 4℃.
[0021] PCR reaction system: Amplification was performed using a 20 μL reaction system, which included approximately 100 ng of genomic DNA template and 10× PCR buffer (containing Mg). 2+ 2.0 μL, final dNTP concentration of 0.3 μM, 1 U Taq DNA polymerase, 0.5 μM each of upstream and downstream primers, add ddH2O to 20 μL.
[0022] Table 2 Primer combinations for identifying Hetian chicken breeds
[0023] The primer combination used to identify Hetian chicken breeds is used to identify Hetian chicken breeds. The identification method includes the following steps: (1) Extract total DNA from the genomic genome of the chicken to be tested (the sample is venous blood from the chicken wing); (2) Based on the selected SNP site combination, perform PCR amplification using the corresponding primers; (3) Sequencing the PCR amplification products to determine the genotype; (4) Based on the genotype results, determine whether the chicken to be tested belongs to the Hetian chicken breed. If one of the genotypes corresponding to the selected SNP locus combination does not match the genotype corresponding to Hetian chicken, then the chicken to be tested is determined not to belong to Hetian chicken. If all the genotypes corresponding to the selected SNP locus combination match the genotype corresponding to Hetian chicken, then the probability of the chicken to be tested belonging to Hetian chicken is determined according to Bayes' theorem.
[0024] In the identification method of this invention, one or more sites from HTC1P to HTC4P are used to identify the breed of Hetian chicken, and corresponding upstream and downstream primers are used for PCR amplification. This invention does not have specific limitations on the PCR amplification method; conventional PCR amplification methods in the art can be used. The amplification results are as follows... Figure 1 As shown.
[0025] Example 2. The genotypes and genotype frequencies of SNP sites in Hetian chicken and other breeds are shown in Table 3.
[0026] Table 3. Genotypes and genotype frequencies of the four SNP loci in Hetian chicken and other breeds.
[0027] Among them, the genotype frequency of other varieties refers to the mean value of the genotype frequency of the group consisting of White-feathered Silkie Chicken, Jinhu Black Phoenix Chicken, Minqing Hairy-legged Chicken, Dehua Black Chicken, and Xiangdong Chicken.
[0028] The formula for calculating Bayes' theorem is as follows: P = 1 / (1+πPi) Where P represents probability, i represents the frequency of the corresponding genotype of other varieties at the i-th SNP locus in the SNP locus combination, i is an integer from 1 to 4, and ∏ represents the joint probability product of multiple independent events (or variables) P1, P2, ..., Pn.
[0029] The genotypes of the four SNP loci HTC1P to HTC4P in the Hetian chicken were GG, CC, GG, and CC, respectively.
[0030] According to Bayes' theorem, the probability of identifying a Hetian chicken genotype based on a single SNP locus is at least 83.75% and at most 85.32%; the probability of identifying a Hetian chicken genotype based on the combination of any two SNP loci is over 96.37%; the probability of identifying a Hetian chicken genotype based on the combination of any three SNP loci is over 99.35%; and the probability of identifying a Hetian chicken genotype based on the combination of any four SNP loci is over 99.88%. Therefore, by randomly selecting any combination of three or four SNP loci, the probability of accurately identifying a Hetian chicken can reach over 99%. Otherwise, the individual can be completely ruled out as a Hetian chicken. This method is simple to operate, highly accurate, and can effectively combat the proliferation of counterfeit Hetian chickens in the market, minimize losses for farmers, and protect the Hetian chicken brand.
[0031] For example, if we select three SNP loci, HTC1P, HTC2P, and HTC3P, and the combined genotype is GG, CC, and GG, then the probability that the individual belongs to the Hetian chicken is P = 1 / (1 + 0.172 × 0.172 × 0.194) = 99.47%.
[0032] Example 3. Reagent Kit 1. Primer pairs for amplifying molecular marker 1 are shown in SEQ ID NO.1 and SEQ ID NO.2; primer pairs for amplifying molecular marker 2 are shown in SEQ ID NO.3 and SEQ ID NO.4; primer pairs for amplifying molecular marker 3 are shown in SEQ ID NO.5 and SEQ ID NO.6; primer pairs for amplifying molecular marker 4 are shown in SEQ ID NO.7 and SEQ ID NO.8; PCR reaction system: Amplification was performed using a 20 μL reaction system, which included approximately 100 ng of genomic DNA template and 10× PCR buffer (containing Mg). 2+ 2.0 μL, final dNTP concentration of 0.3 μM, 1 U Taq DNA polymerase, 0.5 μM each of upstream and downstream primers, add ddH2O to 20 μL.
[0033] 2. Select chicken samples of known breeds, including 400 Hetian chickens and 30 other chickens. Use the molecular markers from step 1 for detection. The sequencing results are as follows: (1) If the 25th position of the HTC1P marker is G, then it is the GG type, which is the genotype of the Hetian chicken; Figure 2 As shown.
[0034] Sequencing results of the HTC1P genotype of the amplified Hetian chicken: (SEQ ID NO.9) AGCACATTCTCACTGACCACATAC G ACCACAACTTTGAAATGCGCACTCCAAGAGCCGTGTGCAAATGAAATAGCTTCCTACAGCACTGGCCCGTAGTGCTGATAGAATAATGGGGAGTTTGCAAATGGCAA; (2) If the 66th position of the HTC2P marker is C, then it is of the CC type, which is the genotype of the Hetian chicken; if Figure 3 As shown.
[0035] Sequencing results of HTC2P of the amplified Hetian chicken genotype: (SEQ ID NO.10) TACTGGCCTCCCTGAAGTCTGAAAAAAATTACAGGTTGCTCTCTAAGAGTATACATTATCTACAGA C ATGGAGGGCTGTACTGAGCACCTCCTGCTGGTGGAAAACGGGACAAATCTCCTAGCTGACAGAAGATCCTAGATTTCTACTCCTCAGTGCTACTAACTGCACATCCACTCCCTC; (3) If the 105th position of the HTC3P marker is G, then it is the GG type, which is the genotype of the Hetian chicken; Figure 4 As shown.
[0036] Sequencing results of HTC3P genotype of Hetian chicken after amplification: (SEQ ID NO.11) TGAGCACCTCCTGCTGGTGGAAAACGGGACAAATCTCCTAGCTGACAGAAGATCCTAGATTTCTACTCCTCAGTGCTACTAACTGCACATCCACTCCCTCTACC G TTTAGACAGGTATGAAAAATGCTTGAATAAGGCAGACCAGCTTCTGTT; (4) If the 93rd position of the HTC1P marker is C, then it is the CC type, which is the genotype of the Hetian chicken; if Figure 5 As shown.
[0037] Sequencing results of HTC4P of the amplified Hetian chicken genotype: (SEQ ID NO.12) GCACATCCACTCCCTCTTCCATTTAGACAGGTATGAAAAATGCTTGAATAAGGCAGACCAGCTTCTGTTTACTTTTTAGCAAGTGAATATCT C GTGTGCTGCAGGGCACAGAGAGGCAGGGAAGGAA; Experimental results verified the following: Three chickens each of the following breeds were randomly selected for verification: Hetian chicken, white-feathered black-boned chicken, Jinhu black-feathered chicken, Minqing hairy-legged chicken, Xiangdong chicken, and Dehua black chicken. The genotypes identified by the four SNP loci HTC1P to HTC4P were all GG, CC, GG, and CC. The chickens to be tested were Hetian chickens. If the genotypes identified by the four SNP loci HTC1P to HTC4P were any three of GG, CC, GG, and CC, they could also be identified as Hetian chickens, which is consistent with the actual chicken types.
[0038] Table 4. Validation results of the four SNP loci in Hetian chicken and other breeds.
Claims
1. A molecular marker combination for identifying the breed of Hetian chicken, characterized in that, The molecular markers are as follows: the gene for molecular marker 1 is shown in SEQ ID NO.9, with a base of G or A at position 25; the gene for molecular marker 2 is shown in SEQ ID NO.10, with a base of C or T at position 66; the gene for molecular marker 3 is shown in SEQ ID NO.11, with a base of G or A at position 105; and the gene for molecular marker 4 is shown in SEQ ID NO.12, with a base of C or T at position 93.
2. The primer combination for amplifying the molecular marker according to claim 1, characterized in that, The primer pairs for amplifying molecular marker 1 are shown in SEQ ID NO.1 and SEQ ID NO.2; the primer pairs for amplifying molecular marker 2 are shown in SEQ ID NO.3 and SEQ ID NO.4; the primer pairs for amplifying molecular marker 3 are shown in SEQ ID NO.5 and SEQ ID NO.6; and the primer pairs for amplifying molecular marker 4 are shown in SEQ ID NO.7 and SEQ ID NO.
8.
3. A reagent kit for identifying Hetian chicken breeds, characterized in that, The kit contains the primer combination as described in claim 2.
4. The reagent kit according to claim 3, characterized in that, It also includes 10×PCR buffer, dNTPs, and Taq DNA polymerase.
5. The application of the molecular marker combination of claim 1, the primer combination of claim 2, or the kit of claim 3 or 4 in the identification of Hetian chicken breeds.
6. The application of the molecular marker combination of claim 1, the primer combination of claim 2, or the kit of claim 3 or 4 in the auxiliary identification, auxiliary breeding, and screening of Hetian chicken breeds.
7. A method for identifying the breed of Hetian chicken, characterized in that, The steps of the method are as follows: (1) Extract total DNA from the chicken genome to be tested; (2) Perform PCR amplification using the primer combination described in claim 2; (3) Sequencing the PCR amplification products to determine the genotype; (4) Based on the genotype results, determine whether the chicken to be tested belongs to the Hetian chicken breed.
8. The method according to claim 7, characterized in that, The sample extracted in step (1) is venous blood from chicken wings.
9. The method according to claim 7, characterized in that, If the genotype is GG, CC, GG, or CC, then it is the Hetian chicken breed.
10. The method according to claim 7, characterized in that, If the genotype is any three of GG, CC, GG, and CC, then it is the Hetian chicken breed.