Methods of modulating cell death and inflammation

Abstract

This disclosure provides the use of a modulator of a component of the tumor necrosis factor receptor 1 (TNFR1) complex II for the treatment or prevention of diseases pathologically involving TNFR1-mediated signal transduction, wherein the component of the TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA. In one embodiment, the RBP is FTO or XPOS, and the pathologically involved TNFR1-mediated signal transduction is cancer, an inflammatory condition, or an infectious disease. Methods for regulating cell death are also disclosed, comprising providing a modulator of a component of the TNFR1 complex II, wherein the component of the TNFR1 complex II is an RBP or RNA.

Description

[0001] This application claims priority to SG 10202303112Y filed on November 2, 2023 and SG10202400127X filed on January 16, 2024, the contents and elements of which are incorporated herein by reference for all purposes. Technical Field

[0002] This disclosure relates to medical treatment and prevention, particularly the medical treatment and prevention of diseases pathologically involving TNFR1-mediated signal transduction. Background Technology

[0003] TNF is a key inflammatory cytokine involved in cellular and developmental processes (Rickard et al., Cell. 2024. 157, 1175-1188). Abnormal activation of TNF-dependent inflammation is a major cause of several human diseases.

[0004] Upon binding to TNFR1, tumor necrosis factor (TNF) triggers cell survival and cell death signaling pathways. Cancer cells have evolved mechanisms to evade cell death, allowing them to survive and proliferate uncontrollably. On the other hand, overactivation of cell death signaling promotes the development of inflammatory conditions such as rheumatoid arthritis (RA) and inflammatory bowel disease (IBD). The global cost of cancer care exceeds $40 trillion annually, highlighting its heavy burden on public health. Despite advances in treatment, cancer remains a major threat. In the case of inflammatory conditions, global spending on anti-TNF inhibitors alone exceeds $40 billion annually.

[0005] Anti-TNF drugs have revolutionized the treatment of many previously refractory chronic inflammatory diseases (Ioannidis et al., Nat Rev Rheumatol. 2013. 9, 665-673). This has spurred clinical research into developing cell death inhibitors as therapeutic interventions for inflammatory diseases. Furthermore, inhibiting cell death may offer therapeutic benefits in the context of neuroinflammation, Alzheimer's disease, and Parkinson's disease, where excessive cell death promotes disease progression (Mifflin et al., Nat RevDrug Discov. 2020. 19, 553-571).

[0006] While TNF inhibitors have demonstrated efficacy in treating rheumatoid arthritis (RA), their high cost and limited efficacy have raised concerns. Furthermore, it is noteworthy that a significant number of patients discontinue treatment within the first year due to treatment resistance. Therefore, despite the promising prospects of anti-TNF drugs, more effective and precise therapeutic interventions are needed for treating cancer, inflammatory conditions, and infectious diseases. Summary of the Invention

[0007] In a first aspect, this disclosure provides a modulator of a component of a tumor necrosis factor receptor 1 (TNFR1) complex II for the treatment or prevention of diseases pathologically involving TNFR1-mediated signal transduction, wherein the component of the TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

[0008] In another aspect, this disclosure provides the use of a modulator of a component of the tumor necrosis factor receptor 1 (TNFR1) complex II in the preparation of a medicament for the treatment or prevention of diseases pathologically involving TNFR1-mediated signal transduction, wherein the component of the TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

[0009] In another aspect, this disclosure provides a method for treating or preventing diseases pathologically involving signal transduction mediated by tumor necrosis factor receptor 1 (TNFR1), wherein the method comprises administering to a subject a modulator of a component of TNFR1 complex II that is therapeutically or preventively effective, wherein the component of TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

[0010] In some embodiments, the RBP component of the TNFR1 complex II comprises, or is composed of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:1 or SEQ ID NO:6.

[0011] In some implementations, the RNA component of TNFR1 complex II is RNA capable of associating with the RBP component of TNFR1 complex II.

[0012] In some implementations, the RNA component of TNFR1 complex II is non-coding RNA.

[0013] In some embodiments, the RNA component of the TNFR1 complex II is an RNA consisting of a nucleotide sequence having at least 70% nucleotide sequence identity with the ribonucleotide sequence identified from Table 1 or Table 2.

[0014] In some embodiments, the RNA component of the TNFR1 complex II is an RNA consisting of a nucleotide sequence having at least 70% nucleotide sequence identity with or composed of the following ribonucleotide sequences: FATALR1, DOCK4, ARHGAP24, PDE10A, RAD51B, ABTB2, AFF3, MIR4451, MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1. GPR22, MIR28, EHMT1, PTPRG, MAST4, FAM222A, LPP, PRKCA-AS1, IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR6077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1, FMNL2, NIBA N1, MIR6529, HIVEP2, MIR3921, MIR4768, AKAP13, MIR586, LINC02605, TBC1D4, RNVU1-4, RBFOX2, JAZF1-AS1, FOXC1, MA PKAP1, SIK3, LRCH1, RASSF5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1, CSF2, MIR3194, SDK1, RBMS3-AS 1. HIVEP1, MB21D2, KLF12, SLC35F3, WWC2, MIR1267, LUZP1, PARP8, RNU1-2, JARID2, ZFAND3, SLIT2-IT1, MAGI1-AS1, FER , LINC00673, SBF2, LIMS1, EIF4G3, THSD4-AS1, ARID4B, DENND1A, WWC1, ANKRD33B, MAP4, RASAL2, TRIM44, OLA1, or KLHL29.

[0015] In some embodiments, the RNA component of the TNFR1 complex II is RNA comprising a nucleotide sequence having at least 70% nucleotide sequence identity with, or composed of, the following ribonucleotide sequences: FATALR1, RAD51B, or AFF3. In some embodiments, the RNA component of the TNFR1 complex II is RNA comprising a nucleotide sequence having at least 70% nucleotide sequence identity with, or composed of, the following ribonucleotide sequences: FATALR1, RAD51B, AFF3, or RUPTR7.

[0016] In some embodiments, the RNA is selected from: FATALR1, DOCK4, ARHGAP24, PDE10A, RAD51B, ABTB2, AFF3, MIR4451, MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1, GPR22, MIR28, EHMT1, PTPRG, MAST4, FAM222A, LP P, PRKCA-AS1, IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR 6077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1, FMNL2, NIBAN1, MIR6529, HIVEP2, MIR3921, M IR4768, AKAP13, MIR586, LINC02605, TBC1D4, RNVU1-4, RBFOX2, JAZF1-AS1, FOXC1, MAPKAP1, SIK3, LRCH1, RASS F5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1, CSF2, MIR3194, SDK1, RBMS3-AS1, HIVEP1, MB21D 2. KLF12, SLC35F3, WWC2, MIR1267, LUZP1, PARP8, RNU1-2, JARID2, ZFAND3, SLIT2-IT1, MAGI1-AS1, FER, LINC00 673, SBF2, LIMS1, EIF4G3, THSD4-AS1, ARID4B, DENND1A, WWC1, ANKRD33B, MAP4, RASAL2, TRIM44, OLA1 and KLHL29.

[0017] In some embodiments, the RNA component of the TNFR1 complex II is an RNA comprising or consisting of a ribonucleotide sequence having at least 70% nucleotide sequence identity with SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:25.

[0018] In some embodiments, the modulator inhibits the expression and / or activity of components of the TNFR1 complex II.

[0019] In some embodiments, the modulator is selected from: small molecules that bind to components of TNFR1 complex II, inhibitory nucleic acids that target components of TNFR1 complex II, and nucleic acids of site-specific nuclease (SSN) systems that encode nucleic acids that target components of TNFR1 complex II.

[0020] In some embodiments, the modulator upregulates the expression and / or activity of components of TNFR1 complex II.

[0021] In some embodiments, the regulator comprises, or is composed of, a nucleic acid encoding an RBP or RNA component of the TNFR1 complex II.

[0022] In some embodiments, the pathologically involved TNFR1-mediated signal transduction disease is characterized by dysregulation of caspase-8, caspase-3, caspase-10, RIPK1, RIPK3 and / or PARP activity.

[0023] In some implementations, the pathologically involved diseases of TNFR1-mediated signal transduction are characterized by dysregulation of cell death.

[0024] In some implementations, the pathologically involved TNFR1-mediated signal transduction disease is characterized by a cytokine storm.

[0025] In some implementations, the pathologically involved disease involving TNFR1-mediated signal transduction is cancer.

[0026] In some implementations, the pathologically involved TNFR1-mediated signal transduction disease is an inflammatory condition and / or an infectious disease.

[0027] In some implementations, the cancer is selected from: solid tumors, breast cancer, breast epithelial carcinoma, ductal carcinoma, gastric cancer, gastric epithelial carcinoma, gastric adenocarcinoma, colorectal cancer, colorectal epithelial carcinoma, colorectal adenocarcinoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung epithelial carcinoma, ovarian cancer, ovarian epithelial carcinoma, ovarian serous adenocarcinoma, kidney cancer, renal cell carcinoma, renal clear cell carcinoma, renal cell adenocarcinoma, renal papillary cell carcinoma, pancreatic cancer, pancreatic adenocarcinoma, pancreatic duct adenocarcinoma, cervical cancer, cervical squamous cell carcinoma, skin cancer, melanoma, esophageal cancer, esophageal adenocarcinoma, liver cancer, hepatocellular carcinoma, bile duct carcinoma, uterine cancer, endometrial carcinoma of the uterine corpus, thyroid cancer, thyroid epithelial carcinoma, pheochromocytoma, paraganglioma, bladder cancer, bladder urothelial carcinoma, prostate cancer, prostate adenocarcinoma, sarcoma, and thymoma.

[0028] In some implementations, the inflammatory condition is selected from: chronic inflammatory diseases, arthritis, rheumatoid arthritis, juvenile arthritis, systemic juvenile idiopathic arthritis, lupus, systemic lupus erythematosus, pancreatitis, thyroiditis, periodontitis, rhinitis, allergic rhinitis, dermatitis, atopic dermatitis, psoriasis, Hermansky-Pudrag syndrome, Graves' disease, diabetes, type 1 diabetes, type 2 diabetes, pregnancy-related hyperglycemia, multiple sclerosis, atherosclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, hippocampal atrophy, lung disease, asthma, and chronic obstructive pulmonary disease. Pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, hepatitis, hepatotoxicity, acetaminophen-induced hepatotoxicity, alcoholic liver disease, pancreatitis, inflammatory bowel disease, Crohn's disease, colitis, ulcerative colitis, endometriosis, nephropathy, kidney injury, acute kidney injury, nephrotoxicity, glomerulonephritis, chronic kidney disease, Allport syndrome, adult-onset Still's disease, Castleman's disease, cytokine release syndrome, sepsis, septic shock, retinopathy, age-related macular degeneration, wet age-related macular degeneration, retinitis pigmentosa, Poitz-Yage syndrome, skeletal muscle diseases, and muscular dystrophy.

[0029] In some implementations, the infectious disease is a bacterial, viral, fungal, or parasitic infection.

[0030] In another aspect, this disclosure provides a method for regulating cell death, wherein the method includes providing a regulator of a component of TNFR1 complex II, wherein the component of TNFR1 complex II is RBP or RNA. Detailed Implementation

[0031] This disclosure is based on the inventors' accidental discovery that ribonucleic acid (RNA)-binding proteins (RBPs) and RNA are components of the TNFR1 complex and participate in TNFR1-mediated signal transduction. The inventors also found that the regulation of the RBP and RNA components of the TNFR1 complex affects the levels of cell death and inflammation.

[0032] Compared to anti-TNF drugs, targeting the RBP and / or RNA components of the TNFR1 complex results in additional levels of specificity. This is due to their cell type-specific expression patterns, as well as their inducibility under disease conditions.

[0033] TNFR1 complex Tumor necrosis factor (TNF), also known as TNFα, is an adipokine and cytokine. TNF is a member of the TNF superfamily, which consists of various proteins with homologous TNF domains. TNF is an important mediator in the immunological processes of infection control, autoimmunity, allergic diseases, and cancer response (Gough and Myles. Front Immunol. 2020; 11:585880). Of particular interest, TNF activity is also involved in cancer development (Wang and Lin. Acta Pharmacol Sin. 2008 Nov; 29(11): 1275–1288). As an adipokine, TNF promotes insulin resistance and is associated with obesity-induced type 2 diabetes. As a cytokine, TNF is used by the immune system for cell signal transduction.

[0034] TNF signaling occurs through two receptors: tumor necrosis factor receptor 1 (TNFR1) and tumor necrosis factor receptor 2 (TNFR2). TNFR1 is constitutively expressed in most cell types, while TNFR2 is primarily expressed through endothelial cells, epithelial cells, and immune cell subsets. TNF signaling is initiated by the activation of TNFR1 and TNFR2, leading to a variety of potential consequences, including cell proliferation, gene activation, or cell death. The fact that such diverse cellular responses are mediated by only two receptors necessitates complex control of intracellular signal transduction (Gough and Myles. Front Immunol. 2020; 11: 585880).

[0035] TNFR1 is the major TNF receptor mediating most of the pathophysiological effects of TNF. TNF binding to TNFR1 upregulates a large number of downstream genes at the transcriptional level (Anderton et al., Nat Rev Rheumatol. 2020. 16, 496-513). TNFR1 includes a death domain (DD), which is constitutively expressed in most cell types and activated by TNF. Following activation by TNF binding, intracellular signal transduction via TNFR1 is initiated through its DD.

[0036] Upon activation, a core signal transduction complex is constructed on the cytoplasmic tail of TNFR1. The first step in this process is TNFR1 trimerization to form a TNFR1 trimer (i.e., the association of three TNFR1 molecules), which is initiated by contact with TNF.

[0037] Once TNFR1 forms a trimer, TNFR1 DD recruits the TNFR1-associated death domain (TRADD). TRADD acts as a scaffold for forming the core signal transduction complex. TRADD recruits either TNF receptor-associated factor (TRAF) 2 or TRAF5, as well as receptor-interacting serine / threonine protein kinase 1 (RIPK1). TRAF2 then provides a platform for recruiting cellular inhibitors of apoptosis protein (cIAP) 1 and cIAP2.

[0038] The ubiquitination level of RIPK1 and / or the activity level of NF-κB regulate the formation of different TNFR1 complexes: TNFR1 complex I or TNFR1 complex II.

[0039] In the context of this application, a complex (or macromolecular complex) is an assembly of related macromolecules, such as an assembly of related peptides and RNA. In some embodiments, the complex comprises both peptides and RNA. In some embodiments, the complex comprises a peptide. In some embodiments, the complex comprises RNA. In some embodiments, the complex is a protein complex. In some embodiments, the complex is an RNA-protein complex. A protein complex or a multi-protein protein complex is a group of two or more associated polypeptide chains. An RNA-protein complex is a macromolecular group comprising at least one polypeptide chain and at least one RNA molecule.

[0040] The TNFR1 complex is a macromolecular complex formed upon activation of TNFR1. In other words, the formation of the TNFR1 complex is mediated by TNFR1 activation. In some embodiments, the TNFR1 complex is a macromolecular complex comprising a polypeptide chain. In some embodiments, the TNFR1 complex is a macromolecular complex comprising a polypeptide chain and an RNA molecule. In some embodiments, the TNFR1 complex does not contain TNFR1. In some embodiments, TNFR1 is not a structural component of the TNFR1 complex.

[0041] In some implementations, the TNFR1 complex is TNFR1 complex I or TNFR1 complex II.

[0042] The ubiquitin chain acts as the backbone for the formation of TNFR1 complex I. If ubiquitination is incomplete, TNFR1 complex II is formed.

[0043] Both TNFR1 complex I and TNFR1 complex II are well known to those skilled in the art. For example, TNFR1 complex I and TNFR1 complex II are discussed, for example, in Muppidi et al. (2004. Immunity, Vol. 21, 461–465), Gough and Myles (2020. Front Immunol. 11: 585880), and Dostert et al. (2019. Physiol Rev. 99: 115–160), each of which is incorporated herein by reference in its entirety.

[0044] In some literature, "TNFR1 complex I" and "TNFR1 complex II" are also referred to as "complex I" and "complex II," or "TNFR1 signal transduction complex I" and "TNFR1 signal transduction complex II." Therefore, TNFR1 complex I can be referred to as complex I, and TNFR1 complex II can be referred to as complex II. In some embodiments, the TNFR1 complex is either complex I or complex II. The terms "TNFR1 complex I," "complex I," and "TNFR1 signal transduction complex I" are used interchangeably. Similarly, the terms "TNFR1 complex II," "complex II," and "TNFR1 signal transduction complex II" are used interchangeably.

[0045] TNFR1 complex I activates the NF-κB, JNK, and p38 pathways to induce cytokine signaling and cell survival. TNFR1 complex II activity leads to apoptotic or necrotic cell death.

[0046] Maintaining a balance between TNFR1 complex I and TNFR1 complex II is important for maintaining physiological homeostasis, and imbalance can lead to various conditions, including cancer, inflammatory conditions, and infectious diseases.

[0047] In some embodiments, TNFR1 complex I comprises TNFR1, TRADD, and RIPK1. In some embodiments, TNFR1 complex I comprises TNF. In some embodiments, TNFR1 complex I comprises TRAF2 and / or TRAF5. In some embodiments, TNFR1 complex I comprises cIAP1 and / or cIAP2. In some embodiments, TNFR1 complex I comprises TNFR1, TRADD, RIPK1, TNF, TRAF2, TRAF5, cIAP1, and / or cIAP2.

[0048] TNFR1 complex I does not contain RIPK3, procystein, or caspase.

[0049] In some implementations, the TNFR1 complex is TNFR1 complex II.

[0050] When RIPK1 is not fully ubiquitinated, it dissociates from the core signal transduction complex. Once released into the cytosol, RIPK1 can associate with other components of the TNFR1 complex II. Therefore, the TNFR1 complex II does not contain TNFR1 or TNF.

[0051] In some embodiments, TNFR1 complex II comprises FADD, RIPK1, and RIPK3. In some embodiments, TNFR1 complex II comprises TRADD. In some embodiments, TNFR1 complex II comprises procysteine. In some embodiments, TNFR1 complex II comprises procysteine-3. In some embodiments, TNFR1 complex II comprises procysteine-8. In some embodiments, TNFR1 complex II comprises procysteine-10. In some embodiments, TNFR1 complex II comprises caspase. In some embodiments, TNFR1 complex II comprises caspase-3. In some embodiments, TNFR1 complex II comprises caspase-8. In some embodiments, TNFR1 complex II comprises caspase-10. In some embodiments, TNFR1 complex II comprises FADD, RIPK1, RIPK3, TRADD, procysteine, and / or caspase.

[0052] Variants of TNFR1 complex II are well known to those skilled in the art. In some embodiments, the TNFR1 complex is TNFR1 complex IIa, TNFR1 complex IIb, or TNFR1 complex IIc.

[0053] The formation of TNFR1 complex IIa is initiated when RIPK1 is deubiquitinated via cylindromaein (CYLD). Incomplete ubiquitination of RIPK1 can also be caused by the consumption or degradation of cIAP1 / 2, leading to a lack or reduction of the K63 polyubiquitin chain added to RIPK1, resulting in the formation of complex IIb. Complex IIb contains the same components as complex IIa, except that it lacks TRADD. Both TNFR1 complex IIa and TNFR1 complex IIb can activate caspase, and caspase-mediated protein cleavage upregulates cell death mechanisms such as apoptosis and pyroptosis. Pyroptosis is a programmed form of lytic cell death. Pyroptosis is triggered downstream of the inflammasome complex via caspase-mediated quercetin D (GSDMD) cleavage. TNFR1 complex IIc is formed in the absence of caspase and is capable of necroptosis via the activity of RIPK1 and RIPK3. Necrotropism is a programmed form of necrosis.

[0054] In some implementations, TNFR1 complex II is TNFR1 complex IIa.

[0055] In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, and TRADD. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, and procysteine. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, and procysteine-8. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, and procysteine-3. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, and procysteine-10. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, and caspase. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, and caspase-8. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, and caspase-3. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, and caspase-10. In some embodiments, TNFR1 complex IIa comprises FADD, RIPK1, RIPK3, TRADD, caspase-3, caspase-8, and / or caspase-10.

[0056] In some implementations, the TNFR1 complex is TNFR1 complex IIb.

[0057] In some embodiments, TNFR1 complex IIb comprises FADD, RIPK1, and RIPK3. In some embodiments, TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, and procysteine. In some embodiments, TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, and procysteine-8. In some embodiments, TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, and procysteine-3. In some embodiments, TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, and procysteine-10. In some embodiments, TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, and caspase. In some embodiments, TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, and caspase-8. In some embodiments, TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, and caspase-3. In some embodiments, the TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, and caspase-10. In some embodiments, the TNFR1 complex IIb comprises FADD, RIPK1, RIPK3, caspase-3, caspase-8, and / or caspase-10.

[0058] In some implementations, the TNFR1 complex is TNFR1 complex IIc.

[0059] In some embodiments, TNFR1 complex IIc does not contain caspase or pro-caspase. In some embodiments, TNFR1 complex IIc contains RIPK1. In some embodiments, TNFR1 complex IIc contains RIPK3. In some embodiments, TNFR1 complex IIc contains FADD. In some embodiments, TNFR1 complex IIc contains both RIPK1 and RIPK3. In some embodiments, TNFR1 complex IIc contains FADD, RIPK1, and RIPK3. In some embodiments, TNFR1 complex IIc contains FADD, RIPK1, RIPK3, and / or TRADD.

[0060] Human TRADD is a 34 kDa protein with two functional domains linked by a non-structured peptide of approximately 37 amino acid residues (Li et al., Comput Struct Biotechnol J. 2020; 18: 2867–2876). TRADD is a death domain containing an adaptor molecule. TRAD is capable of binding TRAF2 and reducing the recruitment of inhibitory apoptosis protein (IAP) via TRAF2. The protein can also interact with FAS and FADD. In some embodiments, TRADD is a component of the TNFR1 complex. In some embodiments, TRADD is a component of TNFR1 complex I. In some embodiments, TRADD is a component of TNFR1 complex II. In some embodiments, TRADD is a component of TNFR1 complex IIa. In some embodiments, TRADD is a component of TNFR1 complex IIc.

[0061] TRAF2 is an intracellular adaptor protein with E3 ligase activity (Siegmund et al., Cancers (Basel). 2022 Aug; 14(16): 4055). The protein complex formed by TRAF2 and TRAF1 interacts with IAP family members cIAP1 and cIAP2 and acts as a mediator of anti-apoptotic signals from the TNF receptor. The interaction of this protein with TRADD (a TNF receptor-associated apoptosis signaling protein) ensures the recruitment of IAP for direct inhibition of caspase activation. In some embodiments, TRAF2 is a component of the TNFR1 complex. In some embodiments, TRAF2 is a component of TNFR1 complex I. TRAF5 is functionally similar to TRAF2 because they both mediate NF-κB activation and suggest that TRAF5 is a signaling protein for LT-βR (Nakano et al., JBC. 1996. 271(25):14661-14664). In some embodiments, TRAF5 is a component of the TNFR1 complex. In some implementations, TRAF5 is a component of TNFR1 complex I.

[0062] cIAP1 and cIAP2 are members of the family of highly conserved and extremely important inhibitory apoptosis proteins (IAPs) used to alleviate intrinsic and extrinsic death signal transduction (Graber and Holcik. Cell Death & Disease. 2011. Vol. 2, e135). In some embodiments, cIAP1 is a component of the TNFR1 complex. In some embodiments, cIAP1 is a component of TNFR1 complex I. In some embodiments, cIAP2 is a component of the TNFR1 complex. In some embodiments, cIAP2 is a component of TNFR1 complex I.

[0063] RIPK1 and RIPK3 (receptor-interacting serine / threonine protein kinases 1 / 3) mediate necrotizing apoptosis through their RIP isomorphic interaction motifs (Newton. Trends Cell Biol. 2015 Jun;25(6):347-53). In some embodiments, RIPK1 is a component of the TNFR1 complex. In some embodiments, RIPK1 is a component of TNFR1 complex I. In some embodiments, RIPK1 is a component of TNFR1 complex II. In some embodiments, RIPK1 is a component of TNFR1 complex IIa. In some embodiments, RIPK1 is a component of TNFR1 complex IIb. In some embodiments, RIPK1 is a component of TNFR1 complex IIc. In some embodiments, RIPK3 is a component of the TNFR1 complex. In some embodiments, RIPK3 is a component of TNFR1 complex II. In some embodiments, RIPK3 is a component of TNFR1 complex IIb. In some embodiments, RIPK3 is a component of TNFR1 complex IIc.

[0064] FADD is a 28-kDa adaptor protein that is a key component of the apoptosis signaling pathway of the death receptor. It initiates the formation of the death-inducible signaling complex and acts as a docking site for caspase-8 (Osborn et al., 2010. PNAS. 107(29) 13034-13039). In some embodiments, FADD is a component of the TNFR1 complex. In some embodiments, RIPK3 is a component of TNFR1 complex II. In some embodiments, RIPK3 is a component of TNFR1 complex IIa.

[0065] Caspases are a family of endopeptides that provide crucial links in the cellular regulatory network controlling inflammation and cell death. The activation of these enzymes is tightly controlled by their production as inactive procystein (zymogens), which acquire catalytic activity following signal transduction events that promote their aggregation into dimers or large molecular complexes. Caspases are key regulators of apoptosis and inflammation. Insufficient caspase activity can promote tumorigenesis or infection; excessive caspase activity can promote neurodegeneration or inflammatory conditions (McIlwain et al., 2013. ColdSpring Harb Perspect Biol. 5(4): a008656.).

[0066] The initiation of apoptosis requires the conversion of procystein into active caspase. Active or mature caspase is referred to as caspase in this paper. Procystein comprises a prodomain, a large protease subunit, and a small protease subunit. Activation of caspase requires proteolytic processing.

[0067] Caspase-3 (CPP32, apopain, or YAMA) is an endopeptide containing two subunits with 3 and 5 sulfhydryl functional groups, respectively (Miller, 1997). The role of caspase-3 in apoptosis is to cleave and activate caspase-6, caspase-7, and caspase-9 to break down apoptotic cells, which are then removed (Kashyap et al., 2021. Advances in Protein Chemistry and Structural Biology. Vol. 125, pp. 73-120).

[0068] In some embodiments, procysteine-3 is a component of the TNFR1 complex. In some embodiments, procysteine-3 is a component of TNFR1 complex II. In some embodiments, procysteine-3 is a component of TNFR1 complex IIa. In some embodiments, procysteine-3 is a component of TNFR1 complex IIb.

[0069] In some embodiments, caspase-3 is a component of the TNFR1 complex. In some embodiments, caspase-3 is a component of TNFR1 complex II. In some embodiments, caspase-3 is a component of TNFR1 complex IIa. In some embodiments, caspase-3 is a component of TNFR1 complex IIb.

[0070] Caspase-8 (also known as FADD-like IL-1β convertase (FLICE), ALPS2B, CAP4, MACH, and MCH5) is an enzyme containing an N-terminal FADD-like death effector domain. Caspase-8 interacts with FADD. Caspase-8 cleaves downstream effector caspases, which mediates apoptosis (Kashyap et al., 2021. Advances in Protein Chemistry and Structural Biology. Vol. 125, pp. 73-120).

[0071] In some embodiments, procysteine-8 is a component of the TNFR1 complex. In some embodiments, procysteine-8 is a component of TNFR1 complex II. In some embodiments, procysteine-8 is a component of TNFR1 complex IIa. In some embodiments, procysteine-8 is a component of TNFR1 complex IIb.

[0072] In some embodiments, caspase-8 is a component of the TNFR1 complex. In some embodiments, caspase-8 is a component of TNFR1 complex II. In some embodiments, caspase-8 is a component of TNFR1 complex IIa. In some embodiments, caspase-8 is a component of TNFR1 complex IIb.

[0073] Caspase-10 (also known as ALPS2, FLICE2, and MCH4) cleaves and activates caspase-3 and caspase-7, and the protein itself is processed by caspase-8. Caspase-10 has a similar activation mechanism and substrate preference to caspase-8 (Wachmann et al., Biochemistry. 2010. 49(38): 8307–8315).

[0074] In some embodiments, procysteine-10 is a component of the TNFR1 complex. In some embodiments, procysteine-10 is a component of TNFR1 complex II. In some embodiments, procysteine-10 is a component of TNFR1 complex IIa. In some embodiments, procysteine-10 is a component of TNFR1 complex IIb.

[0075] In some embodiments, caspase-10 is a component of the TNFR1 complex. In some embodiments, caspase-10 is a component of TNFR1 complex II. In some embodiments, caspase-10 is a component of TNFR1 complex IIa. In some embodiments, caspase-10 is a component of TNFR1 complex IIb.

[0076] The inventors made an unexpected discovery that ribonucleic acid (RNA)-binding protein (RBP) and RNA are essential components of the TNFR1 complex.

[0077] In some embodiments, the component of the TNFR1 complex is RBP. In some embodiments, the component of TNFR1 complex I is RBP. In some embodiments, the component of TNFR1 complex II is RBP. In some embodiments, the component of TNFR1 complex IIa is RBP. In some embodiments, the component of TNFR1 complex IIb is RBP. In some embodiments, the component of TNFR1 complex IIc is RBP.

[0078] RBPs are RNA-binding proteins. In some embodiments, RBPs are capable of binding RNA. In some embodiments, RBPs bind RNA. In some embodiments, RBPs bind to RNA. In some embodiments, RBPs contain an RNA-binding domain (RBD). In some embodiments, RBPs contain an RBD and bind RNA through the RBD.

[0079] The binding of RBP to RNA can also be described as RBP association with RNA, or RBP interaction with RNA. RBP binds to RNA (or associates / interacts with RNA) through molecular interactions between the chemical moieties between protein residues and RNA nucleotides. In some embodiments, the molecular interactions between RBP and RNA include hydrogen bonds, van der Waals interactions, hydrophobic interactions, and stacking interactions. The interaction of RBP with RNA was reviewed in Corley et al. (2020. Molecular Cell 78, 9-29), which is incorporated herein by reference in its entirety.

[0080] In some embodiments, RBP is capable of binding to RNA, which is a component of the TNFR1 complex. In some embodiments, RBP is capable of binding to RNA, which is a component of TNFR1 complex I. In some embodiments, RBP is capable of binding to RNA, which is a component of TNFR1 complex II. In some embodiments, RBP is capable of binding to RNA, which is a component of TNFR1 complex IIa. In some embodiments, RBP is capable of binding to RNA, which is a component of TNFR1 complex IIb. In some embodiments, RBP is capable of binding to RNA, which is a component of TNFR1 complex IIc.

[0081] In some embodiments, RBP binds to RNA, said RNA being a component of the TNFR1 complex. In some embodiments, RBP binds to RNA, said RNA being a component of TNFR1 complex I. In some embodiments, RBP binds to RNA, said RNA being a component of TNFR1 complex II. In some embodiments, RBP binds to RNA, said RNA being a component of TNFR1 complex IIa. In some embodiments, RBP binds to RNA, said RNA being a component of TNFR1 complex IIb. In some embodiments, RBP binds to RNA, said RNA being a component of TNFR1 complex IIc.

[0082] In some embodiments, RBP is FTO or nuclear export protein-5 (XPO5). In some embodiments, RBP is FTO. In some embodiments, RBP is XPO5.

[0083] FTO (also known as α-ketoglutarate-dependent dioxygenase FTO) is N 6 Methyladenosine (m6A) demethylase is a protein associated with fat mass and obesity, and mediates oxidative demethylation of various RNA species. In this specification, "FTO" refers to FTO from any species and includes FTO isoforms, fragments, variants (including mutants), or homologs from any species. In some embodiments, FTO is human FTO.

[0084] Human FTO is a protein identifiable by UniProt: Q9C0B1. Typical isoforms of FTO have the amino acid sequence shown in SEQ ID NO:1. Typical isoforms of FTO include an N-terminal domain (SEQ ID NO:2), a Fe2OG dioxygenase domain (SEQ ID NO:3), and a C-terminal domain (SEQ ID NO:4). The mature form of human FTO is shown in SEQ ID NO:5.

[0085] XPO5 is an RBP traditionally known as a microRNA (miRNA) transporter. In this specification, "XPO5" means XPO5 from any species and includes XPO5 isoforms, fragments, variants (including mutants), or homologs from any species. In some embodiments, XPO5 is human XPO5.

[0086] Human XPO5 is a protein that can be identified by UniProt: Q9HAV4. Typical isoforms of XPO5 have the amino acid sequence shown in SEQ ID NO:6, including a Ran-interacting domain (SEQ ID NO:7), an ILF3-interacting domain (SEQ ID NO:8), and a precursor-miRNA binding domain at positions 641-642 of SEQ ID NO:6 (SEQ ID NO:9).

[0087] As used herein, a protein “fragment,” “variant,” or “homology” may optionally be characterized as having at least 60%, preferably 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity with a reference protein (e.g., a reference isoform). In some embodiments, fragments, variants, isoforms, and homologs of a reference protein may be characterized by their ability to perform the functions performed by the reference protein.

[0088] A “fragment” typically refers to a portion of a reference protein. A “variant” typically refers to a protein having one or more amino acid substitutions, insertions, deletions, or other modifications relative to the amino acid sequence of the reference protein, but retaining a high degree of sequence identity (e.g., at least 60%) with the amino acid sequence of the reference protein. An “isoform” typically refers to a variant of the reference protein expressed by a species of the same species as the reference protein. A “homolog” typically refers to a variant of the reference protein produced by a different species compared to the species of the reference protein.

[0089] The “fragment” of the reference protein may have any length (in terms of amino acid number), but may optionally be at least 20% of the length of the reference protein (i.e., the protein from which the fragment is derived), and may have a maximum length of one of 50%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the length of the reference protein.

[0090] RBP fragments can have a minimum length of one of 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, or 1200 amino acids, and a maximum length of one of 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, or 1200 amino acids.

[0091] In some embodiments, the RBP is a mammalian RBP (e.g., primate (rhesus monkey, cynomolgus monkey, non-human primate, or human) and / or rodent (e.g., rat or mouse) RBP). Isotypes, fragments, variants, or homologs of the RBP may optionally be characterized as having at least 70%, preferably 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity with an immature or mature RBP isotype from a given species (e.g., human).

[0092] Isoforms, fragments, variants, or homologs may optionally be functional isoforms, fragments, variants, or homologs, for example, having the functional properties / activities of a reference RBP, as determined by an appropriate assay of the functional properties / activities. For example, isoforms, fragments, variants, or homologs of RBP may show association with RNA and be able to bind to RNA that is a component of the TNFR1 complex.

[0093] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and / or SEQ ID NO:9.

[0094] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with, one of the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and / or SEQ ID NO:9, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100%.

[0095] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and / or SEQ ID NO:5.

[0096] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and / or SEQ ID NO:5, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100%.

[0097] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with SEQ ID NO:1, SEQ ID NO:3, and / or SEQ ID NO:4. In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with SEQ ID NO:1. In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with SEQ ID NO:3. In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with SEQ ID NO:4.

[0098] In some embodiments, the RBP comprises, or is composed of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequence of SEQ ID NO:1, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% amino acid sequence identity.

[0099] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequence of SEQ ID NO:2, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% amino acid sequence identity.

[0100] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequence of SEQ ID NO:3, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% amino acid sequence identity.

[0101] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequence of SEQ ID NO:4, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% amino acid sequence identity.

[0102] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequence of SEQ ID NO:5, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% amino acid sequence identity.

[0103] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:6, SEQ ID NO:7, and / or SEQ ID NO:8. In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:6. In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:7. In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:8.

[0104] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with, the amino acid sequence of SEQ ID NO:6, SEQ ID NO:7 and / or SEQ ID NO:8, for example, ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99% or 100% amino acid sequence identity.

[0105] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequence of SEQ ID NO:6, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% amino acid sequence identity.

[0106] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequence of SEQ ID NO:7, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% amino acid sequence identity.

[0107] In some embodiments, the RBP comprises, or consists of, an amino acid sequence having at least 75% amino acid sequence identity with the amino acid sequence of SEQ ID NO:8, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% amino acid sequence identity.

[0108] In some embodiments, the RBP comprises, or consists of, the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and / or SEQ ID NO:9.

[0109] In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:1. In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:2. In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:3. In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:4. In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:5. In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:6. In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:7. In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:8. In some embodiments, the RBP comprises, or is composed of, the amino acid sequence of SEQ ID NO:9.

[0110] In some embodiments, a component of the TNFR1 complex is RNA. In some embodiments, a component of TNFR1 complex I is RNA. In some embodiments, a component of TNFR1 complex II is RNA. In some embodiments, a component of TNFR1 complex IIa is RNA. In some embodiments, a component of TNFR1 complex IIb is RNA. In some embodiments, a component of TNFR1 complex IIc is RNA.

[0111] Ribonucleic acid (RNA) is a nucleic acid molecule assembled as chains of nucleotides. RNA differs chemically from DNA in two ways: (1) the nucleotides in RNA are ribonucleotides because they contain ribose, not deoxyribose; and (2) the bases in RNA are uracil (U), not thymine (T), which is present in DNA. RNA is essential for most biological functions, either by performing its function itself (non-coding RNA) or by forming templates for protein production as messenger RNA (mRNA). RNA is well understood by those skilled in the art. Types of RNA are reviewed, for example, by Bhatti et al. (Metab BrainDis. 2021; 36(6): 1119–1134).

[0112] The TNFR1 complex component, as an RNA molecule, can also be referred to as the "RNA component of the TNFR1 complex." The RNA component of the TNFR1 complex can be RNA capable of interacting with components of the TNFR1 complex. The RNA component of the TNFR1 complex can be RNA identified as interacting with components of the TNFR1 complex, for example, by protein-RNA interaction assays (e.g., RNA pull-down assays, oligonucleotide-targeted RNase H protection assays, target measurement via APOBEC-mediated assays (STAMP), and / or fluorescence in situ hybridization co-localization). In some embodiments, the RNA component of the TNFR1 complex is identified as RNA interacting with components of the TNFR1 complex by a STAMP assay.

[0113] In some implementations, RNA is capable of binding to RBP. In some implementations, RNA binds to RBP. In some implementations, RNA binds to RBP.

[0114] In some embodiments, RNA can bind to the RBP component of the TNFR1 complex. In some embodiments, RNA can bind to the RBP component of TNFR1 complex I. In some embodiments, RNA can bind to the RBP component of TNFR1 complex II. In some embodiments, RNA can bind to the RBP component of TNFR1 complex IIa. In some embodiments, RNA can bind to the RBP component of TNFR1 complex IIb. In some embodiments, RNA can bind to the RBP component of TNFR1 complex IIc.

[0115] The binding of RNA to RBP can also be defined as RNA-RBP association, or RNA-RBP interaction. RNA binds to (or associates with / interacts with) RBP through molecular interactions between the chemical moieties between protein residues and RNA nucleotides. In some embodiments, the molecular interactions between RNA and RBP include hydrogen bonds, van der Waals interactions, hydrophobic interactions, and stacking interactions. The interaction of RBP with RNA was reviewed in Corley et al. (2020. Molecular Cell 78, 9-29), which is incorporated herein by reference in its entirety.

[0116] In some implementations, the RNA is messenger RNA (mRNA), intron-derived RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), telomerase RNA, tRNA fragment (tRF), tRNA-derived stress-inducible RNA (tiRNA), microRNA (miRNA), small interfering RNA (siRNA), Piwi-interacting RNA (piRNA), enhancer RNA (eRNA), circular RNA, Y RNA, centromere repeat sequence-associated short interacting (crasi) RNA, telomere-specific small RNA (Tels RNA), chromatin-associated RNA (caRNA), promoter-associated RNA (paRNA), endogenous retroviral element (ERE) RNA, long terminal repeat (LTR) RNA, endogenous retroviral-K (ERVK) RNA, long interstitial nuclear element (LINE) RNA, and short interstitial nuclear element (SINE) RNA or Alu element.

[0117] In some implementations, the RNA is non-coding RNA.

[0118] Non-coding RNA is an RNA molecule that is not translated into protein. In some embodiments, non-coding RNA performs the function of an RNA molecule. In other words, non-coding RNA can perform its function without being transcribed into a protein. Based on transcript size, non-coding RNA can be broadly classified into two domains: small non-coding RNA (sncRNA; < 200 nucleotides) and long non-coding RNA (lncRNA; > 200 nucleotides). In some embodiments, the non-coding RNA is either lncRNA or sncRNA. In some embodiments, the non-coding RNA is lncRNA. In some embodiments, the non-coding RNA is sncRNA.

[0119] In some implementations, the non-coding RNA is intron-derived RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), telomerase RNA, tRNA fragments (tRF), stress-inducible RNA derived from tRNA (tiRNA), microRNA (miRNA), small interfering RNA (siRNA), Piwi-interacting RNA (piRNA), enhancer RNA (eRNA), circular RNA, Y RNA, centromere repeat sequence-associated short interacting (crasi) RNA, telomere-specific small RNA (Tels RNA), chromatin-associated RNA (caRNA), promoter-associated RNA (paRNA), endogenous retroviral element (ERE) RNA, long terminal repeat (LTR) RNA, endogenous retroviral-K (ERVK) RNA, long interstitial nuclear element (LINE) RNA, and short interstitial nuclear element (SINE) RNA or Alu element.

[0120] In some implementations, the non-coding RNA is ERE RNA, paRNA, LTR RNA, ERVK RNA, LINE RNA, SINE RNA, and / or Alu elements.

[0121] In some embodiments, the RNA is ERE RNA. In some embodiments, the RNA is paRNA. In some embodiments, the RNA is LTR RNA. In some embodiments, the RNA is ERVK RNA. In some embodiments, the RNA is LINERNA. In some embodiments, the RNA is SINE RNA. In some embodiments, the RNA is an Alu element. In some embodiments, the RNA is mRNA.

[0122] It is known in the art that mRNAs, in addition to their roles in protein translation, also possess non-coding functions (Boraas et al., Non-coding function for mRNAs in Focal Adhesion Architecture and Mechanotransduction. bioRxiv. 2021). In some embodiments, the RNA is a coding RNA with non-coding functionality. In some embodiments, the RNA is a mRNA with non-coding functionality. In some embodiments, the mRNA is intron-derived mRNA.

[0123] DNA transcription yields RNA, complementary to the template DNA strand. The RNA contains the base uracil (U) in place of thymine (T), meaning that uracil (U) replaces thymine in the RNA. Uracil is present in RNA but not in DNA. Thymine is present in DNA but not in RNA. Both uracil and thymine are complementary to adenine (A). The sequence of the RNA molecule corresponding to a given DNA molecule can be determined by replacing the thymine (T) bases of the given DNA molecule with uracil (U) bases; the identities and positions of the adenine (A), cytosine (C), and guanine (G) bases remain unchanged.

[0124] The sequence of an RNA molecule complementary to a DNA molecule can be determined based on nucleobase complementarity. Adenine (A) is complementary to uracil (U), and cytosine (C) is complementary to guanine (G). Technicians understand the differences between DNA and RNA and are able to determine complementary RNA sequences based on a DNA sequence template (manually or using appropriate tools / programs). A large number of freely available bioinformatics programs can be used to determine the sequence of an RNA molecule transcribed from a given DNA molecule (e.g., transcription and translation tools, freely available from La Universidad de Alcalá), and technicians will understand this and be able to use such tools. Furthermore, technicians can use computational environments such as MATLAB to determine the sequence of an RNA molecule transcribed from a given DNA molecule.

[0125] Tables 1 and 2 also show the genomic locations of DNA sequences encoding RNA, which was identified as RNA molecules interacting with components of the TNFR1 complex. Therefore, Tables 1 and 2 can be used to determine the ribonucleotide sequences of the RNA components of the TNFR1 complex.

[0126] For example, the nucleotide sequence of the AFF3 RNA molecule is a ribonucleotide sequence transcribed from positions 100418069 to 100745658 on the negative strand of human chromosome 2 (Table 1, locus #7).

[0127] For example, the DNA sequence at positions 100418069 to 100418168 on human chromosome 2 is: TTCCCATTTCCTTCGGGACAATCTGGATGCAGGAGCTGCTGTGCTAAAAAGTTTTTCACCATGTCACTAGCTTGACATCTACTTTTACGACCTCTCATTC (SEQ ID NO: 14).

[0128] RNA transcribed from positions 100418069 to 100418168 on the negative strand of human chromosome 2: GAAUGAGAGGUCGUAAAAGUAGAUGUCAAGCUAGUGACAUGGUGAAAACUUUUUAGCACAGCAGCCUCCUGCAUCCAGAUUGUCCCGAAGGAAAUGGGAA (SEQ ID NO: 24).

[0129] To give a further example, the nucleotide sequence of the RNA molecule referred to in this article as “RUPTR7” is a ribonucleotide sequence transcribed from positions 23426206 to 23433775 on the positive strand of human chromosome 20 (Table 2, locus #107).

[0130] In some embodiments, the RNA is a nucleotide sequence or RNA consisting of a nucleotide sequence having at least 70% nucleotide sequence identity with the RNA transcribed from the loci identified in Table 1 or Table 2.

[0131] In some embodiments, the RNA is a nucleotide sequence or RNA comprising at least 75% nucleotide sequence identity with the nucleotide sequence of RNA transcribed from a locus identified in Table 1 or Table 2, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100%.

[0132] Table 1: Genomic locations of RNA transcriptions used for identification by the STAMP assay Table 2: Genomic locations of RNA transcriptions used for identification by the STAMP assay In some embodiments, the RNA is an RNA consisting of a nucleotide sequence having at least 70% nucleotide sequence identity with, or composed of, a nucleotide sequence selected from: (#1a) Nucleotide sequence of RNA transcribed from positions 145959299 to 145969262 on human chromosome 1.

[0133] (#1b) Nucleotide sequence of RNA transcribed from position 147502825 to 147510900 on human chromosome 1.

[0134] (#2) Nucleotide sequence of RNA transcribed from position 111659317 to 111846428 on human chromosome 7.

[0135] (#3) Nucleotide sequence of RNA transcribed from position 86396528 to 86922184 on human chromosome 4.

[0136] (#4) The nucleotide sequence of RNA transcribed from position 165899418 to 166077274 on human chromosome 6.

[0137] (#5) The nucleotide sequence of RNA transcribed from position 68290286 to 68644674 on human chromosome 14.

[0138] (#6) Nucleotide sequence of RNA transcribed from positions 34254566 to 34379410 on human chromosome 11.

[0139] (#7) The nucleotide sequence of RNA transcribed from position 100418069 to 100745658 on human chromosome 2.

[0140] (#8) The nucleotide sequence of RNA transcribed from position 86522442 to 86669286 on human chromosome 4.

[0141] (#9) The nucleotide sequence of RNA transcribed from position 99261673 to 99434556 on human chromosome 15.

[0142] (#10) Nucleotide sequence of RNA transcribed from positions 39917349 to 40178399 on human chromosome 13.

[0143] (#11) Nucleotide sequence of RNA transcribed from positions 34603358 to 35104032 on human chromosome 10.

[0144] (#12) Nucleotide sequence of RNA transcribed from positions 126719089 to 126784246 on human chromosome 10.

[0145] (#13) Nucleotide sequence of RNA transcribed from position 128596422 to 128841778 on human chromosome 6.

[0146] (#14) The nucleotide sequence of RNA transcribed from position 64611344 to 64672035 on human chromosome 3.

[0147] (#15) The nucleotide sequence of RNA transcribed from positions 89445931 to 89526681 on human chromosome 16.

[0148] (#16) The nucleotide sequence of RNA transcribed from positions 1893151 to 2245677 on human chromosome 6.

[0149] (#17) Nucleotide sequence of RNA transcribed from positions 134256502 to 134309412 on human chromosome 8.

[0150] (#18) The nucleotide sequence of RNA transcribed from positions 106964857 to 107157063 on human chromosome 7.

[0151] (#19) Nucleotide sequence of RNA transcribed from position 188347397 to 188533178 on human chromosome 3.

[0152] (#20) Nucleotide sequence of RNA transcribed from positions 140514285 to 140590155 on human chromosome 9.

[0153] (#21) Nucleotide sequence of RNA transcribed from positions 61542606 to 61920401 on human chromosome 3.

[0154] (#22) Nucleotide sequence of RNA transcribed from positions 65892334 to 66385973 on human chromosome 5.

[0155] (#23) The nucleotide sequence of RNA transcribed from positions 110151629 to 110176276 on human chromosome 12.

[0156] (#24) Nucleotide sequence of RNA transcribed from position 187869711 to 188112441 on human chromosome 3.

[0157] (#25) The nucleotide sequence of RNA transcribed from positions 64356475 to 64590847 on human chromosome 17.

[0158] (#26) Nucleotide sequence of RNA transcribed from position 10195009 to 10245811 on human chromosome 3.

[0159] (#27) Nucleotide sequence of RNA transcribed from position 106330722 to 106659430 on human chromosome 8.

[0160] (#28) The nucleotide sequence of RNA transcribed from positions 100558333 to 100680965 on human chromosome 11.

[0161] (#29) Nucleotide sequence of RNA transcribed from positions 149041318 to 149386381 on human chromosome 4.

[0162] (#30) The nucleotide sequence of RNA transcribed from positions 245999527 to 246670404 on human chromosome 1.

[0163] (#31) Nucleotide sequence of RNA transcribed from positions 29677541 to 29904086 on the human X chromosome.

[0164] (#32) Nucleotide sequence of RNA transcribed from positions 23250209 to 23521712 on human chromosome 3.

[0165] (#33) Nucleotide sequence of RNA transcribed from positions 66975015 to 67215923 on human chromosome 14.

[0166] (#34) The nucleotide sequence of RNA transcribed from positions 7566739 to 7966915 on human chromosome 18.

[0167] (#35) The nucleotide sequence of RNA transcribed from positions 59826238 to 60230486 on human chromosome 20.

[0168] (#36) The nucleotide sequence of RNA transcribed from positions 104918024 to 105155677 on human chromosome 12.

[0169] (#37) Nucleotide sequence of RNA transcribed from position 143671031 to 147850490 on human chromosome 1.

[0170] (#38) The nucleotide sequence of RNA transcribed from positions 40812253 to 41217827 on human chromosome 4.

[0171] (#39) Nucleotide sequence of RNA transcribed from position 19837625 to 19869554 on human chromosome 6.

[0172] (#40) Nucleotide sequences of RNA transcribed from positions 189696844 to 189838594 on human chromosome 3.

[0173] (#41) The nucleotide sequence of RNA transcribed from positions 148736110 to 148766960 on human chromosome 1.

[0174] (#42) Nucleotide sequence of RNA transcribed from positions 11802659 to 11993721 on human chromosome 12.

[0175] (#43) The nucleotide sequence of RNA transcribed from position 102247784 to 102456356 on human chromosome 2.

[0176] (#44) Nucleotide sequence of RNA transcribed from positions 171757455 to 171959434 on human chromosome 3.

[0177] (#45) Nucleotide sequence of RNA transcribed from position 188124039 to 188343878 on human chromosome 3.

[0178] (#46) Nucleotide sequence of RNA transcribed from positions 153191855 to 153378429 on human chromosome 2.

[0179] (#47) The nucleotide sequence of RNA transcribed from positions 184834202 to 184943833 on human chromosome 1.

[0180] (#48) The nucleotide sequence of RNA transcribed from positions 119653285 to 119807106 on human chromosome 3.

[0181] (#49) The nucleotide sequence of RNA transcribed from positions 143115825 to 143285504 on human chromosome 6.

[0182] (#50) The nucleotide sequence of RNA transcribed from positions 99641779 to 99758184 on human chromosome 3.

[0183] (#51) The nucleotide sequence of RNA transcribed from positions 17420660 to 17494454 on the human X chromosome.

[0184] (#52) Nucleotide sequence of RNA transcribed from position 85923977 to 86198925 on human chromosome 15.

[0185] (#53) The nucleotide sequence of RNA transcribed from positions 44854771 to 45229571 on human chromosome 6.

[0186] (#54) Nucleotide sequence of RNA transcribed from positions 79733899 to 79850706 on human chromosome 8.

[0187] (#55) Nucleotide sequence of RNA transcribed from positions 75935953 to 76056352 on human chromosome 13.

[0188] (#56) The nucleotide sequence of RNA transcribed from position 144301054 to 144541576 on human chromosome 1.

[0189] (#57) The nucleotide sequence of RNA transcribed from positions 36177613 to 36425639 on human chromosome 22.

[0190] (#58) Nucleotide sequence of RNA transcribed from positions 28012120 to 28209146 on human chromosome 7.

[0191] (#59) Nucleotide sequence of RNA transcribed from positions 1607960 to 1892955 on human chromosome 6.

[0192] (#60) The nucleotide sequence of RNA transcribed from positions 128246768 to 128469388 on human chromosome 9.

[0193] (#61) The nucleotide sequence of RNA transcribed from positions 116854504 to 116968939 on human chromosome 11.

[0194] (#62) Nucleotide sequence of RNA transcribed from positions 47127605 to 47233991 on human chromosome 13.

[0195] (#63) Nucleotide sequence of RNA transcribed from positions 206667573 to 206757842 on human chromosome 1.

[0196] (#64) The nucleotide sequence of RNA transcribed from positions 60596474 to 60768540 on human chromosome 5.

[0197] (#65) The nucleotide sequence of RNA transcribed from positions 76114103 to 76432164 on human chromosome 10.

[0198] (#66) The nucleotide sequence of RNA transcribed from position 7971111 to 8406585 on human chromosome 18.

[0199] (#67) The nucleotide sequence of RNA transcribed from positions 29060442 to 29545467 on human chromosome 11.

[0200] (#68) The nucleotide sequence of RNA transcribed from positions 16371311 to 16437191 on human chromosome 21.

[0201] (#69) The nucleotide sequence of RNA transcribed from positions 131409474 to 131440762 on human chromosome 5.

[0202] (#70) The nucleotide sequence of RNA transcribed from position 49962691 to 50114102 on human chromosome 20.

[0203] (#71) The nucleotide sequence of RNA transcribed from positions 3340909 to 4167031 on human chromosome 7.

[0204] (#72) Nucleotide sequence of RNA transcribed from position 29650814 to 30051606 on human chromosome 3.

[0205] (#73) Nucleotide sequence of RNA transcribed from positions 12008853 to 12151073 on human chromosome 6.

[0206] (#74) The nucleotide sequence of RNA transcribed from positions 192554458 to 192635399 on human chromosome 3.

[0207] (#75) The nucleotide sequence of RNA transcribed from position 74451668 to 74710375 on human chromosome 13.

[0208] (#76) The nucleotide sequence of RNA transcribed from positions 234040499 to 234383480 on human chromosome 1.

[0209] (#77) The nucleotide sequence of RNA transcribed from positions 184020384 to 184088355 on human chromosome 4.

[0210] (#78) The nucleotide sequence of RNA transcribed from positions 108103176 to 108335534 on human chromosome 13.

[0211] (#79) The nucleotide sequence of RNA transcribed from positions 23435467 to 23494419 on human chromosome 1.

[0212] (#80) The nucleotide sequence of RNA transcribed from position 49962374 to 50113788 on human chromosome 5.

[0213] (#81) Nucleotide sequence of RNA transcribed from positions 16830300 to 17076624 on human chromosome 1.

[0214] (#82) The nucleotide sequence of RNA transcribed from positions 15244245 to 15452572 on human chromosome 6.

[0215] (#83) Nucleotide sequence of RNA transcribed from positions 37784676 to 38118126 on human chromosome 6.

[0216] (#84) The nucleotide sequence of RNA transcribed from position 20323631 to 20457117 on human chromosome 4.

[0217] (#85) Nucleotide sequence of RNA transcribed from positions 65339155 to 65907397 on human chromosome 3.

[0218] (#86) The nucleotide sequence of RNA transcribed from position 108082406 to 108460035 on human chromosome 5.

[0219] (#87) Nucleotide sequence of RNA transcribed from positions 70479923 to 70588817 on human chromosome 17.

[0220] (#88) The nucleotide sequence of RNA transcribed from position 10095845 to 10319831 on human chromosome 11.

[0221] (#89) Nucleotide sequence of RNA transcribed from positions 109150930 to 109276049 on human chromosome 2.

[0222] (#90) The nucleotide sequence of RNA transcribed from positions 21376800 to 21554467 on human chromosome 1.

[0223] (#91) Nucleotide sequence of RNA transcribed from positions 71471994 to 71633960 on human chromosome 15.

[0224] (#92) Nucleotide sequence of RNA transcribed from positions 235423963 to 235491373 on human chromosome 1.

[0225] (#93) The nucleotide sequence of RNA transcribed from positions 126475318 to 126692155 on human chromosome 9.

[0226] (#94) The nucleotide sequence of RNA transcribed from positions 167710188 to 167813852 on human chromosome 5.

[0227] (#95) The nucleotide sequence of RNA transcribed from positions 10560487 to 10657638 on human chromosome 5.

[0228] (#96) The nucleotide sequence of RNA transcribed from positions 48011532 to 48132940 on human chromosome 3.

[0229] (#97) Nucleotide sequence of RNA transcribed from position 178063133 to 178395500 on human chromosome 1.

[0230] (#98) The nucleotide sequence of RNA transcribed from positions 35684412 to 35824606 on human chromosome 11.

[0231] (#99) Nucleotide sequence of RNA transcribed from positions 175001674 to 175114226 on human chromosome 2.

[0232] (#100) The nucleotide sequence of RNA transcribed from positions 23608068 to 23868206 on human chromosome 2.

[0233] (#101) The nucleotide sequence of RNA transcribed from positions 46064217 to 46210823 on human chromosome 14.

[0234] (#102) Nucleotide sequence of RNA transcribed from position 109737142 to 109775071 on human chromosome 1.

[0235] (#103) Nucleotide sequence of RNA transcribed from positions 77043779 to 77122468 on human chromosome 7.

[0236] (#104) Nucleotide sequence of RNA transcribed from position 157556333 to 157587186 on human chromosome 2.

[0237] (#105) The nucleotide sequence of RNA transcribed from positions 11417591 to 11461284 on human chromosome 6.

[0238] (#106) Nucleotide sequence of RNA transcribed from position 157398215 to 157460007 on human chromosome 5.

[0239] (#107) The nucleotide sequence of RNA transcribed from positions 23426206 to 23433775 on human chromosome 20.

[0240] (#108) The nucleotide sequence of RNA transcribed from positions 30952569 to 30992458 on human chromosome 11.

[0241] (#109) Nucleotide sequence of RNA transcribed from positions 148264179 to 148330482 on human chromosome 2.

[0242] (#110) The nucleotide sequence of RNA transcribed from positions 117290 to 135277 on human chromosome 22.

[0243] (#111) Nucleotide sequence of RNA transcribed from positions 175989480 to 176027571 on human chromosome 1.

[0244] (#112) The nucleotide sequence of RNA transcribed from positions 9735487 to 9741115 on human chromosome 8.

[0245] (#113) The nucleotide sequence of RNA transcribed from positions 63785231 to 63805565 on human chromosome 8.

[0246] (#114) Nucleotide sequence of RNA transcribed from positions 96720566 to 96739955 on human chromosome 12.

[0247] (#115) The nucleotide sequence of RNA transcribed from positions 230328832 to 230342173 on human chromosome 2.

[0248] (#116) The nucleotide sequence of RNA transcribed from positions 106463621 to 106496054 on human chromosome 12.

[0249] (#117) The nucleotide sequence of RNA transcribed from positions 16437525 to 16552529 on human chromosome 9.

[0250] (#118) The nucleotide sequence of RNA transcribed from positions 156352787 to 156388675 on human chromosome 6.

[0251] (#119) The nucleotide sequence of RNA transcribed from positions 63729009 to 63848896 on human chromosome 8.

[0252] (#120) The nucleotide sequence of RNA transcribed from positions 162719146 to 162753094 on human chromosome 1.

[0253] (#121) The nucleotide sequence of RNA transcribed from positions 37916555 to 37926178 on human chromosome 14.

[0254] (#122) Nucleotide sequence of RNA transcribed from positions 49925315 to 50042315 on the human X chromosome.

[0255] (#123) Nucleotide sequence of RNA transcribed from positions 1968590 to 1987324 on human chromosome 5.

[0256] (#124) The nucleotide sequence of RNA transcribed from positions 148384870 to 148446265 on human chromosome 3.

[0257] (#125) The nucleotide sequence of RNA transcribed from positions 28318533 to 28405425 on human chromosome 14.

[0258] (#126) The nucleotide sequence of RNA transcribed from positions 113215997 to 113218504 on human chromosome 2.

[0259] (#127) Nucleotide sequence of RNA transcribed from position 37974838 to 38015373 on human chromosome 9.

[0260] (#128) Nucleotide sequence of RNA transcribed from positions 8384099 to 8405959 on human chromosome 21.

[0261] (#129) The nucleotide sequence of RNA transcribed from positions 66788980 to 66803872 on human chromosome 17.

[0262] (#130) The nucleotide sequence of RNA transcribed from positions 71147339 to 71174844 on human chromosome 11.

[0263] (#131) The nucleotide sequence of RNA transcribed from position 150017499 to 150223165 on the human X chromosome.

[0264] (#132) Nucleotide sequence of RNA transcribed from positions 87518316 to 87613876 on the human X chromosome.

[0265] (#133) The nucleotide sequence of RNA transcribed from positions 132212148 to 132284358 on human chromosome 11.

[0266] (#134) The nucleotide sequence of RNA transcribed from positions 163256988 to 163425802 on human chromosome 5.

[0267] (#135) The nucleotide sequence of RNA transcribed from positions 49396244 to 49422714 on human chromosome 15.

[0268] (#136) Nucleotide sequence of RNA transcribed from positions 48173220 to 48198075 on human chromosome 1.

[0269] (#137) Nucleotide sequence of RNA transcribed from positions 32902124 to 32925352 on human chromosome 2.

[0270] (#138) The nucleotide sequence of RNA transcribed from positions 13413791 to 13421599 on human chromosome 21.

[0271] (#139) The nucleotide sequence of RNA transcribed from positions 114823036 to 114998256 on human chromosome 6.

[0272] (#140) The nucleotide sequence of RNA transcribed from positions 111468836 to 111491662 on human chromosome 2.

[0273] (#141) Nucleotide sequence of RNA transcribed from positions 144995201 to 145092834 on human chromosome 1.

[0274] (#142) Nucleotide sequence of RNA transcribed from positions 40161637 to 40189054 on human chromosome 1.

[0275] (#143) The nucleotide sequence of RNA transcribed from positions 3471518 to 3535252 on human chromosome 20.

[0276] (#144) The nucleotide sequence of RNA transcribed from positions 71964876 to 72352094 on human chromosome 14.

[0277] (#145) The nucleotide sequence of RNA transcribed from positions 52685691 to 52785534 on human chromosome 5.

[0278] (#146) The nucleotide sequence of RNA transcribed from positions 3999688 to 4023872 on human chromosome 11.

[0279] (#147) Nucleotide sequence of RNA transcribed from positions 4007064 to 4027993 on human chromosome 3.

[0280] (#148) The nucleotide sequence of RNA transcribed from positions 76995521 to 77044203 on human chromosome 1.

[0281] (#149) The nucleotide sequence of RNA transcribed from positions 1671 to 3229 on the human M chromosome.

[0282] (#150) The nucleotide sequence of RNA transcribed from positions 40994854 to 41007439 on human chromosome 9.

[0283] (#151) Nucleotide sequence of RNA transcribed from positions 136093037 to 136117070 on human chromosome 7.

[0284] (#152) Nucleotide sequence of RNA transcribed from position 70660217 to 70664661 on human chromosome 15.

[0285] (#153) The nucleotide sequence of RNA transcribed from positions 24094298 to 24111073 on human chromosome 16.

[0286] (#154) The nucleotide sequence of RNA transcribed from positions 60726214 to 60774900 on human chromosome 13.

[0287] (#155) The nucleotide sequence of RNA transcribed from positions 97306298 to 97373560 on human chromosome 1.

[0288] (#156) The nucleotide sequence of RNA transcribed from positions 25664976 to 25795773 on human chromosome 14.

[0289] (#157) Nucleotide sequence of RNA transcribed from positions 20981625 to 20994089 on human chromosome 17.

[0290] (#158) The nucleotide sequence of RNA transcribed from positions 161973418 to 162054090 on human chromosome 6.

[0291] (#159) Nucleotide sequence of RNA transcribed from positions 209299939 to 209304476 on human chromosome 2.

[0292] (#160) The nucleotide sequence of RNA transcribed from positions 29467682 to 29485833 on human chromosome 16.

[0293] (#161) The nucleotide sequence of RNA transcribed from positions 119273709 to 119291164 on human chromosome 4.

[0294] (#162) The nucleotide sequence of RNA transcribed from position 112271606 to 112360361 on human chromosome 1.

[0295] (#163) The nucleotide sequence of RNA transcribed from positions 14713296 to 14886754 on human chromosome 2.

[0296] (#164) The nucleotide sequence of RNA transcribed from positions 29505794 to 29527687 on human chromosome 16.

[0297] (#165) The nucleotide sequence of RNA transcribed from position 199016466 to 199041555 on human chromosome 1.

[0298] (#166) The nucleotide sequence of RNA transcribed from position 146195111 to 146774270 on human chromosome 7.

[0299] (#167) The nucleotide sequence of RNA transcribed from positions 12833755 to 12850658 on human chromosome 3.

[0300] (#168) The nucleotide sequence of RNA transcribed from positions 10650114 to 10657816 on human chromosome 5.

[0301] (#169) The nucleotide sequence of RNA transcribed from positions 113217376 to 113218609 on human chromosome 2.

[0302] (#170) The nucleotide sequence of RNA transcribed from positions 63148830 to 63154859 on human chromosome 7.

[0303] (#171) Nucleotide sequence of RNA transcribed from positions 9809791 to 9819161 on human chromosome 6.

[0304] (#172) Nucleotide sequence of RNA transcribed from positions 10649266 to 10657816 on human chromosome 5.

[0305] (#173) The nucleotide sequence of RNA transcribed from positions 82475712 to 82477258 on human chromosome 15.

[0306] (#174) Nucleotide sequence of RNA transcribed from positions 88729338 to 88734551 on human chromosome 2.

[0307] Table 1 also shows the names of the RNA molecules identified as interacting with components of the TNFR1 complex. In some embodiments, the RNA is selected from: FATALR1, DOCK4, ARHGAP24, PDE10A, RAD51B, ABTB2, AFF3, MIR4451, MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1, GPR22, MIR28, EHMT1, PTPRG, MAST4, FAM222A, LPP , PRKCA-AS1, IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR6 077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1, FMNL2, NIBAN1, MIR6529, HIVEP2, MIR3921, MI R4768, AKAP13, MIR586, LINC02605, TBC1D4, RNVU1-4, RBFOX2, JAZF1-AS1, FOXC1, MAPKAP1, SIK3, LRCH1, RASS F5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1, CSF2, MIR3194, SDK1, RBMS3-AS1, HIVEP1, MB21D 2. KLF12, SLC35F3, WWC2, MIR1267, LUZP1, PARP8, RNU1-2, JARID2, ZFAND3, SLIT2-IT1, MAGI1-AS1, FER, LINC00673, SBF2, LIMS1, EIF4G3, THSD4-AS1, ARID4B, DENND1A, WWC1, ANKRD33B, MAP4, RASAL2, TRIM44, OLA1, and KLHL29. In some embodiments, the RNA is FATALR1, RAD51B, or AFF3.

[0308] In some embodiments, the RNA is an RNA comprising or composed of a nucleotide sequence having at least 70% nucleotide sequence identity with the following nucleotide sequences: FATALR1, DOCK4, ARHGAP24, PDE10A, RAD51B, ABTB2, AFF3, MIR4451, MIR4714, LHFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1, GPR22, MIR28. EHMT1, PTPRG, MAST4, FAM222A, LPP, PRKCA-AS1, IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPH N, PTPRM, CDH4, MIR3922, MIR6077, APBB2, ID4, P3H2, PPIAL4D, ETV6, MAP4K4, FNDC3B, LPP-AS1, FMNL2, NIBAN1, MIR65 29. HIVEP2, MIR3921, MIR4768, AKAP13, MIR586, LINC02605, TBC1D4, RNVU1-4, RBFOX2, JAZF1-AS1, FOXC1, MAPKAP1, SIK3, LRCH1, RASSF5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1, CSF2, MIR3194, SDK1, RBMS3-AS1, HI VEP1, MB21D2, KLF12, SLC35F3, WWC2, MIR1267, LUZP1, PARP8, RNU1-2, JARID2, ZFAND3, SLIT2-IT1, MAGI1-AS1, FER, L INC00673, SBF2, LIMS1, EIF4G3, THSD4-AS1, ARID4B, DENND1A, WWC1, ANKRD33B, MAP4, RASAL2, TRIM44, OLA1, or KLHL29.

[0309] In some embodiments, the RNA comprises, or consists of, a nucleotide sequence having at least 75% nucleotide sequence identity with, one of the following nucleotide sequences: ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% nucleotide sequence identity: FATALR1, DOCK4, ARHGAP24, PDE10A, RAD51B, ABTB2, AFF3, MIR4451, MIR4714, L HFPL6, PARD3, MIR4296, PTPRK, ADAMTS9-AS2, LOC101927817, GMDS, NDRG1, GPR22, MIR28, EHMT1, PTPRG, MAST4, FAM222A, LPP, PRKCA -AS1, IRAK2, ZFPM2, LOC100128386, NR3C2, SMYD3, MIR4666B, UBE2E2, GPHN, PTPRM, CDH4, MIR3922, MIR6077, APBB2, ID4, P3H2, PPIA L4D, ETV6, MAP4K4, FNDC3B, LPP-AS1, FMNL2, NIBAN1, MIR6529, HIVEP2, MIR3921, MIR4768, AKAP13, MIR586, LINC02605, TBC1D4, RNV U1-4, RBFOX2, JAZF1-AS1, FOXC1, MAPKAP1, SIK3, LRCH1, RASSF5, ZSWIM6, LOC102723439, LOC100192426, LINC02546, NRIP1, CSF2, M IR3194, SDK1, RBMS3-AS1, HIVEP1, MB21D2, KLF12, SLC35F3, WWC2, MIR1267, LUZP1, PARP8, RNU1-2, JARID2, ZFAND3, SLIT2-IT1, MAG I1-AS1, FER, LINC00673, SBF2, LIMS1, EIF4G3, THSD4-AS1, ARID4B, DENND1A, WWC1, ANKRD33B, MAP4, RASAL2, TRIM44, OLA1, or KLHL29.

[0310] In some embodiments, the RNA comprises, or is composed of, a nucleotide sequence having at least 70% nucleotide sequence identity with, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:25.

[0311] In some embodiments, the RNA comprises, or is composed of, a nucleotide sequence having at least 75% nucleotide sequence identity with the nucleotide sequence of SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:25, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99%.

[0312] In some implementations, the RNA comprises, or is composed of, a nucleotide sequence that has at least 70% nucleotide sequence identity with SEQ ID NO:10.

[0313] In some embodiments, the RNA comprises, or is composed of, a nucleotide sequence having at least 75% nucleotide sequence identity with the nucleotide sequence of SEQ ID NO:10, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% nucleotide sequence identity.

[0314] In some implementations, the RNA comprises, or is composed of, a nucleotide sequence that has at least 70% nucleotide sequence identity with SEQ ID NO:11.

[0315] In some embodiments, the RNA comprises, or is composed of, a nucleotide sequence having at least 75% nucleotide sequence identity with the nucleotide sequence of SEQ ID NO:11, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% nucleotide sequence identity.

[0316] In some implementations, the RNA comprises, or is composed of, a nucleotide sequence that has at least 70% nucleotide sequence identity with SEQ ID NO:25.

[0317] In some embodiments, the RNA comprises, or is composed of, a nucleotide sequence having at least 75% nucleotide sequence identity with the nucleotide sequence of SEQ ID NO:25, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% nucleotide sequence identity.

[0318] In some embodiments, the RNA is an RNA containing a nucleotide sequence that has at least 70% nucleotide sequence identity with the RNA motif identified according to the method of Example 11.

[0319] In some embodiments, the RNA is an RNA containing a nucleotide sequence that has at least 75% nucleotide sequence identity with the RNA motif identified according to the method of Example 11, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99% or 100% sequence identity.

[0320] In some implementations, RNA is contained with Figure 16 A or Figure 16 The RNA motif provided in B is an RNA with a nucleotide sequence that has at least 70% nucleotide sequence identity.

[0321] In some implementations, RNA is contained with Figure 16 A or Figure 16 The RNA motif provided in B has a nucleotide sequence identity of at least 75%, for example, ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99% or 100% of the nucleotide sequence identity of the RNA.

[0322] In some embodiments, the RNA is an RNA containing a nucleotide sequence that has at least 70% nucleotide sequence identity with the nucleotide sequences of SEQ ID NO:29, SEQ ID NO:30 and / or SEQ ID NO:31.

[0323] In some embodiments, the RNA is an RNA containing a nucleotide sequence that has at least 75% nucleotide sequence identity with the nucleotide sequence of SEQ ID NO:29, SEQ ID NO:30 and / or SEQ ID NO:31, such as ≥75%, ≥80%, ≥85%, ≥86%, ≥87%, ≥88%, ≥89%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99% or 100%.

[0324] In some embodiments, a component of the TNFR1 complex is a component of TNFR1 complex II. In some embodiments, a component of TNFR1 complex II is a component of TNFR1 complex IIa, TNFR1 complex IIb, and / or TNFR1 complex IIc. In some embodiments, a component of TNFR1 complex II is a component of TNFR1 complex IIa. In some embodiments, a component of TNFR1 complex II is a component of TNFR1 complex IIb. In some embodiments, a component of TNFR1 complex II is a component of TNFR1 complex IIc.

[0325] In some implementations, the components of TNFR1 complex II are TRADD, RIPK1, RIPK3, FADD, procystein-3, procystein-8 or caspase-10, caspase-3, caspase-8, caspase-10, FTO, XPO5, FATALR1, RAD51B, AFF3 and / or RUPTR7.

[0326] In some implementations, the components of TNFR1 complex IIa are TRADD, RIPK1, RIPK3, FADD, procystein-3, procystein-8 or procystein-10, caspase-3, caspase-8, caspase-10, FTO, XPO5, FATALR1, RAD51B, AFF3 and / or RUPTR7.

[0327] In some embodiments, the components of TNFR1 complex IIb are RIPK1, RIPK3, FADD, procystein-3, procystein-8 or procystein-10, caspase-3, caspase-8, caspase-10, FTO, XPO5, FATALR1, RAD51B, AFF3 and / or RUPTR7.

[0328] In some implementations, the components of TNFR1 complex IIc are TRADD, RIPK1, RIPK3, FADD, FTO, XPO5, FATALR1, RAD51B, AFF3 and / or RUPTR7.

[0329] In some embodiments, the RBP component of the TNFR1 complex is FTO and / or XPO5. In some embodiments, the RBP component of TNFR1 complex II is FTO and / or XPO5. In some embodiments, the RBP component of TNFR1 complex IIa is FTO and / or XPO5. In some embodiments, the RBP component of TNFR1 complex IIb is FTO and / or XPO5. In some embodiments, the RBP component of TNFR1 complex IIc is FTO and / or XPO5.

[0330] In some embodiments, the RBP component of the TNFR1 complex is FTO. In some embodiments, the RBP component of TNFR1 complex II is FTO. In some embodiments, the RBP component of TNFR1 complex IIa is FTO. In some embodiments, the RBP component of TNFR1 complex IIb is FTO. In some embodiments, the RBP component of TNFR1 complex IIc is FTO.

[0331] In some embodiments, the RBP component of the TNFR1 complex is XPO5. In some embodiments, the RBP component of TNFR1 complex II is XPO5. In some embodiments, the RBP component of TNFR1 complex IIa is XPO5. In some embodiments, the RBP component of TNFR1 complex IIb is XPO5. In some embodiments, the RBP component of TNFR1 complex IIc is XPO5.

[0332] In some embodiments, the RNA components of the TNFR1 complex are FATALR1, RAD51B, AFF3, and / or RUPTR7. In some embodiments, the RNA components of TNFR1 complex II are FATALR1, RAD51B, AFF3, and / or RUPTR7. In some embodiments, the RNA components of TNFR1 complex IIa are FATALR1, RAD51B, AFF3, and / or RUPTR7. In some embodiments, the RNA components of TNFR1 complex IIb are FATALR1, RAD51B, AFF3, and / or RUPTR7. In some embodiments, the RNA components of TNFR1 complex IIc are FATALR1, RAD51B, AFF3, and / or RUPTR7.

[0333] In some embodiments, the RNA component of the TNFR1 complex is FATALR1. In some embodiments, the RNA component of TNFR1 complex II is FATALR1. In some embodiments, the RNA component of TNFR1 complex IIa is FATALR1. In some embodiments, the RNA component of TNFR1 complex IIb is FATALR1. In some embodiments, the RNA component of TNFR1 complex IIc is FATALR1.

[0334] In some embodiments, the RNA component of the TNFR1 complex is RAD51B. In some embodiments, the RNA component of TNFR1 complex II is RAD51B. In some embodiments, the RNA component of TNFR1 complex IIa is RAD51B. In some embodiments, the RNA component of TNFR1 complex IIb is RAD51B. In some embodiments, the RNA component of TNFR1 complex IIc is RAD51B.

[0335] In some embodiments, the RNA component of the TNFR1 complex is AFF3. In some embodiments, the RNA component of TNFR1 complex II is AFF3. In some embodiments, the RNA component of TNFR1 complex IIa is AFF3. In some embodiments, the RNA component of TNFR1 complex IIb is AFF3. In some embodiments, the RNA component of TNFR1 complex IIc is AFF3.

[0336] In some embodiments, the RNA component of the TNFR1 complex is RUPTR7. In some embodiments, the RNA component of TNFR1 complex II is RUPTR7. In some embodiments, the RNA component of TNFR1 complex IIa is RUPTR7. In some embodiments, the RNA component of TNFR1 complex IIb is RUPTR7. In some embodiments, the RNA component of TNFR1 complex IIc is RUPTR7.

[0337] Further RBP components of the TNFR1 complex (e.g., the RBP components of TNFR1 complex I and TNFR1 complex II) can be identified using the experimental procedures of the embodiments of this disclosure (e.g., Example 1). Alternatively, further RBP components of the TNFR1 complex (e.g., the RBP components of TNFR1 complex I and TNFR1 complex II) can be identified by modifying the experimental procedures of Example 1.

[0338] The pull-down assay is used in Example 1 of this disclosure. The pull-down assay is an in vitro technique for detecting physical interactions between two or more proteins, and a valuable tool for confirming predicted protein-protein interactions or identifying new interacting partners. The target molecule is used as a "decoy" molecule to identify other molecules that bind to the target molecule. The pull-down assay can be performed in a similar manner to the experiment in Example 1, but using different components of the TNFR1 complex as "decoy" molecules. For example, TNF, TNFR1, TRADD, RIPK1, TRAF2, TRAF5, cIAP1, cIAP2, FADD, RIPK3, procysteine, caspase, FTO, XPO5, FATALR1, RAD51B, AFF3, and RUPTR7 can be used as "decoy" molecules to identify further novel components of the TNFR1 complex.

[0339] Further RBP components of the TNFR1 complex (e.g., RBP components of TNFR1 complex I and TNFR1 complex II) can be identified using any suitable method known in the art. Protein-protein interaction assays can be used. These assays include co-immunoprecipitation (co-IP), cross-linked protein interaction assays, tag-transfer protein interaction assays, and / or far-western blot analysis. Alternatively, protein-RNA interaction assays can be used. These assays include RNA pull-down assays, oligonucleotide-targeted RNase H protection assays, target measurement via APOBEC-mediated assays (STAMP), and / or fluorescence in situ hybridization co-localization.

[0340] Further RNA components of the TNFR1 complex (e.g., RNA components of TNFR1 complex I and TNFR1 complex II) can be identified using experimental procedures employed in examples of this disclosure (e.g., Example 3). For instance, the STAMP assay used in Example 3 can modify RNA molecules that interact with XPO5 during BT-induced apoptosis.

[0341] Further RNA components of the TNFR1 complex (e.g., RNA components of TNFR1 complex I and TNFR1 complex II) can be identified using any suitable method known in the art. Protein-RNA interaction assays can be used. Protein-RNA interaction assays include: RNA pull-down assays, oligonucleotide-targeted RNase H protection assays, STAMP and / or fluorescence in situ hybridization co-localization.

[0342] TNFR1-mediated signal transduction TNF signaling occurs through two receptors: TNFR1 and TNFR2. TNFR1 is constitutively expressed in most cell types, while TNFR2 is primarily restricted to endothelial cells, epithelial cells, and immune cell subsets. Activation of TNF signaling through TNFR1 and TNFR2 initiates a variety of potential consequences, including cell proliferation, gene activation, or cell death.

[0343] In this article, "TNFR1-mediated signal transduction" refers to signal transduction mediated by TNFR1 and / or TNFR1 complexes, such as TNFR1 complex I, TNFR1 complex II, TNFR1 complex IIa, TNFR1 complex IIb, and TNFR1 complex IIc. "Signalling" refers to signal transduction and other cellular processes that control cell activity. TNFR1-mediated signal transduction can be mediated by TNFR1 complexes (e.g., TNFR1 complex II). TNFR1-mediated signal transduction can be mediated by complexes containing TNFR1 receptors (e.g., TNFR1 complex I). TNFR1-mediated signal transduction can be mediated by TNFR1 complexes formed after TNFR1 activation (e.g., TNFR1 complex II). TNFR1-mediated signal transduction can be mediated by TNFR1 complexes formed after RIPK1 dissociates from TNFR1 (e.g., TNFR1 complex II). TNFR1-mediated signal transduction can be ligand-dependent, such as triggered by the binding of TNF to TNFR1, or it can be ligand-independent.

[0344] TNFR1-mediated signal transduction develops intracellularly through the formation of different TNFR1 complexes. TNFR1 complex I primarily promotes cell survival by activating the nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways, while complex II promotes cell death by activating caspase (van Loo and Bertrand, 2022. Nat Rev Immunol, 1-15).

[0345] In some embodiments, TNFR1-mediated signal transduction includes TNFR1 complex I-mediated signal transduction, TNFR1 complex II-mediated signal transduction, TNFR1 complex IIa-mediated signal transduction, TNFR1 complex IIb-mediated signal transduction, and / or TNFR1 complex IIc-mediated signal transduction. In some embodiments, TNFR1-mediated signal transduction is TNFR1 complex I-mediated signal transduction. In some embodiments, TNFR1-mediated signal transduction is TNFR1 complex II-mediated signal transduction. In some embodiments, TNFR1-mediated signal transduction is TNFR1 complex IIa-mediated signal transduction. In some embodiments, TNFR1-mediated signal transduction is TNFR1 complex IIb-mediated signal transduction. In some embodiments, TNFR1-mediated signal transduction is TNFR1 complex IIc-mediated signal transduction.

[0346] TNFR1-mediated signal transduction has been described, for example, by van Loo and Bertrand (2022. Nat RevImmunol, 1-15), Gough and Myles (Front Immunol. 2020; 11: 585880), Muppidi et al. (2004. Immunity, Vol. 21, 461–465), Gough and Myles (2020. Front Immunol. 11:585880), and Dostert et al. (2019. Physiol Rev99: 115–160), all of which are incorporated herein by reference in their entirety.

[0347] TNFR1 complex I-mediated signaling can lead to the activation of multiple pathways. Activation of NF-κB, JNK, and p38 via complex I is achieved through the parallel assembly of proteins that are recruited via their ubiquitin-binding domains to activate TGFβ-activated kinase 1 (TAK1) and IκB kinase (IKK) inhibitors. TAK1 also activates mitogen-activated protein kinase kinases (MAPKKs), which activate the JUN NH2-terminal kinase (JNK) and p38 pathways. In some embodiments, TNFR1 complex I-mediated signaling increases the activation of the NF-κB and mitogen-activated protein kinase MAPK signaling pathways. In some embodiments, TNFR1 complex I-mediated signaling promotes cell survival. In some embodiments, TNFR1 complex I-mediated signaling increases cell proliferation. In some embodiments, TNFR1 complex I-mediated signaling increases cancer cell proliferation.

[0348] TNFR1 complex II-mediated signal transduction promotes cell death and includes downstream activities of cell death-inducing enzymes such as caspase and protein kinase (Gough and Myles. Front Immunol. 2020; 11: 585880). In some embodiments, TNFR1 complex II-mediated signal transduction includes the activities of FADD, RIPK1, and RIPK3. In some embodiments, TNFR1 complex II-mediated signal transduction includes the activity of TRADD. In some embodiments, TNFR1 complex II-mediated signal transduction includes the activity of caspase. In some embodiments, TNFR1 complex II-mediated signal transduction includes the activity of caspase-3. In some embodiments, TNFR1 complex II-mediated signal transduction includes the activity of caspase-8. In some embodiments, TNFR1 complex II-mediated signal transduction includes the activity of caspase-10.

[0349] In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the conversion of procysteine ​​to caspase. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates cell death. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates apoptosis. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates necrotic apoptosis. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates pyroptosis.

[0350] In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of caspase. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of caspase-3, caspase-8, and / or caspase-10. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of caspase-3. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of caspase-8. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of caspase-10. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates apoptosis via caspase activity. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates apoptosis via the activities of caspase-3, caspase-8, and / or caspase-10. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates apoptosis via the activities of caspase-3. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates apoptosis via the activities of caspase-8. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates apoptosis via the activities of caspase-10.

[0351] In some embodiments, TNFR1 complex II-mediated signal transduction upregulates RIPK1 expression and / or activity. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates apoptosis via RIPK1 expression and / or activity.

[0352] In some embodiments, TNFR1 complex II-mediated signal transduction upregulates necrotizing apoptosis. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of receptor-interacting serine / threonine protein kinases. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of RIPK1 and / or RIPK3. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of RIPK1. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates the expression and / or activity of RIPK3. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates necrotizing apoptosis via the expression and / or activity of receptor-interacting serine / threonine protein kinases. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates necrotizing apoptosis via the activity of RIPK1 and / or RIPK3. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates necroptosis via RIPK1 activity. In some embodiments, TNFR1 complex II-mediated signal transduction upregulates necroptosis via RIPK3 activity.

[0353] In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates the conversion of caspase to caspase. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates cell death. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates apoptosis. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates the expression and / or activity of caspase. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates the expression and / or activity of caspase-3, caspase-8, and / or caspase-10. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates the expression and / or activity of caspase-3. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates the expression and / or activity of caspase-8. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates the expression and / or activity of caspase-10. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates apoptosis via caspase activity. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates apoptosis via caspase-3, caspase-8, and / or caspase-10 activity. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates apoptosis via caspase-3 activity. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates apoptosis via caspase-8 activity. In some embodiments, TNFR1 complex IIa-mediated signal transduction upregulates apoptosis via caspase-10 activity.

[0354] In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates the conversion of caspase to caspase. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates cell death. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates apoptosis. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates the expression and / or activity of caspase. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates the expression and / or activity of caspase-3, caspase-8, and / or caspase-10. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates the expression and / or activity of caspase-3. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates the expression and / or activity of caspase-8. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates the expression and / or activity of caspase-10. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates apoptosis via caspase activity. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates apoptosis via caspase-3, caspase-8, and / or caspase-10 activity. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates apoptosis via caspase-3 activity. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates apoptosis via caspase-8 activity. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates apoptosis via caspase-10 activity.

[0355] In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates RIPK1 expression and / or activity. In some embodiments, TNFR1 complex IIb-mediated signal transduction upregulates apoptosis via RIPK1 expression and / or activity.

[0356] In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates necroptosis. In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates the expression and / or activity of receptor-interacting serine / threonine protein kinases. In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates the expression and / or activity of RIPK1 and / or RIPK3. In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates the expression and / or activity of RIPK1. In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates the expression and / or activity of RIPK3. In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates necroptosis via the activity of receptor-interacting serine / threonine protein kinases. In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates necroptosis via the activity of RIPK1 and / or RIPK3. In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates necroptosis via RIPK1 activity. In some embodiments, TNFR1 complex IIc-mediated signal transduction upregulates necroptosis via RIPK3 activity.

[0357] In some embodiments, TNFR1 complex activity leads to the regulation of downstream biomolecules, such as enzymes and RNA. In some embodiments, TNFR1 complex activity leads to the upregulation or downregulation of caspase, protein kinase, and / or polymerase activity. In some embodiments, TNFR1 complex activity leads to the upregulation or downregulation of caspase-3, caspase-8, caspase-10, RIPK1, RIPK3, and / or poly(ADP-ribose) polymerase (PARP) expression and / or activity. In some embodiments, TNFR1 complex activity leads to the upregulation or downregulation of caspase-3, caspase-8, caspase-10, RIPK1, RIPK3, and / or PARP expression and / or activity. In some embodiments, TNFR1 complex activity leads to the upregulation or downregulation of caspase-3 expression and / or activity. In some embodiments, TNFR1 complex activity leads to the upregulation or downregulation of caspase-8 expression and / or activity. In some embodiments, TNFR1 complex activity leads to upregulation or downregulation of caspase-10 expression and / or activity. In some embodiments, TNFR1 complex activity leads to upregulation or downregulation of RIPK1 expression and / or activity. In some embodiments, TNFR1 complex activity leads to upregulation or downregulation of RIPK3 expression and / or activity. In some embodiments, TNFR1 complex activity leads to upregulation or downregulation of PARP expression and / or activity.

[0358] Caspases are a family of endonucleases that provide crucial links in the cellular regulatory network controlling inflammation and cell death. Caspase-mediated apoptotic cell death is achieved by cleaving proteins required for cell function and survival. In some embodiments, caspase activity comprises endonuclease activity. In some embodiments, caspase activity comprises upregulation of cell death. In some embodiments, caspase activity comprises upregulation of apoptosis. In some embodiments, caspase activity comprises protein cleavage. In some embodiments, caspase activity comprises caspase-mediated apoptotic cell death. In some embodiments, caspase activity is caspase-3 activity, caspase-8 activity, and / or caspase-10 activity. In some embodiments, caspase activity is caspase-3 activity. In some embodiments, caspase activity is caspase-8 activity. In some embodiments, caspase activity is caspase-10 activity.

[0359] RIPK1 and RIPK3 activities promote the regulation of cell death. RIPK1 and RIPK3 interact with target molecules via their RIP isotype interaction motifs to mediate necroptosis. In some embodiments, RIPK1 activity includes kinase activity. In some embodiments, RIPK1 activity includes upregulation of necroptosis. In some embodiments, RIPK3 activity includes kinase activity. In some embodiments, RIPK3 activity includes upregulation of necroptosis.

[0360] RIPK1 activity also promotes the regulation of apoptosis. In some embodiments, RIPK1 mediates apoptosis; in some embodiments, RIPK1 activity includes kinase activity. In some embodiments, RIPK1 activity includes the upregulation of apoptosis.

[0361] PARP (or PARP-1) is involved in a wide range of physiological and pathological functions, from cell survival to several forms of cell death, and is implicated in gene transcription, immune responses, inflammation, learning, memory, synaptic function, angiogenesis, and aging. The normal function of poly(ADP-ribose) polymerase-1 (PARP-1) is to routinely repair DNA damage by increasing poly(ADP-ribose) polymers in response to various cellular stresses (Chaitanya et al., Cell Commun Signal. 2010; 8: 31). PARP is one of several known cellular substrates of caspase. Caspase cleavage of PARP-1 is considered a marker of apoptosis. Caspase cleavage of PARP-1 is involved in several neurological diseases, such as cerebral ischemia, Alzheimer's disease, multiple sclerosis, Parkinson's disease, traumatic brain injury, NMDA-mediated excitotoxicity, and brain tumors, particularly gliomas. PARP fragments have been shown to be involved in various forms of cell death. In some embodiments, PARP activity includes polymerase activity. In some implementations, PARP activity includes the upregulation of cell death. In some implementations, PARP activity includes the upregulation of apoptosis.

[0362] Downstream activities of biomolecules can also be described as indicators of TNFR1 complex activity. For example, upregulation of caspase expression and / or activity is an indicator of TNFR1 complex II activity.

[0363] In some embodiments, upregulation of caspase-3, caspase-8, caspase-10, RIPK1, and / or RIPK3 expression and / or activity is a relevant indicator of TNFR1 complex II activity. In some embodiments, upregulation of caspase-3 expression and / or activity is a relevant indicator of TNFR1 complex II activity. In some embodiments, upregulation of caspase-8 expression and / or activity is a relevant indicator of TNFR1 complex II activity. In some embodiments, upregulation of caspase-10 expression and / or activity is a relevant indicator of TNFR1 complex II activity. In some embodiments, upregulation of RIPK1 expression and / or activity is a relevant indicator of TNFR1 complex II activity. In some embodiments, upregulation of RIPK3 expression and / or activity is a relevant indicator of TNFR1 complex II activity.

[0364] In some embodiments, upregulation of caspase-3, caspase-8, caspase-10, RIPK1, and / or RIPK3 expression and / or activity is a relevant indicator of TNFR1 complex IIa activity. In some embodiments, upregulation of caspase-3 expression and / or activity is a relevant indicator of TNFR1 complex IIa activity. In some embodiments, upregulation of caspase-8 expression and / or activity is a relevant indicator of TNFR1 complex IIa activity. In some embodiments, upregulation of caspase-10 expression and / or activity is a relevant indicator of TNFR1 complex IIa activity. In some embodiments, upregulation of RIPK1 expression and / or activity is a relevant indicator of TNFR1 complex IIa activity. In some embodiments, upregulation of RIPK3 expression and / or activity is a relevant indicator of TNFR1 complex IIa activity.

[0365] In some embodiments, upregulation of caspase-3, caspase-8, caspase-10, RIPK1, and / or RIPK3 expression and / or activity is a relevant indicator of TNFR1 complex IIb activity. In some embodiments, upregulation of caspase-3 expression and / or activity is a relevant indicator of TNFR1 complex IIb activity. In some embodiments, upregulation of caspase-8 expression and / or activity is a relevant indicator of TNFR1 complex IIb activity. In some embodiments, upregulation of caspase-10 expression and / or activity is a relevant indicator of TNFR1 complex IbI activity. In some embodiments, upregulation of RIPK1 expression and / or activity is a relevant indicator of TNFR1 complex IIb activity. In some embodiments, upregulation of RIPK3 expression and / or activity is a relevant indicator of TNFR1 complex IIb activity.

[0366] In some implementations, upregulation of RIPK1 expression and / or activity is a relevant indicator of TNFR1 complex IIb activity.

[0367] In some embodiments, upregulation of RIPK1 and / or RIPK3 expression and / or activity is a relevant indicator of TNFR1 complex IIc activity. In some embodiments, upregulation of RIPK1 expression and / or activity is a relevant indicator of TNFR1 complex IIc activity. In some embodiments, upregulation of RIPK3 expression and / or activity is a relevant indicator of TNFR1 complex IIc activity.

[0368] regulator This disclosure generally relates to the regulation of the TNFR1 complex, and therefore the regulation of TNFR1-mediated signal transduction. Regulators of components of the TNFR1 complex are provided.

[0369] Regulation of TNFR1 complex / TNRF1-mediated signal transduction by modulators of this disclosure can occur by targeting RBP, RNA, RBP-RNA interactions, and / or RNA modification.

[0370] A "regulator" is an agent capable of upregulating or downregulating the expression and / or activity of a given molecule. In some embodiments, a regulator is an agent that upregulates the expression and / or activity of a given molecule. In some embodiments, a regulator is an agent that downregulates the expression and / or activity of a given molecule.

[0371] Modulators of components of the TNFR1 complex can directly upregulate or downregulate the expression and / or activity of components of the TNFR1 complex. As used herein, a modulator that “directly” regulates the expression and / or activity of a given component of the TNFR1 complex contacts / interacts with the given component or the nucleic acid encoding the given component. In some embodiments, the modulator is an agent that directly upregulates or downregulates the expression and / or activity of components of the TNFR1 complex.

[0372] Modulators of components of the TNFR1 complex can indirectly upregulate or downregulate the expression and / or activity of components of the TNFR1 complex. As used herein, a modulator that “indirectly” modulates the expression and / or activity of a given component of the TNFR1 complex does not contact / interact with the given component or the nucleic acid encoding the given component. Indirect regulation can be achieved, for example, through interaction with an interaction pair of the given component / modulation of the interaction pair of the given component, or through interaction with a modulator of the given component / modulation of the modulator of the given component. In some embodiments, the modulator is an agent that indirectly upregulates or downregulates the expression and / or activity of a component of the TNFR1 complex. In some embodiments, the modulator is an agent that modulates the expression and / or activity of an interaction pair of a component of the TNFR1 complex. In some embodiments, the modulator is an agent that modulates the expression and / or activity of a modulator of a component of the TNFR1 complex.

[0373] Modulators of components of the TNFR1 complex can target RBP, RNA, protein-protein interactions, RBP-RNA interactions, RNA modification, and / or RNA-RNA interactions. In some embodiments, modulators of the TNFR1 complex are capable of one or more of the following: binding to RBP, binding to an interacting partner of RBP, binding to RNA, binding to an interacting partner of RNA, inhibiting / reducing the binding of RBP to an interacting partner, inhibiting / reducing the binding of RNA to an interacting partner, inhibiting / reducing the binding of RBP to partner RNA, and inhibiting / reducing RNA modification (e.g., A-to-I editing, m...). 6 A、m 6 Am、m 1A、m 3 C) Increases the binding of RBP to the interacting partner, increases the binding of RNA to the interacting partner, increases the binding of RBP to partner RNA, and increases RNA modification (e.g., A-to-I editing, m 6 A、m 6 Am、m 1 A、m 3 C).

[0374] Modulators of TNFR1 complex components are reagents that can upregulate or downregulate the expression and / or activity of TNFR1 complex components. Modulators of TNFR1 complex II components are reagents that can upregulate or downregulate the expression and / or activity of TNFR1 complex II components.

[0375] In some embodiments, modulators of the TNFR1 complex components are capable of upregulating or downregulating the expression and / or activity of the TNFR1 complex components. In some embodiments, modulators of the TNFR1 complex components are capable of upregulating the expression and / or activity of the TNFR1 complex components. In some embodiments, modulators of the TNFR1 complex components are capable of downregulating the expression and / or activity of the TNFR1 complex components.

[0376] In some embodiments, a modulator of a component of the TNFR1 complex upregulates or downregulates the expression and / or activity of that component. In some embodiments, a modulator of a component of the TNFR1 complex upregulates the expression and / or activity of that component. In some embodiments, a modulator of a component of the TNFR1 complex downregulates the expression and / or activity of that component. In some embodiments, the TNFR1 complex is TNFR1 complex I, TNFR1 complex II, TNFR1 complex IIa, TNFR1 complex IIb, or TNFR1 complex IIc.

[0377] In some embodiments, a regulator of a component of TNFR1 complex II is capable of upregulating or downregulating the expression and / or activity of a component of TNFR1 complex II. In some embodiments, a regulator of a component of TNFR1 complex II is capable of upregulating the expression and / or activity of a component of TNFR1 complex II. In some embodiments, a regulator of a component of TNFR1 complex II is capable of downregulating the expression and / or activity of a component of TNFR1 complex II. In some embodiments, a regulator of a component of TNFR1 complex II upregulates the expression and / or activity of a component of TNFR1 complex II. In some embodiments, a regulator of a component of TNFR1 complex II downregulates the expression and / or activity of a component of TNFR1 complex II. In some embodiments, TNFR1 complex II is TNFR1 complex IIa, TNFR1 complex IIb, or TNFR1 complex IIc.

[0378] In some embodiments, the components of the TNFR1 complex are RBP and / or RNA. In some embodiments, the components of TNFR1 complex I are RBP and / or RNA. In some embodiments, the components of TNFR1 complex II are RBP and / or RNA. In some embodiments, the components of TNFR1 complex IIa are RBP and / or RNA. In some embodiments, the components of TNFR1 complex IIb are RBP and / or RNA. In some embodiments, the components of TNFR1 complex IIc are RBP and / or RNA.

[0379] In some embodiments, the component of the TNFR1 complex is RBP. In some embodiments, the component of TNFR1 complex I is RBP. In some embodiments, the component of TNFR1 complex II is RBP. In some embodiments, the component of TNFR1 complex IIa is RBP. In some embodiments, the component of TNFR1 complex IIb is RBP. In some embodiments, the component of TNFR1 complex IIc is RBP.

[0380] In some embodiments, a component of the TNFR1 complex is RNA. In some embodiments, a component of TNFR1 complex I is RNA. In some embodiments, a component of TNFR1 complex II is RNA. In some embodiments, a component of TNFR1 complex IIa is RNA. In some embodiments, a component of TNFR1 complex IIb is RNA. In some embodiments, a component of TNFR1 complex IIc is RNA.

[0381] In some implementations, the RBP is FTO or XPO5. In some implementations, the RBP is FTO. In some implementations, the RBP is XPO5.

[0382] In some embodiments, the modulator can upregulate or downregulate the expression and / or activity of FTO and / or XPO5. In some embodiments, the modulator can upregulate or downregulate the expression and / or activity of FTO. In some embodiments, the modulator can upregulate or downregulate the expression and / or activity of XPO5.

[0383] In some embodiments, the RNA is FATALR1, RAD51B, AFF3, or RUPTR7. In some embodiments, the RNA is FATALR1. In some embodiments, the RNA is RAD51B. In some embodiments, the RNA is AFF3. In some embodiments, the RNA is RUPTR7.

[0384] In some embodiments, the RNA component of the TNFR1 complex is FATALR1, RAD51B, AFF3, or RUPTR7. In some embodiments, the RNA component of the TNFR1 complex is FATALR1. In some embodiments, the RNA component of the TNFR1 complex is RAD51B. In some embodiments, the RNA is AFF3. In some embodiments, the RNA is RUPTR7.

[0385] In some embodiments, the modulator can upregulate and / or downregulate the expression or activity of FATALR1, RAD51B, AFF3, and / or RUPTR7. In some embodiments, the modulator can upregulate or downregulate the expression and / or activity of FATALR1. In some embodiments, the modulator can upregulate or downregulate the expression and / or activity of RAD51B. In some embodiments, the modulator can upregulate and / or downregulate the expression or activity of AFF3. In some embodiments, the modulator can upregulate and / or downregulate the expression or activity of RUPTR7.

[0386] In this article, “downregulation” may also be referred to as “antagonism,” “inhibition,” “reduction,” “blocking,” and / or “blocking.” Therefore, regulators that downregulate the expression and / or activity of a target may also be described as regulators that antagonize, inhibit, reduce, block, and / or block the expression and / or activity of a target.

[0387] In this article, "upregulation" may also be referred to as "excitation," "promotion," "increase," "enhancement," and / or "enhancement." Therefore, regulators that downregulate the expression and / or activity of a target may also be described as regulators that excite, promote, increase, enhance, and / or enhance the expression and / or activity of a target.

[0388] In some embodiments, the modulator is an inhibitor. In some embodiments, the modulator is an inhibitor of the expression and / or activity of a component of the TNFR1 complex. In some embodiments, the modulator is an inhibitor of the expression and / or activity of a component of TNFR1 complex II.

[0389] In some implementations, the regulator is selected from small molecules, inhibitory nucleic acids, and nucleic acids encoding site-specific nuclease (SSN) systems.

[0390] In some implementations, the modulator is selected from: small molecules that bind to components of the TNFR1 complex, inhibitory nucleic acids that target components of the TNFR1 complex, and nucleic acids of an SSN system that encodes nucleic acids that target the TNFR1 complex.

[0391] In some implementations, the regulator is a small molecule.

[0392] As used herein, “small molecule” refers to organic compounds with low molecular weight (< 1000 Daltons, typically around 300-700 Daltons). Small molecule inhibitors of components of the TNFR1 complex can be identified by screening libraries of such small molecules for their ability to inhibit components of the TNFR1 complex.

[0393] In some embodiments, the small molecule inhibits the activity of the target molecule. In some embodiments, the small molecule inhibits the activity of the TNFR1 complex. In some embodiments, the small molecule inhibits the activity of a component of the TNFR1 complex. In some embodiments, the small molecule inhibits the activity of the RBP or RNA component of the TNFR1 complex. In some embodiments, the small molecule inhibits the activity of the RBP component of the TNFR1 complex. In some embodiments, the small molecule inhibits the activity of the RNA component of the TNFR1 complex.

[0394] In some embodiments, the small molecule binds to the target molecule and inhibits its activity. In some embodiments, the small molecule binds to a component of the TNFR1 complex and inhibits its activity. In some embodiments, the small molecule binds to the RBP or RNA component of the TNFR1 complex and inhibits its activity. In some embodiments, the small molecule binds to the RBP component of the TNFR1 complex and inhibits its activity. In some embodiments, the small molecule binds to the RNA component of the TNFR1 complex and inhibits its activity.

[0395] In some embodiments, the small molecule increases the activity of the target molecule. In some embodiments, the small molecule increases the activity of the TNFR1 complex. In some embodiments, the small molecule increases the activity of a component of the TNFR1 complex. In some embodiments, the small molecule increases the activity of the RBP or RNA component of the TNFR1 complex. In some embodiments, the small molecule increases the activity of the RBP component of the TNFR1 complex. In some embodiments, the small molecule increases the activity of the RNA component of the TNFR1 complex.

[0396] In some embodiments, the small molecule binds to the target molecule and increases the activity of the target molecule. In some embodiments, the small molecule binds to a component of the TNFR1 complex and increases the activity of that component. In some embodiments, the small molecule binds to the RBP or RNA component of the TNFR1 complex and increases the activity of that RBP or RNA component. In some embodiments, the small molecule binds to the RBP component of the TNFR1 complex and increases the activity of that RBP component. In some embodiments, the small molecule binds to the RNA component of the TNFR1 complex and increases the activity of that RNA component.

[0397] In some implementations, the regulator is an inhibitory nucleic acid.

[0398] The repressive nucleic acid according to this disclosure may comprise, or be composed of, DNA and / or RNA. The repressive nucleic acid may be single-stranded (e.g., in the case of antisense oligonucleotides (e.g., nick bodies)). The repressive nucleic acid may be double-stranded, or may contain double-stranded regions (e.g., in the case of siRNA, shRNA, etc.). The repressive nucleic acid may contain both double-stranded and single-stranded regions (e.g., in the case of shRNA and precursor-miRNA molecules, which are double-stranded in the stem region of the hairpin structure and single-stranded in the loop region of the hairpin structure).

[0399] In some embodiments, repressive nucleic acids promote the degradation of RNA target molecules or the RNA encoding target molecules. In some embodiments, repressive nucleic acids reduce the stability of RNA target molecules or the RNA encoding target molecules. In some embodiments, repressive nucleic acids disrupt the splicing of RNA target molecules or the RNA encoding target molecules. In some embodiments, repressive nucleic acids inhibit the translation of RNA encoding target molecules. In some embodiments, repressive nucleic acids inhibit the transcription of RNA target molecules.

[0400] In some embodiments, the repressive nucleic acid according to this disclosure may be, contain, or encode an antisense polynucleotide. An "antisense polynucleotide" refers to a polyribonucleotide or polydeoxyribonucleotide that is complementary to at least a portion of a target nucleotide sequence (e.g., RNA encoding a polypeptide whose expression will be repressed). The antisense polynucleotide according to this disclosure is preferably a single-stranded nucleic acid and binds to the target nucleotide sequence via complementary Watson-Crick base pairing. Complementary base pairing may include hydrogen bonding between complementary base pairs. The antisense polynucleotide may be provided as a single-stranded molecule, such as in the case of an antisense oligonucleotide, or may be contained in a double-stranded molecule class, such as in the case of siRNA, shRNA, and precursor-miRNA molecules.

[0401] In some embodiments, antisense polynucleotides reduce / prevent transcription of nucleic acids containing their target nucleotide sequences. In some embodiments, antisense polynucleotides reduce / prevent association of factors (e.g., enhancers, RNA polymerases) required for normal transcription of nucleic acids containing their target nucleotide sequences. In some embodiments, antisense polynucleotides increase / enhance the degradation of nucleic acids containing their target nucleotide sequences, for example, through RNA interference. In some embodiments, antisense polynucleotides reduce / prevent the translation of nucleic acids containing their target nucleotide sequences, for example, through RNA interference or through antisense degradation by RNase H activity.

[0402] RNA interference is described, for example, in Agrawal et al., Microbiol. Mol. Bio. Rev. (2003) 67(4): 657–685 and Hu et al., Sig. Transduc. Tar. Ther. (2020) 5(101), both of which are incorporated herein by reference in their entirety. In short, double-stranded RNA molecules are recognized by the argonaute component of the RNA-induced silencing complex (RISC). The double-stranded RNA is broken into single strands and integrated into the active RISC via the RISC loading complex (RLC). The RISC-integrated strands bind to their target RNAs via complementary base pairing, and depending on the identity of the RISC-integrated RNA and the degree of complementarity with the target RNA, the RISC then cleaves the target RNA, causing its degradation, or otherwise blocks ribosome access, thereby preventing its translation. RNAi-based therapeutics have been approved for a wide range of indications (see, for example, Kim, Chonnam Med J. (2020) 56(2): 87–93).

[0403] In some embodiments, the repressive nucleic acid according to this disclosure is siRNA, dsiRNA, miRNA, shRNA, pri-miRNA, precursor-miRNA, saRNA, or snoRNA or antisense oligonucleotide (e.g., nick body) that contains antisense polynucleotides as described herein or nucleic acids encoding such molecules.

[0404] In some embodiments, the inhibitory nucleic acid targeting a component of the TNFR1 complex is an inhibitory nucleic acid capable of downregulating the expression and / or activity of the component of the TNFR1 complex. In some embodiments, the inhibitory nucleic acid targeting a component of the TNFR1 complex is an inhibitory nucleic acid capable of downregulating the expression of the component of the TNFR1 complex. In some embodiments, the inhibitory nucleic acid targeting a component of the TNFR1 complex is an inhibitory nucleic acid capable of downregulating the activity of the component of the TNFR1 complex.

[0405] In some embodiments, the inhibitory nucleic acid targeting a component of TNFR1 complex II is an inhibitory nucleic acid capable of downregulating the expression and / or activity of the component of TNFR1 complex II. In some embodiments, the inhibitory nucleic acid targeting a component of TNFR1 complex II is an inhibitory nucleic acid capable of downregulating the expression of the component of TNFR1 complex II. In some embodiments, the inhibitory nucleic acid targeting a component of TNFR1 complex II is an inhibitory nucleic acid capable of downregulating the activity of the component of TNFR1 complex II.

[0406] Exemplary inhibitory nucleic acid systems capable of downregulating the activity of components of the TNFR1 complex II were used in the embodiments of this disclosure. For example, the expression and activity of FTO and XPO5 were downregulated using the shRNA system of Example 4. As a further example, RUPTR7 expression was downregulated using the shRNA of Example 9.

[0407] In some implementations, the repressive nucleic acid system (e.g., shRNA) comprises the nucleotide sequences of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:26 and / or SEQ ID NO:27, or variants thereof comprising one or more nucleotide substitutions, insertions, deletions or other modifications.

[0408] In some embodiments, the repressive nucleic acid system comprises the nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20, or a variant thereof comprising one or more nucleotide substitutions, insertions, deletions, or other modifications. In some embodiments, the shRNA comprises the nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20, or a variant thereof comprising one or more nucleotide substitutions, insertions, deletions, or other modifications.

[0409] In some embodiments, the repressive nucleic acid system comprises the nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20, or a variant thereof comprising a single nucleotide substitution. In some embodiments, the shRNA comprises the nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20, or a variant thereof comprising a single nucleotide substitution.

[0410] In some embodiments, the inhibitory nucleic acid system comprises, or is composed of, the nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20. In some embodiments, the shRNA comprises, or is composed of, the nucleotide sequence of SEQ ID NO:19 or SEQ ID NO:20.

[0411] In some embodiments, the repressive nucleic acid system comprises the nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27, or a variant thereof comprising one or more nucleotide substitutions, insertions, deletions, or modifications thereof. In some embodiments, the shRNA comprises the nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27, or a variant thereof comprising one or more nucleotide substitutions, insertions, deletions, or modifications thereof.

[0412] In some embodiments, the repressive nucleic acid system comprises the nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27, or a variant thereof comprising a single nucleotide substitution. In some embodiments, the shRNA comprises the nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27, or a variant thereof comprising a single nucleotide substitution.

[0413] In some embodiments, the inhibitory nucleic acid system comprises, or is composed of, the nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27. In some embodiments, the shRNA comprises, or is composed of, the nucleotide sequence of SEQ ID NO:26 or SEQ ID NO:27.

[0414] In some implementations, the regulator is a site-specific nuclease (SSN) system.

[0415] In some implementations, the SSN system is a CRISPR system, a zinc finger nuclease (ZFN) system, or a transcription activator-like effector nuclease (TALEN) system. In some implementations, the CRISPR system is a CRISPR / Cas9, CRISPR / Cas13, CRISPR / Cpf1, CRISPR / C2c1, CRISPR / C2c2, and / or CRISPR / C2c3 system.

[0416] SSN systems can be used to modulate the expression, stability, and / or activity of target molecules. Gene editing using SSNs is reviewed, for example, in Eid and Mahfouz, Exp Mol Med. (2016) 48(10): e265, which is incorporated herein by reference in its entirety. Enzymes capable of creating site-specific double-strand breaks (DSBs) can be engineered to introduce DSBs into target nucleic acid sequences. DSBs can be repaired by error-prone non-homologous end joining (NHEJ), where the two ends of the break are typically joined by the insertion or deletion of nucleotides. Alternatively, DSBs can be repaired by homology-directed repair (HDR), where a DNA template with ends homologous to the break site is provided and introduced at the DSB site. SSNs capable of being engineered to produce target nucleic acid sequence-specific DSBs include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly spaced palindromic repeats / CRISPR-associated protein 9 (CRISPR / Cas9) systems.

[0417] The ZFN system is reviewed, for example, in Umov et al., Nat Rev Genet. (2010) 11(9):636-46, which is incorporated herein by reference in its entirety. ZFNs contain programmable zinc finger DNA-binding domains and DNA-cutting domains (e.g., FokI endonuclease domains). The DNA-binding domains can be identified by screening zinc finger arrays capable of binding target nucleic acid sequences. The TALEN system is reviewed, for example, in Mahfouz et al., Plant Biotechnol J. (2014) 12(8):1006-14, which is incorporated herein by reference in its entirety. TALEs contain repeating domains consisting of repeating sequences of 33-39 amino acids, which are identical except for two residues at positions 12 and 13 of each repeat sequence, which are repeating variable diresidues (RVDs). Each RVD determines the binding of the repeat sequence to nucleotides in the target DNA sequence according to the following relationships: "HD" binds to C, "NI" binds to A, "NG" binds to T, and "NN" or "NK" binds to G (Moscou and Bogdanove, Science (2009) 326(5959):1501.). CRISPR / Cas9 and related systems, such as CRISPR / Cpf1, CRISPR / C2c1, CRISPR / C2c2, and CRISPR / C2c3, are reviewed, for example, in Nakade et al., Bioengineered (2017) 8(3):265-273, which is incorporated herein by reference in its entirety. These systems comprise endonucleases (e.g., Cas9, Cpf1, etc.) and a single guide RNA (sgRNA) molecule. sgRNAs can be engineered to target the endonuclease activity to the target nucleic acid sequence.

[0418] In some implementations, the CRISPR system comprises a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas protein). The gRNA is a short synthetic RNA consisting of a backbone sequence necessary for Cas-binding and a user-defined spacer region of approximately 20 nucleotides, which defines the genomic target to be modified. Therefore, the genomic target of the Cas protein can be altered simply by changing the target sequence present in the gRNA.

[0419] In some embodiments, the CRISPR / Cas system is capable of RNA degradation, RNA stabilization, transcriptional activation, and / or transcriptional inactivation. In some embodiments, downregulation of the expression and / or activity of components of the TNFR1 complex includes CRISPR / Cas-mediated RNA degradation and / or transcriptional inactivation. In some embodiments, upregulation of the expression and / or activity of components of the TNFR1 complex includes CRISPR / Cas-mediated RNA stabilization and / or transcriptional activation.

[0420] CRISPR / Cas9 is an SSN system comprising two essential components: a guide RNA that matches the desired target gene and Cas9 (CRISPR-associated protein 9)—an endonuclease that causes double-strand DNA breaks, allowing for genome modification. In some embodiments, the CRISPR / Cas9 system is capable of transcriptional inactivation. In some embodiments, the CRISPR / Cas9 system is capable of transcriptional activation. In some embodiments, downregulation of the expression and / or activity of components of the TNFR1 complex includes CRISPR / Cas9-mediated transcriptional activation.

[0421] CRISPR / Cas13 is another SSN system similar to CRISPR / Cas9. The CRISPR / Cas13 system contains the programmable single-effect RNA-guided ribonuclease Cas13. In contrast to the DNA-targeting activity of Cas9, Cas13 is a single-effect RNA-guided RNA interference activity. In some embodiments, the CRISPR / Cas13 system is capable of RNA degradation or RNA stabilization. In some embodiments, downregulation of the expression and / or activity of components of the TNFR1 complex includes CRISPR / Cas13-mediated RNA degradation.

[0422] In some embodiments, the SSN system is capable of downregulating the expression and / or activity of components of the TNFR1 complex. In some embodiments, the SSN system is capable of downregulating the expression of components of the TNFR1 complex. In some embodiments, the SSN system is capable of downregulating the activity of components of the TNFR1 complex.

[0423] In some embodiments, the SSN system is capable of downregulating the expression and / or activity of components of the TNFR1 complex II. In some embodiments, the SSN system is capable of downregulating the expression of components of the TNFR1 complex II. In some embodiments, the SSN system is capable of downregulating the activity of components of the TNFR1 complex II.

[0424] In the embodiments of this disclosure, exemplary SSN systems capable of downregulating the activity of components of the TNFR1 complex II are used. For example, the CRISPR / Cas9 system of Example 2 is used to downregulate FTO and XPO5 expression and activity.

[0425] In some embodiments, the SSN system comprises DNA containing the nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18, or a variant thereof containing one or more nucleotide substitutions, insertions, deletions, or modifications thereof. In some embodiments, the CRISPR / Cas9 system comprises a gRNA spacer region containing the nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18, or a variant thereof containing one or more nucleotide substitutions, insertions, deletions, or modifications thereof.

[0426] In some embodiments, the SSN system comprises DNA containing the nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18, or a variant thereof containing a single nucleotide substitution. In some embodiments, the CRISPR / Cas9 system comprises a gRNA spacer region containing the nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18, or a variant thereof containing a single nucleotide substitution.

[0427] In some embodiments, the SSN system comprises or is composed of DNA, said DNA containing the nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18. In some embodiments, the CRISPR / Cas9 system comprises or is composed of a gRNA spacer region, said spacer region containing the nucleotide sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18.

[0428] In some embodiments, the modulator is an agonist. In some embodiments, the modulator is an agonist of the expression and / or activity of a component of the TNFR1 complex. In some embodiments, the modulator is an agonist of the expression and / or activity of the RBP component of the TNFR1 complex. In some embodiments, the modulator is an agonist of the expression and / or activity of the RNA component of the TNFR1 complex. In some embodiments, the RBP is FTO or XPO5. In some embodiments, the RNA is FATALR1, RAD51B, AFF3, or RUPTR7.

[0429] In some embodiments, the modulator is an agonist of the expression and / or activity of a component of the TNFR1 complex II. In some embodiments, the modulator is an agonist of the expression and / or activity of the RBP component of the TNFR1 complex II. In some embodiments, the modulator is an agonist of the expression and / or activity of the RNA component of the TNFR1 complex II. In some embodiments, the RBP is FTO or XPO5. In some embodiments, the RNA is FATALR1, RAD51B, AFF3, or RUPTR7.

[0430] In some embodiments, the agonist mediates the overexpression of the target molecule. In some embodiments, the agonist mediates the overexpression of components of the TNFR1 complex.

[0431] In some embodiments, the agonist mediates the overexpression of RNA. In some embodiments, the agonist mediates the overexpression of FATALR1, RAD51B, AFF3, or RUPTR7. In some embodiments, the agonist mediates the overexpression of RNA encoding RBP. In some embodiments, the agonist mediates the overexpression of RNA encoding FTO or XPO5.

[0432] In some embodiments, the agonist mediates the transcriptional activation of the target molecule. In some embodiments, the agonist mediates the transcriptional activation of RNA. In some embodiments, the agonist mediates the transcriptional activation of FATALR1, RAD51B, AFF3, or RUPTR7. In some embodiments, the agonist mediates the transcriptional activation of RNA encoding RBP. In some embodiments, the agonist mediates the transcriptional activation of RNA encoding FTO or XPO5.

[0433] In some embodiments, the agonist mediates the transcriptional stabilization of the target molecule. In some embodiments, the agonist mediates the transcriptional stabilization of RNA. In some embodiments, the agonist mediates the transcriptional stabilization of FATALR1, RAD51B, AFF3, or RUPTR7. In some embodiments, the agonist mediates the transcriptional stabilization of RNA encoding RBP. In some embodiments, the agonist mediates the transcriptional stabilization of RNA encoding FTO or XPO5.

[0434] In some embodiments, the modulator consists of a nucleic acid encoding an RBP or RNA component of the TNFR1 complex, or contains a nucleic acid encoding an RBP or RNA component of the TNFR1 complex. In some embodiments, the modulator consists of a nucleic acid fragment encoding an RBP or RNA component of the TNFR1 complex, or contains a nucleic acid fragment encoding an RBP or RNA component of the TNFR1 complex. In some embodiments, the modulator consists of a nucleic acid fragment encoding a functional fragment of an RBP or RNA component of the TNFR1 complex, or contains a nucleic acid fragment encoding a functional fragment of an RBP or RNA component of the TNFR1 complex. In some embodiments, the modulator that upregulates the activity and / or expression of the RBP or RNA component of the TNFR1 complex consists of a nucleic acid encoding an RBP or RNA component of the TNFR1 complex, or contains a nucleic acid encoding an RBP or RNA component of the TNFR1 complex.

[0435] In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:1. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:2. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:3. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:4. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:5. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:6. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:7. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:8. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:10. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:11. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:21. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:22. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:23. In some embodiments, the modulator consists of or contains a nucleic acid encoding SEQ ID NO:25.

[0436] In some embodiments, the modulator consists of nucleic acids encoding fragments of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 and / or SEQ ID NO:25, or contains nucleic acids encoding fragments of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 and / or SEQ ID NO:25.

[0437] In some embodiments, the modulator consists of, or contains, nucleic acids according to SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 and / or SEQ ID NO:25.

[0438] In some embodiments, the nucleic acid may be a vector (e.g., an expression vector) or may be contained within a vector (e.g., an expression vector). The nucleotide sequence of the nucleic acid may be contained within a vector (e.g., an expression vector). As used herein, a “vector” is a nucleic acid molecule used as a medium to transfer exogenous nucleic acids into cells. A vector may be a carrier for expressing nucleic acids in cells. Such a vector may include a promoter sequence operatively linked to a nucleotide sequence encoding the sequence to be expressed. The vector may also include a stop codon and an expression enhancer. Any suitable vector, promoter, enhancer, and stop codon known in the art may be used to express peptides or polypeptides from vectors according to this disclosure.

[0439] In some embodiments, the CRISPR / Cas9 system is capable of transcriptional activation. In some embodiments, the upregulation of expression and / or activity of components of the TNFR1 complex includes CRISPR / Cas9-mediated transcriptional activation.

[0440] In some embodiments, the CRISPR / Cas13 system is capable of RNA stabilization. In some embodiments, the upregulation of expression and / or activity of components of the TNFR1 complex includes CRISPR / Cas13-mediated RNA stabilization.

[0441] In some embodiments, the target molecule is the RBP component of the TNFR1 complex. In some embodiments, the target molecule is FTO or XPO5. In some embodiments, the target molecule is the RNA component of the TNFR1 complex. In some embodiments, the target molecule is FATALR1, RAD51B, AFF3, or RUPTR7.

[0442] Preferably, the modulator according to this disclosure is provided for introduction into cells. In some embodiments, the modulator is provided as a nucleic acid and / or a vector. In some embodiments, an inhibitory nucleic acid, a nucleic acid encoding a site-specific nuclease (SSN) system, and / or a nucleic acid encoding an RBP or RNA component of the TNFR1 complex is provided as a nucleic acid and / or a vector.

[0443] Preferably, nucleic acids and / or vectors according to this disclosure are provided for introduction into cells. Suitable vectors include plasmids, binary vectors, DNA vectors, mRNA vectors, viral vectors (e.g., gamma retroviral vectors (e.g., vectors derived from murine leukemia virus (MLV)), lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, vaccinia virus vectors, and herpesvirus vectors), transposon-based vectors, and artificial chromosomes (e.g., yeast artificial chromosomes), described, for example, in Maus et al., Annu Rev Immunol (2014) 32:189-225 or Morgan and Boyerinas (Biomedicines 2016. 4,9), both of which are incorporated herein by reference in their entirety.

[0444] In some embodiments, the vector may be a eukaryotic vector, for example, a vector containing elements necessary for protein expression from a vector in eukaryotic cells. In some embodiments, the vector may be a mammalian vector, for example, containing a cytomegalovirus (CMV) or SV40 promoter to drive protein expression. In some embodiments, the viral vector may be a lentivirus, retrovirus, adenovirus, or herpes simplex virus vector.

[0445] In some embodiments, the vector is selected based on tropism to the cell type / tissue / organ to which nucleic acids need to be delivered, such as cell types / tissues / organs affected by the disease to be treated / prevented according to this disclosure (i.e., cells / tissues / organs exhibiting disease symptoms). In some embodiments, the vector is selected based on tropism to macrophages or their precursors (e.g., monocytes, macrophage / DC progenitors, or myeloid progenitors).

[0446] In some embodiments, the nucleic acid and / or vector contains one or more sequences for controlling nucleic acid expression. Therefore, in some embodiments, the nucleic acid / vector contains control elements for the inducible expression of the nucleic acid.

[0447] In some embodiments, the nucleic acid is a suitable vector for delivering RBP or RNA components encoding the TNFR1 complex as a gene therapy. In some embodiments, the vector is an adeno-associated virus (AAV) vector.

[0448] Adeno-associated virus vectors and their use in gene therapy are reviewed, for example, in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378 and Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272, both of which are incorporated herein by reference in their entirety. In some embodiments, the vector may be the adeno-associated virus vector described in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378. In some embodiments, the vector may be the adeno-associated virus vector described in Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272.

[0449] In some implementations, the vector is a self-complementary adeno-associated virus (scAAV) vector. Self-complementary adeno-associated virus vectors are described, for example, in McCarty, Mol Ther. (2008) 16(10):1648-56, which is incorporated herein by reference in its entirety. Conventional AAVs have a single-stranded DNA genome and rely on the DNA replication machinery of the transduced cell to synthesize the complementary strand, which delays transgene expression. In contrast, scAAVs contain a complementary sequence that anneals spontaneously after infection, eliminating the need for DNA synthesis in the transduced host cell. Compared to classic single-stranded AAV vectors, scAAV vectors have been shown to provide accelerated initiation of transgene expression, as well as increased levels of transgene expression.

[0450] In some embodiments, the vector may be an adeno-associated virus vector of one of the following serotypes: AAV1, AAV2, AAV2i8, AAV5, AAV6, AAV8, AAV9, AAV9.45, AAV10, or AAVrh74. In some embodiments, the vector is an AAV9 vector.

[0451] In some embodiments, the vector may be a cardiotropic adeno-associated virus vector. In some embodiments, the vector may be an adeno-associated virus vector of one of the following serotypes: AAV1, AAV8, AAV9, or AAV9.45.

[0452] In some embodiments, the vector may be a skeletal muscle tropism adeno-associated virus vector. In some embodiments, the vector may be an adeno-associated virus vector of one of the following serotypes: AAV1, AAV6, AAV7, AAV8, AAV9, AAV9.45.

[0453] In some embodiments, the vector contains modifications to increase binding to and / or transduction to the target cell type (i.e., compared to binding / transduction levels via an unmodified vector). In some embodiments, the modification is performed on the capsid protein.

[0454] In some embodiments, the vector comprises a capsid protein containing a cell-targeting peptide. In some embodiments, the cell-targeting peptide is the cell-targeting peptide described in Büning and Srivastava, Molecular Therapy: Methods & Clinical Development (2019) 12: 248-265, which is incorporated herein by reference in its entirety.

[0455] In some embodiments, the carrier comprises a capsid protein comprising substitutions for one or more tyrosine residues, such as one or more surface-exposed tyrosine residues. In some embodiments, one or more tyrosine residues of the capsid protein are substituted with phenylalanine. In some embodiments, the carrier comprises a capsid protein wherein one or more tyrosine residues are substituted with another amino acid, as described in Iida et al., Biomed Res Int. (2013) 2013:974819, which is incorporated herein by reference in its entirety.

[0456] In some embodiments, the vector may be the adeno-associated virus vector described in Büning and Srivastava (ibid.). In some embodiments, the vector may be the adeno-associated virus vector described in Iida et al. (ibid.).

[0457] In some embodiments, the composition includes a modifier according to the present disclosure encapsulated in or immobilized on nanoparticles, liposomes, nanogels or nanolipogels.

[0458] Nanoparticles are reviewed, for example, in Mitchell et al., Nature Reviews Drug Discovery (2021) 20:101–124, which is incorporated herein by reference in its entirety. In some embodiments, nanoparticles are polymeric nanoparticles (e.g., polymer bodies, dendritic polymers, polymer micelles, nanogels, or nanospheres), inorganic nanoparticles (e.g., silica nanoparticles, quantum dots, iron oxide nanoparticles, or gold nanoparticles), or lipid-based nanoparticles (e.g., liposomes, lipid nanoparticles, or emulsions).

[0459] Nanolipogels are described, for example, in Cao et al., Nanoscale Adv. (2020) 2: 1040-1045, which is incorporated herein by reference in its entirety. In some embodiments, nanolipogels are nanoscale core-shell systems having a gelled core and lipid bilayer.

[0460] In some embodiments, the modulators described herein associate (covalently or non-covalently) with cell-penetrating peptides (e.g., the cell-penetrating peptides described above), cationic polymers, cationic lipids, or viral vectors. In some embodiments, the modulators described herein associate with peptides / polypeptides (e.g., antibodies, peptide aptamers, ligands of cell surface molecules / fragments thereof) or nucleic acids (e.g., nucleic acid aptamers) capable of binding to target cells (or their antigens).

[0461] Modifiers can be identified by any suitable method known in the art. For example, a library of potential modifiers can be screened for their ability to modulate components of the TNFR1 complex. Alternatively or additionally, modifiers of components of the TNFR1 complex can be generated using a rational design.

[0462] Many assays can be used to screen for potential regulators by determining the ability of a component of the TNFR1 complex to modulate it. The ability of a potential regulator to upregulate or downregulate the expression or activity of a component of the TNFR1 complex can be determined by any method known in the art, such as by using the assays used in the embodiments of this disclosure, or by other assays disclosed herein.

[0463] Libraries of potential modulators can be screened based on their ability to modulate the components of the TNFR1 complex. For example, small molecule libraries can be screened based on their ability to modulate the components of the TNFR1 complex.

[0464] Small molecules, SSN systems, and inhibitory nucleic acids can be designed as components that regulate the TNFR1 complex, and such design methods are well known to those skilled in the art.

[0465] Components of an SSN system can be designed and modified to target predetermined nucleotide sequences. For example, gDNA, guide RNA (gRNA), DNA-binding domains, and other targeting sequences can be designed and modified for the SSN system using methods known in the art. In some embodiments, for a CRISPR system, gDNA or gRNA sequences are designed and modified to modulate components of the TNFR1 complex. In some embodiments, for CRISPR / Cas9, gRNA sequences are designed and modified to modulate components of the TNFR1 complex. In some embodiments, for CRISPR / Cas13, gRNA sequences are designed and modified to modulate components of the TNFR1 complex. In some embodiments, for an SSN system, DNA-binding domains are designed and modified to modulate components of the TNFR1 complex. In some embodiments, for a ZFN system, DNA-binding domains are designed and modified to modulate components of the TNFR1 complex. In some embodiments, for a TALEN system, DNA-binding domains are designed and modified to modulate components of the TNFR1 complex. Methods for designing and modifying SSN systems are described in Hiranmiramol et al. (Bioinformatics, Vol. 36, No. 9, May 2020, pp. 2684–2689), Wessels et al. (Nature Biotechnology. 38, 722–727. 2020), Granados-Riveron and Aquino-Jarquin (Cancer Res (2018) 78 (15): 4107–4113), Heigwer et al. (Nucleic Acids Research, 41(20), 2013, e190), and Carroll et al. (Nature Protocols. 1, 1329–1341. 2006), which are incorporated herein by reference in their entirety.

[0466] Furthermore, inhibitory nucleic acids can be designed to regulate components of the TNFR1 complex, and such design methods are well known to those skilled in the art. Based on this disclosure, those skilled in the art can readily select suitable inhibitory nucleic acids to reduce the activity and / or expression of components of the TNFR1 complex. Methods for designing inhibitory nucleic acids are discussed in Moore et al. (Methods MolBiol. 2010; 629: 141–158), Fakhr et al. (Cancer Gene Therapy 23, 73–82. 2016), Mickiewicz et al. (Acta Biochim Pol. 2016;63(1):71–77), and Aartsma-Rus et al. (Mol Ther. 2009; 17(3): 548–553), each of which is incorporated herein by reference in its entirety.

[0467] In embodiments where it is necessary to inhibit the activity and / or expression of the RBP component of the TNFR1 complex, the repressive nucleic acid may comprise or encode an antisense nucleic acid having a target nucleotide sequence, which is a nucleotide sequence encoding the RBP component of the TNFR1 complex (e.g., a nucleotide sequence of RNA encoded by a gene encoding FTO or a nucleotide sequence of RNA encoding XPO5). In some embodiments, the target nucleotide sequence comprises one or more nucleotides encoding an exon of RNA encoding FTO (e.g., a nucleotide sequence of an exon of RNA encoding FTO). In some embodiments, the target nucleotide sequence comprises one or more nucleotides encoding an exon of RNA encoding XPO5 (e.g., a nucleotide sequence of an exon of RNA encoding XPO5).

[0468] In embodiments where it is necessary to inhibit the activity and / or expression of the RNA component of the TNFR1 complex, the repressive nucleic acid may comprise or encode an antisense nucleic acid having a target nucleotide sequence, which is the nucleotide sequence of the RNA component of the TNFR1 complex. In some embodiments, the target nucleotide sequence comprises one or more nucleotides of the RNA component of the TNFR1 complex as identified in Table 1. In some embodiments, the target nucleotide sequence comprises one or more nucleotides of FATALR1. In some embodiments, the target nucleotide sequence comprises one or more nucleotides of RAD51B. In some embodiments, the target nucleotide sequence comprises one or more nucleotides of AFF3. In some embodiments, the target nucleotide sequence comprises one or more nucleotides of RUPTR7.

[0469] Methods for upregulating the activity and / or expression of genes, RNA, and / or proteins are well known to those skilled in the art. Methods for generating regulators for upregulating the activity and / or expression of genes, RNA, and / or proteins are also well known to those skilled in the art. In some embodiments, the overexpression construct consists of nucleic acids encoding an RBP or RNA component of the TNFR1 complex, or contains nucleic acids encoding an RBP or RNA component of the TNFR1 complex. In some embodiments, the overexpression construct consists of nucleic acids encoding a fragment of an RBP or RNA component of the TNFR1 complex, or contains nucleic acids encoding a fragment of an RBP or RNA component of the TNFR1 complex. In some embodiments, the overexpression construct consists of nucleic acids encoding a functional fragment of an RBP or RNA component of the TNFR1 complex, or contains nucleic acids encoding a functional fragment of an RBP or RNA component of the TNFR1 complex. In some embodiments, regulators for upregulating the activity and / or expression of the RBP or RNA component of the TNFR1 complex consist of nucleic acids encoding an RBP or RNA component of the TNFR1 complex, or contain nucleic acids encoding an RBP or RNA component of the TNFR1 complex. In some embodiments, the nucleic acid may be a vector (e.g., an expression vector) or may be contained within a vector (e.g., an expression vector). The nucleotide sequence of the nucleic acid may be contained within a vector (e.g., an expression vector). As used herein, a “vector” is a nucleic acid molecule used as a medium to transfer exogenous nucleic acids into cells. A vector may be a vector for expressing nucleic acids in cells. Such a vector may include a promoter sequence operatively linked to a nucleotide sequence encoding the sequence to be expressed. The vector may also include a stop codon and an expression enhancer. Any suitable vector, promoter, enhancer, and stop codon known in the art may be used to express peptides or polypeptides from vectors according to this disclosure. The design of regulators (e.g., constructs for gene therapy) for upregulating the activity and / or expression of genes, RNA, and / or proteins is well known to those skilled in the art.

[0470] Functional properties of regulators The modulators described herein can be characterized by reference to certain functional properties. In some embodiments, the antigen-binding molecules described herein may possess one or more of the following properties: Inhibit the expression and / or activity of the RBP component of the TNFR1 complex; Inhibit the expression and / or activity of the RNA component of the TNFR1 complex; Inhibit cell death; Inhibit caspase expression and / or activity; Inhibit receptor-interacting serine / threonine-protein kinase expression and / or activity; Upregulate the expression and / or activity of the RBP component of the TNFR1 complex; Upregulate the expression and / or activity of the RNA component of the TNFR1 complex; Upregulates cell death; Upregulates caspase expression and / or activity; Upregulates receptor-interacting serine / threonine protein kinase expression and / or activity.

[0471] It will be understood that the provided modifier may exhibit more than one of the properties described in the preceding paragraphs. For the properties described in the preceding paragraphs, the provided modifier may be evaluated using a suitable assay. For example, the assay may be, for instance, an in vitro assay, optionally a cell-based assay, or a cell-free assay. In some embodiments, the assay may be, for instance, an in vivo assay, i.e., an assay performed in a non-human animal. In some embodiments, the assay may be, for instance, an ex vivo assay, i.e., an assay performed using cells / tissues / organs obtained from a subject.

[0472] In cell-based assays, these may include treating cells with a provided modifier to determine whether the modifier exhibits one or more of the described properties. Assays may use substances capable of detecting entity markers to facilitate their detection. Assays may include evaluating the described properties after treating cells individually with a range of amounts / concentrations of the provided modifier (e.g., a dilution series).

[0473] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of the RBP component of the TNFR1 complex. In some embodiments, the modulator inhibits the expression of the RBP component of the TNFR1 complex. In some embodiments, the modulator upregulates the activity of the RBP component of the TNFR1 complex. The expression level of the RBP component of the TNFR1 complex can be determined by any method known in the art.

[0474] In some embodiments, the expression of the RBP component of the TNFR1 complex is gene expression and / or protein expression. In some embodiments, the expression of the RBP component of the TNFR1 complex is gene expression. In some embodiments, the expression of the RBP component of the TNFR1 complex is protein expression.

[0475] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of FTO and / or XPO5. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of FTO. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of XPO5.

[0476] In some embodiments, the modulator inhibits or upregulates the expression of FTO and / or XPO5. In some embodiments, the modulator inhibits or upregulates the expression of FTO. In some embodiments, the modulator inhibits or upregulates the expression of XPO5.

[0477] In some embodiments, the modulator inhibits or upregulates the activity of FTO and / or XPO5. In some embodiments, the modulator inhibits or upregulates the activity of FTO. In some embodiments, the modulator inhibits or upregulates the activity of XPO5.

[0478] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of the RNA component of the TNFR1 complex. In some embodiments, the modulator inhibits or upregulates the expression of the RNA component of the TNFR1 complex. In some embodiments, the modulator inhibits or upregulates the activity of the RNA component of the TNFR1 complex. The expression level of the RNA component of the TNFR1 complex can be determined by any method known in the art. The expression of the RNA component of the TNFR1 complex does not imply protein expression.

[0479] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of FATALR1, RAD51B, AFF3, and / or RUPTR7. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of FATALR1. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of RAD51B. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of AFF3. In some embodiments, the modulator inhibits or upregulates the expression and / or activity of RUPTR7.

[0480] In some embodiments, the modulator inhibits or upregulates the expression of FATALR1, RAD51B, AFF3, and / or RUPTR7. In some embodiments, the modulator inhibits or upregulates the expression of FATALR1. In some embodiments, the modulator inhibits or upregulates the expression of RAD51B. In some embodiments, the modulator inhibits or upregulates the expression of AFF3. In some embodiments, the modulator inhibits or upregulates the expression of RUPTR7.

[0481] In some embodiments, the modulator inhibits or upregulates the activity of FATALR1, RAD51B, AFF3, and / or RUPTR7. In some embodiments, the modulator inhibits or upregulates the activity of FATALR1. In some embodiments, the modulator inhibits or upregulates the activity of RAD51B. In some embodiments, the modulator inhibits or upregulates the activity of AFF3. In some embodiments, the modulator inhibits or upregulates the activity of RUPTR7.

[0482] Gene expression levels, i.e., the level of RNA transcribed from genes, can be determined by any method known in the art, such as quantitative real-time PCR (qRT-PCR), serial gene expression analysis (SAGE), microarray analysis, and / or RNA sequencing (RNA-Seq). Protein expression levels can be determined by any method known in the art, such as antibody-based methods, Western blotting, immunohistochemistry, immunocytochemistry, flow cytometry, and / or ELISA.

[0483] The activity levels of components of the TNFR1 complex can be determined by any method known in the art. In some embodiments, the activity of components of the TNFR1 complex includes: binding to interacting partners, binding to components of the TNFR1 complex, activation of the NF-κB pathway, activation of the JNK pathway, activation of the p38 pathway, upregulation of cell death, upregulation of apoptosis, and / or upregulation of necrotic apoptosis.

[0484] In some embodiments, the activity of a component of TNFR1 complex I includes binding to an interacting partner, binding to a component of TNFR1 complex I, activation of the NF-κB pathway, activation of the JNK pathway, and / or activation of the p38 pathway. In some embodiments, the activity of a component of TNFR1 complex II includes binding to an interacting partner, binding to a component of TNFR1 complex II, upregulation of cell death, and / or upregulation of apoptosis.

[0485] In some embodiments, the activity of a component of TNFR1 complex IIa includes binding to an interacting partner, binding to a component of TNFR1 complex IIa, upregulation of cell death, and / or upregulation of apoptosis. In some embodiments, the activity of a component of TNFR1 complex IIb includes binding to an interacting partner, binding to a component of TNFR1 complex IIb, upregulation of cell death, and / or upregulation of apoptosis. In some embodiments, the activity of a component of TNFR1 complex IIc includes binding to an interacting partner, binding to a component of TNFR1 complex IIc, upregulation of cell death, and / or upregulation of necroptosis.

[0486] The level of NF-κB pathway activation can be determined by any method known in the art. In some embodiments, the level of NF-κB pathway activation is determined by gene expression analysis and / or protein expression analysis of genes / proteins activated by the NF-κB pathway. In some embodiments, the level of NF-κB pathway activation is determined by measuring p65 (RelA) protein that has translocated to the cell nucleus. In some embodiments, the level of NF-κB pathway activation is determined using the NF-κB translocation assay described in the assay instruction manual (Markossian et al., Eli Lilly & Company and the National Center for Advancing Translational Sciences; 2004). In some embodiments, the level of NF-κB pathway activation is determined using a widely available commercially available NF-κB assay.

[0487] JNK pathway activation levels can be determined by any method known in the art. In some embodiments, JNK pathway activation is determined by gene expression analysis and / or protein expression analysis of genes / proteins activated by the JNK pathway. In some embodiments, immune-complex kinase assays, AP1 reporter assays, or commercially available JNK pathway activation assays are used to determine JNK pathway activation levels. In some embodiments, the assay used by He et al. (Cell Death and Differentiation (1999) 6, 987-991) is used to determine JNK pathway activation levels.

[0488] The level of p38 pathway activation can be determined by any method known in the art. In some embodiments, p38 pathway activation is determined by gene expression analysis and / or protein expression analysis of genes / proteins activated by the p38 pathway. In some embodiments, phosphorylation of p38 MAPK (p-p38) is detected by enzyme-linked immunosorbent assay (ELISA) to determine the level of p38 pathway activation. In some embodiments, the assay used by LaJevic et al. (Immunology. 2011 Feb;132(2): 197–208) is employed.

[0489] The binding level with the interacting partner, such as the binding level with a component of the TNFR1 complex, can be determined by any suitable method known in the art. In some embodiments, the binding level with the interacting partner is determined using a cell-based interaction assay. In some embodiments, the binding level with the interacting partner is determined using a cell-based protein interaction assay. Many types of cell-based interaction assays are known to those skilled in the art. In some embodiments, the binding level with the interacting partner is determined using a luminescence-based, fluorescence-based, and / or imaging-based assay. In some embodiments, the binding level with the interacting partner is determined using an assay described in the assay instruction manual (Markossian et al., Eli Lilly & Company and the National Center for Advancing Translational Sciences; 2004).

[0490] In some embodiments, the modulator inhibits or upregulates the level of cell death. The level of cell death can be determined by any method known in the art, such as the annexin V / propidium iodide (PI) assay used in the embodiments of this disclosure. Cell death assays for drug discovery are reviewed in Kepp et al. (2011. Nature Reviews DrugDiscovery. Vol. 10, 221–237), which is incorporated herein by reference in its entirety. In some embodiments, cell death is apoptosis. The level of apoptosis can be determined by any method known in the art, such as the annexin V / propidium iodide (PI) assay used in the embodiments of this disclosure. Commercially available apoptosis assays are available to those skilled in the art from many sources. In some embodiments, cell death is necroptosis. The level of necroptosis can be determined by any method known in the art, such as the assay reviewed in Degterev et al. (Methods Enzymol. 2014:545:1-33). Commercially available necroptosis assays are available to those skilled in the art.

[0491] In some embodiments, the modulator inhibits or upregulates the levels of caspase expression and / or activity. In some embodiments, the caspase is caspase-3, caspase-8, and / or caspase-10. The level of caspase expression can be determined by any method known in the art. In some embodiments, caspase expression is caspase gene expression and / or caspase protein expression. The levels of gene expression and / or protein expression can be determined by any method known in the art. The level of caspase activity can be determined by any method known in the art, such as by using colorimetric assays, fluorescence assays, cell imaging, and / or the method used in Example 2 (where the processing of caspases (caspase-8 and caspase-3) is determined). Caspase activity assays are reviewed in Niles et al. (Methods Mol Biol. 2008:414:137-50), which is incorporated herein by reference in its entirety.

[0492] In some embodiments, the modulator inhibits or upregulates the level of caspase-3 expression. In some embodiments, the modulator inhibits or upregulates the level of caspase-3 activity. Caspase-3 initiates apoptosis or other cellular processes in mammalian cells. As a simple and convenient analytical method, the caspase-3 activity assay measures caspase activity by recognizing the DEVD sequence. This assay is based on the spectrophotometric detection of the chromophore p-nitroaniline (pNA) cleaved from the labeled substrate DEVD-pNA. The light emission of pNA can be quantified at 400–405 nm using a spectrophotometer or microplate reader. Comparing the pNA absorbance of treated samples and untreated controls allows for the determination of a fold increase in caspase-3 activity.

[0493] In some embodiments, the modulator inhibits or upregulates the level of caspase-8 expression. In some embodiments, the modulator inhibits or upregulates the level of caspase-8 activity. A caspase-8 assay can be based on the recognition of the sequence Ile-Glu-Thr-Asp (IETD). This assay is based on spectrophotometric detection of pNA after cleavage from the labeled substrate IETD-pNA. pNA light emission can be quantified at OD 400–405 nm using a spectrophotometer or microplate reader. Comparing the absorbance of pNA from apoptotic samples with that from uninduced controls allows for the determination of a fold increase in caspase-8 activity.

[0494] In some embodiments, the modulator inhibits or upregulates the level of caspase-10 expression. In some embodiments, the modulator inhibits or upregulates the level of caspase-10 activity. The caspase-10 assay can be based on the recognition of the AEVD sequence. This assay is based on the spectrophotometric detection of the chromophore p-NA after cleavage from the labeled substrate AEVD-p-NA. The p-NA light emission can be quantified at 400–405 nm using a spectrophotometer or microplate reader.

[0495] In some embodiments, the modulator inhibits or upregulates the expression and / or activity of receptor-interacting serine / threonine-protein kinases. The levels of receptor-interacting serine / threonine-protein kinase expression and / or activity can be determined by any method known in the art, such as colorimetric assays, fluorescence assays, and / or cell imaging. In some embodiments, the serine / threonine-protein kinase is RIPK1 and / or RIPK3. In some embodiments, the modulator inhibits or upregulates the level of RIPK1 expression. In some embodiments, the modulator inhibits or upregulates the level of RIPK1 activity. In some embodiments, the modulator inhibits or upregulates the level of RIPK3 expression. In some embodiments, the modulator inhibits or upregulates the level of RIPK3 activity. In some embodiments, the levels of RIPK1 and / or RIPK3 activity can be determined by any method known in the art, such as the method used in Example 2 (where RIPK1 processing is determined). Assays for assessing receptor-interacting serine / threonine-protein kinases are reviewed in Degterev et al. (Methods Enzymol. 2014:545:1-33), which is incorporated herein by reference in its entirety.

[0496] In some embodiments, in a suitable expression assay, the modulator reduces the expression and / or activity of the RBP component of the TNFR1 complex to less than 1 times the level observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≤0.99 times, ≤0.95 times, ≤0.9 times, ≤0.85 times, ≤0.8 times, ≤0.75 times, ≤0.7 times, ≤0.65 times, ≤0.6 times, ≤0.55 times, ≤0.5 times, ≤0.45 times, ≤0.4 times, ≤0.35 times, ≤0.3 times, ≤0.25 times, ≤0.2 times, ≤0.15 times, ≤0.1 times, ≤0.05 times, or ≤0.01 times. In some embodiments, the modulator inhibits more than 10% of the expression and / or activity observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≥20%, ≥25%, ≥30%, ≥35%, ≥40%, ≥45%, ≥50%, ≥55%, ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99%.

[0497] In some embodiments, in a suitable expression assay, the modulator reduces the expression and / or activity of the RNA component of the TNFR1 complex to less than one-fold of the level observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≤0.99-fold, ≤0.95-fold, ≤0.9-fold, ≤0.85-fold, ≤0.8-fold, ≤0.75-fold, ≤0.7-fold, ≤0.65-fold, ≤0.6-fold, ≤0.55-fold, ≤0.5-fold, ≤0.45-fold, ≤0.4-fold, ≤0.35-fold, ≤0.3-fold, ≤0.25-fold, ≤0.2-fold, ≤0.15-fold, ≤0.1-fold, ≤0.05-fold, or ≤0.01-fold. In some embodiments, the modulator inhibits more than 10% of the expression and / or activity observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≥20%, ≥25%, ≥30%, ≥35%, ≥40%, ≥45%, ≥50%, ≥55%, ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99%.

[0498] In some embodiments, in a suitable expression assay, the modulator reduces the level of caspase and / or receptor-interacting serine / threonine-protein kinase expression / activity to less than 1 times the level observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example ≤0.99, ≤0.95, ≤0.9, ≤0.85, ≤0.8, ≤0.75, ≤0.7, ≤0.65, ≤0.6, ≤0.55, ≤0.5, ≤0.45, ≤0.4, ≤0.35, ≤0.3, ≤0.25, ≤0.2, ≤0.15, ≤0.1, ≤0.05, or ≤0.01 times. In some embodiments, the modulator inhibits more than 10% of the expression and / or activity observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≥20%, ≥25%, ≥30%, ≥35%, ≥40%, ≥45%, ≥50%, ≥55%, ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99%.

[0499] In some embodiments, in a suitable assay, the modulator reduces the level of cell death (e.g., apoptosis, necroptosis, and / or pyroptosis) to less than 1 times the level observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≤0.99 times, ≤0.95 times, ≤0.9 times, ≤0.85 times, ≤0.8 times, ≤0.75 times, ≤0.7 times, ≤0.65 times, ≤0.6 times, ≤0.55 times, ≤0.5 times, ≤0.45 times, ≤0.4 times, ≤0.35 times, ≤0.3 times, ≤0.25 times, ≤0.2 times, ≤0.15 times, ≤0.1 times, ≤0.05 times, or ≤0.01 times. In some embodiments, the modulator inhibits more than 10% of the expression and / or activity observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≥20%, ≥25%, ≥30%, ≥35%, ≥40%, ≥45%, ≥50%, ≥55%, ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, or ≥99%.

[0500] In some embodiments, in a suitable expression assay, the modulator increases the level of expression and / or activity of the RBP component of the TNFR1 complex to more than 1-fold the level observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example ≥1.01-fold, ≥1.05-fold, ≥1.1-fold, ≥1.15-fold, ≥1.2-fold, ≥1.25-fold, ≥1.5-fold, ≥1.6-fold, ≥1.7-fold, ≥1.8-fold, ≥1.9-fold, ≥2-fold, ≥3-fold, ≥4-fold, or ≥5-fold. In some embodiments, the modulator upregulates expression and / or activity to more than 110% of the expression and / or activity observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≥120%, ≥125%, ≥130%, ≥135%, ≥140%, ≥145%, ≥150%, ≥155%, ≥160%, ≥165%, ≥170%, ≥175%, ≥180%, ≥185%, ≥190%, ≥195%, ≥200%, ≥250%, or ≥300%.

[0501] In some embodiments, in a suitable expression assay, the modulator increases the level of expression and / or activity of the RNA component of the TNFR1 complex to more than 1-fold the level observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example ≥1.01-fold, ≥1.05-fold, ≥1.1-fold, ≥1.15-fold, ≥1.2-fold, ≥1.25-fold, ≥1.5-fold, ≥1.6-fold, ≥1.7-fold, ≥1.8-fold, ≥1.9-fold, ≥2-fold, ≥3-fold, ≥4-fold, or ≥5-fold. In some embodiments, the modulator upregulates expression and / or activity to more than 110% of the expression and / or activity observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≥120%, ≥125%, ≥130%, ≥135%, ≥140%, ≥145%, ≥150%, ≥155%, ≥160%, ≥165%, ≥170%, ≥175%, ≥180%, ≥185%, ≥190%, ≥195%, ≥200%, ≥250%, or ≥300%.

[0502] In some embodiments, in a suitable expression assay, the modulator increases the level of caspase and / or receptor-interacting serine / threonine-protein kinase expression / activity to more than 1-fold the level observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example ≥1.01-fold, ≥1.05-fold, ≥1.1-fold, ≥1.15-fold, ≥1.2-fold, ≥1.25-fold, ≥1.5-fold, ≥1.6-fold, ≥1.7-fold, ≥1.8-fold, ≥1.9-fold, ≥2-fold, ≥3-fold, ≥4-fold, or ≥5-fold. In some embodiments, the modulator upregulates expression and / or activity to more than 110% of the expression and / or activity observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example, ≥120%, ≥125%, ≥130%, ≥135%, ≥140%, ≥145%, ≥150%, ≥155%, ≥160%, ≥165%, ≥170%, ≥175%, ≥180%, ≥185%, ≥190%, ≥195%, ≥200%, ≥250%, or ≥300%.

[0503] In some embodiments, in a suitable assay, the modulator increases the level of cell death (e.g., apoptosis, necroptosis, and / or pyroptosis) to more than 1-fold the level observed in the absence of the modulator (or in the presence of a suitable control molecule, such as a non-modulatory molecule), for example ≥1.01-fold, ≥1.05-fold, ≥1.1-fold, ≥1.15-fold, ≥1.2-fold, ≥1.25-fold, ≥1.5-fold, ≥1.6-fold, ≥1.7-fold, ≥1.8-fold, ≥1.9-fold, ≥2-fold, ≥3-fold, ≥4-fold, or ≥5-fold. In some implementations, the regulator upregulates cell death to more than 110% of the expression and / or activity observed in the absence of the regulator (or in the presence of a suitable control molecule, such as a non-regulatory molecule), for example, ≥120%, ≥125%, ≥130%, ≥135%, ≥140%, ≥145%, ≥150%, ≥155%, ≥160%, ≥165%, ≥170%, ≥175%, ≥180%, ≥185%, ≥190%, ≥195%, ≥200%, ≥250%, or ≥300%.

[0504] Treating / preventing diseases by regulating the components of the TNFR1 complex The modifiers described herein and compositions containing the modifiers described herein may be used in therapeutic and preventative methods.

[0505] This disclosure provides modulators of components of the TNFR1 complex for the treatment or prevention of the diseases described herein, wherein the components of the TNFR1 complex are RBP or RNA. Use of the modulators of components of the TNFR1 complex in the preparation of medicaments for the treatment or prevention of the diseases described herein is also provided, wherein the components of the TNFR1 complex are RBP or RNA. Methods for treating or preventing the diseases described herein are also provided, wherein the method comprises administering to a subject a therapeutically or preventively effective amount of a modulator of components of the TNFR1 complex, wherein the components of the TNFR1 complex are RBP or RNA.

[0506] This disclosure also provides modulators of components of TNFR1 complex I for the treatment or prevention of the diseases described herein, wherein the components of TNFR1 complex I are RBP or RNA. Use of the modulators of components of TNFR1 complex I in the preparation of medicaments for the treatment or prevention of the diseases described herein is also provided, wherein the components of TNFR1 complex I are RBP or RNA. Methods for treating or preventing the diseases described herein are also provided, wherein the method comprises administering to a subject a therapeutically or preventively effective amount of a modulator of components of TNFR1 complex I, wherein the components of TNFR1 complex I are RBP or RNA.

[0507] This disclosure also provides modulators of components of the TNFR1 complex II for the treatment or prevention of the diseases described herein, wherein the components of the TNFR1 complex II are RBP or RNA. Use of the modulators of components of the TNFR1 complex II in the preparation of medicaments for the treatment or prevention of the diseases described herein is also provided, wherein the components of the TNFR1 complex II are RBP or RNA. Methods for treating or preventing the diseases described herein are also provided, wherein the method comprises administering to a subject a therapeutically or preventively effective amount of a modulator of components of the TNFR1 complex II, wherein the components of the TNFR1 complex II are RBP or RNA.

[0508] In some embodiments, the pathologically involved TNFR1-mediated signal transduction is a disease pathologically involved TNFR1 complex I-mediated signal transduction. In some embodiments, the pathologically involved TNFR1-mediated signal transduction is a disease pathologically involved TNFR1 complex II-mediated signal transduction. In some embodiments, the pathologically involved TNFR1-mediated signal transduction is a disease pathologically involved TNFR1 complex IIa-mediated signal transduction. In some embodiments, the pathologically involved TNFR1-mediated signal transduction is a disease pathologically involved TNFR1 complex IIb-mediated signal transduction. In some embodiments, the pathologically involved TNFR1-mediated signal transduction is a disease pathologically involved TNFR1 complex IIc-mediated signal transduction.

[0509] The methods described herein can effectively reduce the development or progression of a disease / condition, alleviate symptoms, or reduce the pathology of a disease / condition. The methods can effectively prevent the progression of a disease / condition, such as preventing its worsening or slowing its rate of development. In some embodiments, the methods can lead to improvement in the disease / condition, such as a reduction in symptoms or a decrease in other relevant indicators of the severity / activity of the disease / condition. In some embodiments, the methods can prevent the development of late-stage (e.g., chronic or metastatic) diseases / conditions.

[0510] Experimental embodiments of this disclosure describe the identification and functional characterization of modulators of components of the TNFR1 complex, which possess unique functional profiles. In particular, the modulators of this disclosure have been demonstrated to be effective in regulating cell death and / or inflammation.

[0511] Therefore, it will be understood that the items disclosed herein can be used to treat / prevent virtually any disease / condition from which therapeutic or preventative benefits are derived by regulation of cell death and / or inflammation.

[0512] For example, the disease / condition can be one in which increased / upregulated / high levels of cell death are positively correlated with the onset, development, or progression of the disease / condition and / or the severity of one or more symptoms of the disease / condition. In some embodiments, increased / upregulated / high levels of cell death may be a risk factor for the onset, development, or progression of the disease / condition.

[0513] The disease / condition can be one in which a decrease / downregulation / low level of cell death is positively correlated with the onset, development, or progression of the disease / condition and / or the severity of one or more symptoms of the disease / condition. In some embodiments, a decrease / downregulation / low level of cell death may be a risk factor for the onset, development, or progression of the disease / condition.

[0514] The disease / condition can be one in which increased / upregulated / high levels of inflammation are positively correlated with the onset, development, or progression of the disease / condition and / or the severity of one or more symptoms of the disease / condition. In some embodiments, increased / upregulated / high levels of inflammation may be a risk factor for the onset, development, or progression of the disease / condition.

[0515] The disease / condition can be one in which a decrease / downregulation / low level of inflammation is positively correlated with the onset, development, or progression of the disease / condition and / or the severity of one or more symptoms of the disease / condition. In some embodiments, a decrease / downregulation / low level of inflammation may be a risk factor for the onset, development, or progression of the disease / condition.

[0516] It will also be understood that the items disclosed herein can be used to treat / prevent virtually any disease / condition from which therapeutic or preventative benefits are derived by regulation of TNFR1-mediated signal transduction.

[0517] The disease / condition can be one in which increased / upregulated / high levels of TNFR1-mediated signaling are positively correlated with the onset, development, or progression of the disease / condition and / or the severity of one or more symptoms of the disease / condition. In some embodiments, increased / upregulated / high levels of TNFR1-mediated signaling may be a risk factor for the onset, development, or progression of the disease / condition.

[0518] As used herein, a disease / condition pathologically involving TNFR1-mediated signaling is a disease / condition in which an increase or decrease in the level of TNFR1-mediated signaling is positively correlated with the onset, development, or progression of the disease / condition and / or the severity of one or more symptoms of the disease / condition, for example, compared to the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease-affected tissue). In some embodiments, a decrease / downregulation / low level of TNFR1-mediated signaling may be a risk factor for the onset, development, or progression of the disease / condition, for example, compared to the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease-affected tissue).

[0519] Diseases / conditions pathologically involving TNFR1-mediated signal transduction can be characterized by one or more of the following: Increased / upregulated / high level of TNFR1-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of TNFR1 complex I-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of TNFR1 complex II-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of cell death, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of apoptosis, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of caspase expression and / or activity, for example, compared with the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high levels of receptor-interacting serine / threonine-protein kinase (e.g., RIPK1 or RIPK3) expression and / or activity, for example, compared to levels / numbers / proportions / activities in the absence of said disease / condition (e.g., in healthy subjects or in the same unaffected tissues); Increased / upregulated / high level of PARP expression and / or activity, for example, compared to the level / amount / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of inflammation, for example, compared to the level / amount / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Reduced / downregulated / low level of TNFR1-mediated signal transduction, for example, compared with the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduced / downregulated / low level of TNFR1 complex I-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Reduced / downregulated / low level of TNFR1 complex II-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same unaffected tissues); The reduction / downregulation / low level of cell death, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduction / downregulation / low level of apoptosis, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Decreased / downregulated / low level of caspase expression and / or activity, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Decreased / downregulated / low level of receptor-interacting serine / threonine-protein kinase (e.g., RIPK1 or RIPK3) expression and / or activity, for example, compared to the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same unaffected tissues); Decreased / downregulated / low level of PARP expression and / or activity, for example, compared with the level / amount / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduction / downregulation / low level of inflammation, for example, compared to the level / amount / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue).

[0520] In some embodiments, the pathologically involved TNFR1-mediated signaling disorders are characterized by dysregulation of cell death mediated by TNFR1 signaling. In some embodiments, the pathologically involved TNFR1-mediated signaling disorders are characterized by dysregulation of apoptosis mediated by TNFR1 signaling. In some embodiments, the pathologically involved TNFR1-mediated signaling disorders are characterized by dysregulation of apoptosis mediated by TNFR1 complex II signaling.

[0521] In some embodiments, the pathologically involved TNFR1-mediated signal transduction disease is characterized by dysregulation of caspase activity. In some embodiments, the pathologically involved TNFR1-mediated signal transduction disease is characterized by dysregulation of caspase-8, caspase-3, caspase-10, RIPK1, RIPK3 and / or PARP activity.

[0522] In some embodiments, the pathologically involved TNFR1-mediated signal transduction disease is characterized by dysregulation of RIPK1 activity. In some embodiments, the pathologically involved TNFR1-mediated signal transduction disease is characterized by low levels of RIPK1 expression and / or activity, for example, compared to expression / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease-prone tissue). In some embodiments, the pathologically involved TNFR1-mediated signal transduction disease is characterized by high levels of RIPK1 expression and / or activity, for example, compared to expression / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease-prone tissue).

[0523] In some implementations, the pathologically involved TNFR1-mediated signal transduction disease is a disease / condition that pathologically involves RIPK1 activity.

[0524] In some implementations, the disease / condition is a disease / condition that is pathologically involved with RIPK1.

[0525] As used herein, a pathologically involved RIPK1 disease / condition is one in which an increase or decrease in the level of RIPK1 expression and / or activity is positively correlated with the onset, development, or progression of the disease / condition and / or the severity of one or more symptoms of the disease / condition, for example, compared to the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease-affected tissue). In some embodiments, a decrease / downregulation / low level of RIPK1 expression and / or activity may be a risk factor for the onset, development, or progression of the disease / condition, for example, compared to the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease-affected tissue).

[0526] Diseases / conditions pathologically involving RIPK1 can be characterized by one or more of the following: Increased / upregulated / high level of RIPK1 activity, for example, compared with the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of cell death, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of apoptosis, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of TNFR1-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of TNFR1 complex I-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of TNFR1 complex II-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduction / downregulation / low level of RIPK1 activity, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduction / downregulation / low level of cell death, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduction / downregulation / low level of apoptosis, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Reduced / downregulated / low level of TNFR1-mediated signal transduction, for example, compared with the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduced / downregulated / low level of TNFR1 complex I-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduced / downregulated / low level of TNFR1 complex II-mediated signal transduction, for example, compared to the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue).

[0527] In some implementations, the disease / condition is a pathologically related to apoptosis.

[0528] As used herein, a disease / condition pathologically involving apoptosis is one in which an increase or decrease in the level of apoptosis is positively correlated with the onset, development, or progression of the disease / condition and / or the severity of one or more symptoms of the disease / condition, for example, compared to the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease-prone tissue). In some embodiments, a decrease / downregulation / low level of apoptosis may be a risk factor for the onset, development, or progression of the disease / condition, for example, compared to the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease-prone tissue).

[0529] Diseases / conditions pathologically involving apoptosis can be characterized by one or more of the following: Increased / upregulated / high level of TNFR1-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of TNFR1 complex II-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of cell death, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of apoptosis, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high level of caspase expression and / or activity, for example, compared with the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Increased / upregulated / high levels of TNF and / or interferon-γ expression, for example, compared to levels / quantities / proportions / activities in the absence of the said disease / condition (e.g., in healthy subjects or in the same unaffected tissues); Reduced / downregulated / low level of TNFR1-mediated signal transduction, for example, compared with the level / number / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Reduced / downregulated / low level of TNFR1 complex II-mediated signal transduction, for example, compared with the level / amount / proportion / activity in the absence of said disease / condition (e.g., in healthy subjects or in the same unaffected tissues); The reduction / downregulation / low level of cell death, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); The reduction / downregulation / low level of apoptosis, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Decreased / downregulated / low level of caspase expression and / or activity, for example, compared to the level / number / proportion / activity in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue); Decreased / downregulated / low levels of TNF and / or interferon-γ expression, for example, compared to levels in the absence of the said disease / condition (e.g., in healthy subjects or in the same non-disease tissue).

[0530] In some embodiments, the disease is cancer, an inflammatory condition, and / or an infectious disease. In some embodiments, the disease pathologically involving TNFR1-mediated signaling is cancer, an inflammatory condition, and / or an infectious disease. In some embodiments, the disease pathologically involving apoptosis is cancer, an inflammatory condition, and / or an infectious disease.

[0531] In some embodiments, the disease is cancer, an inflammatory condition, or an infectious disease. In some embodiments, the disease pathologically involving TNFR1-mediated signaling is cancer, an inflammatory condition, or an infectious disease. In some embodiments, the disease pathologically involving apoptosis is cancer, an inflammatory condition, or an infectious disease.

[0532] In some embodiments, the disease is cancer. TNF activity and TNFR1 signaling are involved in cancer development (Wang and Lin. Acta Pharmacol Sin. 2008 Nov; 29(11): 1275–1288). TNFR1-mediated signaling is dysregulated in various cancers and is associated with malignant progression. For example, TNFR1-mediated signaling plays a pleiotropic role in the development of hepatocellular carcinoma (HCC), where TNFR1 complex I supports cancer cell survival, while TNFR1 complex II-mediated signaling leads to apoptosis (Zou et al. Theranostics 2020; 10(23):10434–10447). Therefore, agonists of components of TNFR1 complex II are effective in treating cancer. Examples of this disclosure demonstrate that upregulation of components of TNFR1 complex II is effective in treating cancer.

[0533] According to this disclosure, cancer can be any unwanted cell proliferation (or any disease that manifests itself as unwanted cell proliferation), neoplasm, or tumor. The cancer can be benign or malignant. The cancer can be primary or secondary (e.g., metastatic). A neoplasm or tumor can be any abnormal cell growth or proliferation and can be located in any organ / tissue (and / or originate from its cells).

[0534] In some implementations, the cancer is selected from: lung cancer (e.g., non-small cell lung cancer), skin cancer (e.g., melanoma), head and neck cancer (e.g., head and neck squamous cell carcinoma), liver cancer (e.g., hepatocellular carcinoma), glioblastoma, colorectal cancer, cervical cancer, and breast cancer.

[0535] Cancer can originate from cells such as: adrenal glands, adrenal medulla, anus, appendix, bladder, blood, bone, bone marrow, brain, breast, cecum, central nervous system (including or excluding the brain), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidneys, lacrimal glands, larynx, liver, lungs, lymph nodes, lymphoblasts, maxilla, mediastinum, mesentery, myometrium, nasopharynx, omentum, oral cavity, ovary, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary glands, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testes, thymus, thyroid gland, tongue, tonsils, trachea, uterus, vulva, and / or leukocytes.

[0536] Cancer can be or may include one or more tumors. Cancer can be glioma, medulloblastoma, meningioma, neurofibroma, ependymoma, Schwannoma, neurofibrosarcoma, astrocytoma and oligodendroglioma, melanoma, mesothelioma, myeloma, lymphoma, non-Hodgkin lymphoma (NHL), Hodgkin lymphoma, cutaneous T-cell lymphoma (CTCL), leukemia, chronic myeloid leukemia (CML), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), hepatocellular carcinoma, epidermoid carcinoma, prostate cancer, breast cancer, lung cancer, non-small cell lung cancer (NSCLC), colon cancer, ovarian cancer, pancreatic cancer, thymic cancer, hematologic malignancies, or sarcomas.

[0537] In some implementations, the cancers described in this disclosure are selected from: solid tumors, breast cancer, breast epithelial carcinoma, ductal carcinoma, gastric cancer, gastric epithelial carcinoma, gastric adenocarcinoma, colorectal cancer, colorectal epithelial carcinoma, colorectal adenocarcinoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung epithelial carcinoma, ovarian cancer, ovarian epithelial carcinoma, ovarian serous adenocarcinoma, renal cancer, renal cell carcinoma, and clear cell renal cancer. Skin cancer, renal cell adenocarcinoma, renal papillary cell carcinoma, pancreatic cancer, pancreatic adenocarcinoma, pancreatic duct adenocarcinoma, cervical cancer, cervical squamous cell carcinoma, skin cancer, melanoma, esophageal cancer, esophageal adenocarcinoma, liver cancer, hepatocellular carcinoma, bile duct carcinoma, uterine cancer, endometrial carcinoma of the uterine body, thyroid cancer, thyroid epithelial carcinoma, pheochromocytoma, paraganglioma, bladder cancer, bladder urothelial carcinoma, prostate cancer, prostate adenocarcinoma, sarcoma, and thymoma.

[0538] In some embodiments, the cancer is characterized by high levels of expression of components of the TNFR1 complex (e.g., compared to expression in healthy subjects, the same non-cancerous tissue, or other cancerous tissue). In some embodiments, the cancer is characterized by high levels of expression of the RNA component of the TNFR1 complex (e.g., compared to activity in healthy subjects, the same non-cancerous tissue, or other cancerous tissue). In some embodiments, the cancer is characterized by high levels of expression of the RBP component of the TNFR1 complex (e.g., compared to activity in healthy subjects, the same non-cancerous tissue, or other cancerous tissue). In some embodiments, the cancer is characterized by high levels of expression of FATALR1, RAD51B, AFF3, RUPTR7, FTO, and / or XPO5. In some embodiments, the cancer is characterized by high levels of FATALR1 expression. In some embodiments, the cancer is characterized by high levels of RAD51B expression. In some embodiments, the cancer is characterized by high levels of AFF3 expression. In some embodiments, the cancer is characterized by high levels of RUPTR7 expression. In some embodiments, the cancer is characterized by high levels of FTO expression. In some embodiments, the cancer is characterized by high levels of XPO5 expression.

[0539] In some embodiments, the cancer is characterized by TNF and / or interferon-γ expression. In some embodiments, the cancer is characterized by high levels of TNF and / or interferon-γ expression (e.g., compared to expression in healthy subjects, the same non-cancerous tissue, or other cancerous tissue). In some embodiments, the cancer comprises a tumor microenvironment characterized by high levels of TNF and / or interferon-γ expression (e.g., compared to expression in healthy subjects, the same non-cancerous tissue, or tissues outside the tumor microenvironment).

[0540] In some embodiments, the disease is an inflammatory condition. In some embodiments, the disease pathologically involving TNFR1-mediated signal transduction is an inflammatory condition. In some embodiments, the disease pathologically involving cell death is an inflammatory condition.

[0541] Inflammatory conditions can develop and / or progress due to excessive cell death. As previously discussed, excessive cell death has been shown to result from elevated levels of TNFR1-mediated signaling. Elevated levels of TNFR1 complex II-mediated signaling can lead to the upregulation of molecules that promote cell death, such as caspase. Examples of this disclosure demonstrate the efficacy of inhibition of the RBP / RNA component of the RBP / TNFR1 complex II in the treatment of inflammatory conditions.

[0542] In some implementations, an inflammatory condition is any condition characterized by excessive inflammation. The terms "inflammatory condition" and "inflammatory disease" are used interchangeably herein.

[0543] In some embodiments, the inflammatory condition is a chronic inflammatory condition or chronic inflammatory disease. In some embodiments, the inflammatory condition is characterized by chronic inflammation.

[0544] Chronic inflammation represents a long-term response to inflammatory stimuli, characterized by the persistent recruitment of monocytes (monocytes and lymphocytes) accompanied by tissue damage due to the sustained inflammatory response. In contrast to an acute inflammatory response, chronic inflammation can last for weeks, months, or even a lifetime in some chronic inflammatory diseases. In addition to the accumulation of macrophages and lymphocytes derived from monocytes, chronic inflammation is characterized by changes associated with wound healing, such as the proliferation of fibroblasts and small blood vessels. Many chronic inflammatory diseases begin with a low-grade, persistent response to pathogens or certain endogenous or exogenous substances. Chronic inflammation plays a crucial role in the development and progression of many chronic diseases, including but not limited to autoimmune diseases, metabolic disorders (such as atherosclerosis and obesity), fibrosis, and cancer.

[0545] As used in this article, an inflammatory condition is a condition in which inflammation is a symptom of the disease / condition. Diseases and conditions characterized by inflammation include, but are not limited to: Conditions / diseases / conditions that affect the respiratory system, such as chronic obstructive pulmonary disease (COPD), emphysema, chronic bronchitis, and asthma; Conditions / diseases / conditions that affect the liver, such as chronic liver disease, non-alcoholic fatty liver disease (NAFLD), steatohepatitis, non-alcoholic steatohepatitis (NASH), alcoholic liver disease (ALD), alcoholic fatty liver (AFL), alcoholic hepatitis, alcoholic steatohepatitis (ASH), primary biliary cirrhosis (PBC), schistosomiasis-related liver disease, and hepatocellular carcinoma (HCC); Conditions / diseases / conditions affecting the cardiovascular system, such as hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), atrial fibrillation, Brugada syndrome, myocardial infarction, fibrotic vascular disease, hypertension, hypertensive heart disease, arrhythmogenic right ventricular cardiomyopathy (ARVC), atherosclerosis, arteriosclerosis, chronic pulmonary hypertension, AIDS-related pulmonary hypertension, heart failure with preserved ejection fraction (HFpEF), heart failure with reduced ejection fraction (HFrEF), varicose veins, and cerebral infarction; Conditions / diseases / conditions that affect the kidneys, such as nephritic syndrome, Allport syndrome, HIV-related nephropathy, polycystic kidney disease, Fabry disease, diabetic nephropathy, chronic glomerulonephritis, and nephritis associated with systemic lupus erythematosus; Conditions / diseases / conditions that affect the pancreas, such as pancreatic fibrosis, cystic fibrosis, and chronic pancreatitis; Conditions / diseases / conditions that affect the nervous system, such as gliosis, Alzheimer's disease, and multiple sclerosis; Conditions / diseases / conditions that affect the musculoskeletal system, such as muscular dystrophy, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and fibrotic myopathy; Conditions / diseases / conditions that affect the gastrointestinal system, such as inflammatory bowel disease (IBD), Crohn's disease, microscopic colitis, and primary sclerosing cholangitis (PSC); Conditions / diseases / conditions that affect the skin, such as scleroderma, Dupuytren contracture, and keloids. Conditions / diseases / conditions affecting the eyes, such as Graves' eye disease, macular degeneration (e.g., wet age-related macular degeneration (AMD)), diabetic retinopathy, glaucoma, corneal fibrosis; Conditions / diseases / conditions that affect the joints, such as joint fibrosis, arthritis, and adhesive capsulitis; Diseases / conditions affecting multiple tissue / organ systems, including progressive systemic sclerosis (PSS) and chronic graft-versus-host disease (GVHD); Cancers such as hepatocellular carcinoma, stomach cancer, esophageal cancer, head and neck cancer, colorectal cancer, pancreatic cancer, cervical cancer, and vulvar cancer.

[0546] In some embodiments, the inflammatory condition is characterized by high levels of expression of components of the TNFR1 complex (e.g., compared to expression in healthy subjects or the same non-disease-prone tissues). In some embodiments, the inflammatory condition is characterized by high levels of expression of the RNA component of the TNFR1 complex (e.g., compared to activity in healthy subjects or the same non-disease-prone tissues). In some embodiments, the inflammatory condition is characterized by high levels of expression of FATALR1, RAD51B, AFF3, RUPTR7, FTO, and / or XPO5. In some embodiments, the inflammatory condition is characterized by high levels of expression of FATALR1. In some embodiments, the inflammatory condition is characterized by high levels of expression of RAD51B. In some embodiments, the inflammatory condition is characterized by high levels of expression of AFF3. In some embodiments, the inflammatory condition is characterized by high levels of expression of RUPTR7. In some embodiments, the inflammatory condition is characterized by high levels of expression of FTO. In some implementations, the inflammatory condition is characterized by high levels of XPO5 expression.

[0547] In some implementations, the inflammatory condition is selected from: chronic inflammatory diseases, arthritis, rheumatoid arthritis, juvenile arthritis, systemic juvenile idiopathic arthritis, lupus, systemic lupus erythematosus, pancreatitis, thyroiditis, periodontitis, rhinitis, allergic rhinitis, dermatitis, atopic dermatitis, psoriasis, Hermansky-Pudrag syndrome, Graves' disease, diabetes, type 1 diabetes, type 2 diabetes, pregnancy-related hyperglycemia, multiple sclerosis, atherosclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, hippocampal atrophy, lung disease, asthma, and chronic obstructive pulmonary disease. Pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, hepatitis, hepatotoxicity, acetaminophen-induced hepatotoxicity, alcoholic liver disease, pancreatitis, inflammatory bowel disease, Crohn's disease, colitis, ulcerative colitis, endometriosis, nephropathy, kidney injury, acute kidney injury, nephrotoxicity, glomerulonephritis, chronic kidney disease, Allport syndrome, adult-onset Still's disease, Castleman's disease, cytokine release syndrome, sepsis, septic shock, retinopathy, age-related macular degeneration, wet age-related macular degeneration, retinitis pigmentosa, Poitz-Yage syndrome, skeletal muscle diseases, and muscular dystrophy.

[0548] In some embodiments, the disease is an infectious disease. In some embodiments, the disease pathologically involving TNFR1-mediated signal transduction is an infectious disease. In some embodiments, the disease pathologically involving cell death is an infectious disease.

[0549] Infectious diseases can develop and / or progress due to excessive cell death. As previously discussed, excessive cell death has been shown to result from elevated levels of TNFR1-mediated signaling. Elevated levels of TNFR1-mediated signaling can lead to the upregulation of molecules that promote cell death, such as caspase. Inhibitors of the RNA / RBP component of the TNFR1 complex, as shown in Example 5 of this disclosure, are effective in treating infectious diseases.

[0550] In some implementations, the infectious disease is a bacterial, viral, fungal, or parasitic infection.

[0551] Examples of treatable bacterial infections include those caused by Bacillus species ( Bacillus spp. Bordetella pertussis () Bordetella pertussis ), Clostridium species ( Clostridium spp. ), species of the genus Corynebacterium ( Corynebacterium spp. ), Vibrio cholerae ( Vibrio chloerae ), species of the genus Staphylococcus ( Staphylococcus spp. ), species of the genus Streptococcus ( Streptococcus spp. ), Escherichia coli ( Escherichia ), Klebsiella spp. Klebsiella ), Proteus spp. Proteus Yersinia spp. Yersinia Erwinia ( ) Erwina Salmonella ( Salmonella Listeria species ( Listeria sp Helicobacter pylori ( Helicobacter pylori ), Mycobacterium ( mycobacteria (For example, Mycobacterium tuberculosis) Mycobacterium tuberculosis )) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa Infections caused by bacteria, such as sepsis or tuberculosis, are treatable. Examples of treatable viral infections include those caused by influenza virus, measles virus, hepatitis B virus (HBV), hepatitis C virus (HCV), human immunodeficiency virus (HIV), lymphocytic choriomeningitis virus (LCMV), herpes simplex virus, and human papillomavirus (HPV). Examples of treatable fungal infections include those caused by species of the genus *Alternaria* (…). Alternaria sp ), species of the genus Aspergillus ( Aspergillus sp ), species of the genus Candida ( Candida sp ) and Histoplasma species ( Histoplasma sp Infections caused by fungi. These fungal infections can be fungal sepsis or histoplasmosis. Examples of treatable parasitic infections include those caused by Plasmodium ( ). Plasmodium ) species (e.g., Plasmodium falciparum) Plasmodium falciparum ), Plasmodium yoelii ( Plasmodium yoeli ), Plasmodium ovale ( Plasmodium ovale ), Plasmodium vivax ( Plasmodium vivax ) or the nominate subspecies of Plasmodium shahrii ( Plasmodium chabaudi chabaudi The parasitic infection can be a disease such as malaria, leishmaniasis, and toxoplasmosis. In some embodiments, the infectious disease is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection (COVID).

[0552] In some embodiments, the infectious disease is characterized by high levels of expression of components of the TNFR1 complex (e.g., compared to expression in healthy subjects or the same non-disease-prone tissues). In some embodiments, the infectious disease is characterized by high levels of expression of the RNA component of the TNFR1 complex (e.g., compared to activity in healthy subjects or the same non-disease-prone tissues). In some embodiments, the infectious disease is characterized by high levels of expression of the RBP component of the TNFR1 complex (e.g., compared to activity in healthy subjects or the same non-disease-prone tissues). In some embodiments, the infectious disease is characterized by high levels of expression of FATALR1, RAD51B, AFF3, RUPTR7, FTO, and / or XPO5. In some embodiments, the infectious disease is characterized by high levels of expression of FATALR1. In some embodiments, the infectious disease is characterized by high levels of expression of RAD51B. In some embodiments, the infectious disease is characterized by high levels of expression of AFF3. In some embodiments, the infectious disease is characterized by high levels of expression of RUPTR7. In some embodiments, the infectious disease is characterized by high levels of expression of FTO. In some embodiments, the infectious disease is characterized by high levels of expression of XPO5.

[0553] In some embodiments, the pathologically involved TNFR1-mediated signaling disorders are characterized by a cytokine storm. In some embodiments, the cancers, inflammatory conditions, and / or infectious diseases are characterized by a cytokine storm.

[0554] Cytokine storm and cytokine release syndrome are life-threatening systemic inflammatory syndromes involving elevated levels of circulating cytokines and hyperactivation of immune cells (which can be triggered by cell signaling pathways, including TNFR1-mediated signaling).

[0555] A method for regulating TNFR1-mediated signal transduction is provided, the method comprising providing a regulator according to the present disclosure, wherein a component of TNFR1 complex II is RBP or RNA. In some embodiments, the method for regulating TNFR1-mediated signal transduction is a method of inhibiting TNFR1-mediated signal transduction. In some embodiments, the method for regulating TNFR1-mediated signal transduction is a method of upregulating TNFR1-mediated signal transduction. In some embodiments, the method is an in vivo method. In some embodiments, the method is an in vitro method.

[0556] A method for regulating cell death is provided, the method comprising providing a regulator according to the present disclosure, wherein a component of TNFR1 complex II is RBP or RNA. In some embodiments, the method for regulating cell death is a method for inhibiting cell death. In some embodiments, the method for regulating cell death is a method for upregulating cell death. In some embodiments, the cell death is apoptosis. In some embodiments, the method is an in vivo method. In some embodiments, the method is an in vitro method.

[0557] Set This disclosure also provides component kits. Kits according to this disclosure may contain, in whole or in part, components for performing the methods described herein.

[0558] The kit may have at least one container containing a predetermined amount of one or more reagents or compositions described herein. The reagents / compositions may be provided in predetermined amounts. In cases where the kit contains multiple different reagents / compositions, they may be provided in separate containers or in the same container.

[0559] The kit may further include reagents, buffer solutions, and / or standards required to perform the methods according to this disclosure.

[0560] Kits according to this disclosure may include instructions for use, such as in the form of a booklet or brochure. The instructions may include protocols for performing any one or more of the methods described herein. The kit may contain instructions for using agents to evaluate a disease to determine suitability for treatment.

[0561] Numbering Clauses The following numbered paragraphs describe specific aspects and implementations of this disclosure: 1. A modulator of a component of a tumor necrosis factor receptor 1 (TNFR1) complex II for the treatment or prevention of diseases pathologically involving TNFR1-mediated signal transduction, wherein the component of TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

[0562] 2. Use of a modulator of a component of tumor necrosis factor receptor 1 (TNFR1) complex II in the preparation of a medicament for the treatment or prevention of diseases pathologically involving TNFR1-mediated signal transduction, wherein the component of TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

[0563] 3. A method for treating or preventing a disease pathologically involving signal transduction mediated by tumor necrosis factor receptor 1 (TNFR1), wherein the method comprises administering to a subject a modulator of a component of a therapeutically or preventively effective TNFR1 complex II, wherein the component of TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

[0564] 4. The modulator used according to paragraph 1, the use according to paragraph 2, or the method according to paragraph 3, wherein the RBP component of the TNFR1 complex II comprises, or is composed of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:1 or SEQ ID NO:6.

[0565] 5. The regulator used according to paragraph 1 or paragraph 4, the use according to paragraph 2 or paragraph 4, or the method according to paragraph 3 or paragraph 4, wherein the RNA component of TNFR1 complex II is RNA capable of associating with the RBP component of TNFR1 complex II.

[0566] 6. The regulator used according to any one of paragraphs 1, 4 or 5, the use according to any one of paragraphs 2, 4 or 5, or the method according to any one of paragraphs 3-5, wherein the RNA component of the TNFR1 complex II is non-coding RNA.

[0567] 7. The modulator used according to any one of paragraph 1 or 4-6, the use according to any one of paragraph 2 or 4-6, or the method according to any one of paragraphs 3-6, wherein the RNA component of the TNFR1 complex II is an RNA comprising a nucleotide sequence having at least 70% nucleotide sequence identity with a nucleotide sequence selected from: The nucleotide sequence of RNA transcribed from positions 145959299 to 145969262 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 147502825 to 147510900 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 111659317 to 111846428 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 86396528 to 86922184 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 165899418 to 166077274 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 68290286 to 68644674 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 34254566 to 34379410 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 100418069 to 100745658 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 86522442 to 86669286 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 99261673 to 99434556 on human chromosome 15. The nucleotide sequence of RNA transcribed from positions 39917349 to 40178399 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 34603358 to 35104032 on human chromosome 10. The nucleotide sequence of RNA transcribed from positions 126719089 to 126784246 on human chromosome 10. The nucleotide sequence of RNA transcribed from positions 128596422 to 128841778 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 64611344 to 64672035 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 89445931 to 89526681 on human chromosome 16. The nucleotide sequence of RNA transcribed from positions 1893151 to 2245677 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 134256502 to 134309412 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 106964857 to 107157063 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 188347397 to 188533178 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 140514285 to 140590155 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 61542606 to 61920401 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 65892334 to 66385973 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 110151629 to 110176276 on human chromosome 12. The nucleotide sequence of RNA transcribed from positions 187869711 to 188112441 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 64356475 to 64590847 on human chromosome 17. The nucleotide sequence of RNA transcribed from positions 10195009 to 10245811 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 106330722 to 106659430 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 100558333 to 100680965 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 149041318 to 149386381 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 245999527 to 246670404 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 29677541 to 29904086 on the human X chromosome. The nucleotide sequence of RNA transcribed from positions 23250209 to 23521712 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 66975015 to 67215923 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 7566739 to 7966915 on human chromosome 18. The nucleotide sequence of RNA transcribed from positions 59826238 to 60230486 on human chromosome 20. The nucleotide sequence of RNA transcribed from positions 104918024 to 105155677 on human chromosome 12. The nucleotide sequence of RNA transcribed from positions 143671031 to 147850490 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 40812253 to 41217827 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 19837625 to 19869554 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 189696844 to 189838594 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 148736110 to 148766960 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 11802659 to 11993721 on human chromosome 12. The nucleotide sequence of RNA transcribed from positions 102247784 to 102456356 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 171757455 to 171959434 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 188124039 to 188343878 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 153191855 to 153378429 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 184834202 to 184943833 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 119653285 to 119807106 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 143115825 to 143285504 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 99641779 to 99758184 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 17420660 to 17494454 on the human X chromosome. The nucleotide sequence of RNA transcribed from positions 85923977 to 86198925 on human chromosome 15. The nucleotide sequence of RNA transcribed from positions 44854771 to 45229571 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 79733899 to 79850706 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 75935953 to 76056352 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 144301054 to 144541576 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 36177613 to 36425639 on human chromosome 22. The nucleotide sequence of RNA transcribed from positions 28012120 to 28209146 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 1607960 to 1892955 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 128246768 to 128469388 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 116854504 to 116968939 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 47127605 to 47233991 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 206667573 to 206757842 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 60596474 to 60768540 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 76114103 to 76432164 on human chromosome 10. The nucleotide sequence of RNA transcribed from positions 7971111 to 8406585 on human chromosome 18. The nucleotide sequence of RNA transcribed from positions 29060442 to 29545467 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 16371311 to 16437191 on human chromosome 21. The nucleotide sequence of RNA transcribed from positions 131409474 to 131440762 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 49962691 to 50114102 on human chromosome 20. The nucleotide sequence of RNA transcribed from positions 3340909 to 4167031 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 29650814 to 30051606 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 12008853 to 12151073 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 192554458 to 192635399 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 74451668 to 74710375 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 234040499 to 234383480 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 184020384 to 184088355 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 108103176 to 108335534 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 23435467 to 23494419 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 49962374 to 50113788 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 16830300 to 17076624 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 15244245 to 15452572 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 37784676 to 38118126 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 20323631 to 20457117 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 65339155 to 65907397 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 108082406 to 108460035 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 70479923 to 70588817 on human chromosome 17. The nucleotide sequence of RNA transcribed from positions 10095845 to 10319831 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 109150930 to 109276049 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 21376800 to 21554467 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 71471994 to 71633960 on human chromosome 15. The nucleotide sequence of RNA transcribed from positions 235423963 to 235491373 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 126475318 to 126692155 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 167710188 to 167813852 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 10560487 to 10657638 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 48011532 to 48132940 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 178063133 to 178395500 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 35684412 to 35824606 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 175001674 to 175114226 on human chromosome 2, and The nucleotide sequence of RNA transcribed from positions 23608068 to 23868206 on human chromosome 2.

[0568] 8. The modulator used according to any one of paragraph 1 or 4-7, the use according to any one of paragraph 2 or 4-7, or the method according to any one of paragraphs 3-7, wherein the RNA component of the TNFR1 complex II is RNA comprising or consisting of a ribonucleotide sequence having at least 70% nucleotide sequence identity with SEQ ID NO:10 or SEQ ID NO:11.

[0569] 9. The modulator used according to any one of paragraph 1 or 4-8, the use according to any one of paragraph 2 or 4-8, or the method according to any one of paragraphs 3-8, wherein the modulator inhibits the expression and / or activity of components of TNFR1 complex II.

[0570] 10. The modulator used according to any one of paragraph 1 or 4-9, the use according to any one of paragraph 2 or 4-9, or the method according to any one of paragraphs 3-9, wherein the modulator is selected from: small molecules that bind to components of TNFR1 complex II, inhibitory nucleic acids that target components of TNFR1 complex II, and nucleic acids of site-specific nuclease (SSN) systems that encode nucleic acids that target components of TNFR1 complex II.

[0571] 11. The modulator used according to any one of paragraph 1 or 4-8, the use according to any one of paragraph 2 or 4-8, or the method according to any one of paragraphs 3-8, wherein the modulator upregulates the expression and / or activity of components of TNFR1 complex II.

[0572] 12. The modulator used according to any one of paragraphs 1, 4-8 or 11, the use according to any one of paragraphs 2, 4-8 or 11, or the method according to any one of paragraphs 3-8 or 11, wherein the modulator comprises, or is composed of, a nucleic acid encoding an RBP or RNA component of the TNFR1 complex II.

[0573] 13. The modulator used according to any one of paragraph 1 or 4-12, the use according to any one of paragraph 2 or 4-12, or the method according to any one of paragraphs 3-12, wherein the pathologically involved disease involving TNFR1-mediated signal transduction is characterized by dysregulation of caspase-8, caspase-3, caspase-10, RIPK1, RIPK3 and / or PARP activity.

[0574] 14. The modulator used according to any one of paragraph 1 or 4-13, the use according to any one of paragraph 2 or 4-13, or the method according to any one of paragraphs 3-13, wherein the pathologically involved disease is characterized by dysregulation of cell death.

[0575] 15. The modulator used according to any one of paragraph 1 or 4-14, the use according to any one of paragraph 2 or 4-14, or the method according to any one of paragraphs 3-14, wherein the pathologically involved disease is characterized by a cytokine storm.

[0576] 16. The modulator used according to any one of paragraphs 1, 4-8 or 11-15, the use according to any one of paragraphs 2, 4-8 or 11-15, or the method according to any one of paragraphs 3-8 or 11-15, wherein the pathologically involved disease involving TNFR1-mediated signal transduction is cancer.

[0577] 17. The modulator used according to any one of paragraphs 1, 4-10 or 13-15, the use according to any one of paragraphs 2, 4-10 or 13-15, or the method according to any one of paragraphs 3-4-10 or 13-15, wherein the pathologically involved TNFR1-mediated signal transduction disease is an inflammatory condition and / or an infectious disease.

[0578] 18. The modifier, use, or method described in paragraph 16, wherein the cancer is selected from: solid tumors, breast cancer, epithelial breast cancer, ductal carcinoma, gastric cancer, gastric epithelial carcinoma, gastric adenocarcinoma, colorectal cancer, colorectal epithelial carcinoma, colorectal adenocarcinoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung epithelial carcinoma, ovarian cancer, ovarian epithelial carcinoma, ovarian serous adenocarcinoma, renal cancer, renal cell carcinoma, and kidney dialysis. Papilledema, renal cell carcinoma, renal papillary cell carcinoma, pancreatic cancer, pancreatic adenocarcinoma, pancreatic duct adenocarcinoma, cervical cancer, cervical squamous cell carcinoma, skin cancer, melanoma, esophageal cancer, esophageal adenocarcinoma, liver cancer, hepatocellular carcinoma, bile duct carcinoma, uterine cancer, endometrial carcinoma of the uterine body, thyroid cancer, thyroid epithelial carcinoma, pheochromocytoma, paraganglioma, bladder cancer, bladder urothelial carcinoma, prostate cancer, prostate adenocarcinoma, sarcoma, and thymoma.

[0579] 19. The modifier, use, or method described in paragraph 17, wherein the inflammatory condition is selected from: chronic inflammatory diseases, arthritis, rheumatoid arthritis, juvenile arthritis, systemic juvenile idiopathic arthritis, lupus, systemic lupus erythematosus, pancreatitis, thyroiditis, periodontitis, rhinitis, allergic rhinitis, dermatitis, atopic dermatitis, psoriasis, Hermansky-Pudrag syndrome, Graves' disease, diabetes, type 1 diabetes, type 2 diabetes, pregnancy-related hyperglycemia, multiple sclerosis, atherosclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, hippocampal atrophy, lung disease, asthma, Chronic obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, hepatitis, hepatotoxicity, acetaminophen-induced hepatotoxicity, alcoholic liver disease, pancreatitis, inflammatory bowel disease, Crohn's disease, colitis, ulcerative colitis, endometriosis, nephropathy, kidney injury, acute kidney injury, nephrotoxicity, glomerulonephritis, chronic kidney disease, Allport syndrome, adult-onset Still's disease, Castleman's disease, cytokine release syndrome, sepsis, septic shock, retinopathy, age-related macular degeneration, wet age-related macular degeneration, retinitis pigmentosa, Poitz-Yage syndrome, skeletal muscle diseases, and muscular dystrophy.

[0580] 20. The modifier, use, or method of use as described in paragraph 17, wherein the infectious disease is a bacterial, viral, fungal, or parasitic infection.

[0581] 21. A method for regulating cell death, wherein the method includes providing a regulator of a component of TNFR1 complex II, wherein the component of TNFR1 complex II is RBP or RNA.

[0582] Sequence identity As used herein, “sequence identity” refers to the percentage of nucleotide / amino acid residues in the target sequence that are identical to those in the reference sequence after sequence alignment (and, if necessary, vacancies are introduced to achieve maximum percentage sequence identity between sequences). For the purpose of determining the percentage sequence identity between two or more amino acid or nucleic acid sequences, pairing and multiple sequence alignment can be performed in various ways known to those skilled in the art, such as using publicly available computer software, such as ClustalOmega (Söding, J. 2005, Bioinformatics 21, 951-960), T-coffee (Notredame et al. 2000, J. Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer 2005, BMC Bioinformatics, 6(298)) and MAFFT (Katoh and Standley 2013, Molecular Biology and Evolution, 30(4) 772–780). When using such software, default parameters are preferably used, such as default parameters for vacancy penalties and extension penalties.

[0583] sequence The RNA sequences in the table below are provided in accordance with WIPO standard ST.26 by replacing uracil (u) bases with thymine (t) bases, where the symbol “t” is interpreted as thymine in DNA and uracil in RNA. *** This disclosure includes combinations of the described aspects and preferred features, unless such combinations are obviously not permitted or explicitly avoided.

[0584] The chapter titles used in this article are for organizational purposes only and should not be construed as limiting the topics described.

[0585] Aspects and embodiments of this disclosure will now be illustrated by way of example with reference to the accompanying drawings. Further aspects and embodiments will be apparent to those skilled in the art. All references herein are incorporated by way of citation.

[0586] Throughout this specification, including the appended claims, unless the context otherwise requires, the word “comprise” and variations such as “comprises” and “comprising” shall be understood to imply inclusion of the specified integer or step or group of steps, but not to exclude any other integer or step or group of steps.

[0587] It should be noted that, as used in the specification and appended claims, the singular forms “a,” “an,” and “the” include plural objects unless the context explicitly indicates otherwise. A range herein may be expressed as “about” a particular value and / or “about” another particular value. When such a range is expressed, another embodiment includes from a particular value and / or to another particular value. Similarly, when a value is expressed as an approximation using the antecedent “about,” it will be understood that the particular value forms another embodiment.

[0588] When nucleic acid sequences are disclosed or mentioned in this article, their reverse complementary sequences are also explicitly considered.

[0589] The methods described herein are preferably performed in vitro. The term “in vitro” is intended to include procedures performed using cultured cells, while “in vivo” is intended to include procedures performed on or in whole multicellular organisms.

[0590] Values ​​may be expressed herein as “about” a specific value. Similarly, ranges may be expressed herein as “about” a specific value and / or to “about” another specific value. The term “about” for numerical values ​​is optional and means, for example, + / - 10%. For example, mentioning “about 10%” should be interpreted as 9% to 11%. When “about” is used in this document, the value following it is also taken into account. For example, mentioning “about 10%” also specifically takes into account 10%. Attached Figure Description

[0591] The embodiments and experiments illustrating the principles of the present invention will now be discussed with reference to the accompanying drawings.

[0592] Figure 1RNA-binding proteins are novel components of the TNFR complex. (A) Illustration of TNFR signal transduction and in vitro apoptosis models. (B) MDA-MB-231 cells treated with Strep1-TNFα for 5 min. Complex I was immunoprecipitated with Strep beads. Identified components of Complex I were detected by Western blotting. XPO5 was detected as a component of Complex I. (C) MDA-MB-231 cells stably expressing Strep1-FADD were treated with brenalapa and TNF (BT) for 2 h. Complex II was purified using beads and eluted with biotin. The eluent was injected into a size exclusion column (Superose® 6 Increase 10 / 300), and a gel filtration plot is shown (top). The peak fractions in the top plot were collected for Western blotting to probe for components of Complex II. RBPs, including XPO5 and FTO, were detected in TNFR1 Complex II.

[0593] Figure 2 FTO and XPO5 are essential for TNFR-mediated cell death. (AB) Quantitative summary of the percentage of viable cells in WT, FTO KO (A), and XPO5 KO (B) cells treated with bismuth subtilis and TNF (BT) for specified time. (CD) WT, FTO KO (C), and XPO5 KO (D) cells treated with BT for specified time. Apoptosis markers were detected by Western blotting.

[0594] Figure 3 STAMP analysis identifies RNA molecules assembled into complex II. (A) Schematic diagram of the STAMP method used to identify RNA targets in complex II. (B) Overlap analysis of the number of genes identified in cell lines expressing APOBEC1-FTO and APOBEC1-FADD under both UT and BT treatments. (C) Heatmap showing the top 50 hits according to the developed scoring system.

[0595] Figure 4FATALR1 is a novel component of complex II. (A) FTO knockout cells reconstructed with an empty vector (EV) or FTO tagged with Strepll were treated with brenalapa and TNF (BT) for 2 hours. 1% of the cell lysate was retained as input, and the remainder was subjected to Strepll beads overnight. The FTO-bound RNA was isolated and reverse transcribed into cDNA. qPCR was performed, and Cq values ​​were used to calculate the enrichment fold. (B) FADD knockout cells reconstructed with an empty vector (EV) or FADD tagged with Strepll were treated with BT for 2 hours. 1% of the cell lysate was retained as input, and the remainder was subjected to Strepll beads overnight. The FADD-bound RNA was isolated and reverse transcribed into cDNA. qPCR was performed, and Cq values ​​were used to calculate the enrichment fold. (C) Cells stably overexpressing dCas13-eGFP, mCherry-FADD, and non-targeting gRNA (gNT) or FATALR1-targeting gRNA (gRIAR) were treated with BT for 2 hours without treatment. Confocal images were captured to analyze the colocalization of FATALR1 and FADD under two conditions.

[0596] Figure 5 FATALR1 is responsible for recruiting TRADD to mediate TNFR-induced apoptosis. (AB) Stable cell lines expressing control and FATALR1 shRNA were generated in SKOV3 (A) and MDA-MB-231 (B). The percentage of viable cells was analyzed by flow cytometry. Control and FATALR1 knockdown cells were stained with annexin V and P1 with or without brenalapa and TNF (BT) treatment. The percentage of viable cells under specified conditions is shown in a bar chart. (CD) Control and FATALR1 knockdown cells generated from SKOV3 (C) and MDA-MB-231 (D) were treated with BT for specified time. Lysates were used to detect apoptotic markers, including p-RIPK1 and cleaved caspase-8 / 3. (E) To evaluate complex formation in control and FATALR1 knockdown cells 4 hours after BT treatment, we used anti-FADD antibody to pull down FADD. Well-known complex components were detected in the anti-FADD immunoprecipitate using Western blotting.

[0597] Figure 6 Inhibition of FTO effectively reduced the production of inflammatory cytokines. WT and FTO KO cells were treated with birenapa and TNF (BT) for 4 hours. Total RNA was isolated for RNA-seq. Inflammatory cytokines that were significantly downregulated in FTO KO cells were identified.

[0598] Figure 7Inhibition of FATALR1 significantly reduced the expression of inflammatory cytokines. (AD) WT and FATALR1 knockout cells were treated with or without birenapa and TNF (BT) for 6 hours. Total RNA was isolated and reverse transcribed into cDNA. The relative expression of TNFα (A), IL-6 (B), IL-8 (C), and MCR1 (D) was measured by qPCR.

[0599] Figure 8 FATALR1 is upregulated in COVID patients, and loss of FATALR1 in COVID patients protects monocytes from TNF / IFN, a cytokine storm. (A) Single-cell analysis of FATALR1 expression in healthy, mild, and severe COVID patients. (BC) Expression of FATALR1 (B), TNF, and IFNG (C) in COVID patients compared to the healthy group in the different clusters listed. (DE) WTU937 cells or controls and FATALR1 knockdown cells treated with TNFcc / IFNy(IT) for 30 hours, and bar charts showing the percentage of viable cells in each treatment group.

[0600] Figure 9 Overexpression of FATALR1 leads to increased sensitivity of cancer cells to chemotherapy. Control RNA (Cnt), FATALR1 fragment 1 (5' - SEQ ID NO:21), FATALR1 fragment 2 (Mid - SEQ ID NO:22), and FATALR1 fragment 3 (3' - SEQ ID NO:23) were transfected into FATALR1 knockout cells. All four conditions were treated with birenapa and TNF (BT) and subsequently analyzed by flow cytometry after staining with annexin V. Bar charts show the quantitative analysis of the percentage of viable cells under each condition.

[0601] Figure 10 FTO modulates FATALR1 induction via m6A modification. (A) WT and FTO KO MDA-MB-231 cells were treated with bismuth subcitrate and TNF (BT) at specified time points (hours). In WT (left-side column) and FTO... KO(Right column) The relative expression level of FATALR1 in MDA-MB-231 cells was analyzed by qPCR. Data are presented as mean ± SEM of n=3 experiments. p > 0.05 (ns), p < 0.05 (*), p < 0.01 (**), p < 0.001 (***) were statistically analyzed by two-tailed t-test. (B) After BT treatment, two replicates (Rep 1 and Rep 2) of the m6A site (purple line) on FATALR1 and the corresponding methylation level (y-axis) were plotted. Chromosome 1 is shown, and the genomic region encoding FATALR1 is indicated by gray markers. The genomic loci of FATALR1 on chromosome 1 from the human reference genome hg38 are marked in gray and magnified and represented in gray using genomic coordinates. (C) WT and FATALR1 knockout (FATALR1 KO MDA-MB-231 cells were treated with BT at specified time points (hours). In WT and FATALR1... KO The relative expression level of FATALR1 in cells was analyzed by qPCR. Data are presented as mean ± SEM of n = 3 experiments, and statistical analysis was performed using a two-tailed t-test. (D) WT and FATALR1 levels after 16 hours of BT treatment with or without BT. KO Quantification of the percentage of viable cells in MDA-MB-231 cells. Data are presented as mean ± SEM of n = 3 experiments. p > 0.05 (ns), p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), statistical analysis was performed using a two-tailed t-test. (E) WT and FATALR1 KO MDA-MB-231 cells were treated with or without BT for 2 hours. Total cell lysates and RIPK1 immunoprecipitates were examined for the specified proteins.

[0602] Figure 11 FTO enhances RNA polymerase recruitment to the FATALR1 promoter. (AB) The levels of H3K27Ac labeling (A) and RNA polymerase association (B) at the FATALR1 promoter were analyzed by chromatin immunoprecipitation assay (CHIP) and qPCR.

[0603] Figure 12 (A) Schematic diagram of FTO constructs tagged with StrepII, including wild-type (WT), non-catalytically active FTO mutants with specified residue mutations (Mut 1 / 2), and truncated FTO mutants (Mut 3 / 4). These targeted residues are important for the demethylase activity of FTO. (B) FTO reconstructed with specified constructs. KOCells were treated with or without BT for 2 hours. For phosphorylated RIPK1 (p-RIPK1) and GAPDH, total cell lysates were examined.

[0604] Figure 13 RUPTR7 enhances RIPK1 phosphorylation. (A) Compared to control (shCnt) cells, in RUPTR7 Knockdown (sh) RUPTR7 ) cells RUPTR7 qPCR quantification of relative expression levels. (B) Control (shCnt) and RUPTR7 Knockdown (sh) RUPTR7 MDA-MB-231 cells were treated with BT at specified time points (hours). The levels of cIAP1, phosphate-RIPK1 (p-RIPK1), PARP, caspase-3 (C3), cleaved caspase-3 (CC3), and GAPDH were detected by immunoblotting.

[0605] Figure 14 Knockout of FTO and FATALR1 provides protection against cell death. The figure shows the percentage of live control (shCnt), FTO knockout (shFTO), and FATALR1 knockout (shFATALR1-2) cells before and after IT treatment.

[0606] Figure 15 RNA immunoprecipitation (RIP) assays showed that FADD interacts with FATALR1, RAD51, ARHGAP24, and ABTB2.

[0607] Figure 16 Common RNA motifs identified in RNA molecules by the STAMP assay. The 10 most common motifs found in the top 100 RNA hits from the FTO STAMP assay (Table 1) are shown below. Figure 16 In A. The 10 most common motifs found in the top 100 RNA hits from the FADD STAMP assay (Table 2) are shown in Figure 16 B in.

[0608] Example Example 1: RBP is a structural component of the TNFR1 complex. RBP (XPO5) was identified as a component of TNFR1 complex I by treating cells with TNF with a double StrepII tag, as well as well-known components of TNFR1 complex I, such as RIPK1, cIAP1, and TNFR1 ( Figure 1B). In contrast, when cells ectopically expressed FADD tagged with StrepII and treated with BT (100 nM brenalapa and 10 ng / ml TNF), immunoprecipitation of complex II with StrepII beads revealed the presence of FTO and XPO5 as novel RBP components of TNFR1 complex II. Figure 1 C).

[0609] Details of the experimental procedure are provided below.

[0610] Cell culture: MDA-MB-231 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS). Cells were passaged every 3–4 days using trypsin (HyClone™). All cells were maintained in a humidified incubator at 37°C and 5% CO2.

[0611] TNFR1 complex I pull down: MDA-MB-231 cells were treated with TNF with a double StrepII tag for 5 minutes. Following treatment, cells were rapidly washed with ice-cold PBS and lysed using lysis buffer (20 mM Tris (pH 8.0), 137 mM NaCl, 1 mM EDTA, 1.5 mM MgCl2, 10% glycerol, 1% Triton X-100) supplemented with PhosSTOP™ tablets (Roche), a cOmplete™ EDTA-free protease inhibitor mixture (Roche), and a biotin blocker (IBA). Cell lysates were clarified by centrifugation at 15,000 rpm for 30 minutes and quantified using the Bradford protein assay (Bio-Rad). 1 mg of protein extract was incubated overnight at 4°C with Strep-Tactin beads. The next day, the beads were washed six times with lysis buffer and resuspended in 2X NuPAGE™ LDS sample buffer. The eluent was then used for Western blotting.

[0612] For size exclusion chromatography of complex IIa: MDA-MB-231 cells overexpressing FADD with a double StrepII tag were treated with BT for 2 hours. To isolate total protein, cells were lysed using the same buffer and procedure as used in the immunoprecipitation assay. Biotin blocker was added to the soluble protein extract and the cells were incubated at 4°C for 30 minutes. The lysate was then incubated overnight at 4°C with Strep-Tactin beads. The next day, the beads were washed six times with lysis buffer and eluted with buffer BXT (IBA) at 4°C for 2 hours. The eluent was collected and size exclusion chromatography was performed on an AKTA instrument using Superose™ 6 Increase.

[0613] Example 2: Targeting RBP to regulate TNFR1-mediated cell death Cell death, a downstream consequence of TNFR1, can be blocked by FDA-approved anti-TNF drugs. To verify the inhibitory effects of targeting FTO or XPO5 on cell death, time-course experiments were performed using wild-type (WT), FTO knockout (KO), and XPO5 KO cells treated with BT. Flow cytometry analysis revealed that WT cells rapidly underwent cell death after BT treatment, while FTO KO and XPO5 KO cells showed a significant delay in cell death induction, as shown by flow cytometry analysis. Figure 2 In biochemistry, unlike WT cells, cell death markers, including RIPK1 activation and the processing of caspase-8, caspase-3, and PARP, were significantly reduced in the absence of FTO or XPO5. Figure 2 These findings strongly suggest that inhibition of FTO and XPO5 (a newly discovered component of the TNFR1 complex) effectively reduces cell death levels. Details of the experimental procedures are provided below.

[0614] Generation of knockout cell lines: FTO KO and XPO5 KO knockout cell lines were generated using the CRISPR / Cas9 system. MDA-MB-231 and SKOV3 cell lines were co-transfected with Cas9 and gRNA expression plasmids. Transfected cells were sorted into single clones using fluorescent markers GFP and mCherry, respectively, derived from the Cas9 and gRNA expression vectors. Knockout clones were validated by targeted sequencing of genomic DNA and subsequent quantitative PCR (qPCR).

[0615] The gRNA sequences targeting each gene are listed below: FTO (MDA-MB-231): AGCTTCGCGCTCTCGTTCCT (SEQ ID NO:15) FTO (SKOV3):TCTGGTGGACAGGTCAGCGGTGG (SEQ ID NO:16) XPO5 (MDA-MB-231): GAAACGCGCTGTGCGAGCAGC (SEQ ID NO:17) XPO5 (SKOV3):GGCTTCCAGCCGGTAGCGCT (SEQ ID NO:18) Annexin V / Propidium Iodide (PI) Apoptosis Assay: WT, FTO KO, and XPO5 KO cells were treated with BT. Samples were obtained at different time points after BT treatment. Cells were washed once with 1X PBS and then treated with trypsin for 3 minutes. The trypsin-treated cells were then neutralized with culture medium and collected in the same tube as dead cells. Cells were harvested by centrifugation at 4000 rpm, and the resulting cell pellet was washed with 1X PBS and centrifuged again at the same speed. Cells were then stained with 5 µl of annexin V (BD Pharmingen™) for 15 minutes in 1X annexin V binding buffer (0.01 M HEPES (pH 7.4), 0.14 M NaCl, 2.5 mM CaCl2 solution), followed by 1 µl of propidium iodide staining. The percentage of viable cells was analyzed by flow cytometry, which included counting the number of double-negative cells. Results were shown in [data missing]. Figure 2 In AB.

[0616] Protein blot: Total protein was isolated using the NucleoSpin RNA / Protein Kit according to the manufacturer's instructions. Protein concentration was measured using a protein quantification kit (MACHEREY-NAGEL) and normalized to the same concentration in all samples. Protein extracts were separated on 4%–12% NuPAGE Bis-Tris gels in NuPAGE MOPS running buffer (Thermofisher) and transferred to PVDF membranes. The membranes were blocked with 5% skim milk in PBST for 1 hour and then incubated overnight at 4°C with the designated primary antibody. After incubation with the primary antibody, the membranes were washed three times with PBST for 10 minutes each time and then incubated with the secondary antibody for 1 hour at room temperature. The membranes were washed again with PBST (3 times, 10 minutes each time) and developed using SuperSignal™ West FemtoMaximum Sensitivity Substrate (Thermofisher).Using anti-cIAP1 (CST, #7065, 1:1000), anti-phospho-RIPK1 (Ser166) (CST, #44590, 1:1000), anti-cysteine-8 (Proteintech, 13423-1-AP, 1:1000), anti-cleaved cysteine-8 (CST, #9748, 1:1000); anti-cysteine-3 (CST, #9662, 1:1000), anti-cleaved cysteine-3 (CST, #9662, 1:1000), anti-PARP (CST, #9541, 1:1000), anti-FTO (abcam, ab92821, 1:1000), and anti-HSP90 (BD bioscience, #610419), Anti-RIP1 (CST, #3493S, 1:1000), Anti-RIP3 (CST, #13526S, 1:1000), Anti-FADD (Proteintech, 14906-1-Ap, 1:1000), Anti-TNFR1 (Santa Cruz, sc-8436, 1:500), GAPDH (Santa Cruz, sc-32233, 1:500), Anti-p65 (Sigma, #06418, 1:1000), Anti-TRADD (BDbioscience, 610573, 1:1000), IKK (CST, #2678, 1:1000), Anti-MLKL (CST, #14993S, 1:1000), anti-IkB (Santa Cruz, sc-371, 1:500), and anti-p-IkB (CST, #9246S, 1:1000) probe samples.

[0617] Example 3: RNA molecules are structural components of the TNFR1 complex The APOBEC-mediated Target Measurement Assay (STAMP) was used to identify RNA molecules that interact with both FADD and FTO during BT-induced apoptosis. The STAMP assay is based on the use of the RNA editing enzyme APOBEC1, which is fused to either FTO or FADD. Binding of FTO or FADD to their respective RNA targets promotes C-to-U conversion mediated by tethered APOBEC1. Details of the experimental procedure are provided below.

[0618] High-throughput RNA sequencing was performed on samples prepared from cells overexpressing APOBEC1-FADD or APOBEC1-FTO to identify C-to-U editing and determine interacting RNAs. Figure 3 A). Analysis revealed that under UT and BT treatments, APOBEC1-FTO edited a total of 815 and 1118 genes, respectively, while APOBEC1-FADD edited 886 and 1470 genes, respectively.

[0619] It is worth noting that among the edited genes, there is some overlap between UT and BT treatment conditions for APOBEC1-FTO and APOBEC1-FADD. Figure 3 B). Notably, under UT conditions, 411 genes were identified as being edited by both APOBEC1-FTO and APOBEC1-FADD. Additionally, under BT conditions, 640 genes were edited by both APOBEC1-FTO and APOBEC1-FADD. This analysis led to the identification of RNAs associated with TNFR1 complex-II formation, which were ordered according to the bioinformatics analysis described below. The top 50 hits were in... Figure 3 The results are displayed as a heatmap in C, and the top 100 hits are shown in Table 1.

[0620] FATALR1 functions as a novel component II of the complex. (Pull down FTO) Figure 4 A) and FADD ( Figure 4 B) Both enriched FATALR1 RNA, especially under BT treatment conditions. Furthermore, RNA labeling using nuclease-free CRISPR-Cas13 and FATALR1-specific guide RNA (gRNA) showed co-localization with FADD in cytoplasmic foci after BT treatment. Figure 4 C). In summary, these experiments identified FATALR1 as an RNA that interacts with components of complex II (including FADD and FTO).

[0621] STAMP assay: STAMP assays were performed using FTO and FADD knockout cells (FTO KO and FADD KO) generated according to previously described methods. FTO KO and FADD KO cells were transduced with APOBEC1-FTO and APOBEC1-FADD lentiviral integration, respectively. The APOBEC1 plasmid was used as a control. Western blotting was used to verify the expression of the fusion proteins. Cell lines were stabilized with or without BT treatment for 2 hours. Total RNA isolation was performed using Trizol according to standard manufacturer's instructions. rRNA depletion and library preparation were performed according to standard procedures.

[0622] RNA-Seq analysis: For RNA-seq libraries, raw sequencing reads were processed using Trimmomatic v0.32 (Bolger et al., Bioinformatics. 2014. 30, 2114-2120) to remove adapters and low-quality reads. The remaining reads were mapped to the human genome GRCh38 using hisat2 v2.1.0 (Kim et al., Nat Biotechnol. 2019. 37, 907-915), and the reads mapped to features annotated in ensemble v84 were quantified by transcription using the FeatureCounts subroutine of subread v1.6.2 software (Liao et al., Bioinformatics. 2014. 30, 923-930). Finally, after count normalization, differential expression was tested in R (https: / / www.R-project.org / ) using the edgeR package (Robinson et al., Bioinformatics. 2010. 26, 139-140) by fitting to a linear model. Results were plotted in R (https: / / www.R-project.org / ) using ggplot2 (https: / / ggplot2.tidyverse.org.) and the ComplexHeatmap library (Gu et al., Bioinformatics. 2016. 32, 2847-2849).

[0623] STAMP analysis: RNA STAMP libraries from both unprocessed and processed experiments were processed using the SAILOR software package, as previously described (Brannan et al., Nat Methods. 2021. 18, 507-519). Briefly, sequencing reads were trimmed with Trimmomatic v0.32 (3) and mapped to the human genome (hg19) using STAR v2.7.10b (Dobin et al., Bioinformatics. 2013. 29, 15-21) with a trimming index of 149 bp. Each alignment file was then run using the SAILOR pipeline v1.2 (located in the singularity container). Each library was merged using mergePeaks to combine edits from different strands and annotated to the nearest genomic features using annotatePeaks; both features are part of the homer software v4.11 (Dobin et al., Bioinformatics. 2013. 29, 15-21). Finally, the number and level of C>T edits were quantified according to the annotated loci and compared with the control RNA library. To obtain a score for each edited locus and each STAMP-RBP library, the average edit level of each replicate in the treated library was divided by the level in the untreated library, and the libraries were scaled by their edit levels to rank the loci with the highest edit levels. A false count of 0.1 was used to avoid division by zero and to count the limit of detection levels for the STAMP libraries, where the edit level in the untreated library was zero. Finally, genome visualization was generated using the Gviz software package.

[0624] Analysis of FATALR1: FTO KO cells reconstituted with empty vector (EV) or FTO tagged with Strepll were treated with BT for 2 hours. 1% of the cell lysate was retained as input, and the remainder was subjected to Strepll beads overnight. FTO-bound RNA was isolated and reverse transcribed into cDNA. qPCR was performed, and enrichment folds were calculated using Cq values.

[0625] FADD KO cells reconstituted with empty vector (EV) or FADD tagged with Strepll were treated with BT for 2 hours. 1% of the cell lysate was retained as input, and the remainder was subjected to Strepll beads overnight. FADD-bound RNA was isolated and reverse transcribed into cDNA. qPCR was performed, and enrichment folds were calculated using Cq values.

[0626] Cells stably overexpressing dCas13-eGFP, mCherry-FADD, and non-targeting gRNA (gNT) or FATALR1-targeting gRNA (gRIAR) were treated with BT for 2 hours without treatment. Confocal images were captured to analyze the colocalization of FATALR1 and FADD under both conditions.

[0627] Example 4: Targeting RNA to regulate TNFR1-mediated cell death The interaction of FATALR1 with FTO and FADD after BT treatment suggests its functional role in TNFR1-mediated apoptosis. In SKOV3 and MDA-MB-231 cell lines, shRNA knockdown of FATALR1 protected cells from BT-induced apoptosis. Figure 5 AB). Biochemical analysis revealed reduced caspase-3 and caspase-8 processing in FATALR1 knockdown cells, further confirming these results. Figure 5 CD). Furthermore, complex formation analysis indicated that in the absence of FATALR1, a defective complex II lacking TRADD was formed (CD). Figure 5 E). These results indicate that FATALR1 plays a crucial role in regulating cell death by facilitating TRADD recruitment and promoting complex II formation. Details of the experimental procedure are provided below.

[0628] shRNA-mediated knockdown experiment: Following standard manufacturer instructions, the shRNA sequence was designed and cloned into the pLKO.1-TRC vector using the GPP Web Portal (https: / / portals.broadinstitute.org / gpp / public / ). The cloned construct was validated using Sanger sequencing. Knockdown cell lines were generated using standard procedures with both SKOV3 and MDA-MB-231 host cells. Knockdown efficiency was evaluated using qPCR or Western blotting.

[0629] The following shRNA sequences are used to generate shFATALR1-1, shFATALR1-2, and shFTO knockdown lines: shFATALR1-1:TATGAAGAACAGAGCAAATTA (SEQ ID NO:19) shFATALR1-2:CCCGTTCGGTTGTTAACATAA (SEQ ID NO:20) shFTO: GCCTCAGTTTCCTCATCTGTA (SEQ ID NO: 28) The shFATALR1-1, shFATALR1-2 and sh FTO knockdown systems are also used in subsequent embodiments.

[0630] Annexin V / Propidium Iodide (PI) Apoptosis Assay: The procedure was performed on control (shCnt) and FATALR1 knockdown (shFATALR1) cells. Sixteen hours after BT treatment, culture medium containing dead cells was collected. Cells still attached to the wells were washed once with 1X PBS and then treated with trypsin for 3 minutes. The trypsin-treated cells were then neutralized with culture medium and collected in the same tubes as the dead cells. Cells were harvested by centrifugation at 4000 rpm, and the resulting cell pellet was washed with 1X PBS and centrifuged again at the same speed. Cells were then stained with 5 µl of annexin V (BD Pharmingen™) for 15 minutes in 1X annexin V binding buffer (0.01 M HEPES (pH 7.4), 0.14 M NaCl, 2.5 mM CaCl2 solution), followed by staining with 1 µl of propidium iodide. The percentage of viable cells was analyzed by flow cytometry, including counting the number of double-negative cells.

[0631] Protein blot: Total protein was isolated from control (shCnt) and FATALR1 knockdown (shFATALR1) cells using the NucleoSpin RNA / protein kit, following the manufacturer's instructions. Western blot analysis was performed as described in Example 2.

[0632] Example 5: Treatment of Inflammatory Diseases and Cytokine Storms To further determine the potential of the RBP component of TNFR1 complex II as a novel therapeutic target for inflammatory diseases by modulating cell death, cell death was induced in both wild-type (WT) and FTO KO cell lines, followed by RNA sequencing (RNA-seq) analysis as described in previous examples. Upon exposure to cell death stimuli, WT cells exhibited robust production of inflammatory cytokines, such as TNFα and IL6, creating an environment rich in cytokines. In contrast, FTO KO cells showed significantly reduced levels of these inflammatory cytokines. Figure 6 These findings provide compelling evidence that targeting novel components of the TNFR1 complex II, such as FTO, holds promising therapeutic potential for treating inflammatory diseases.

[0633] Similar experiments were also performed to evaluate the potential of the RNA component of TNFR1 complex II as a novel therapeutic target for inflammatory diseases. Cell death was induced in both wild-type (WT) and FATALR1 KO cell lines by BT treatment, followed by RNA-seq analysis as previously described. Significant upregulation of inflammatory cytokines was identified in WT cells following BT treatment. However, the upregulation of these cytokines was significantly reduced in FATALR1 KO cells. Figure 7 (AD). This compelling finding provides evidence that targeting the RNA component of the TNFR complex II offers new therapeutic opportunities for inflammatory diseases.

[0634] Example 6: Treatment of Infectious Diseases The expression of FATALR1 in healthy, mild, and severe COVID patients was determined by analyzing publicly available single-cell RNA-seq datasets.

[0635] FATALR1 expression was found to be higher in mild and severe COVID samples than in healthy samples. Figure 8 A). After cell type assignment, FATALR1 expression was found to be elevated in many immune cell types, including lymphocytes (e.g., B cells and T cells), dendritic cells (e.g., cDCs), and monocytes (…). Figure 8 B). TNF expression was also upregulated in these cell types. Figure 8 C).

[0636] Several studies have shown that monocytes are a major target of SARS-CoV-2 infection and undergo cell death. Therefore, the U937 monocyte cell line was used as an in vitro model to study the physiological significance of FATALR1 in cytokine-mediated cell death. WT U937 cells showed a robust response to combined treatment with TNFα and IFNγ (IT). Figure 8 D). Conversely, knocking down FATALR1 provides significant protection against IT ( Figure 8 E) Control cells (shCnt) showed significantly higher levels of cell death than FATALR1 knockdown (shFATALR1-1 and shFATALR1-2). Additionally, FTO knockdown also provided protection against IT. Figure 14 The control cells (shCnt) showed a higher level of cell death than the FTO knockdown cells (shFTO). These data further reaffirm the roles of FATALR1 and FTO in cell death under physiological conditions.

[0637] Single-cell RNA data acquisition Using the organizational structure of the scRNA dataset in the DISCO database, alignment files were provided by the DISCO database authors and analyzed via the 10X genomics cell ranger pipeline v7.0.1. For each file, unique cell barcodes and UMI barcodes were merged and quantified on the FATALR1 region using Samtools v1.16.1 and Bedtools v2.30. Each count was assigned to a cell barcode and integrated together with the corresponding count matrix downloaded from the DISCO database using DISCO toolkit v1.0.0 (https: / / github.com / JinmiaoChenLab / DISCOtoolkit) in R v4.2.0 (R coreteam 2022) assembled with OpenBLAS. Only lung and blood COVID samples with an admission time point equal to zero in their DISCO metadata were used as COVID samples. For health data selection, samples annotated as “normal” for the same item belonging to the selected COVID samples were used. Finally, the severity of COVID infection was identified.

[0638] Single-cell RNA analysis Each corrected count matrix was converted into a Seurat object using Seurat Library v4. For each object, cells with low RNA counts (< 200) or high mitochondrial RNA content (> 5%) were removed, and the mitotic stage of the remaining cells was inferred using the CellCycleScoring function and human-specific markers. Subsequently, RNA counts in each library were log-normalized to parts-per-million (ppm) counts and scaled to identify up to 4000 variable features. Three different methods were then used for data integration: simple “merge” (via the Seurat merge function), harmony integration, and fastintegration, to reduce batch effects per sample. For each merged Seurat object, principal component analysis (PCA) and unified manifold approximation and projection (UMAP) plots were generated with up to 30 dimensions. Integrations generated via harmony were selected for further analysis by manual review. Cell clusters were identified using FindClusters from the Seurat package, and cell types were identified using CELLiD. The cell annotations were manually edited, and plots were generated by cell type and conditions using ggplot2 and Seurat built-in functions.

[0639] Example 7: Cancer Treatment Birapa, currently undergoing clinical trials, shows potential as a monotherapy or in combination with other chemotherapy drugs for cancer treatment (Nikkhoo et al., J Cell Biochem. 2019. 120, 9300-9314). However, not all cancer cells respond effectively to this treatment. Cancer cells were modified to overexpress FATALR1 and fragments of FATALR1, and the sensitivity of cells with upregulated FATALR1 expression to birapa was measured. The results indicate that overexpression of FATALR1, particularly the middle portion or 3' end of FATALR1 RNA, can restore sensitivity to birapa in previously resistant cancer cells. Figure 9 Furthermore, drug resistance resulting from FATALR1 modification in any type of cancer can be restored by involving the FATALR1 overexpression pathway to restore sensitivity to the drug.

[0640] Overexpression of FATALR1: plasmid transfection MDA-MB-231 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS). Cells were passaged every 3–4 days using trypsin (HyClone™). All cells were kept in a humidified incubator at 37°C and 5% CO2.

[0641] FATALR1 knockout cells were generated from MDA-MB-231 cells using CRISPR-Cas9 technology. MDA-MB-231 cells were co-transfected with Cas9 and gRNA expression plasmids. Transfected cells were sorted into single clones using fluorescent markers GFP and mCherry, respectively, derived from the Cas9 and gRNA expression vectors. Knockout clones were validated by targeted sequencing of genomic DNA and qPCR analysis of RNA expression.

[0642] The gRNA sequences targeting each gene are listed below: - TCATGTTCACCGAGGCCTGC (SEQ ID NO:12) - TAGTAGTGTTATAAGGACGG (SEQ ID NO:13) Then, control RNA (Cnt), FATALR1 fragment 1 (5' – SEQ ID NO:21), FATALR1 fragment 2 (Mid – SEQ ID NO:22), and FATALR1 fragment 3 (3' – SEQ ID NO:23) were overexpressed in FATALR1 knockout cells to generate four different overexpression lines (in Figure 9 They are referred to as (i) Cnt, (ii) 5', (iii) Mid and (iv) 3'.

[0643] To generate three overexpression lines and a control line, FATALR1 knockout cells were transfected with different plasmids (as described above). Each plasmid contained a different transgene (control RNA (Cnt), FATALR1 fragment 1 (5' – SEQ ID NO:21), FATALR1 fragment 2 (Mid – SEQ ID NO:22), or FATALR1 fragment 3 (3' – SEQ ID NO:23)). All plasmids contained a CMV promoter, a CMV enhancer, and the NeoR gene for selecting transfected cells. The transfected cells were then selected and validated.

[0644] After validating the expression lines, they were treated with BT (100 nM brenalapa and 10 ng / ml TNF) for 16 hours, followed by annexin V staining and flow cytometry analysis to determine the percentage of viable cells in each treatment group.

[0645] Example 8: FTO-mediated induction of FATALR1 During BT-induced cell death, FATALR1 Expression was significantly upregulated in wild-type (WT) cells, while this upregulation was observed in FTO cells. KO Significantly weakened in cells ( Figure 10 A). This indicates that FTO is related to BT-induced... FATALR1 Expression is necessary.

[0646] FTO is an m6A demethylase, and studies have shown that FTO demethylation activity is required to promote TNF-induced apoptosis. Experiments were conducted to determine whether FTO... FATALR1 m6A modification control FATALR1 TadA-assisted N6-methyladenosine sequencing (eTAM-seq) is an antibody-free method for quantitative analysis of m6A sites in the transcriptome at single-base resolution. eTAM-seq is used to examine... FATALR1 The m6A site was located on the 5' end, and an m6A island was identified at its 5' end. Figure 10 B). When the coding region including the identified m6A site is used with CRISPR-Cas9 technology ( FATALR1 m6A-del When removing, after BT processing FATALR1 The inducement was abolished. Figure 10 C), therefore the cells are resistant to BT treatment ( Figure 10 D) indicates that the formation of complex IIa is disrupted. Figure 10 E).

[0647] Research on FTO promotes FATALR1The potential mechanism of induction. In the absence of FTO, the H3K27ac tag in the 5' encoding m6A-modified region. FATALR1 Area reduction ( Figure 11 A). This indicates reduced chromatin accessibility in the absence of FTO, which is further supported by reduced recruitment of RNA polymerase II. Figure 11 B). These results collectively suggest that FTO promotes the opening of chromatin regions to enable [the process of...]. FATALR1 Transcription.

[0648] Cut & Tag (a transposase-assisted assay for detecting DNA binding targets) was performed, and it was found that FTO and RNA polymerase II co-localized to m6A-rich sites. FATALR1 The 5' end. These results together indicate that by binding FATALR1 The promoter region of FTO enhances the recruitment of RNA polymerase II for... FATALR1 Transcription, which explains the role of FTO in regulating cell death. FATALR1 It plays an important role in induction.

[0649] Example 9: Identification of RNA molecules regulating RIPK1 phosphorylation RIPK1 autophosphorylation is a key determinant of cell death downstream of TNFR1, influencing both apoptosis and necroptosis. Aberrant phosphorylation of RIPK1 is associated with various diseases, including inflammatory and neurodegenerative disorders. Experiments were conducted to identify RNAs that regulate RIPK1 phosphorylation.

[0650] The assay confirmed the robust regulation of RIPK1 phosphorylation by FTO, and this regulation depends on the demethylase activity of FTO on RNA. This is because only WT FTO, not the catalytically inactive mutant FTO, recombines to form FTO. KO Cells successfully restored RIPK1 phosphorylation ( Figure 12 (A and 12B).

[0651] FTO STAMP assays and RIPK1 STAMP assays (as described in Example 3) were performed to identify FTO-regulated RNAs that potentially regulate RIPK1 activation during cell death. In addition to APOBEC1, an evolved form of the RNA-editing enzyme TadA, used in conventional STAMP assays, was included; this enzyme performs A-to-G editing to eliminate sequence bias caused by different enzymes. Analysis of the STAMP assays yielded a list of predicted hits regulating RIPK1 phosphorylation (Table 2).

[0652] shRNA screening was performed to validate RNA candidates that regulate RIPK1 phosphorylation. It is worth noting that... RUPTR7 Knockdown ( Figure 13A) This resulted in a significant reduction in RIPK1 phosphorylation after BT treatment, and cells were protected from apoptosis, as evidenced by impaired processing of PARP and caspase-3. Figure 13 B). These results indicate that... RUPTR7 It is a positive regulator of RIPK1 phosphorylation.

[0653] Example 10: Interactions between FADD and RNA molecules (FATALR1, RAD51, ARHGAP24, and ABTB2) Cells were knocked out using FADD knockout cells reconstituted with StrepII peptide or StrepII-FADD. 20 million cells, with or without BT treatment, were harvested by scraping and centrifugation at 1000 rpm for 5 minutes. The cell pellet was washed twice with cold PBS and then lysed using lysis buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES-NaOH (pH 7), 0.5% Nonidet P-40 (NP-40)) supplemented with protease inhibitors (Roche), phospho-stop (Roche), and 200 U / ml RNase inhibitor (NEB). The cell lysates were gently agitated at 4°C for 30 minutes, followed by sonication for 5 minutes at high setting using a Biouptor UCD-200 (Diagenode). After centrifugation at 15000 rpm for 30 minutes, 10% of the soluble extract was retained as input, and the remaining extract was incubated overnight with 100 µL Strep-Tactin beads under vortex. The next day, the beads were washed six times with lysis buffer, and both the input and immunoprecipitates were subjected to protease digestion to elute RNA. RNA was then purified using RNA Clean and Concentrator (Zymo). All RNA was reverse transcribed into cDNA and purified via 2... -ΔΔCt ([Ct(RIP)- Ct(输入)-log2(稀释倍数)] / NIS]) Enrichment folds were calculated, with Ct values ​​determined by qPCR. Results were shown in... Figure 15 The study confirmed that FADD interacts with FATALR1, RAD51, ARHGAP24, and ABTB2.

[0654] Example 11: Common motifs in RNA molecules identified by the STAMP assay Nucleic acid sequences from RNA hits obtained by FTO STAMP (Table 1) and FADD STAMP (Table 2) assays were analyzed using the HOMER algorithm (http: / / homer.ucsd.edu / homer / motif / ) to identify high-frequency common RNA motifs.

[0655] The 10 most common motifs found in the top 100 RNA hits from the FTO STAMP assay (Table 1) are shown in... Figure 16 In A. The 10 most common motifs found in the top 100 RNA hits from the FADD STAMP assay (Table 2) are shown in Figure 16 In B, the following motifs are considered particularly important: GCCGGCCG (SEQ ID NO:29), UUGUCCCUCA (SEQ ID NO:30), and UCGGCGGCCGCU (SEQ ID NO:31).

Claims

1. A modulator of a component of a tumor necrosis factor receptor 1 (TNFR1) complex II for the treatment or prevention of diseases pathologically involving TNFR1-mediated signal transduction, wherein said component of the TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

2. Use of a modulator of a component of tumor necrosis factor receptor 1 (TNFR1) complex II in the preparation of a medicament for the treatment or prevention of diseases pathologically involving TNFR1-mediated signal transduction, wherein said component of TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

3. A method for treating or preventing a disease pathologically involving signal transduction mediated by tumor necrosis factor receptor 1 (TNFR1), wherein the method comprises administering to a subject a modulator of a component of a therapeutically or preventively effective TNFR1 complex II, wherein said component of TNFR1 complex II is a ribonucleic acid (RNA)-binding protein (RBP) or RNA.

4. The modulator used according to claim 1, the use according to claim 2, or the method according to claim 3, wherein the RBP component of the TNFR1 complex II comprises, or is composed of, an amino acid sequence having at least 70% amino acid sequence identity with, SEQ ID NO:1 or SEQ ID NO:

6.

5. The modulator used according to claim 1 or 4, the use according to claim 2 or 4, or the method according to claim 3 or 4, wherein the RNA component of TNFR1 complex II is RNA capable of associating with the RBP component of TNFR1 complex II.

6. The modulator used according to any one of claims 1, 4 or 5, the use according to any one of claims 2, 4 or 5, or the method according to any one of claims 3-5, wherein the RNA component of the TNFR1 complex II is non-coding RNA.

7. The modulator used according to any one of claims 1 or 4-6, the use according to any one of claims 2 or 4-6, or the method according to any one of claims 3-6, wherein the RNA component of the TNFR1 complex II is RNA comprising or composed of a nucleotide sequence having at least 70% nucleotide sequence identity with a nucleotide sequence selected from: The nucleotide sequence of RNA transcribed from positions 145959299 to 145969262 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 147502825 to 147510900 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 111659317 to 111846428 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 86396528 to 86922184 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 165899418 to 166077274 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 68290286 to 68644674 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 34254566 to 34379410 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 100418069 to 100745658 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 86522442 to 86669286 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 99261673 to 99434556 on human chromosome 15. The nucleotide sequence of RNA transcribed from positions 39917349 to 40178399 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 34603358 to 35104032 on human chromosome 10. The nucleotide sequence of RNA transcribed from positions 126719089 to 126784246 on human chromosome 10. The nucleotide sequence of RNA transcribed from positions 128596422 to 128841778 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 64611344 to 64672035 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 89445931 to 89526681 on human chromosome 16. The nucleotide sequence of RNA transcribed from positions 1893151 to 2245677 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 134256502 to 134309412 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 106964857 to 107157063 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 188347397 to 188533178 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 140514285 to 140590155 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 61542606 to 61920401 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 65892334 to 66385973 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 110151629 to 110176276 on human chromosome 12. The nucleotide sequence of RNA transcribed from positions 187869711 to 188112441 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 64356475 to 64590847 on human chromosome 17. The nucleotide sequence of RNA transcribed from positions 10195009 to 10245811 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 106330722 to 106659430 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 100558333 to 100680965 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 149041318 to 149386381 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 245999527 to 246670404 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 29677541 to 29904086 on the human X chromosome. The nucleotide sequence of RNA transcribed from positions 23250209 to 23521712 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 66975015 to 67215923 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 7566739 to 7966915 on human chromosome 18. The nucleotide sequence of RNA transcribed from positions 59826238 to 60230486 on human chromosome 20. The nucleotide sequence of RNA transcribed from positions 104918024 to 105155677 on human chromosome 12. The nucleotide sequence of RNA transcribed from positions 143671031 to 147850490 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 40812253 to 41217827 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 19837625 to 19869554 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 189696844 to 189838594 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 148736110 to 148766960 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 11802659 to 11993721 on human chromosome 12. The nucleotide sequence of RNA transcribed from positions 102247784 to 102456356 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 171757455 to 171959434 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 188124039 to 188343878 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 153191855 to 153378429 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 184834202 to 184943833 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 119653285 to 119807106 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 143115825 to 143285504 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 99641779 to 99758184 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 17420660 to 17494454 on the human X chromosome. The nucleotide sequence of RNA transcribed from positions 85923977 to 86198925 on human chromosome 15. The nucleotide sequence of RNA transcribed from positions 44854771 to 45229571 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 79733899 to 79850706 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 75935953 to 76056352 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 144301054 to 144541576 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 36177613 to 36425639 on human chromosome 22. The nucleotide sequence of RNA transcribed from positions 28012120 to 28209146 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 1607960 to 1892955 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 128246768 to 128469388 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 116854504 to 116968939 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 47127605 to 47233991 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 206667573 to 206757842 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 60596474 to 60768540 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 76114103 to 76432164 on human chromosome 10. The nucleotide sequence of RNA transcribed from positions 7971111 to 8406585 on human chromosome 18. The nucleotide sequence of RNA transcribed from positions 29060442 to 29545467 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 16371311 to 16437191 on human chromosome 21. The nucleotide sequence of RNA transcribed from positions 131409474 to 131440762 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 49962691 to 50114102 on human chromosome 20. The nucleotide sequence of RNA transcribed from positions 3340909 to 4167031 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 29650814 to 30051606 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 12008853 to 12151073 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 192554458 to 192635399 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 74451668 to 74710375 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 234040499 to 234383480 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 184020384 to 184088355 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 108103176 to 108335534 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 23435467 to 23494419 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 49962374 to 50113788 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 16830300 to 17076624 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 15244245 to 15452572 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 37784676 to 38118126 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 20323631 to 20457117 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 65339155 to 65907397 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 108082406 to 108460035 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 70479923 to 70588817 on human chromosome 17. The nucleotide sequence of RNA transcribed from positions 10095845 to 10319831 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 109150930 to 109276049 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 21376800 to 21554467 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 71471994 to 71633960 on human chromosome 15. The nucleotide sequence of RNA transcribed from positions 235423963 to 235491373 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 126475318 to 126692155 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 167710188 to 167813852 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 10560487 to 10657638 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 48011532 to 48132940 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 178063133 to 178395500 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 35684412 to 35824606 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 175001674 to 175114226 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 23608068 to 23868206 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 46064217 to 46210823 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 109737142 to 109775071 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 77043779 to 77122468 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 157556333 to 157587186 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 11417591 to 11461284 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 157398215 to 157460007 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 23426206 to 23433775 on human chromosome 20. The nucleotide sequence of RNA transcribed from positions 30952569 to 30992458 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 148264179 to 148330482 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 117290 to 135277 on human chromosome 22. The nucleotide sequence of RNA transcribed from positions 175989480 to 176027571 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 9735487 to 9741115 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 63785231 to 63805565 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 96720566 to 96739955 on human chromosome 12. The nucleotide sequence of RNA transcribed from positions 230328832 to 230342173 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 106463621 to 106496054 on human chromosome 12. The nucleotide sequence of RNA transcribed from positions 16437525 to 16552529 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 156352787 to 156388675 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 63729009 to 63848896 on human chromosome 8. The nucleotide sequence of RNA transcribed from positions 162719146 to 162753094 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 37916555 to 37926178 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 49925315 to 50042315 on the human X chromosome. The nucleotide sequence of RNA transcribed from positions 1968590 to 1987324 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 148384870 to 148446265 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 28318533 to 28405425 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 113215997 to 113218504 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 37974838 to 38015373 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 8384099 to 8405959 on human chromosome 21. The nucleotide sequence of RNA transcribed from positions 66788980 to 66803872 on human chromosome 17. The nucleotide sequence of RNA transcribed from positions 71147339 to 71174844 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 150017499 to 150223165 on the human X chromosome. The nucleotide sequence of RNA transcribed from positions 87518316 to 87613876 on the human X chromosome. The nucleotide sequence of RNA transcribed from positions 132212148 to 132284358 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 163256988 to 163425802 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 49396244 to 49422714 on human chromosome 15. The nucleotide sequence of RNA transcribed from positions 48173220 to 48198075 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 32902124 to 32925352 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 13413791 to 13421599 on human chromosome 21. The nucleotide sequence of RNA transcribed from positions 114823036 to 114998256 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 111468836 to 111491662 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 144995201 to 145092834 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 40161637 to 40189054 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 3471518 to 3535252 on human chromosome 20. The nucleotide sequence of RNA transcribed from positions 71964876 to 72352094 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 52685691 to 52785534 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 3999688 to 4023872 on human chromosome 11. The nucleotide sequence of RNA transcribed from positions 4007064 to 4027993 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 76995521 to 77044203 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 1671 to 3229 on the human M chromosome. The nucleotide sequence of RNA transcribed from positions 40994854 to 41007439 on human chromosome 9. The nucleotide sequence of RNA transcribed from positions 136093037 to 136117070 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 70660217 to 70664661 on human chromosome 15. The nucleotide sequence of RNA transcribed from positions 24094298 to 24111073 on human chromosome 16. The nucleotide sequence of RNA transcribed from positions 60726214 to 60774900 on human chromosome 13. The nucleotide sequence of RNA transcribed from positions 97306298 to 97373560 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 25664976 to 25795773 on human chromosome 14. The nucleotide sequence of RNA transcribed from positions 20981625 to 20994089 on human chromosome 17. The nucleotide sequence of RNA transcribed from positions 161973418 to 162054090 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 209299939 to 209304476 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 29467682 to 29485833 on human chromosome 16. The nucleotide sequence of RNA transcribed from positions 119273709 to 119291164 on human chromosome 4. The nucleotide sequence of RNA transcribed from positions 112271606 to 112360361 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 14713296 to 14886754 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 29505794 to 29527687 on human chromosome 16. The nucleotide sequence of RNA transcribed from positions 199016466 to 199041555 on human chromosome 1. The nucleotide sequence of RNA transcribed from positions 146195111 to 146774270 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 12833755 to 12850658 on human chromosome 3. The nucleotide sequence of RNA transcribed from positions 10650114 to 10657816 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 113217376 to 113218609 on human chromosome 2. The nucleotide sequence of RNA transcribed from positions 63148830 to 63154859 on human chromosome 7. The nucleotide sequence of RNA transcribed from positions 9809791 to 9819161 on human chromosome 6. The nucleotide sequence of RNA transcribed from positions 10649266 to 10657816 on human chromosome 5. The nucleotide sequence of RNA transcribed from positions 82475712 to 82477258 on human chromosome 15, and The nucleotide sequence of RNA transcribed from positions 88729338 to 88734551 on human chromosome 2.

8. The modulator used according to any one of claims 1 or 4-7, the use according to any one of claims 2 or 4-7, or the method according to any one of claims 3-7, wherein the RNA component of the TNFR1 complex II is RNA comprising or composed of a ribonucleotide sequence having at least 70% nucleotide sequence identity with SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:

25.

9. The modulator used according to any one of claims 1 or 4-8, the use according to any one of claims 2 or 4-8, or the method according to any one of claims 3-8, wherein the modulator inhibits the expression and / or activity of said component of TNFR1 complex II.

10. The modulator used according to any one of claims 1 or 4-9, the use according to any one of claims 2 or 4-9, or the method according to any one of claims 3-9, wherein the modulator is selected from: small molecules that bind to the components of TNFR1 complex II, inhibitory nucleic acids that target the components of TNFR1 complex II, and nucleic acids encoding site-specific nuclease (SSN) systems that target nucleic acids encoding the components of TNFR1 complex II.

11. The modulator used according to any one of claims 1 or 4-8, the use according to any one of claims 2 or 4-8, or the method according to any one of claims 3-8, wherein the modulator upregulates the expression and / or activity of the component of TNFR1 complex II.

12. The modulator used according to any one of claims 1, 4-8 or 11, the use according to any one of claims 2, 4-8 or 11, or the method according to any one of claims 3-8 or 11, wherein the modulator comprises or is composed of a nucleic acid encoding an RBP or RNA component of TNFR1 complex II.

13. The modulator used according to any one of claims 1 or 4-12, the use according to any one of claims 2 or 4-12, or the method according to any one of claims 3-12, wherein the pathologically involved disease involving TNFR1-mediated signal transduction is characterized by dysregulation of caspase-8, caspase-3, caspase-10, RIPK1, RIPK3 and / or PARP activity.

14. The modulator used according to any one of claims 1 or 4-13, the use according to any one of claims 2 or 4-13, or the method according to any one of claims 3-13, wherein the pathologically involved disease of TNFR1-mediated signal transduction is characterized by dysregulation of cell death.

15. The modulator used according to any one of claims 1 or 4-14, the use according to any one of claims 2 or 4-14, or the method according to any one of claims 3-14, wherein the pathologically involved disease of TNFR1-mediated signal transduction is characterized by a cytokine storm.

16. The modulator used according to any one of claims 1, 4-8 or 11-15, the use according to any one of claims 2, 4-8 or 11-15, or the method according to any one of claims 3-8 or 11-15, wherein the pathologically involved disease involving TNFR1-mediated signal transduction is cancer.

17. The modulator used according to any one of claims 1, 4-10 or 13-15, the use according to any one of claims 2, 4-10 or 13-15, or the method according to any one of claims 3-4-10 or 13-15, wherein the pathologically involved TNFR1-mediated signal transduction disease is an inflammatory condition and / or an infectious disease.

18. The modifier, use, or method according to claim 16, wherein the cancer is selected from: solid tumors, breast cancer, breast epithelial carcinoma, ductal carcinoma, gastric cancer, gastric epithelial carcinoma, gastric adenocarcinoma, colorectal cancer, colorectal epithelial carcinoma, colorectal adenocarcinoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung epithelial carcinoma, ovarian cancer, ovarian epithelial carcinoma, ovarian serous adenocarcinoma, renal cancer, renal cell carcinoma, etc. Renal clear cell carcinoma, renal cell adenocarcinoma, renal papillary cell carcinoma, pancreatic cancer, pancreatic adenocarcinoma, pancreatic duct adenocarcinoma, cervical cancer, cervical squamous cell carcinoma, skin cancer, melanoma, esophageal cancer, esophageal adenocarcinoma, liver cancer, hepatocellular carcinoma, bile duct carcinoma, uterine cancer, endometrial carcinoma of the uterine body, thyroid cancer, thyroid epithelial carcinoma, pheochromocytoma, paraganglioma, bladder cancer, bladder urothelial carcinoma, prostate cancer, prostate adenocarcinoma, sarcoma, and thymoma.

19. The modifier, use, or method of claim 17, wherein the inflammatory condition is selected from: chronic inflammatory diseases, arthritis, rheumatoid arthritis, juvenile arthritis, systemic juvenile idiopathic arthritis, lupus, systemic lupus erythematosus, pancreatitis, thyroiditis, periodontitis, rhinitis, allergic rhinitis, dermatitis, atopic dermatitis, psoriasis, Hermansky-Pudrag syndrome, Graves' disease, diabetes, type 1 diabetes, type 2 diabetes, pregnancy-related hyperglycemia, multiple sclerosis, atherosclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, hippocampal atrophy, lung disease, asthma, chronic... Obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis, hepatitis, hepatotoxicity, acetaminophen-induced hepatotoxicity, alcoholic liver disease, pancreatitis, inflammatory bowel disease, Crohn's disease, colitis, ulcerative colitis, endometriosis, nephropathy, kidney injury, acute kidney injury, nephrotoxicity, glomerulonephritis, chronic kidney disease, Allport syndrome, adult-onset Still's disease, Castleman's disease, cytokine release syndrome, sepsis, septic shock, retinopathy, age-related macular degeneration, wet age-related macular degeneration, retinitis pigmentosa, Poitz-Yage syndrome, skeletal muscle diseases, and muscular dystrophy.

20. The modifier, use, or method of use according to claim 17, wherein the infectious disease is a bacterial, viral, fungal, or parasitic infection.

21. A method for regulating cell death, wherein the method includes providing a regulator of a component of TNFR1 complex II, wherein said component of TNFR1 complex II is RBP or RNA.

Images