Enhancing TREX-1 to mitigate genotoxic stress and exert cardioprotection

By applying reagents that enhance the Trex1 gene product, stabilizing or overexpressing Trex1 mRNA, the problem of insufficient cardiac protection by macrophages after myocardial infarction was solved, achieving the effects of reducing cardiac damage and fibrosis and improving cardiac function.

CN122249562APending Publication Date: 2026-06-19CEDARS SINAI MEDICAL CENT

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CEDARS SINAI MEDICAL CENT
Filing Date
2024-09-12
Publication Date
2026-06-19

Smart Images

  • Figure CN122249562A_ABST
    Figure CN122249562A_ABST
Patent Text Reader

Abstract

This application provides a method for treating conditions associated with aging, atrophy, fibrosis, tissue aging, inflammation, heart disease, and / or muscle disease by administering to a subject an agent that enhances the expression of the Trex1 gene product, wherein said agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CGWCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:3). This application also provides compositions for treating conditions associated with aging, atrophy, inflammation, and / or fibrosis, comprising a nucleic acid that anneals to the Trex1 5' UTR and enhances Trex1 expression, a nucleic acid encoding Trex1 and enhancing Trex1 expression, a macrophage population having enhanced Trex1 gene product expression, or a combination thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Citation of relevant applications This application claims priority to U.S. Provisional Patent Application No. 63 / 583,007, filed September 15, 2023, the disclosure of which is incorporated herein by reference in its entirety.

[0002] Statement on federally funded research and development activities This application was made with the following government grants: grant number R01 HL124074 (awarded to Dr. Eduardo Marbán), grant number R01 HL142579 (awarded to Dr. Ahmed Ibrahim), and grant number R01 HL164588 from the National Institutes of Health. The U.S. government holds certain rights to this application.

[0003] References to sequence lists This application is submitted together with an electronic sequence list. The sequence list is provided as a file named SequenceListingCSMC022WO.xml, created on September 12, 2024, and is approximately 17,593 bytes in size. The electronic information of the sequence list is incorporated herein by reference in its entirety. Background Technology

[0004] This disclosure relates to the Trex1-cGAS / STING pathway and its role in mitigating genotoxic stress.

[0005] Inflammation and tissue damage are major drivers of the pathology of certain cardiac injuries and other diseases. As key participants in the innate immune system, macrophages secrete inflammatory mediators, clear cellular debris (through cytotoxicity), and remodel tissues after injury. Macrophages are key effector cells in the cardiomyocyte-derived cell (CDC) extracellular vesicle (EV)-mediated cardioprotective action after myocardial infarction (MI), and are associated with enhanced cytotoxicity. Consistent with this, macrophage depletion weakens cardioprotection.

[0006] Cardiac damage such as that associated with myocardial infarction (MI) affects a large population in the United States and globally. Effective treatments are needed to protect the heart and reduce fibrosis, adverse remodeling, scarring, and / or ventricular dysfunction. Summary of the Invention

[0007] This application provides a method for treating conditions associated with aging, atrophy, inflammation, and / or fibrosis, comprising: administering to a subject requiring treatment for conditions associated with aging, atrophy, inflammation, and / or fibrosis an effective amount of an agent that enhances the expression of the Trex1 gene product, wherein said agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CCUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). A method for treating conditions associated with aging, atrophy, inflammation, and / or fibrosis is also provided, including inflammation and / or fibrosis of the heart, skeletal muscle, or skin. In some embodiments, the conditions associated with aging, atrophy, inflammation, and / or fibrosis include symptoms and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma. In some embodiments, the inflammation-related conditions include symptoms or sequelae of infectious diseases or are associated with immunotherapy. In some embodiments, the infectious diseases include viral infections. In some embodiments, the inflammation-related conditions include cytokine storms. In some embodiments, the inflammation-related conditions include autoimmune diseases. In some embodiments, the autoimmune diseases include scleroderma or systemic sclerosis. In some embodiments, the conditions associated with aging, atrophy, and fibrosis include infectious diseases, idiopathic pulmonary fibrosis, or symptoms or sequelae of cirrhosis.

[0008] This application provides a method for treating heart disease or its symptoms, comprising: administering to a subject requiring treatment for heart disease or its symptoms an effective amount of an agent that enhances the expression of a Trex1 gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the heart disease includes symptoms and / or sequelae of heart failure. In some embodiments, the heart disease includes hypertrophic cardiomyopathy. In some embodiments, the heart disease includes heart failure with preserved ejection fraction (HFpEF). In some embodiments, the heart disease includes symptoms or sequelae of an infectious disease. In some embodiments, the infectious disease includes a viral infection. In some embodiments, the subject suffers from heart disease. In some embodiments, the subject is at risk of developing heart disease. In some embodiments, This application provides a method for treating muscle diseases or their symptoms, comprising: administering to a subject requiring treatment for muscle diseases or their symptoms an effective amount of a reagent that enhances the expression of the Trex1 gene product, wherein the reagent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CGICCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the muscle disease includes muscular dystrophy or cardiomyopathy. In some embodiments, the muscle disease includes Duchenne muscular dystrophy. In some embodiments, the subject has a muscle disease. In some embodiments, the subject is at risk of developing a muscle disease. In some embodiments, the subject is genetically predisposed to developing a muscle disease.

[0009] This application provides a method for treating diseases related to aging, tissue aging, or atrophy, comprising: administering to a subject requiring treatment for diseases related to aging, tissue aging, or atrophy an effective amount of an agent that enhances the expression of a Trex1 gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). According to any of the preceding claims, the agent does not contain an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the Trex1 gene product comprises Trex1 mRNA. In some embodiments, the agent comprises a nucleic acid that anneals to a first sequence in the 5' UTR of the Trex1 mRNA, the first sequence being different from a second sequence in the 5' UTR of the Trex1 mRNA, the second sequence annealing to a nucleic acid comprising a nucleotide sequence of CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the first sequence does not overlap with the second sequence. In some embodiments, the reagent stabilizes Trex1 mRNA or prolongs the half-life of Trex1 mRNA. In some embodiments, the reagent comprises a nucleic acid encoding a Trex1 gene product, optionally wherein the Trex1 gene product comprises a truncated TREX1 protein having exonuclease activity. In some embodiments, the nucleic acid comprises a promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product, wherein the promoter drives Trex1 gene product expression. In some embodiments, the nucleic acid comprises a vector. In some embodiments, the vector is a viral vector or a plasmid. In some embodiments, the nucleic acid is contained in macrophages. In some embodiments, the method comprises administering a macrophage population, wherein the population comprises an effective amount of a reagent that enhances Trex1 gene product expression. In some embodiments, the nucleic acid comprises stable Trex1 mRNA. In some embodiments, the stabilized Trex1 mRNA comprises an engineered poly(A) tail. In some embodiments, the reagent comprises one or more chemically modified nucleotides. In some embodiments, the chemically modified nucleotides comprise backbone modifications. In some embodiments, the main chain modification includes main chain sugar modification. In some embodiments, the one or more chemically modified nucleotides include locked nucleic acids (LNAs) and / or methylated nucleotides. In some embodiments, the reagent alleviates DNA damage in inflamed and / or fibrotic tissues or tissues at risk of inflammation and / or fibrosis.In some embodiments, when an effective amount of the reagent is administered to the subject, the reagent enhances the expression of the Trex1 gene product in macrophages.

[0010] This application provides a method for treating conditions associated with inflammation and / or fibrosis, comprising: upregulating Trex1 in macrophages of a subject who requires treatment for conditions associated with inflammation and / or fibrosis.

[0011] This application provides a method for treating a condition associated with inflammation and / or fibrosis, comprising: administering to a subject requiring treatment for a condition associated with inflammation and / or fibrosis an effective amount of an agent that reduces DNA damage in inflamed and / or fibrotic tissue or tissue at risk of inflammation and / or fibrosis, wherein said agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the method comprises administering an effective amount of the agent intravenously, intramuscularly, intracardiacly, or orally.

[0012] This application provides a method for promoting the anti-inflammatory activity of macrophages, comprising contacting a macrophage population with an agent that enhances the expression of the Trex1 gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CGWCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), thereby promoting the anti-inflammatory activity of the macrophage population. In some embodiments, the contact comprises administering an effective amount of the agent to a subject requiring treatment for conditions associated with aging, atrophy, inflammation, and / or fibrosis, thereby promoting the anti-inflammatory activity of macrophages in the subject. In some embodiments, the conditions associated with aging, atrophy, inflammation, and / or fibrosis include inflammation and / or fibrosis of the heart, skeletal muscle, or skin. In some embodiments, the conditions associated with aging, atrophy, inflammation, and / or fibrosis include symptoms and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma. In some embodiments, the nucleic acid includes a promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product, wherein the promoter drives the expression of the Trex1 gene product. In some embodiments, the nucleic acid includes a vector. In some embodiments, the vector is a viral vector or a plasmid. In some embodiments, the reagent stabilizes Trex1 mRNA or prolongs the half-life of Trex1 mRNA. In some embodiments, the macrophage population includes human macrophages.

[0013] This application provides a composition for treating conditions associated with aging, atrophy, inflammation, and / or fibrosis, comprising: a nucleic acid that anneals to a first sequence in a Trex1 mRNA 5' UTR, the first sequence being different from a second sequence in the Trex1 mRNA 5' UTR, the second sequence being annealed to a nucleic acid comprising a nucleotide sequence including CCUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), wherein the nucleic acid enhances Trex1 gene product expression; a nucleic acid encoding the Trex1 gene product, wherein the nucleic acid is configured to overexpress the Trex1 gene product; and a macrophage population having enhanced anti-inflammatory activity, wherein the macrophages in the population have enhanced Trex1 gene product expression and do not include exogenous RNA comprising a nucleotide sequence having at least 95% identity with CCUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3); or a combination thereof. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the macrophages in the population are genetically modified to overexpress the Trex1 gene product. In some embodiments, the macrophages in the population are genetically modified to include nucleic acids comprising a promoter operatively linked to a nucleotide sequence encoding the Trex1 gene product, wherein the promoter drives the expression of the Trex1 gene product in the macrophages. In some embodiments, the nucleic acid comprises a vector. In some embodiments, the vector is a viral vector or a plasmid. In some embodiments, the composition is used to treat heart disease, muscle disease, inflammatory disease, or a condition associated with aging and / or atrophy in subjects in need. In some embodiments, the composition is used to prepare a medicament for treating heart disease, muscle disease, inflammatory disease, or a condition associated with aging and / or atrophy in subjects in need.

[0014] This application also provides an in vitro method for identifying a reagent that enhances the expression of Trex1 gene product in target cells, comprising: contacting a candidate reagent with target cells; and measuring the expression level of Trex1 gene product in the target cells after contact, wherein when the measured expression level and / or activity level of Trex1 gene product increases compared with a suitable reference value, the candidate reagent is determined to be a reagent that enhances the expression of Trex1 gene product. Attached Figure Description

[0015] Figure 1A One non-limiting implementation of sequence alignment for EV-YF1 (SEQ ID NO:1) and NT4 (SEQ ID NO:2).

[0016] Figure 1BThis is a non-limiting embodiment showing a bar chart illustrating how EV-YF1 and NT4 upregulated IL10 expression in rat bone marrow-derived macrophages (BMDM) compared to a solvent control.

[0017] Figure 1C This is a non-limiting implementation of a schematic diagram illustrating a three-step screening process for NT4-derived structural variants to optimize their activity.

[0018] Figure 1D To evaluate screening for different nucleotide substitutions at the 5' end of IL-10 expression (guanine; all groups compared to NT4) (see [link to relevant documentation]). Figure 1C A non-limiting implementation of the bar chart of step 1.

[0019] Figure 1E To evaluate screening for variants that include LNA in IL-10 expression (all groups compared to NT41G-C) (see [link to relevant documentation]). Figure 1C A non-limiting implementation of the bar chart for step 2 of the diagram.

[0020] Figure 1F To evaluate the screening of adenylation and methylation at the 3' end of TY1 in IL-10 expression in mouse macrophages (all groups compared to TY1) (see [link to relevant documentation]). Figure 1C A non-limiting implementation of the bar chart in step 3 of the diagram.

[0021] Figure 1G To evaluate the screening of adenylation and methylation at the 3' end of TY1 in IL-10 expression in human macrophages (all groups compared with TY1) (see [link to relevant documentation]). Figure 1C A non-limiting implementation of the bar chart in step 3 of the diagram.

[0022] Figure 1H To illustrate a non-limiting embodiment of sequence alignment of naturally occurring NT4 (SEQ ID NO:2), its optimized biomimetic derivative (TY1, SEQ ID NO:3), and a disordered variant (Scr, SEQ ID NO:4) having the same nucleotide composition and containing LNA, the variant is described in... Figure 1F and Figure 1G The middle is used as a comparison.

[0023] Figure 1I A non-limiting embodiment is shown as a line graph illustrating the stability of TY1, NT4, and EV-YF1 after treatment with increasing concentrations of the exonuclease RNase R.

[0024] Figure 1JThis is a non-limiting embodiment of a bar chart showing the levels of a aging marker (P21) in bone marrow-derived macrophages (BMDMs) that have been pretreated with TY1, solvent, or a scrambled sequence prior to lipopolysaccharide (LPS) treatment.

[0025] Figure 1K This is a non-limiting embodiment of a bar chart showing the levels of inflammatory markers (NFkb) in bone marrow-derived macrophages (BMDMs) that have been pretreated with TY1, solvent, or out-of-order sequence prior to lipopolysaccharide (LPS) treatment.

[0026] Figure 1L This is a non-limiting embodiment of a bar chart showing the levels of the inflammatory marker (IL6) in bone marrow-derived macrophages (BMDMs) that have been pretreated with TY1, solvent, or a scrambled sequence prior to lipopolysaccharide (LPS) treatment.

[0027] Figure 2A This is a non-limiting embodiment that displays a heatmap of RNA sequencing data from rat bone marrow-derived macrophages (BMDM) treated with solvent (PBS) or TY1.

[0028] Figure 2B This is a non-limiting implementation of Ingenuity Pathway Analysis (IPA), which identifies DNA repair as a major associated pathway in TY1-treated macrophages.

[0029] Figure 2C A non-limiting implementation of a heatmap showing the unique enrichment of DNA repair genes with differential TY1 expression, including the Trex1 signaling pathway.

[0030] Figure 2D For comparison Figure 2C A non-limiting embodiment of a bar chart showing the expression of genes identified in TY1 (see dashed box) under TY1 and PBS induction.

[0031] Figure 2E This is a non-limiting embodiment of a bar chart showing the downregulation of TY1 on inflammatory genes.

[0032] Figure 2F A non-limiting embodiment of a bar chart showing the downregulation of the unfolded protein response (UPR) gene by TY1.

[0033] Figure 2G This is a non-limiting embodiment of a graph showing the level of misfolded protein aggregates (protein aggregates) in LPS-stressed macrophages after treatment with TY1, disordered, and solvent, as measured by the amyloid protein aggregation dye ProteoStat.

[0034] Figure 2H This is a non-limiting embodiment showing immunofluorescence images of LPS-stressed macrophages stained with the amyloid aggregation dyes ProteoStat and DAPI. Scale bar: 100 μ m.

[0035] Figure 2I This is a non-limiting embodiment of a bar chart showing the expression levels of ubiquitination pathway genes in cells treated with TY1 and solvent.

[0036] Figure 2J This is a non-limiting embodiment showing a bar chart of MAP-ERK signals in cells treated with TY1 or solvent.

[0037] Figure 2K This is a non-limiting implementation of a histogram measuring the nuclear and cytoplasmic localization of TY1 cells under baseline (solvent) and LPS stress conditions.

[0038] Figure 2L This is a non-limiting embodiment of a schematic diagram designed for mass spectrometry analysis of protein pull-down assays performed on macrophage lysates incubated with biotinylated TY1.

[0039] Figure 2M This is a non-limiting embodiment of a graph showing the mass spectrometry peptide hit results of a protein pull-down experiment performed after incubating macrophage lysate with biotinylated TY1, indicating its association with nuclear porin, RAN GTPase protein, and mRNA-binding protein.

[0040] Figure 2N To synthesize these findings, a non-limiting implementation of a model diagram illustrating the binding of TY1 to nuclear membrane proteins is provided.

[0041] Figure 3A This is a non-limiting embodiment illustrating a schematic diagram of two orthogonal methods for identifying RNA targets of TY1.

[0042] Figure 3B To show the use Figure 3A This outlines a non-limiting embodiment of a Venn diagram for determining the number of genes using certain implementations of the method outlined.

[0043] Figure 3C This is a non-limiting embodiment of a bar chart showing the level of TY1 RNA targets in TY1-treated macrophages as detected by RNA sequencing.

[0044] Figure 3DThis is a non-limiting embodiment showing a bar chart of Trex1 counts detected by RNA-RNA pull-down sequencing reads using a decoy trapping method.

[0045] Figure 3E This is a non-limiting embodiment showing a bar chart of Trex1 counts detected by RNA-RNA pull-down sequencing reads using a probe capture method.

[0046] Figure 3F This is a non-limiting implementation of a graph demonstrating that TY1 stabilizes the untranslated region (UTR) of the luciferase signal by binding to the 5' UTR of Trex1.

[0047] Figure 3G This is a non-limiting implementation of a graph from a luciferase assay demonstrating that TY1 does not stabilize the untranslated region (UTR) of Trex1 by binding to the 3' UTR of Trex1.

[0048] Figure 3H A non-limiting embodiment of a graph showing the level of Trex1 in TY1-treated bone marrow-derived macrophages as detected by qPCR.

[0049] Figure 3I A non-limiting embodiment of a graph showing the level of Trex1 in bone marrow-derived macrophages after TREX1 suppression demonstrates that TREX1 expression was partially restored by TY1 treatment.

[0050] Figure 3J A non-limiting embodiment of a graph showing the level of IL10 in bone marrow-derived macrophages after TREX1 suppression demonstrates that IL10 expression was partially restored by TY1 treatment.

[0051] Figure 3K This is a non-limiting embodiment showing a graph illustrating how Trex1 overexpression (OE) enhances IL10 expression in macrophages.

[0052] Figure 3L For the detection of the transcription inhibitor actinomycin D (10) by qPCR μ A non-limiting embodiment of a graph showing TREX1 levels in macrophages treated with TY1 (g / ml) demonstrates that TY1 does not affect the stability of existing TREX1 mRNA, as indicated by similar decay rates.

[0053] Figure 3M A non-limiting embodiment of a graph showing Trex1 levels in mouse bone marrow-derived macrophages as measured by qPCR, demonstrating a dose-dependent upregulation of Trex1 with increasing TY1 treatment concentration.

[0054] Figure 3N A non-limiting implementation of a bar chart to show the increased TREX1 protein levels in mouse mononuclear cell lines by TY1.

[0055] Figure 3O A non-limiting embodiment is described to demonstrate that TY1 increases TREX1 protein expression in a mouse mononuclear cell line.

[0056] Figure 3P This is a non-limiting embodiment showing a bar chart of the results of a comet experiment in cells pre-incubated with TY1.

[0057] Figure 3Q As a non-limiting embodiment showing the results of the comet experiment, immunofluorescence images show that cells pre-incubated with TY1 are resistant to serum starvation-induced DNA damage.

[0058] Figure 4A This is a non-limiting implementation of a study design diagram illustrating the administration of TY1 in a rat model of acute myocardial infarction. Rats underwent ischemia-reperfusion injury (45 minutes of ischemia) followed by intravenous injection of TY1. Forty-eight hours post-injury, animals receiving TY1 had lower levels of circulating cardiac troponin.

[0059] Figure 4B This is a non-limiting embodiment of a graph showing circulating cardiac troponin (cTnl) levels in rats 48 hours after intravenous injection of TY1, a TY1 randomized control, or a solvent following ischemia-reperfusion injury (45 minutes of ischemia).

[0060] Figure 4C This is a non-limiting embodiment of a graph showing the infarct quality in rats 48 hours after intravenous injection of TY1, a TY1 randomized control, or a solvent following ischemia-reperfusion injury (45 minutes of ischemia).

[0061] Figure 4D This is a non-limiting embodiment of a graph showing infarction in rats 48 hours after intravenous injection of TY1, a TY1 randomized control, or a solvent following ischemia-reperfusion injury (45 minutes of ischemia).

[0062] Figure 4E This is a non-limiting embodiment showing immunofluorescence images of left ventricular sections stained with DAPI, CD68, and Trex1 from a MI animal. Scale bar: 100 μ m.

[0063] Figure 4FA non-limiting embodiment of a graph showing the level of CD68 (macrophage marker) in immunofluorescence images of left ventricular sections from MI animals, indicating a comparable degree of macrophage infiltration.

[0064] Figure 4G A non-limiting embodiment of a graph showing the level of Trex1 in immunofluorescence images of left ventricular sections from MI animals, demonstrating similar tissue Trex1 levels across all groups.

[0065] Figure 4H A non-limiting embodiment of a graph showing Trex1 levels in macrophages (CD68+ cells) in a heart with MI treated with TY1 and Scr or solvent.

[0066] Figure 4I This is a non-limiting embodiment showing a graph of phosphorylated H2AX (pH2AX), a DNA damage marker, in myocardial tissue after MI in animals treated with TY1 compared to the solvent group and the disordered group (scale bar: 1 mm).

[0067] Figure 4J This is a non-limiting embodiment of a graph showing the levels of phosphorylated H2AX (pH2AX), a DNA damage marker, in myocardial tissue after MI in animals treated with TY1 compared to the solvent group and the disordered group.

[0068] Figure 4K This is a non-limiting embodiment showing a bar chart of the reduction in infarct area in animals that received TY1 forty-eight hours after injury.

[0069] Figure 4L One non-limiting embodiment is shown as a bar chart illustrating lower levels of circulating cardiac troponin (cTNI) in animals receiving TY1 forty-eight hours after injury.

[0070] Figure 4M This is a non-limiting embodiment of a graph measuring TREX1 protein levels in left ventricular tissue of animals receiving TY1 and in either a disordered or control group using Western blotting, showing an increase in TREX1. The graph on the lower panel is an embodiment of Western blotting.

[0071] Figure 4N This is a non-limiting embodiment showing immunofluorescence images of lower levels of genotoxic stress in TY1-treated animals compared to the solvent group and the disordered group, as measured by phosphorylated H2AX (pH2AX, scale bar: 1 mm) of the DNA damage marker.

[0072] Figure 4OThis is a non-limiting embodiment of a bar chart showing lower levels of genotoxic stress in TY1-treated animals as measured by the DNA damage marker phosphorylated H2AX (pH2AX) compared to the solvent group and the disordered group.

[0073] Figure 4P This is a non-limiting implementation of a design schematic for a long-term follow-up study of myocardial infarction animals receiving a single dose of TY1, Scr, or solvent.

[0074] Figure 4Q A non-limiting embodiment of a bar chart of ejection fraction (EF) percentage shows that rats receiving TY1 retained their ejection fraction and exhibited enhanced left ventricular function.

[0075] Figure 4R A non-limiting implementation of a bar chart of the percentage of shortened fraction (FS) shows that rats receiving TY1 retained their shortened fraction and exhibited enhanced left ventricular function.

[0076] Figure 4S A non-limiting embodiment of the end-systolic volume (LVIDs) histogram shows that rats receiving TY1 retain their end-systolic volume and exhibit reduced cardiac remodeling.

[0077] Figure 4T A non-limiting implementation of a bar chart of diastolic volume (LVID d) shows that rats receiving TY1 retained end-systolic volume and exhibited reduced cardiac remodeling.

[0078] Figure 4U A non-limiting embodiment of a heart slice image shows reduced myocardial scarring in rats that received TY1.

[0079] Figure 4V A non-limiting embodiment of the bar chart showing the percentage of fibrosis demonstrates reduced myocardial scarring in rats receiving TY1.

[0080] Figure 4W This is a non-limiting implementation of a study design for administering TY1 in a porcine acute myocardial infarction model. Pigs were subjected to ischemia-reperfusion injury (90 minutes of ischemia), followed by intravenous infusion of TY1, with a TY1 randomized control.

[0081] Figure 4X This is a non-limiting embodiment of a graph showing that, forty-eight hours after injury, pigs treated with TY1 had smaller infarct areas compared to pigs treated with a disordered control and solvent.

[0082] Figure 4YIn a non-limiting embodiment illustrating images of the infarcted area in pigs, it is shown that, forty-eight hours after injury, pigs treated with TY1 had a smaller infarcted area compared to pigs treated with disordered tyrosine and solvent.

[0083] Figure 4Z This is a non-limiting embodiment of an experimental design schematic for a chronic intravenous (postocular) administration toxicity study.

[0084] Figure 4AA This is a non-limiting implementation of a graph showing the weekly weight change trend of animals treated with TY1 at week 4.

[0085] Figure 4BB This is a non-limiting implementation of a bar chart showing the percentage distribution of whole blood cell counts (CBCs) in animals at week 4.

[0086] Figure 4CC This is a non-limiting implementation showing a bar chart of the animal's organ mass / body weight percentage at week 4.

[0087] Figure 4DD This is a non-limiting implementation of a blood biochemical index test table for animals at week 4.

[0088] Figure 4EE A non-limiting embodiment of immunofluorescence images of the left ventricle of a MI model animal after staining with DAPI, CD68, and TREX1 (scale bar: 100). μ m).

[0089] Figure 4FF To illustrate a non-limiting embodiment of a graph measuring CD68, showing similar levels of macrophage infiltration.

[0090] Figure 4GG This is a non-limiting embodiment that shows a graph demonstrating that TREX1 expression in macrophages of TY1-treated animals is also enriched compared to the solvent control group or the disordered control group.

[0091] Figure 5A This is a non-limiting implementation of an experimental design illustrating the depletion of rat macrophages by daily intravenous injection of clophosphate prior to inducing myocardial infarction. Animals were given TY1, randomized, or control treatments 20 minutes after reperfusion.

[0092] Figure 5B This is a non-limiting embodiment that shows images of infarct sites in animals after macrophage depletion (chlorophosphonate group) or non-depletion (solvent group) followed by administration of TY1 or randomized (control) before inducing myocardial infarction.

[0093] Figure 5C This is a non-limiting embodiment that illustrates images of scar size in animals with functional macrophages and non-functional macrophages (comparing the solvent group and the disordered group).

[0094] Figure 5D Macrophages (3 × 10⁻⁶) of MI rats were transfected with TY1, disordered, solvent, or Trex1 activation plasmids via tail vein infusion. 6 A non-limiting embodiment of an experimental design (cells / animals).

[0095] Figure 5E To illustrate an image of the infarct site in MI animals, a non-limiting embodiment shows that animals given macrophages overexpressing TY1 or Trex1 have significantly smaller scar sizes compared to animals given macrophages transfected with disordered or solvent-based macrophages.

[0096] Figure 5F This is a non-limiting embodiment that illustrates a graph showing the infarct quality of animals given macrophages overexpressing TY1 or Trex1 versus animals given macrophages transfected with disordered or solvent-based macrophages.

[0097] Figure 5G Macrophages (3 × 10⁻⁶) of MI rats were transfected with TY1, disordered, solvent, or TREX1 activation plasmids via tail vein infusion. 6 A non-limiting embodiment of an experimental design (cells / animals).

[0098] Figure 5H To illustrate a non-limiting embodiment of images of infarct sites in MI animals, it is shown that animals given macrophages overexpressing TY1 or TREX1 had significantly smaller scar sizes compared to animals given macrophages transfected with disordered or solvent-based macrophages.

[0099] Figure 5I A non-limiting embodiment of the bar chart showing the percentage of infarction demonstrates that animals given macrophages overexpressing TY1 or TREX1 had significantly smaller scar sizes compared to animals given macrophages transfected with disordered or solvent-based macrophages.

[0100] Figure 6 This invention represents a non-limiting implementation of a graphical summary of TY1, based on naturally occurring small Y RNAs. This is a novel chemical entity that influences innate immune and DNA damage pathways in macrophages by binding to TREX1 (a key regulator of genotoxic stress). In vivo, TY1 alleviates ischemia / reperfusion-induced cardiac injury in myocardial infarction.

[0101] Figure 7AThis is a non-limiting embodiment illustrating a schematic diagram of a TY1 pharmacodynamic study.

[0102] Figure 7B This is a non-limiting implementation that displays a graph of TREX1 levels in peripheral blood mononuclear cells isolated at different time points after animal feeding.

[0103] Figure 8 This is a non-limiting implementation that illustrates a schematic diagram of the TY1 mechanism of action model. Detailed Implementation

[0104] TY1, a synthetic ncRNA, is inspired by naturally occurring human small Y RNA, which is abundant in EVs derived from cardiac stromal / progenitor cells with immunomodulatory properties. TY1 interacts with the messenger RNA (mRNA) of Trex1, a DNA damage repair enzyme and a rapidly degrading exonuclease of cytoplasmic DNA. By binding to the trex1 5' UTR, TY1 (rather than the disordered control RNA) stabilizes Trex1 mRNA levels, thereby increasing Il10 expression in macrophages. Intravenous injection of TY1 has a cardioprotective effect in rat and pig models of myocardial infarction (MI), an effect that can be eliminated by pre-depletion of macrophages and can be mimicked by adoptive transfer of macrophages treated with TY1 or Trex1. Therefore, this application provides non-limiting embodiments of an agent that has disease-modifying biological activity by pharmacologically upregulating TREX1 in macrophages.

[0105] This application provides a method for treating diseases associated with aging, atrophy, inflammation, and / or fibrosis by enhancing the expression of Trex1 in subject cells, such as macrophages. In some embodiments, Trex1 is human Trex1. In some embodiments, Trex1 refers to the gene associated with Gene ID 11277. In some embodiments, enhanced expression of Trex1 in macrophages (e.g., by stabilizing Trex1 mRNA or overexpressing Trex1) can alleviate genotoxic stress and confer cardioprotection.

[0106] definition As used herein, the terms "nucleic acid" or "oligonucleotide" refer to a molecule containing multiple nucleotides (e.g., a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and an exchangeable organic base, wherein the exchangeable organic base is a substituted pyrimidine (e.g., cytosine (C), thymine (T), or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). The term includes polynucleotides (i.e., polynucleotides minus a phosphate group) and any other molecules containing an organic base. Polymers of purines and pyrimidines. Purines and pyrimidines include, but are not limited to, adenine, cytosine, guanine, thymine, hypoxanthine nucleoside, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleoside bases, substituted and unsubstituted aromatic residues. Nucleic acids may include any other suitable modifications. Therefore, the term nucleic acid also encompasses, for example, nucleic acids having substitutions or modifications in their bases and / or sugars.

[0107] The polypeptide or nucleic acid molecules of this application may share a degree of sequence similarity or identity with reference molecules (e.g., reference polypeptides or reference polynucleotides), such as molecules described in the art (e.g., engineered or designed molecules or wild-type molecules). The term "identity" as known in the art refers to the relationship between the sequences of two or more polypeptides or polynucleotides determined by comparing sequences. In the art, identity also means the degree of sequence correlation between them, determined by the number of matches between two or more strings of amino acid residues or nucleic acid residues. Identity is measured as the percentage of identity matches between the smaller of two or more sequences with vacancy alignments (if any), solved by a specific mathematical model or computer program (e.g., an "algorithm"). The identity of related peptides can be readily calculated by known methods. When applied to polypeptide or polynucleotide sequences, "%identity" is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical to residues in the amino acid sequence or nucleic acid sequence of the second sequence after sequence alignment and, where necessary, the introduction of vacancy to achieve the maximum percentage identity. Any suitable method and computer program for alignment can be used. It should be understood that identity depends on the calculation of the percentage of identity, but may differ in value due to gaps and penalties introduced in the calculation. Typically, a variant of a particular polynucleotide or polypeptide is determined to have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity with a particular reference polynucleotide or polypeptide, determined by sequence alignment procedures and parameters described in this application and known to those skilled in the art. Tools for such alignment include BLAST suites (Stephen F. Altschul et al. (1997), “Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs”. Nucleic Acids Res. 25:3389-3402). Another popular local alignment technique is based on the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981) “Identification of common molecular subsequences.” J. Mol. Biol. 147: 195-197).One general global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch. CD (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins." J. Mol. Biol. 48:443-453). Recently, a Fast Optimized Global Sequence Alignment Algorithm (FOGSAA) has been developed, which is claimed to generate global alignments of nucleotide and protein sequences faster than other optimized global alignment algorithms, including the Needleman-Wunsch algorithm. Other tools are specifically described in the following definition of "identity" in this application.

[0108] The term "identity" refers to the overall correlation between polymer molecules, such as between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. For example, the percentage of identity between two polynucleotide sequences can be calculated by aligning the two sequences for optimized comparison purposes (e.g., to optimize alignment, vacancies can be introduced in one or both of the first and second nucleic acid sequences, and dissimilar sequences can be ignored for comparison purposes). In some embodiments, the length of the alignment sequence for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. Nucleotides at the corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at said position. Taking into account the number of vacancies introduced for optimized alignment and the length of each vacancies, the percentage of identity between two sequences is a function of the number of identical positions shared by the sequences. Suitable mathematical algorithms can be used to perform sequence comparisons and determine the percentage of identity between two sequences. For example, the percentage of identity between two nucleic acid sequences can be determined using methods described, for example, in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects. Smith, DW, ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference.For example, the percentage of identity between two nucleic acid sequences can be determined using the Meyers-Miller algorithm (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM 120 weight residue table, a vacancy length penalty of 12 points, and a vacancy penalty of 4 points. Alternatively, the percentage of identity between two nucleic acid sequences can be determined using the GAP program of the GCG software package, using the NWSgapdna.CMP matrix. Methods commonly used to determine the percentage of identity between sequences include, but are not limited to, the method disclosed in Carillo, H. and Lipman, D., SIAM J Applied Math., 48:1073 (1988); which is incorporated herein by reference. The techniques used to determine identity are encoded in publicly available computer programs. Exemplary computer software for determining homology between two sequences includes, but is not limited to, the GCG package (Deverux, J. et al., Nucleic Acids Research, 12(1), 387(1984)), BLASTP, BLASTN, and FASTA Altschul (SF et al., J. Biol., 215, 403(1990)).

[0109] The term “Watson-Crick base pairing” or “base pairing” refers to the formation of hydrogen bonds between specific nucleotide base pairs (“complementary base pairs”). For example, two hydrogen bonds are formed between adenine (A) and uracil (U), and three hydrogen bonds are formed between guanine (G) and cytosine (C). A method for assessing the bond strength between two polynucleotides is by quantifying the percentage of bonds formed between the guanine and cytosine bases of the two polynucleotides (“GC content”). In some embodiments, the GC content of the bonds between the two nucleic acids of a multimer molecule (e.g., an mRNA multimer molecule) is at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the GC content of the bonds between the two nucleic acids of a multimer molecule (e.g., an mRNA multimer molecule) is from 10% to 70%, from about 20% to about 60%, or from about 30% to about 60%. The formation of a nucleic acid duplex through the bonds of complementary base pairs can also be referred to as “hybridization”. Typically, two nucleic acids sharing a complementary region can hybridize (e.g., via base pairing) under suitable conditions to form a double-stranded structure. The size of the complementary region can vary. In some embodiments, the length of the complementary region ranges from about 2 base pairs to about 100 base pairs. In some embodiments, the length of the complementary region ranges from about 5 base pairs to about 75 base pairs. In some embodiments, the length of the complementary region ranges from about 10 base pairs to about 50 base pairs. In some embodiments, the length of the complementary region ranges from about 20 base pairs to about 30 base pairs.

[0110] As used in this application, the term "isolated" refers to isolated biomolecules, such as nucleic acids, and has the same conventional and common meaning to those skilled in the art as the content of this application. Isolated biomolecules, such as isolated nucleic acids, are typically in unnatural environments, or in environments in which the biomolecules would not otherwise exist without human intervention. In some embodiments, the isolated biomolecules are not located within cells or organisms.

[0111] The term "micelle" as used in this application has the same conventional and common meaning to those skilled in the art as the content of this application. Casein micelles can include one or more casein phosphopeptides (e.g., α -S1 casein, α -S2 casein, β -Casein, and κ - Colloidal particles of aggregates of one or more, two or more, three or more, or all four types of casein.

[0112] As used in this application, the term "subject" refers to any vertebrate, including both mammals and non-mammals. Subjects may include primates, including humans, and non-primate mammals such as rodents, livestock, or wild animals. Non-primate mammals may include mice, rats, hamsters, rabbits, dogs, foxes, wolves, cats, horses, cattle, pigs, sheep, goats, camels, deer, buffalo, bison, etc. Non-mammals may include birds (e.g., chickens, ostriches, emus, pigeons), reptiles (e.g., snakes, lizards, turtles), amphibians (e.g., frogs, salamanders), fish (e.g., salmon, cod, pufferfish, tuna), etc. The terms "individual," "patient," and "subject" are used interchangeably in this application.

[0113] As used in this application, "application" may include any suitable route of administration of the therapeutic agent or composition disclosed in this application. Suitable routes of administration include, but are not limited to, oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, skin, injection, or local application. Application may be local or systemic.

[0114] As used in this application, "treatment" includes the cure, improvement, relief, reduction of severity, prevention, slowing of progression, and / or delay of the onset of a disease, condition, and / or its symptoms.

[0115] If one or more signs or symptoms of the condition described in this application change in a beneficial manner, other clinically accepted symptoms improve or are even relieved, or a desired response is induced after treatment according to the methods described in this application, for example, at least 2%, 3%, 4%, 5%, 10%, or more, then the treatment may be considered “effective” or “therapeutically effective” as used in this application. For example, efficacy can be assessed by measuring markers, indicators, symptoms, and / or incidence of the condition treated according to the methods described in this application, or any other suitable measurable parameter (e.g., exercise endurance). Efficacy can also be measured by the absence of deterioration or the need for medical intervention (e.g., cessation of disease progression) in an individual as assessed during hospitalization. Treatment includes any treatment of a disease or condition in an individual or animal (some non-limiting embodiments include humans or animals) and includes: (1) suppressing the disease or condition, for example, preventing the worsening of symptoms (e.g., pain or inflammation); or (2) reducing the severity of the disease or condition, for example, causing symptom resolution. An effective amount for treating a disease or condition means an amount sufficient, when administered to a subject in need, to produce an effective therapeutic effect on the disease or condition as defined herein. The efficacy of an agent can be determined by assessing bodily indicators of the condition or expected response (e.g., muscle function, mass, or volume). Those skilled in the art can monitor the efficacy of administration and / or treatment by measuring any one or any combination of these parameters.

[0116] As used herein, the term "effective amount" or "therapeutic effective amount" refers to the amount of composition or agent required to alleviate at least one or more symptoms of a disease or condition, and relates to a sufficient amount of therapeutic composition to provide the desired effect. The term "effective amount" or "therapeutic effective amount" may refer to an amount of composition or therapeutic agent sufficient to provide, in particular, anti-inflammatory and / or cardioprotective effects when administered to a typical subject. In various contexts, the effective amount as used herein may include an amount sufficient to delay the development of symptoms of a disease or condition, alter the course of symptoms of a disease or condition (e.g., but not limited to, slowing the progression of symptoms of a disease or condition), or reverse the symptoms of a disease or condition. In some embodiments, the therapeutic effective amount is administered as one or more doses of a therapeutic agent. In some embodiments, the therapeutic effective amount is administered in a single dose or in multiple doses over a period of time.

[0117] As used in this application, the phrases “physiologically compatible” and “pharmaceutically acceptable” are used interchangeably to refer to compounds, materials, compositions, and / or dosage forms that, to the extent of reasonable medical judgment, are suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0118] Definitions of common terms in cell biology and molecular biology can be found in: *Merck Manual of Diagnosis and Therapy*, 19th edition, published by Merck Research Laboratories, 2006 (ISBN 0-91 1910-19-0); *The Encyclopedia of Molecular Biology*, edited by Robert S. Porter et al., published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); *Genes X*, published by Jones & Artlett Publishing, 2009 (ISBN-10: 0763766321); *Molecular Biology and Biotechnology: A Comprehensive Desk Reference*, edited by Kendrew et al., published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); and *Current Protocols in Protein Sciences*, 2009, Wiley. Intersciences, Coligan et al. (editors).

[0119] Unless the context clearly indicates otherwise, the singular terms “an,” “a,” and “the” include plural indicators. Similarly, unless the context clearly indicates otherwise, the word “or” is intended to include “and.” “For example” is used in this application to indicate a non-limiting embodiment. Therefore, the abbreviation “for example (eg)” is synonymous with the term “for example.” The term “about,” as used in this application, for example, defines a value and range of molecular weight as meaning that the indicated value and / or range limit can vary within ±20%, for example, within ±10%, including within ±5%. When “about” is used before a number, the number itself is included. For example, “about 5” provides explicit support for “5.” Numbers provided in ranges include overlapping ranges and integers between them; for example, ranges of 1 to 4 and 5 to 7 include, for example, 1 to 7, 1 to 6, 1 to 5, 2 to 5, 2 to 7, 4 to 7, 1, 2, 3, 4, 5, 6, and 7.

[0120] method This application provides a method for treating a subject in need using a reagent that increases the level of the Trex1 gene product (also referred to herein as a "treatment method"). As used herein, "reagent" means any molecule, compound, or construct suitable for this method. In some embodiments, the reagent is a protein, nucleic acid, small molecule compound, organic compound, inorganic compound, lipid, carbohydrate, polysaccharide, etc. In some embodiments, the method of this disclosure includes enhancing Trex1 expression in a subject (e.g., in the subject's macrophages) without using isolated RNA (e.g., isolated RNA having at least one chemically modified nucleotide) comprising a nucleotide sequence having at least 95% identity with SEQ ID NO: 3. In some embodiments, the method includes enhancing Trex1 expression in a subject without using isolated RNA comprising a nucleotide sequence having about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 3 (or having at least any of the above values, or being within a range covering the above values). In some embodiments, the methods of this disclosure include enhancing Trex1 expression in a subject (e.g., macrophages of the subject) without using TY1. As used herein, "TY1" refers to a nucleic acid consisting of the nucleotide sequence CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), wherein the nucleic acid is RNA, and wherein the nucleotide sequence is locked nucleic acid (LNA) at positions 1, 3, 5, 20, 22, and 24. In some embodiments, a method of treating a condition associated with aging, atrophy, inflammation, and / or fibrosis includes administering an effective amount of an agent that enhances the expression of the Trex1 gene product to a subject requiring treatment for a condition associated with aging, atrophy, inflammation, and / or fibrosis, wherein the agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the method includes enhancing Trex1 expression in a subject without using isolated RNA comprising a nucleotide sequence having about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 3 (or having at least any of the above values, or being within a range covering the above values). Unless otherwise stated, the terms “Trex1” and “Trex1 gene product” as used herein are interchangeable.

[0121] In any of the methods described in this application, in some embodiments, the agent for enhancing Trex1 gene product expression does not include NT4 (SEQ ID NO: 2) or EV-YF1 (SEQ ID NO: 1). In some embodiments, the agent is not EV-YF1-U16. In some embodiments, the agent is not an extracellular vesicle (e.g., exosome) derived from cardioglobulus-derived cells containing NT4 (SEQ ID NO: 2) or EV-YF1 (SEQ ID NO: 1). In some embodiments, the agent is not Y RNA or fragments thereof contained in CDC-EV.

[0122] The reagent can be used with any suitable option to enhance Trex1 expression. In some embodiments, the enhancement of Trex1 gene product expression is associated with enhanced Trex1 gene product activity (e.g., enhanced TREX1 protein exonuclease activity). In some embodiments, the reagent increases the rate of Trex1 transcription and / or RNA processing. In some embodiments, the reagent increases the rate at which the Trex1 gene product is transported to the cytoplasm and translated into protein. In some embodiments, the Trex1 protein folds more rapidly. In some embodiments, the degradation of the Trex1 protein is blocked. In some embodiments, modifications to the Trex1 protein prevent its degradation. In some embodiments, the reagent induces changes in gene expression and / or epigenetic changes in macrophages that increase the Trex1 gene product. In some implementations, the reagent independently increases the transcription of Trex1 by at least about 1.5, 2, 4, 6, 8, 10, 15, 20, 30, 50, 100, 200, 300, 400, 500, 1000, or more times, or by a number of times within the range defined by any two of the foregoing values, compared to a suitable control (e.g., macrophages that have not yet been contacted with nucleic acids).

[0123] In some embodiments, the reagent is an isolated nucleic acid (e.g., isolated RNA) that does not include a nucleotide sequence having at least 95% identity with CGICCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the reagent comprises a nucleic acid that anneals to a first sequence in the Trex1 mRNA 5' UTR, the first sequence being different from a second sequence in the Trex1 mRNA 5' UTR, the second sequence annealing to a nucleic acid including the nucleotide sequence of CGICCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). In some embodiments, the nucleic acid does not include isolated RNA having a nucleotide sequence having about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 3 (or having at least any of the above values, or within a range covering the above values). The nucleic acid of this application can be single-stranded or double-stranded (e.g., an RNA / DNA hybrid). In some embodiments, the nucleic acid is single-stranded. In some embodiments, the isolated nucleic acid of this application comprises one or more chemically modified nucleotides, for example, nucleotides having a modified backbone. Typically, the chemical modification is one that substantially preserves or enhances the therapeutic efficacy of the nucleic acid. Any suitable number of nucleotides of the nucleic acid can be chemically modified.

[0124] In some embodiments, the isolated nucleic acid may include any suitable chemical modification. In some embodiments, the chemical modification is a backbone modification, such as modification of the sugar / phosphate backbone. In some embodiments, the chemical modification is a backbone sugar modification. In some embodiments, the chemically modified nucleotide includes LNA. In some embodiments, the chemical modification includes introducing a thiophosphate group as a linker between nucleotides. Suitable backbone modifications of the chemically modified nucleotide include, but are not limited to, thiophosphates, triphosphates, methylphosphonates, short-chain alkyl or cycloalkyl sugar bonds, or short-chain heteroatom or heterocyclic sugar bonds. In some embodiments, the chemical modification is a base modification.

[0125] The nucleic acid described in this application can be prepared using any suitable option. Suitable options include, but are not limited to, chemical synthesis, enzymatic production, and / or biological production. In some embodiments, the nucleic acid is prepared using chemical synthesis. Any suitable option for chemically synthesizing nucleic acids can be used. Suitable options include, but are not limited to, phosphodiester, phosphotriester, phosphoramide, phosphodiester-triester, and solid-phase synthesis methods. In some embodiments, the preparation of the nucleic acid includes in vitro transcription. In some embodiments, the nucleic acid is prepared using recombinant DNA technology. In some embodiments, the nucleic acid is prepared by chemically modifying an unmodified nucleic acid having the nucleotide sequence of interest.

[0126] In some embodiments, the reagent increases the expression of Trex1 mRNA in cells. In some embodiments, the reagent stabilizes Trex1 mRNA or prolongs the half-life of Trex1 mRNA, for example, in cells, such as macrophages. In some embodiments, the reagent increases the amount of Trex1 mRNA expressed in cells. As used herein, "amount of expressed mRNA" means the net amount of mRNA expressed within a defined time period (e.g., the amount produced minus the amount degraded or removed). In some embodiments, the reagent increases the amount of Trex1 mRNA expressed in cells without altering or substantially altering the stability of the Trex1 mRNA's half-life. In some embodiments, the reagent increases the transcription of Trex1 mRNA in cells. In some implementations, Trex1 mRNA levels in cells are increased by at least 1.1-fold, 1.2-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.1-fold, 2.2-fold, 2.3-fold, 2.4-fold, 2.5-fold, 2.6-fold, 2.7-fold, 2.8-fold, or approximately ...2-fold compared to a suitable reference point (e. 0.9 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 20 times, 25 times, 30 times, 35 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 150 times, 200 times, 300 times, 400 times, 500 times, 750 times, 1000 times, or more, or optionally, Trex1 mRNA increases by a number of times within any two of the foregoing values ​​(e.g., 1.1 times to 1000 times, 1.5 times to 100 times, 2 times to 20 times, 5 times to 15 times, 1.2 times to 500 times, etc.).

[0127] In some implementations, Trex1 mRNA comprises the following nucleotide sequence (5' UTR underlined) (SEQ ID NO: 5): 1 gtcattgctt tgggctgggg ccatgggaag aaaccattgt gtggcaggga aggaggtggc 61 tcttggccca ggcctaaacc aggaaagcct gggaaactgg gacccacagg tgggcatgaa 121 agggccgcag caggggctcc cagcagtgtg taagaccggg agctggtctg gcaccactgc 181 cctggtcctt ccagctgcct gtcactggta tgatggcccc ggtgcattgt gccaccagca 241 ggccacagct gtggatcttg gaaggcctct ggggtccccc gggagcaggg gagtgggtgt 301 gggggggaac ggatggtggt gagagggaca gaccaggcag gccctgcccc cggggccc at 361 gcagaccctc atctttttcg acatggaggc cactggcttg cccttctccc agcccaaggt 421 cacggagctg tgcctgctgg ctgtccacag atgtgccctg gagagccccc ccacctctca 481 ggggccacct cccacagttc ctccaccacc gcgtgtggta gacaagctct ccctgtgtgt 541 ggctccgggg aaggcctgca gccctgcagc cagcgagatc acaggtctga gcacagctgt 601 gctggcagcg catgggcgtc aatgttttga tgacaacctg gccaacctgc tcctagcctt 661 cctgcggcgc cagccacagc cctggtgcct ggtggcacac aatggtgacc gctacgactt 721 ccccctgctc caagcagagc tggctatgct gggcctcacc agtgctctgg atggtgcctt 781 ctgtgtggat agcatcactg cgctgaaggc cctggagcga gcaagcagcc cctcagaaca 841 cggcccaagg aagagctata gcctaggcag catctacact cgcctgtatg ggcagtcccc 901 tccagactcg cacacggctg agggtgatgt cctggccctg ctcagcatct gtcagtggag 961 accacaggcc ctgctgcggt gggtggatgc tcacgccagg cctttcggca ccatcaggcc 1021 catgtatggg gtcacagcct ctgctaggac caagccaaga ccatctgctgtcacaaccac 1081 tgcacacctg gccacaacca ggaacactag tcccagcctt ggagagagcaggggtaccaa 1141 ggatcttcct ccagtgaagg accctggagc cctatccagg gaggggctgctggccccact 1201 gggtctgctg gccatcctga ccttggcagt agccacactg tatggactatccctggccac 1261 acctggggag taggccaaga aggaaaatct gacgaataaa gacccccgct gccccata In some embodiments, Trex1 mRNA comprises the following nucleotide sequence (SEQ ID NO: 6) (5’ UTR underlined): 1 acttcccgcc actgctgcca gcgagagccg cgggagtg tgcagccgag tcactactgc 61 ctgcctgcct gcctgctacg gctcagcagc aggtacgtac ccaacc atgg gctcgcaggc 121 cctgcccccg gggcccatgc agaccctcat ctttttcgac atggaggcca ctggcttgcc 181 cttctcccag cccaaggtca cggagctgtg cctgctggct gtccacagat gtgccctgga 241 gagccccccc acctctcagg ggccacctcc cacagttcct ccaccaccgc gtgtggtaga 301 caagctctcc ctgtgtgtgg ctccggggaa ggcctgcagc cctgcagcca gcgagatcac 361 aggtctgagc acagctgtgc tggcagcgca tgggcgtcaa tgttttgatg acaacctggc 421 caacctgctc ctagccttcc tgcggcgcca gccacagccc tggtgcctgg tggcacacaa 481 tggtgaccgc tacgacttcc ccctgctcca agcagagctg gctatgctgg gcctcaccag 541 tgctctggat ggtgccttct gtgtggatag catcactgcg ctgaaggccc tggagcgagc 601 aagcagcccc tcagaacacg gcccaaggaa gagctatagc ctaggcagca tctacactcg 661 cctgtatggg cagtcccctc cagactcgca cacggctgag ggtgatgtcc tggccctgct 721 cagcatctgt cagtggagac cacaggccct gctgcggtgg gtggatgctc acgccaggcc 781 tttcggcacc atcaggccca tgtatggggt cacagcctct gctaggacca agccaagacc 841 atctgctgtc acaaccactg cacacctggc cacaaccagg aacactagtc ccagccttgg 901 agagagcagg ggtaccaagg atcttcctcc agtgaaggac cctggagccc tatccaggga 961 ggggctgctg gccccactgg gtctgctggc catcctgacc ttggcagtag ccacactgta 1021 tggactatcc ctggccacac ctggggagta ggccaagaag gaaaatctgacgaataaaga 1081 cccccgctgc cccata In some embodiments, the reagent comprises an isolated nucleic acid encoding a Trex1 gene product (e.g., DNA encoding Trex1 mRNA, or RNA encoding TREX1 protein, or DNA encoding TREX1 protein via mRNA). In some embodiments, the nucleic acid comprises a DNA sequence encoding Trex1 mRNA (e.g., SEQ ID NO: 5 or 6). In some embodiments, the Trex1 gene product encoded by the isolated nucleic acid comprises a truncated TREX1 protein (or a catalytically active truncated form thereof) having exonuclease activity. In some embodiments, the catalytically active truncated form of the TREX1 protein has 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the exonuclease activity of the native TREX1 protein (e.g., the untruncated TREX1 protein), or an approximation of these values, or at least these values. In some embodiments, the Trex1 gene product is or includes the TREX1 protein, isotype a associated with UNIPROT ID Q9NSU2-1 (SEQ ID NO: 7), or a variant thereof having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity and possessing exonuclease activity. In some embodiments, the Trex1 gene product is or includes the TREX1 protein, isotype b associated with UNIPROT ID Q9NSU2-3 (SEQ ID NO: 8), or a variant thereof having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity and possessing exonuclease activity. In some embodiments, the Trex1 gene product is or includes the TREX1 protein, isotype c associated with UNIPROT ID Q9NSU2-2 (SEQ ID NO: 9), or a variant thereof having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity and exonuclease activity. In some embodiments, the Trex1 protein gene product includes a truncated TREX1 protein, wherein the truncated form includes the exonuclease domain of TREX1. In some embodiments, the truncated form is a C-terminal truncated version of the native TREX1 protein retaining at least the catalytic domain (e.g., as shown in any one of SEQ ID NO: 7-9).In some embodiments, the Trex1 gene product is or includes a truncated natural TREX1 protein, such as isotype a shown in SEQ ID NO: 10, or a variant having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity and possessing exonuclease activity. In some embodiments, the Trex1 gene product is or includes a truncated natural TREX1 protein, such as isotype b shown in SEQ ID NO: 11, or a variant having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity and possessing exonuclease activity. In some embodiments, the Trex1 gene product is or includes isoform c of the truncated natural TREX1 protein (such as SEQ ID NO: 12), or a variant having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity and exonuclease activity. In some embodiments, the TREX1 protein is a homodimer (e.g., composed of the same isoform). In some embodiments, the TREX1 protein is a heterodimer (e.g., composed of different isoforms).

[0128] In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) located in the cytoplasm. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) located in the endoplasmic reticulum. In some embodiments, the Trex1 protein is located in the perinuclear region. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) located in the nucleus. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) located in both the nucleus and cytoplasm. In some embodiments, the Trex1 gene product comprises a Trex1 catalytic domain fused to a nuclear localization signal. In some embodiments, the Trex1 gene product comprises a Trex1 catalytic domain fused to a mitochondrial localization signal. In some embodiments, the Trex1 gene product comprises a Trex1 catalytic domain fused to an endoplasmic reticulum localization signal.

[0129] In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) that degrades double-stranded DNA in the nucleus and / or cytoplasm. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) that degrades single-stranded DNA in the nucleus and / or cytoplasm. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) that degrades single-stranded RNA in the nucleus and / or cytoplasm. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) that degrades single-stranded RNA, single-stranded DNA, double-stranded DNA, and DNA / RNA hybrids in the nucleus and / or cytoplasm. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) that degrades mitochondrial DNA. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) that degrades viral single-stranded RNA. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically active truncated form thereof) that degrades viral single-stranded DNA. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically truncated form thereof) that degrades viral double strands. In some embodiments, the Trex1 gene product comprises a TREX1 protein (or a catalytically truncated form thereof) that degrades viral DNA / RNA hybrids.

[0130] In some embodiments, the nucleic acid comprises a vector, such as a viral vector or a plasmid. Any suitable vector (e.g., a viral vector or plasmid) can be used. In some embodiments, the vector is a lentiviral vector. The nucleic acid may include any suitable regulatory element (e.g., a promoter, 5' UTR, 3' UTR, IRES, etc.) to control the expression of a sequence encoding a Trex1 gene product from the nucleic acid. In some embodiments, the nucleic acid includes a promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product (e.g., Trex1 mRNA). In some embodiments, the nucleic acid is configured to express the Trex1 gene product in macrophages (e.g., human macrophages). In some embodiments, the nucleic acid includes a CMV promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product (e.g., Trex1 mRNA). In some embodiments, the nucleic acid includes a macrophage-specific promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product (e.g., Trex1 mRNA). Any suitable macrophage-specific promoter can be used. In some embodiments, the nucleic acid includes a macrophage-specific promoter selected from the Csf1r promoter, LysM promoter, CD68 promoter, or CX3CR1 promoter. In some embodiments, the nucleic acid is a Trex1 activation plasmid, for example, a plasmid comprising a CMV promoter operatively linked to a nucleic acid encoding the Trex1 gene product.

[0131] In some embodiments, the nucleic acid is contained in macrophages (e.g., human macrophages). In some embodiments, the nucleic acid is extrachromosomal DNA (e.g., a plasmid) or a portion thereof within the macrophage. In some embodiments, the nucleic acid is integrated into the genome of the macrophage. In some embodiments, the nucleic acid is constitutively expressed. In some embodiments, the nucleic acid is expressed by an inducible promoter.

[0132] In some embodiments, the reagent is identified using a screening method as described in this application for identifying reagents that upregulate Trex1 expression, protein levels, and / or activity. In some embodiments, the reagent is a small molecule. In some embodiments, the reagent is a biological product. In some embodiments, the reagent is a nucleic acid (e.g., any nucleic acid described in this application). In some embodiments, the reagent directly upregulates Trex1 expression, protein levels, and / or activity. In some embodiments, the reagent indirectly upregulates Trex1 expression, protein levels, and / or activity.

[0133] In some implementations, the reagent increases, at least increases, or approximately increases the expression of Trex1 protein in cells by 1.1-fold, 1.2-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.1-fold, 2.2-fold, 2.3-fold, 2.4-fold, 2.5-fold, 2.6-fold, 2.7-fold, 2.8-fold, 2.9-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 7-fold, or 8-fold compared to a suitable reference point (e.g., protein levels in subjects treated with a control group prior to administering the reagent to the subject). 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 20 times, 25 times, 30 times, 35 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 150 times, 200 times, 300 times, 400 times, 500 times, 750 times, 1000 times, or more, or optionally, the Trex1 protein increases by a number of times within any two of the foregoing values ​​(e.g., 1.1 times to 1000 times, 1.5 times to 100 times, 2 times to 20 times, 5 times to 15 times, 1.2 times to 500 times, etc.).

[0134] In some implementations, the reagent increases, at least increases, or about 1.1-fold, 1.2-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.1-fold, 2.2-fold, 2.3-fold, 2.4-fold, 2.5-fold, 2.6-fold, 2.7-fold, 2.8-fold, 2.9-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 7-fold, 8-fold, or 9-fold of the activity of TREX1 protein (e.g., exonuclease activity) in cells compared to a suitable reference point (e.g., activity in subjects treated with a control group before administering the reagent to the subject). 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 20 times, 25 times, 30 times, 35 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 150 times, 200 times, 300 times, 400 times, 500 times, 750 times, 1000 times, or more, or optionally, TREX1 protein activity (e.g., exonuclease activity) increases by a number of times within the range defined by any two of the foregoing values ​​(e.g., 1.1 times to 1000 times, 1.5 times to 100 times, 2 times to 20 times, 5 times to 15 times, 1.2 times to 500 times, etc.).

[0135] In some embodiments, the method includes administering a macrophage population to a subject, wherein an effective amount of an agent for enhancing Trex1 gene product expression is contained in the macrophage population. In some embodiments, prior to administering the treated macrophages to the subject, the macrophages are treated in vitro with the agent described in this application to enhance Trex1 gene product expression in the macrophages. In some embodiments, the macrophages are genetically modified in vitro to enhance Trex1 gene product expression. In some embodiments, the macrophages administered to the subject are autologous macrophages. In some embodiments, the macrophages administered to the subject are allogeneic macrophages.

[0136] Any suitable amount of macrophages with enhanced Trex1 expression as described in this application (e.g., macrophages genetically modified with a plasmid expressing Trex1) can be administered to the subject to achieve the desired therapeutic effect. In some embodiments, the number of macrophages with enhanced Trex1 expression administered to the subject is, approximately, or at least 1 × 10⁻⁶. 5 2×10 5 5×10 5 1×10 6 2×10 6 5×10 6 1×10 7 2×10 7 5×10 7 1×10 8 2×10 8 5×10 8 1×10 9 2×10 9 5×10 9 1×10 10 One or more cells, or alternatively, the cell number is within the range defined by any two of the aforementioned values ​​(e.g., 1 × 10⁻⁶). 5 Up to 1×10 10 1 cell, 1×10 6 Up to 1×10 9 1 cell, 1×10 7 Up to 1×10 9 1 cell, 2×10 6 Up to 5×10 9 5 × 10 cells 8 Up to 1×10 10 (e.g., individual cells).

[0137] In some embodiments, the nucleic acid comprises a stable Trex1 mRNA (e.g., Trex1 mRNA comprising one or more chemically modified nucleotides of a stable mRNA). In some embodiments, the modification on the nucleotide is selected from LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluorine, 2'-deoxy, 2'-hydroxy, and combinations thereof. In some embodiments, the modification is a lipid or cholesterol modification.

[0138] This application provides a method for treating a condition associated with inflammation and / or fibrosis, comprising: administering to a subject requiring treatment for a condition associated with inflammation and / or fibrosis an effective amount of an agent that reduces DNA damage in inflamed and / or fibrotic tissue or in tissue at risk of inflammation and / or fibrosis, wherein said agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0139] A method for treating diseases associated with aging, tissue aging, or atrophy is also provided. The method may include administering an effective amount of an agent that enhances the expression of the Trex1 gene product to a subject requiring treatment for diseases associated with aging, tissue aging, or atrophy. In some embodiments, the agent used in the method of this application for treating aging, tissue aging, or atrophy is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CGICCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0140] In some embodiments, the method of this application includes administering an effective amount of the reagent intravenously, intramuscularly, intracardiacly, or orally. The reagent or composition can be administered via any suitable route. Administration can be local or systemic. In some embodiments, administration is parenteral. Suitable options for administration include, but are not limited to, intravenous, intramuscular, subcutaneous, intraarterial, intraperitoneal, or oral administration. In some embodiments, the reagent or composition is administered intravenously. In some embodiments, the reagent or composition is administered by infusion.

[0141] Conditions treatable by the treatment methods of this application include, but are not limited to, heart disease and inflammatory conditions. In some embodiments, the conditions include, but are not limited to, muscle diseases, myocardial infarction, heart disease, cardiomyopathy, muscular dystrophy, fibrotic diseases, inflammatory diseases, viral infections, sepsis, or wound healing. In some embodiments, the conditions treated by the treatment methods include, but are not limited to, conditions related to inflammation and / or fibrosis. In some embodiments, according to the treatment methods of this application, the subject treated by administering the reagents of this application needs to treat a condition related to inflammation and / or fibrosis. The conditions related to inflammation and / or fibrosis may include, but are not limited to, inflammation and / or fibrosis of the heart, skeletal muscle, or skin. In some embodiments, the conditions related to inflammation and / or fibrosis include aging. In some embodiments, one or more symptoms of aging-related inflammation and / or fibrosis are treated or reversed by administering the reagents of this application according to the treatment methods of this application. In some embodiments, a subject suffering from accelerated aging (e.g., progeria) is treated by administering the reagents of this application according to the treatment methods of this application. In some embodiments, the condition treated by this treatment method is a symptom and / or sequelae of an infection. In some embodiments, the infection is a viral infection, such as a respiratory viral infection (e.g., COVID-19), or an infection caused by other coronaviruses or other viral pathogens (e.g., influenza, H1N1, hepatitis C, HIV, West Nile virus, Zika virus, etc.).

[0142] In some embodiments, the treatment method includes a method of treating a muscle disease (or muscle symptom) or its symptoms, the method comprising administering a therapeutically effective amount of the reagent of this application (or a composition containing said reagent) to a subject requiring treatment for the muscle disease or its symptoms. The muscle disease may be, but is not limited to, skeletal muscle disease or cardiac muscle disease. In some embodiments, the muscle disease includes muscular dystrophy, such as Duchenne muscular dystrophy. In some embodiments, the subject has muscular dystrophy or is at risk of developing muscular dystrophy. In some embodiments, the subject is genetically predisposed to developing muscular dystrophy, such as Duchenne muscular dystrophy. In some embodiments, the subject has one or more mutations in the dystrophin gene that predispose the subject to developing muscular dystrophy, such as Duchenne muscular dystrophy.

[0143] In some embodiments, the treatment method includes methods for treating skin conditions, such as inflammation and / or fibrosis of the skin (e.g., but not limited to, scleroderma). In some embodiments, the method includes administering a therapeutically effective amount of the agent of this application (or a composition containing said agent) to a subject requiring treatment for inflammation and / or fibrosis of the skin. In some embodiments, the inflammation and / or fibrosis of the skin is scleroderma.

[0144] In some embodiments, the treatment method includes a method of treating heart disease or its symptoms, the method comprising administering a therapeutically effective amount of the reagent of this application (or a composition containing said reagent) to a subject requiring treatment for heart disease or its symptoms. In some embodiments, the subject is a human subject. In some embodiments, the subject is a non-human subject, for example, a non-human mammal.

[0145] A variety of cardiac conditions can be treated using the method described above. In some embodiments, the cardiac conditions include symptoms and / or sequelae of heart failure or myocardial infarction. In some embodiments, the cardiac conditions include hypertrophic cardiomyopathy. In some embodiments, the cardiac conditions include heart failure with preserved ejection fraction (HFpEF).

[0146] In some embodiments, the subject is at risk of developing heart disease. In some embodiments, the subject is at risk of developing one or more heart diseases based on the subject's family history, genetic predisposition, lifestyle, and medical history. In some embodiments, the subject has a mutation in cardiac troponin I, which predisposes the subject to hypertrophic cardiomyopathy (HCM). In some embodiments, the subject has one or more comorbidities of heart disease. In some embodiments, the one or more comorbidities include obesity and hypertension. In some embodiments, the subject has or has been diagnosed with heart disease.

[0147] In some embodiments, the subject exhibits one or more of the following: hypertension, elevated E / e' ratio, cardiac hypertrophy, myocardial fibrosis, obesity, emaciation, decreased endurance, and elevated systemic inflammatory markers. In some embodiments, the subject has hypertension, and administration of a therapeutically effective amount of the reagent (or its composition) lowers the subject's blood pressure. In some embodiments, the subject with hypertension has a resting blood pressure exceeding 130 / 90 mmHg. In some embodiments, the subject with hypertension has a resting blood pressure exceeding 140 / 90 mmHg. In some embodiments, administration of a therapeutically effective amount of the reagent (or its composition) lowers the subject's systolic or diastolic blood pressure. In some embodiments, after administration of a therapeutically effective amount of the reagent (or its composition), the subject's blood pressure (systolic or diastolic) decreases by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30%, or more, or decreases by a percentage within the range defined by any two of the foregoing values. In some embodiments, after administration of a therapeutically effective amount of the reagent (or a combination thereof), the subject's blood pressure (systolic or diastolic) is reduced to a level that is no longer considered to be hypertension.

[0148] In some embodiments, the subject has an elevated E / e' ratio, and administration of a therapeutically effective amount of the reagent (or its composition) reduces the E / e' ratio. In some embodiments, after administration of a therapeutically effective amount of the reagent (or its composition), the subject's E / e' ratio decreases by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more, or decreases by a percentage within the range defined by any two of the foregoing values. In some embodiments, after administration of a therapeutically effective amount of the reagent (or its composition), the subject's E / e' ratio decreases to at least a level considered no longer clinically relevant.

[0149] In some embodiments, the subject suffers from cardiac hypertrophy, and the administration of a therapeutically effective amount of the reagent (or a combination thereof) reduces the cardiac hypertrophy. Any suitable option can be used to measure the cardiac hypertrophy. In some embodiments, echocardiography is used to measure the cardiac hypertrophy. In some embodiments, a subject with cardiac hypertrophy, as measured by echocardiography, has increased end-diastolic interventricular septal thickness (IVSd) and / or end-diastolic left ventricular posterior wall thickness (LVPWd), and the administration of a therapeutically effective amount of the reagent (or a combination thereof) reduces the IVSd and / or LVPWd. In some embodiments, after the administration of a therapeutically effective amount of the reagent (or a combination thereof), the subject's IVSd or LVPWd decreases by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30%, or more, or by a percentage within the range defined by any two of the foregoing values. In some embodiments, after administration of a therapeutically effective amount of the reagent (or a combination thereof), the subject's IVSd or LVPWd decreases to at least a level that is no longer considered hypertrophic.

[0150] In some embodiments, the subject suffers from myocardial fibrosis, and the administration of a therapeutically effective amount of the reagent (or a combination thereof) reduces cardiac fibrosis. As used in this application, "fibrosis" may include any remodeling (e.g., pathological remodeling) of tissue (e.g., myocardium), such as, but not limited to, deposition of fibrotic and / or adipose tissue, replacement of muscle tissue with fibrotic and / or adipose tissue, etc. Cardiac fibrosis is monitored using any suitable means, such as biopsy, ultrasound, or MRI. In some embodiments, the administration of a therapeutically effective amount of the reagent (or a combination thereof) eliminates or delays the progression of myocardial fibrosis.

[0151] In some embodiments, the subject suffers from inflammation and / or fibrosis associated with an autoimmune disease. In some embodiments, the subject suffers from scleroderma or systemic sclerosis.

[0152] In some embodiments, the subject exhibits emaciation or weight loss, and the administration of a therapeutically effective amount of the reagent (or its composition) delays or prevents emaciation. In some embodiments, after administration of a therapeutically effective amount of the reagent (or its composition), the subject exhibits a weight loss of up to about 20%, 15%, 10%, 5%, 3%, or less, or a percentage within the range defined by any two of the foregoing values. In some embodiments, after administration of a therapeutically effective amount of the reagent (or its composition), the subject's weight returns to or substantially remains at the pre-treatment level.

[0153] In some embodiments, the subject exhibits a decline in endurance (e.g., exercise endurance), and the application of a therapeutically effective amount of the reagent (or its composition) delays or prevents this decline. In some embodiments, after application of a therapeutically effective amount of the reagent (or its composition), the subject exhibits an endurance decline of up to about 20%, 15%, 10%, 5%, 3%, or less, or a percentage within the range defined by any two of the foregoing values. In some embodiments, after application of a therapeutically effective amount of the reagent (or its composition), the subject's exercise endurance recovers to or substantially remains at pre-treatment levels. In some embodiments, after application of a therapeutically effective amount of the reagent (or its composition), the subject exhibits an endurance improvement of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, or more, or a percentage within the range defined by any two of the foregoing values. In some embodiments, after application of a therapeutically effective amount of the reagent (or its composition), endurance continues to improve during treatment. In some embodiments, after application of a therapeutically effective amount of the reagent (or its composition), the improvement in endurance continues after multiple applications.

[0154] In some embodiments, the subject exhibits elevated levels of systemic inflammatory markers, for example, in peripheral blood. In some embodiments, the systemic inflammatory markers include one or more of IL-6 and brain natriuretic peptide (BNP). In some embodiments, after administration of a therapeutically effective amount of the reagent (or a combination thereof), the systemic inflammatory markers decrease by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more, or decrease by a percentage within the range defined by any two of the foregoing values. In some embodiments, after administration of a therapeutically effective amount of the reagent (or a combination thereof), the subject's systemic inflammatory markers decrease to at least a level that is no longer considered elevated.

[0155] In some embodiments, the therapeutic effect of the agent is independent of the subject's obesity when the subject is obese. In some embodiments, the application of the agent (or a combination thereof) does not affect the subject's weight.

[0156] In some embodiments, the subject exhibits decreased skeletal muscle function, such as the amount of force or torque exerted by skeletal muscle groups. In some embodiments, the subject exhibits decreased skeletal muscle function, and administration of a therapeutically effective amount of the reagent (or its composition) slows the progression of the decreased skeletal muscle function, prevents further deterioration of skeletal muscle function, or enhances skeletal muscle function. In some embodiments, after administration of a therapeutically effective amount of the reagent (or its composition), the subject's skeletal muscle function recovers to or substantially remains at pre-treatment levels. In some embodiments, after administration of a therapeutically effective amount of the reagent (or its composition), the subject exhibits at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, or higher, or a percentage within the range defined by any two of the foregoing values, of skeletal muscle function.

[0157] In some embodiments, any therapeutic effect of applying a therapeutically effective amount of the reagent (or its composition) described in this application is maintained during treatment. This effect persists over multiple doses. In some embodiments, any therapeutic effect of applying a therapeutically effective amount of the reagent (or its composition) described in this application is not instantaneous during treatment.

[0158] In some embodiments, the treatment methods of this application are used to treat any one or more of a variety of inflammatory conditions. In some embodiments, the inflammatory condition is a chronic condition. In some embodiments, the inflammatory condition is a condition that responds to the anti-inflammatory effect of IL-10. In some embodiments, the inflammatory condition includes autoimmune diseases, graft-versus-host disease (GVHD), or an immune response to organ transplantation. In some embodiments, the inflammatory condition includes viral infections, sepsis, arthritis (rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis), multiple sclerosis, pemphigus, and type 1 diabetes (also known as insulin-dependent diabetes mellitus (IDDM)). In some embodiments, the inflammatory conditions include Behçet's disease, polymyositis / dermatomyositis, autoimmune cytopenia, autoimmune myocarditis, primary cirrhosis, Goodpesture syndrome, autoimmune meningitis, Sjögren's syndrome, systemic lupus erythematosus, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, insulin-dependent diabetes mellitus, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, spondyloarthritis, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis. In some embodiments, the inflammation is related to bone marrow transplantation. In some embodiments, the inflammation is related to allogeneic graft rejection after tissue transplantation. In some embodiments, the autoimmune disease is a cardiac autoimmune disease, such as autoimmune myocarditis. In some embodiments, the autoimmune disease is scleroderma or systemic sclerosis.

[0159] In some embodiments, the treatment methods described in this application are used to treat symptoms and / or sequelae of any one or more infectious diseases. In some embodiments, the reagents described in this application treat cardiac conditions or inflammatory conditions, including symptoms and / or sequelae of infectious diseases. In some embodiments, the infectious disease is associated with myocardial injury. In some embodiments, the cardiac condition includes acute myocarditis associated with an infectious disease. In some embodiments, the inflammatory condition includes a cytokine storm or hyperinflammatory associated with an infectious disease. In some embodiments, the inflammatory condition includes acute lung injury or acute respiratory distress syndrome (ARDS).

[0160] In some embodiments, infectious diseases are caused by infection with one or more of the following pathogens, but not limited to: viruses (including, but not limited to, coronaviruses, human immunodeficiency virus, herpes simplex virus, papillomavirus, parainfluenza virus, influenza virus, hepatitis virus, Coxsackie virus, varicella-zoster virus, measles virus, mumps virus, rubella, rabies virus, hemorrhagic viral fever, H1N1, etc.), prions, parasites, fungi, molds, yeasts, and bacteria (Gram-positive and Gram-negative). In some embodiments, pathogens include, but are not limited to, Candida albicans, Aspergillus niger, and Escherichia coli (…). E. coli ), Pseudomonas aeruginosa ( P. aeruginosa ), and Staphylococcus aureus ( S. aureus Group A beta-hemolytic streptococci, Streptococcus pneumoniae, Mycobacterium tuberculosis, Campylobacter jejuni, Salmonella, Shigella, and various drug-resistant bacteria.

[0161] In some embodiments, the inflammation occurs after or simultaneously with viral (e.g., DNA or RNA virus) infection. In some embodiments, the virus is an RNA virus, such as a single-stranded or double-stranded virus. In some embodiments, the RNA virus is a positive-sense single-stranded RNA virus. In some embodiments, the virus belongs to the order Nematovirales. In some embodiments, the virus belongs to the family Coronaviridae. In some embodiments, the virus belongs to... α coronavirus β Coronaviruses, gamma coronaviruses, or delta coronaviruses. In some embodiments, the... α Coronaviruses are, but are not limited to, human coronavirus 229E, human coronavirus NL63, or infectious gastroenteritis virus (TGEV). In some embodiments, the... β The coronavirus is, but is not limited to, severe acute respiratory syndrome coronavirus (SARS-CoV), SARS-CoV-2 (COVID-19), Middle East respiratory syndrome (MERS-CoV), human coronavirus HKU1, or human coronavirus OC43. In some embodiments, the gamma coronavirus is infectious bronchitis virus (IBV).

[0162] In some embodiments, the reagent may be administered to the subject in any suitable amount to achieve the desired therapeutic effect. In some embodiments, the therapeutically effective amount of the reagent includes amounts ranging from 0.01 µg to 100 mg, for example, 0.01 µg to 0.1 µg, 0.1 µg to 1 µg, 1 µg to 10 µg, 10 µg to 100 µg, 100 µg to 1 mg, 1 mg to 10 mg, and 10 mg to 100 mg. In some embodiments, the therapeutically effective amount of the reagent includes amounts ranging from 0.001 µg / g to 100 µg / g body weight, for example, 0.001 µg / g to 0.01 µg / g, 0.01 µg / g to 0.1 µg / g, 0.1 µg / g to 1 µg / g, 1 µg / g to 10 µg / g, and 10 µg / g to 100 µg / g.

[0163] The reagent or composition may be administered to the subject using any suitable administration regimen. In some embodiments, the subject is administered a therapeutically effective amount of the reagent or composition not more than twice a week, once a week, once every two weeks, once a month, once every two months, once every three months, once every four months, or longer, or at a frequency within the range defined by any two of the foregoing values. In some embodiments, the subject is administered the reagent once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, fifteen times, twenty times, twenty five times, thirty times, or more. In some embodiments, the subject is administered the reagent at regular intervals.

[0164] This application also provides a method for enhancing the anti-inflammatory activity of macrophages (also referred to herein as a macrophage modulation method). The method generally involves contacting a macrophage population with a reagent or composition of this application. In some embodiments, the reagent induces changes in gene expression and / or epigenetic alterations in macrophages treated with the reagent. In some embodiments, contact with the reagent (or composition) increases the expression of one or more of Trex1, IL-10, IRF-7, NOS-2, and ARG-1. In some embodiments, contact with the reagent (or composition) increases the transcription or translation of one or more of Trex1, IL-10, IRF-7, NOS-2, and ARG-1. In some embodiments, compared with a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression), exposure to the reagent (e.g., nucleic acid) (or composition) independently increases the transcription of one or more of Trex1, IL-10, IRF-7, NOS-2, and ARG-1 by at least about 1.5-fold, 2-fold, 4-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 1000-fold, or more, or by a factor of fold within the range defined by any two of the foregoing values.

[0165] In some embodiments, exposure to the reagent (or composition) increases the secretion of interleukin-10 (IL-10) from macrophages. In some embodiments, exposure to the reagent (or composition) increases IL-10 secretion from macrophages by at least about 1.2-fold, 1.5-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 50-fold, or more, or by a factor within the range defined by any two of the foregoing values, compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression).

[0166] The macrophage population can be exposed to the reagent or composition for any suitable duration. In some embodiments, the exposure lasts for 24 hours or longer, 36 hours or longer, 48 hours or longer, 60 hours or longer, 72 hours or longer, or a duration within any two of the foregoing values.

[0167] In some embodiments, the contact is performed in vitro. In some embodiments, the contact is performed in vivo. In some embodiments, the contact includes administering an effective amount of the reagent or composition to a subject requiring treatment for inflammation. In some embodiments, the macrophages are human macrophages. In some embodiments, the subject is a human subject. In some embodiments, the subject is a non-human subject, such as a non-human mammal.

[0168] Any suitable amount of reagent can be applied to the macrophage population to enhance the anti-inflammatory activity of the macrophages. In some embodiments, the effective amount depends on whether the application is performed in vivo or in vitro.

[0169] A screening method for identifying reagents that enhance Trex1 gene product expression is also provided. This document provides an in vitro method for identifying reagents that enhance Trex1 gene product expression in target cells, comprising: contacting a candidate reagent with target cells; and measuring the Trex1 gene product expression level in the target cells after said contact, wherein the candidate reagent is identified as an agent that enhances Trex1 gene product expression when the measured Trex1 gene product expression level is higher than a suitable reference value. In some embodiments, the suitable reference value is the Trex1 gene product expression level before the candidate reagent is contacted with the target cells. In some embodiments, the suitable reference value is a control level of Trex1 gene product expression (e.g., in target cells contacted with a vector). In some embodiments, the target cells are genetically modified to express TREX1 protein labeled with a detectable marker (e.g., fused with a fluorescent marker such as GFP). In some embodiments, the Trex1 gene product expression level is measured by detecting a detectable marker (e.g., GFP fluorescence) in the target cells. Any suitable detectable marker can be used in the screening method. Any suitable target cells can be used for the screening method, such as, but not limited to, HEK293 or CHO cells. In some embodiments, the method includes screening a library of candidate reagents (e.g., small molecule libraries, nucleic acid libraries, biopharmaceutical libraries, etc.) using the screening method to identify one or more reagents that enhance the expression of the Trex1 gene product in target cells. This application also provides an in vitro method for identifying reagents that enhance the expression of the Trex1 gene product, comprising: contacting a candidate reagent with a Trex1 gene product (e.g., Trex1 mRNA or protein); and measuring the level of the Trex1 gene product after contact, wherein the candidate reagent is identified as a reagent that enhances the expression of the Trex1 gene product when the measured level and / or measured activity of the Trex1 gene product increases compared to a suitable reference value.

[0170] Composition This application also provides a composition for treating conditions associated with aging, atrophy, inflammation, and / or fibrosis, the composition comprising: a nucleic acid that anneals to a first sequence in a Trex1 mRNA 5' UTR, the first sequence being different from a second sequence in the Trex1 mRNA 5' UTR, the second sequence being annealed to a nucleic acid comprising a nucleotide sequence including CCUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), wherein the nucleic acid enhances Trex1 gene product expression; a nucleic acid encoding the Trex1 gene product, wherein the nucleic acid is configured to overexpress the Trex1 gene product; and a macrophage population having enhanced anti-inflammatory activity, wherein the macrophages in the population have enhanced Trex1 gene product expression and do not include exogenous RNA comprising a nucleotide sequence having at least 95% identity with CCUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3); or combinations thereof. In some embodiments, the composition comprises a pharmaceutically acceptable carrier.

[0171] In some embodiments, the macrophages in the population are genetically modified to overexpress the Trex1 gene product. In some embodiments, the macrophages are genetically modified to overexpress the Trex1 gene product using genome editing techniques, for example, by using a CRISPR system. In some embodiments, Trex1 is integrated into the genome of the macrophages using a viral vector. In some embodiments, the macrophages include plasmids configured to overexpress Trex1.

[0172] In some embodiments, the macrophages in the population are genetically modified to include nucleic acids comprising a promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product, wherein the promoter drives the expression of the Trex1 gene product in the macrophages. In some embodiments, the promoter is macrophage-specific, for example, the CD68 gene promoter. In some embodiments, the nucleic acid comprises a vector. In some embodiments, the vector is a viral vector or a plasmid.

[0173] In some embodiments, the composition is used to prepare a medicament for treating heart disease, muscle disease, inflammatory disease, or conditions related to aging and / or atrophy in subjects in need.

[0174] In some embodiments, the composition is used in the preparation of a medicament for treating heart disease, muscle disease, inflammatory disease, or conditions related to aging and / or atrophy in subjects in need.

[0175] This application also provides compositions comprising pharmaceutically acceptable excipients. Some non-limiting examples of materials that can be used as pharmaceutically acceptable excipients include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered astragalus gum; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols. Alcohols, such as glycerol, sorbitol, mannitol, and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) pH buffer solution; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) swelling agents, such as peptides and amino acids; (23) serum components, such as serum albumin, HDL, and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances used in pharmaceutical preparations.

[0176] In some embodiments, the composition includes a transfection agent, for example, to facilitate the delivery of a reagent (e.g., nucleic acid) to a target cell (in vitro or in vivo). The composition may include any suitable transfection agent. Suitable transfection agents include, but are not limited to, liposomes, extracellular vesicles (EVs), and polyethylene glycol (PEG)-cationic lipid complexes (PCLCs). In some embodiments, the transfection agent includes lipids (e.g., lipids that form liposomes) or PEGylated lipids. In some embodiments, the lipids are cationic lipids as provided in this invention. In some embodiments, the transfection agent includes DharmaFECT® or Lipofectamine®. In some embodiments, in the composition, the reagent (e.g., nucleic acid) described in this application is formulated together with the transfection agent to facilitate cellular uptake and / or pharmacokinetics of the reagent (e.g., nucleic acid).

[0177] Liposomes are artificially prepared vesicles primarily composed of a lipid bilayer and can be used as delivery carriers for administering drug formulations. Liposomes can have different sizes, for example, but not limited to, diameters of hundreds of nanometers, and can comprise a series of concentric bilayers of multilayer vesicles (MLVs) separated by narrow aqueous compartments, small monolayer vesicles (SUVs) with diameters less than 50 nm, and large monolayer vesicles (LUVs) with diameters ranging from 50 nm to 500 nm. Liposome design can include, but is not limited to, opsonins or ligands to improve liposome adhesion to target tissues / cells, or to activate events (e.g., but not limited to, endocytosis). Liposomes may contain low or high pH to improve the delivery of cargoes (e.g., nucleic acids as described in this application).

[0178] In some embodiments, the composition includes, but is not limited to, liposomes formed from, but not limited to, 1,2-dioleoyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2-dilinoleoyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleoyl-4-(2-dimethylaminoethyl)-[1,3]dioxolane (DLin-KC2-DMA), and MC3, and, for example, but not limited to, liposomes from, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).

[0179] In some embodiments, the composition comprises cationic lipids. Any suitable cationic lipid can be used in the compositions of this application. Suitable cationic lipids include, but are not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and amino alcohol lipids. In some embodiments, the composition comprises a cationic lipid complex, such as a polyethylene glycol (PEG)-cationic lipid complex (PCLC). In some embodiments, the cationic lipid is PEGylated, for example, 2 kDa PEG (“PEG2000”). Any suitable option can be used to PEGylate the cationic lipid. In some embodiments, PCLC is formed by subjecting a mixture of PEG and cationic lipid to one or more freeze / thaw cycles, for example, 1, 2, 3, 4, 5, or more freeze / thaw cycles. In some embodiments, the freeze / thaw cycle comprises freezing the mixture with liquid nitrogen (e.g., about -190°C) for about 5 minutes and thawing it at about 60°C for about 5 minutes. The nucleic acid of this application can be mixed with PCLC to produce a complex of nucleic acid and PCLC.

[0180] In some embodiments, the composition comprises extracellular vesicles (EVs), such as exosomes. The extracellular vesicles (EVs) can be derived from any suitable source, such as EVs derived from cardiomyocyte-derived cells (CDCs) or fibroblasts. Suitable EVs, such as CDC-derived EVs, are provided, for example, in U.S. Patent Publications 20080267921, 20160158291, and 20160160181; Smith et al. Circulation. 2007. 115:896-908; Aminzadeh, MA et al. Stem Cell Reports 10, 942-955 (2018); and Ibrahim et al., Stem Cell Reports. May 8, 2014; 2(5):606-19, Ibrahim, AG et al. Nanomedicine 33, 102347 (2020), the entire contents of which are incorporated herein by reference. In some embodiments, the EVs are those isolated from serum-free medium conditioned with human CDC in culture. In some embodiments, the composition comprises EVs, and liposomes and / or PCLCs as transfection reagents. In some embodiments, the composition is substantially free of CDC-derived EVs.

[0181] In some embodiments, the composition comprises casein, for example, casein micelles. In some embodiments, the composition comprises chitosan. In some embodiments, the composition comprises casein and chitosan, for example, casein-chitosan micelles. In some embodiments, the composition comprises a casein-chitosan complex. In some embodiments, the reagents in the composition (e.g., isolated nucleic acids) are encapsulated in a casein-chitosan complex. In some embodiments, the composition comprises one or more phosphoproteins. α -s1 casein, α -s2 casein, β -Casein, and κ - Casein. In some embodiments, the composition comprises two or more, three or more, or all four phosphoproteins: α -s1 casein, α -s2 casein, β -Casein, and κ- Casein. The phosphoprotein can be present in the composition at any suitable concentration (relative to each other and relative to the total volume of the composition), and in some embodiments, in an amount suitable for forming casein micelles. In some embodiments, the casein phosphoprotein is present in the composition at about 5% to 10% (volume weight). In some embodiments, the casein phosphoprotein is present in the composition at about 8% (volume weight). In some embodiments, the casein phosphoprotein is present in the composition at about 5% (volume weight). The casein phosphoprotein can be derived from any suitable animal, such as mammals, including, but not limited to, humans, non-human primates, cattle, pigs, horses, camels, goats, and sheep. In some embodiments, the casein phosphoprotein is bovine. α -s1 casein, α -s2 casein, β -Casein, and κ - Casein. Suitable casein formulations having EVs are provided, for example, in Aminzadeh et al., J Extracell Vesiles. Jan 2021; 10(3): e12045, the entire contents of which are incorporated herein by reference. In some embodiments, compositions of the present application (e.g., pharmaceutical compositions) made with casein provided in this application are suitable for oral administration to a subject. Without being bound by theory, casein phosphoproteoproteins in said compositions are believed to increase the bioavailability of orally administered EVs and / or liposomes and their goods (e.g., reagents of the present application (e.g., nucleic acids)).

[0182] In some embodiments, a composition for enhancing the oral bioavailability of the therapeutic agents (e.g., nucleic acids) described in this application comprises: a physiologically compatible excipient selected from... α -s1 casein, α -s2 casein, β -Casein, and κ - At least two phosphoproteins in casein, wherein the phosphoproteins are present in an amount of about 5% to about 10% (by volume weight) of the composition. In some embodiments, the composition comprises about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, or about 30% to about 40%) (by weight) of the phosphoproteins in the composition. α -s1 casein, in amounts of about 0% to about 20% (e.g., about 5% to about 15%, about 7% to about 12%, including about 8% to about 12%) (by weight). α-s2 casein, in amounts of about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, about including 30% to about 40%) (by weight). β - Casein, and amounts of about 0% to about 20% (e.g., about 5% to about 18%, about 8% to about 18%, including about 10% to about 15%) (by weight). κ - Casein. The compositions of this application are capable of providing improved oral bioavailability of therapeutic agents (e.g., nucleic acids).

[0183] In some embodiments, the formulation provided in this application is in the form of lipid-bound vesicles, such as micelles or liposomes, and therefore may include any suitable number of particles. In some embodiments, the number of micelles (e.g., casein-chitosan-coated micelles) is about 10. 6 To about 10 10 Within the range of particles, for example, approximately 2 × 10⁻⁶. 6 To about 10 10 Particles, approximately 5 × 10 6 To about 10 10 Particles, approximately 10 7 Approximately 5×10 9 Particles, approximately 2 × 10 7 Approximately 5×10 9 Particles, approximately 5 × 10 7 Approximately 5×10 9 Particles, including approximately 1 × 10 8 Approximately 2×10 9 Particles. In some embodiments, the number of micelles (e.g., casein-chitosan-coated micelles) in the group is about 10. 6 Particles, approximately 2 × 10 6 Particles, approximately 5 × 10 6 Particles, approximately 10 7 Particles, approximately 2 × 10 7 Particles, approximately 5 × 10 7 Particles, approximately 10 8 Particles, approximately 2 × 10 8 Particles, approximately 5 × 10 8 Particles, approximately 10 9 Particles, approximately 2 × 10 9 Particles, approximately 5 × 10 9 Particles, or about 10 10 Particles, or any two of the aforementioned values.

[0184] In some embodiments, the composition comprises casein-chitosan-coated lipid micelles, wherein the casein phosphoproteoproteins are present in the composition in suitable amounts (e.g., the total amount of suitable phosphoproteoproteins in the composition, and suitable proportions of phosphoproteoproteins relative to each other). In some embodiments, the composition comprises a selection from... α -s1 casein, α -s2 casein, β -Casein, and κ - Two, three, or all four phosphoproteins in casein. In some embodiments, the amount of phosphoprotein in the composition depends on the amount of one or more other phosphoproteins present in the composition.

[0185] In some embodiments, the α -s1 casein is a phosphoprotein associated with the gene name CSN1S1. α -s1 casein can be a CSN1S1 phosphoprotein from any suitable mammal. In some embodiments, the... α -s1 casein is found in cattle (Gene ID: 282208), pigs (Gene ID: 445514), horses (Gene ID: 100033982), sheep (Gene ID: 443382), goats (Gene ID: 100750242), camels (Gene ID: 105090954), or humans (Gene ID: 1446). α -s1 casein. In some embodiments, the... α -s1 casein is non-human α -s1 casein. In some embodiments, the... α -s1 casein is a polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence shown in SEQ ID NO: 17.

[0186] In some embodiments, the composition comprises any suitable amount α -s1 casein. In some embodiments, the composition includes... α-s1 casein, in an amount from about 0% to about 50% by weight of the phosphoprotein in the composition, for example, about 5% to about 50%, about 10% to about 50%, about 15% to about 45%, about 20% to about 45%, including about 25% to about 40%. In some embodiments, the composition comprises, by weight, about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40% of the phosphoprotein in the composition. α -s1 casein, or an amount within a range defined by any two of the aforementioned values.

[0187] In some embodiments, the α -s2 casein is a phosphoprotein associated with the gene name CSN1S2. α -s2 casein can be a CSN1S2 phosphoprotein from any suitable mammal. In some embodiments, α -s2 casein is a protein found in cattle (Gene ID: 282209), pigs (Gene ID: 445515), horses (Gene ID: 100327035), sheep (Gene ID: 443383), goats (Gene ID: 100861229), or camels (Gene ID: 105090951). α -s2 casein. In some embodiments, the... α -s2 casein is a polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence shown in SEQ ID NO:18.

[0188] The composition may include any suitable amount α -s2 casein. In some embodiments, the composition includes... α -s2 casein, comprising, by weight, about 0% to about 20% of the phosphoprotein in the composition, for example, about 2% to about 18%, about 3% to about 18%, about 4% to about 17%, about 5% to about 16%, including about 5% to about 15%. In some embodiments, the composition comprises, by weight, about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, or 20% of the -s2 casein. α -s2 casein, or an amount within a range defined by any two of the aforementioned values.

[0189] In some embodiments, the βCasein is a phosphoprotein associated with the gene name CSN2. β Casein can be a CSN2 phosphoprotein from any suitable mammal. In some embodiments, the... β Casein is found in cattle (Gene ID: 281099), pigs (Gene ID: 404088), horses (Gene ID: 100033903), sheep (Gene ID: 443391), goats (Gene ID: 100860784), camels (Gene ID: 105080412), or humans (Gene ID: 1447). β -Casein. In some embodiments, the... β Casein is non-human β -Casein. In some embodiments, the... β Casein is a polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence shown in SEQ ID NO: 19 or 20.

[0190] The composition may include any suitable amount β -Casein. In some embodiments, the composition includes β - Casein, comprising, by weight, about 0% to about 50% of the phosphoprotein in the composition, for example, about 5% to about 50%, about 10% to about 50%, about 15% to about 45%, about 20% to about 45%, including about 25% to about 40%. In some embodiments, the composition comprises, by weight, about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40% of the casein in the composition. β - Casein, or an amount within a range defined by any two of the aforementioned values.

[0191] In some embodiments, the κ Casein is a phosphoprotein associated with the gene name CSN3. β Casein can be a CSN3 phosphoprotein from any suitable mammal. In some embodiments, the... κCasein is a protein found in cattle (Gene ID: 281728), pigs (Gene ID: 445511), horses (Gene ID: 100033983), sheep (Gene ID: 443394), goats (Gene ID: 100861231), camels (Gene ID: 105080408 or 105090949), or humans (Gene ID: 1448). κ -Casein. In some embodiments, the... κ Casein is non-human. κ -Casein. In some embodiments, the... κ Casein is a polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence shown in SEQ ID NO:21.

[0192] The composition may include any suitable amount κ -Casein. In some embodiments, the composition includes κ - Casein, comprising, by weight, about 0% to about 20% of the phosphoprotein in the composition, for example about 2% to about 18%, about 3% to about 18%, about 4% to about 17%, about 5% to about 16%, including about 5% to about 15%. In some embodiments, the composition comprises about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, or 20% by weight of the casein. κ - Casein, or an amount within a range defined by any two of the aforementioned values.

[0193] In some embodiments, a combination of caseins from different species is used. For example, in some embodiments, one or more human caseins are used in combination with one or more bovine caseins. In some embodiments, the ratio of caseins used is, for example, α -s1 casein: α -s2 casein: β -Casein: κ The ratio of casein is 3:1:3:1. In some embodiments, different ratios may be used, such as 4:1:4:1, 2:1:2:1, or 1:1:1:1. Ratios ranging from 1:1, 2:1, 3:1, 4:1, 5:1, 10:1, 1:5, 1:4, 1:3, 1:2, etc., may also be used between any two given caseins in the composition.

[0194] The composition may contain any suitable total amount of phosphoprotein. In some embodiments, the phosphoprotein is present in an amount of 5% to about 10% of the composition, for example, about 6% to about 10%, about 6% to about 9%, including about 6% to about 8% (by volume). In some embodiments, the phosphoprotein is present in an amount of about 5%, 6%, 7%, 8%, 9%, or 10% of the composition, or in an amount within the range defined by any two of the foregoing values ​​(by weight / volume).

[0195] In some embodiments, one or more casein phosphopeptides are non-human casein phosphopeptides. In some embodiments, the exosomes and at least one casein phosphopeptide are from different species. In some embodiments, the exosomes are human exosomes, and one or more casein phosphopeptides are non-human casein phosphopeptides. In some embodiments, the exosomes are human exosomes, and one or more casein phosphopeptides are bovine (or sheep, pig, goat, camel, or horse) casein phosphopeptides.

[0196] In some embodiments, the composition comprises a micelle structure formed by at least a portion of casein phosphopeptide. In some embodiments, the casein micelles are substantially spherical. In some embodiments, the average diameter (measured per individual micelle) of the casein micelles in the composition is about 40 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, about 100 nm, about 110 nm, about 120 nm, about 130 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, or greater, or the average diameter is within the range defined by any two of the foregoing values. In some embodiments, the average diameter (measured per individual micelle) of the casein micelles in the composition is from about 40 nm to about 500 nm, for example, from about 40 nm to about 400 nm, from about 50 nm to about 300 nm, from about 60 nm to about 250 nm, from about 70 nm to about 250 nm, from about 80 nm to about 200 nm, including from about 90 nm to about 150 nm. The casein micelles in the compositions of this application are generally non-precipitated or in gel form.

[0197] In some embodiments, the composition comprises one or more colloidal minerals (e.g., minerals in suspension). In some embodiments, a complex (e.g., two or more) of minerals is used as a colloidal mineral complex. The colloidal mineral complex may comprise any suitable mineral compound and / or its salts. In some embodiments, the colloidal mineral complex comprises, but is not limited to, calcium, magnesium, inorganic phosphates, citrates, sodium, potassium, and chlorides, or one or more of their respective salts. In some embodiments, the colloidal mineral complex is present in amounts from about 2% to about 15% of the phosphate protein content of the composition, for example, from about 2% to about 12%, from about 5% to about 10%, from about 5% to about 9%, including from about 6% to about 9% (by weight). In some embodiments, the colloidal mineral complex is present in amounts of about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, or in amounts within the range defined by any two of the foregoing percentages.

[0198] In some embodiments, the composition is a parenteral dosage form. In some embodiments, the parenteral dosage form is sterile or capable of being sterilized prior to administration to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions prepared for injection, dried products prepared for dissolution or suspension in a pharmaceutically acceptable injectable carrier, suspensions prepared for injection, and emulsions. Furthermore, controlled-release parenteral dosage forms can be prepared for administration to a subject. Suitable excipients that can be used to provide parenteral dosage forms of the reagent include, but are not limited to: sterile water; water for injection (USP); saline solution; glucose solution; aqueous carriers, such as, but not limited to, sodium chloride injection, Linköping's injection, glucose injection, glucose and sodium chloride injection, and lactated Linköping's injection; water-miscible carriers, such as, but not limited to, ethanol, polyethylene glycol, and propylene glycol; and non-aqueous carriers, such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.

[0199] This application also provides macrophages with enhanced Trex1 gene product expression as described herein. In some embodiments, the macrophages are CD68+ macrophages. In some embodiments, the macrophages are human macrophages. In some embodiments, macrophages with enhanced Trex1 gene product expression exhibit enhanced anti-inflammatory activity compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression). In some embodiments, the macrophages are bone marrow-derived macrophages (BMDM). In some embodiments, the macrophages have enhanced expression of one or more of IL-10, IRF-7, NOS-2, and ARG-1. In some embodiments, the macrophages have enhanced mRNA expression of one or more of IL-10, IRF-7, NOS-2, and ARG-1 compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression). In some embodiments, the macrophages exhibit enhanced expression of one or more mRNAs of IL-10, IRF-7, NOS-2, and ARG-1 compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression). In some embodiments, the expression of one or more mRNAs of IL-10, IRF-7, NOS-2, and ARG-1 in the macrophages exhibiting enhanced Trex1 gene product expression is independently enhanced by at least 1.5-fold, 2-fold, 4-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 1000-fold, or more, or by a number of folds within the range defined by any two of the foregoing values, compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression). In some embodiments, the macrophages exhibit enhanced expression of one or more proteins of IL-10, IRF-7, NOS-2, and ARG-1 compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression). In some embodiments, the expression of one or more proteins of IL-10, IRF-7, NOS-2, and ARG-1 in the macrophages with enhanced Trex1 gene product expression is independently enhanced by at least 1.5-fold, 2-fold, 4-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 100-fold, 200-fold, or more, or by a multiple within the range defined by any two of the foregoing values, compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression). In some embodiments, the macrophages exhibit enhanced IL-10 secretion compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression).In some embodiments, compared to a suitable control group (e.g., macrophages without enhanced Trex1 gene product expression), IL-10 secretion in macrophages with enhanced Trex1 gene product expression is independently enhanced by at least about 1.2-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 50-fold, or more, or by a factor within the range defined by any two of the foregoing values. In some embodiments, the macrophages are in a culture. In some embodiments, the macrophages are in a subject, for example, in peripheral blood, bone marrow, and / or at the site of tissue injury.

[0200] Table 1: Sequences

[0201]

[0202] Application of the composition Some embodiments of the methods and compositions provided in this application involve administering the composition to a subject. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human animal.

[0203] In some embodiments, the composition is administered as a single dose of about 1 μg / kg to about 100 mg / kg body weight of polynucleotide. For example, in some embodiments, the dosage range is about 1 to about 10 μg / kg, about 10 to about 20 μg / kg, about 20 to about 30 μg / kg, about 30 to about 40 μg / kg, about 40 to about 50 μg / kg, about 50 to about 60 μg / kg, about 60 to about 70 μg / kg, about 70 to about 180 μg / kg, about 80 to about 90 μg / kg, about 90 to about 100 μg / kg, about 100 to about 200 μg / kg, about 145 to about 155 μg / kg, about 100 μg / kg to about 500 μg / kg, about 500 μg / kg to about 1000 μg / kg, about 1000 μg / kg to about 10 mg / kg, about 10 mg / kg to about 50 mg / kg, about 50 mg / kg to about 100 mg / kg, or any value between the dosages listed above.

[0204] In some embodiments, a single dose is administered to the subject multiple times (e.g., repeatedly over a period of time). In some embodiments, administration of the composition includes injection of the composition. In some embodiments, the composition is infused percutaneously, subcutaneously, intraperitoneally, retroorbitally, intramuscularly, intradermally, or intraperitoneally.

[0205] In some embodiments, the amount of polynucleotide applied is less than about 75 mg per kg body weight, or less than about 70 mg, 60 mg, 50 mg, 40 mg, 30 mg, 20 mg, 10 mg, 5 mg, 2 mg, 1 mg, 0.5 mg, 0.1 mg, 0.05 mg, 0.01 mg, 0.005 mg, 0.001 mg, or 0.0005 mg. In some embodiments, the unit dose of the polynucleotide is less than 200 nmol per kg body weight (e.g., about 4.4 × 10⁻⁶). 16 (1 copy), or polynucleotides less than 1500 nmol, 750 nmol, 300 nmol, 150 nmol, 75 nmol, 15 nmol, 7.5 nmol, 1.5 nmol, 0.75 nmol, 0.15 nmol, 0.075 nmol, 0.015 nmol, 0.0075 nmol, 0.0015 nmol, 0.00075 nmol, or 0.00015 nmol per kg body weight per day. In some embodiments, the dosage range of the polynucleotide is 0.01 μg to 5.0 μg, 0.1 μg to 200 μg, 0.1 μg to 100 μg, or 1.0 μg to 50 μg per kg body weight per day. In some embodiments, the dosage range of the polynucleotide is 1.0 μg to 25 μg per kg body weight per day. In some embodiments, the dosage of the polynucleotide is in the range of 0.01 μg to 5.0 μg, 0.1 μg to 200 μg, 0.1 μg to 100 μg, or 1.0 μg to 50 μg. In some embodiments, the dosage of the polynucleotide is in the range of 1.0 μg to 25 μg. In some embodiments, the dosage of the polynucleotide is in the range of 1 mg to 5 mg. In some embodiments, the dosage of the polynucleotide is about 10 μg. In some embodiments, the dosage of the polynucleotide is about 3 mg.

[0206] In some embodiments, a single dose is compared to a dose administered sequentially two, three, four, or more times. In some embodiments, the repeated or sequentially administered dose is provided for treating an acute illness or condition. In some embodiments, the repeated or sequentially administered dose is provided for treating a chronic illness or condition.

[0207] In some embodiments, the polynucleotide is administered to the subject using any technique known in the art. In some embodiments, administration includes percutaneous delivery. In some embodiments, additional delivery sites are used, including any one or more chambers of the heart, such as arteries, veins, coronary arteries, or ventricular locations. In some embodiments, administration includes delivery to a tissue or organ site different from the site of the lesion or dysfunction. In some embodiments, the delivery is via inhalation or oral administration. Systemic administration is used in several embodiments. However, in several embodiments, local delivery is employed.

[0208] In some embodiments, the composition to be administered is a pharmaceutical composition comprising one or more of the agents for enhancing Trex1 gene product expression as described in this application and pharmaceutically acceptable carriers. Examples of pharmaceutically acceptable carriers include solvents, dispersion media, coating agents, antibacterial and antifungal agents, isotonic agents, and absorption delay agents, which are compatible with drug administration. In some embodiments, such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. For orally administered drugs, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, colorants, and preservatives. Suitable inert diluents include, but are not limited to, sodium carbonate, calcium carbonate, sodium phosphate, calcium phosphate, and lactose. Suitable disintegrants include, but are not limited to, corn starch and alginic acid. Binders include, but are not limited to, starch and gelatin. In some embodiments, a lubricant is present. In some embodiments, the lubricant is magnesium stearate, stearic acid, or talc. In some embodiments, the tablets are coated with materials such as glyceryl monostearate or glyceryl distearate, for example, to delay absorption in the gastrointestinal tract. In some embodiments, a supplemental active compound is incorporated into the composition. In some embodiments, an agent that enhances the expression of the Trex1 gene product is administered together with a pharmaceutically acceptable carrier.

[0209] In some embodiments, the pharmaceutical composition comprises conventional pharmaceutical excipients or additives. In some embodiments, the pharmaceutical excipients include stabilizers, antioxidants, osmotic regulators, buffers, and pH adjusters. Suitable additives include physiologically biocompatible buffers (e.g., methamidophos hydrochloride), chelating agents (e.g., DTPA or DTPA-bisamide), or calcium chelates (e.g., calcium DTPA, CaNaDTPA-bisamide). Suitable additives also include the addition of calcium or sodium salts (e.g., calcium chloride, calcium ascorbate, calcium gluconate, or calcium lactate). In some embodiments, the pharmaceutical composition is packaged for use in liquid form or lyophilized. In some embodiments, for solid compositions, conventional non-toxic solid carriers are used: for example, pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, etc.

[0210] In some embodiments, the composition comprises a solid pharmaceutical composition for oral administration, the solid pharmaceutical composition having any of the carriers and excipients listed above and 10% to 95% or 25% to 75% of one or more polynucleotide reagents as described in this application. In some embodiments, the composition comprises a therapeutically effective amount of polynucleotides.

[0211] Treatment effect Some embodiments of the methods and compositions provided in this application relate to imparting beneficial therapeutic effects to subjects, such as protection, cardioprotection, prevention or delay of inflammation progression, or tissue regeneration. In some embodiments, application of the reagents and / or compositions can induce tissue regeneration or modulate apoptosis, inflammatory hypertrophy, cardiac function, or fibrosis.

[0212] In some embodiments, the therapeutic benefits arise through indirect mechanisms involving regenerative tissue generated from an endogenous source. For example, in some embodiments, the composition is capable of generating and delivering growth factors, transcription factors, cytokines, and nucleic acids for novel therapeutic applications in a manner that not only slows disease progression but also repairs and regenerates diseased or dysfunctional tissue. In some embodiments, the components of the composition, through synergistic mechanisms, attract endogenous stem cells to sites of tissue degeneration and injury, promote cell differentiation, and reverse the pathophysiological processes of chronic diseases.

[0213] Some embodiments relate to a method of treatment, including administering a composition to an individual, wherein the administration of the composition is therapeutic to the subject. In some embodiments, the subject requires treatment for an inflammatory disease or condition. In some embodiments, the inflammation-related disease or condition is acute. In some embodiments, the inflammation-related disease or condition is chronic. In some embodiments, the inflammation-related disease or condition is a heart-related disease or condition. In some embodiments, the heart-related disease or condition is myocardial infarction. In some embodiments, the heart-related disease or condition is ischemia-reperfusion injury. In some embodiments, the heart-related disease or condition is atherosclerosis or heart failure. In some embodiments, the subject requires treatment for a disease or condition involving tissue damage or dysfunction.

[0214] In some embodiments, treatment of the subject results in reduced fibrosis, reduced inflammation, and / or enhanced mitochondrial function. In some embodiments, reduced fibrosis includes a reduction in collagen accumulation. In some embodiments, collagen includes type I collagen or type III collagen. In some embodiments, reduced inflammation includes an increase in nuclear factor E2-associated factor 2 (Nrf2), a decrease in fatty acid peroxidation end products, a decrease in the number of inflammatory cells, and / or upregulation of antioxidant expression. In some embodiments, antioxidants include, but are not limited to, heme oxygenase-1 (HO-1), catalase, superoxide dismutase-2 (SOD-2), or glutamate-cysteine ​​ligase catalytic (GCLC) subunits. In some embodiments, inflammatory cells include CD68+ macrophages and CD3+ T cells. In some embodiments, enhanced mitochondrial function includes enhanced mitochondrial ultrastructure or increased mitochondrial biosynthesis. In some embodiments, enhanced mitochondrial function includes increased expression of nuclear PPAR-γ coactivator-1 (PGC-1).

[0215] In some embodiments, application of the reagent or composition can alter gene expression in inflamed, damaged, or dysfunctional tissues, regulate or reduce inflammation in the tissue, improve the vitality of damaged tissues, or enhance the regeneration or formation of new tissue in an individual. In some embodiments, application of the reagent and / or composition or polynucleotide can lead to improved tissue function.

[0216] In some embodiments, damaged or dysfunctional tissue requires repair, regeneration, or functional improvement due to an acute event. In some embodiments, acute events include trauma such as lacerations, crush injuries, or impact injuries, shock, blood loss or hypoxia, infection, chemical or heat treatment, treatment with poison or venom, or drug abuse or overtreatment. In some embodiments, tissue is also damaged due to a chronic disease. In some embodiments, the dose is administered in repeated doses, such as two, three, four, or more doses in sequence. In some embodiments, the repeated or sequential doses are provided for treating an acute disease or condition. In some embodiments, the repeated or sequential doses are provided for treating a chronic disease or condition.

[0217] In some embodiments, the subject's heart is hypertrophic. In some embodiments, cardiac hypertrophy is determined by an increase or excess in the thickness of the cardiac septum or ventricular walls, such as an increase in end-diastolic left ventricular posterior wall thickness (LVPWd), end-diastolic left ventricular diameter (LVIDd), or end-diastolic interventricular septal thickness (IVSd). In some embodiments, cardiac hypertrophy is determined by the following indicators: increased or excess heart mass, heart mass / body weight ratio, heart mass / tibia length ratio, left ventricular (LV) mass, right ventricular (RV) mass, atrial natriuretic peptide (ANP) levels, Anp Gene expression, brain natriuretic peptide (BNP) levels, Bnp gene expression, cardiomyocyte length, or cardiomyocyte width. In some embodiments, administration of an agent that enhances Trex1 gene product expression reduces cardiac hypertrophy (or its markers) in the subject. In some embodiments, reduction in cardiac hypertrophy is indicated by a decrease in cardiac hypertrophy indicators. In some embodiments, the subject's heart is damaged, hypertrophic, fibrotic, inflamed, or dysfunctional due to hypertension. In some embodiments, the subject's heart is damaged, hypertrophic, fibrotic, inflamed, or dysfunctional due to causes other than hypertension. In some embodiments, the subject's heart is damaged, hypertrophic, fibrotic, inflamed, or dysfunctional, and the subject does not have hypertension.

[0218] In some embodiments, the subject's heart is fibrotic. In some embodiments, the fibrosis in the heart includes interstitial myocardial fibrosis. In some embodiments, fibrosis is determined by Masson's trichrome staining or by an increase or overexpression of collagen genes or proteins. In some embodiments, administration of an agent that enhances the expression of the Trex1 gene product reduces cardiac fibrosis in the subject.

[0219] In some implementations, the subject's heart (or other organ) is inflamed. Inflammation markers include markers of infiltrative inflammatory cells (such as...). CD68) and pro-inflammatory cytokines (such as Il6 and Il1b In some implementations, through genes such as CD68 , Il6 ,or Il1b Increased or overexpression of the Trex1 gene product is used to determine tissue inflammation. In some embodiments, administration of an agent that enhances the expression of the Trex1 gene product reduces the expression of genes associated with inflammation or inflammatory markers in the heart of the subject.

[0220] Some embodiments of the methods and compositions provided in this application relate to treating a subject with cardiac injury, including: administering to the subject with cardiac injury an agent that enhances the expression of the Trex1 gene product; wherein the agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), not EV-YF1 or a fragment thereof, not EV-YF1-U16 or a fragment thereof, and / or not NT4 or a fragment thereof; and wherein the agent has a therapeutic effect on the heart of the subject.

[0221] Some embodiments of this application relate to a method for treating a subject with cardiac injury. In some embodiments, the cardiac injury includes myocardial infarction or heart attack. In some embodiments, the cardiac injury is caused by ischemia or ischemia-reperfusion. In some embodiments, an agent that enhances the expression of the Trex1 gene product is applied to the subject with cardiac injury. In some embodiments, the agent that enhances the expression of the Trex1 gene product is an oligonucleotide as described in this application. In some embodiments, the agent that enhances the expression of the Trex1 gene product does not include EV-YF1 or a fragment thereof. In some embodiments, the agent that enhances the expression of the Trex1 gene product does not include EV-YF1-U16 or a fragment thereof. In some embodiments, the agent that enhances the expression of the Trex1 gene product has a therapeutic effect on the heart of the subject. In some embodiments, the application of the agent that enhances the expression of the Trex1 gene product reduces the degree of injury. In some embodiments, the application of the agent that enhances the expression of the Trex1 gene product reduces the infarct area of ​​the heart of the subject.

[0222] In some embodiments, the application of the reagent and / or composition reduces inflammation or gene expression of inflammatory markers in the injured heart of the subject.

[0223] In some embodiments, the damage reduces cardiomyocyte viability in the subject's heart. In some embodiments, the heart (or other organ) contains an excessive or increased number of necrotic or apoptotic cells or cardiomyocytes due to the damage. In some embodiments, apoptosis is determined by the number of TUNEL-positive cells or cardiomyocytes. In some embodiments, the damage induces oxidative stress in the subject's heart, such as an increase in the production of H2O2 or superoxide. In some embodiments, administration of the agent that enhances Trex1 gene product expression increases cardiomyocyte viability in the subject's heart. In some embodiments, administration of the agent that enhances Trex1 gene product expression reduces the number of necrotic or apoptotic cells or cardiomyocytes in the subject. In some embodiments, administration of the agent that enhances Trex1 gene product expression reduces the number of TUNEL-positive cells or cardiomyocytes in the subject. In some embodiments, administration of the agent that enhances Trex1 gene product expression alleviates oxidative stress in the subject's heart.

[0224] Some embodiments of the methods and compositions provided in this application relate to treating a subject suffering from a metabolic disorder, including: administering a reagent and / or composition to the subject suffering from a metabolic disorder; wherein the reagent and / or composition has a therapeutic effect on the subject's metabolism.

[0225] Some embodiments of this application relate to a method of treating a subject with a metabolic disorder. In some embodiments, the subject is obese. In some embodiments, the subject is diabetic. In some embodiments, the subject has excessively high or elevated blood glucose levels. In some embodiments, the subject exhibits glucose intolerance or experiences excessively high or elevated blood glucose levels after a glucose load. In some embodiments, an agent that enhances the expression of the Trex1 gene product is administered to the subject with the metabolic disorder. In some embodiments, the agent that enhances the expression of the Trex1 gene product is an oligonucleotide as described in this application. In some embodiments, the agent and / or composition has a therapeutic effect on the subject's metabolism. In some embodiments, administration of the agent and / or composition improves the subject's metabolic function or reduces the degree of diabetes in the subject. In some embodiments, administration of the agent and / or composition reduces blood glucose levels or improves glucose tolerance in the subject.

[0226] In some embodiments, administration of the reagent and / or composition increases IL-10 gene expression in at least one of the subject's heart or spleen, or in the subject's kidney. In some embodiments, administration of the reagent and / or composition increases circulating IL-10 in the subject. In some embodiments, administration of the reagent and / or composition increases IL-10 in the subject's blood, serum, or plasma.

[0227] Some embodiments of this application relate to methods of treating a subject by administering a reagent and / or composition to the subject. In some embodiments, the subject has a damaged, hypertrophic, fibrotic, inflamed, or dysfunctional heart. For example, the subject may suffer from heart failure or cardiomyopathy. Examples of heart failure include heart failure with a reduced ejection fraction (such as a reduced ejection fraction of the left or right ventricle) and heart failure with a preserved ejection fraction. In some embodiments, the cardiomyopathy includes heart failure, cardiac hypertrophy, or fibrosis.

[0228] In some embodiments, the reagent and / or composition increases the amount of plasma IL-10 protein, induces macrophage IL-10 gene expression, and reduces one or more of cardiac CD68 and IL1b gene expression. In some embodiments, the reagent and / or composition increases the amount of plasma IL-10 protein, induces macrophage IL-10 gene expression, reduces one or more of cardiac CD68 and IL1b gene expression, and induces a therapeutic effect on the subject's heart, thereby treating the subject's damaged, hypertrophic, fibrotic, inflamed, or dysfunctional heart. For example, treatment or application using the reagent and / or composition improves cardiac function, fibrosis, and / or other cardiac conditions in subjects with heart failure (e.g., heart failure with reduced or preserved ejection fraction) and / or cardiomyopathy (e.g., hereditary, heritable, or sporadic hypertrophic cardiomyopathy).

[0229] Reagent test kit This application also provides kits that include the reagents or compositions disclosed herein. As provided in this application, in some embodiments, the kits have been found to be useful for treating muscle diseases, heart conditions, or inflammatory conditions (e.g., those associated with viral infections). The kits may include the reagents described in this application and transfection reagents. The transfection reagents may be any suitable transfection reagents provided in this application. In some embodiments, the transfection reagents include one or more of lipids (e.g., lipids that form liposomes), PEGylated lipids, and extracellular vesicles. In some embodiments, the kits include pharmaceutically acceptable excipients as provided in this application. In some embodiments, the kits include casein and / or chitosan. The kits may include one or more containers (e.g., vials, ampoules, test tubes, flasks, or bottles) for containing one or more components of the kit. The kits may also include instructions for using the kits to treat conditions (e.g., HCM, HFpEF, muscular dystrophy, scleroderma, and inflammatory conditions associated with viral infections). Information and descriptions may be in the form of text, images, or both.

[0230] Additional Implementation Methods Some non-limiting embodiments of this disclosure are provided by embodiments numbered below.

[0231] 1. A method for treating a condition associated with aging, atrophy, inflammation, and / or fibrosis, comprising: administering to a subject requiring treatment for a condition associated with aging, atrophy, inflammation, and / or fibrosis an effective amount of a reagent that enhances the expression of a Trex1 gene product, wherein the reagent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0232] 2. The method according to embodiment 1, wherein the condition associated with aging, atrophy, inflammation, and / or fibrosis includes inflammation and / or fibrosis of the heart, skeletal muscle, or skin.

[0233] 3. The method according to embodiment 1 or 2, wherein the condition associated with aging, atrophy, inflammation, and / or fibrosis includes symptoms and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma.

[0234] 4. The method according to any one of the foregoing embodiments, wherein the inflammation-related condition includes symptoms or sequelae of infectious diseases or is related to immunotherapy.

[0235] 5. The method according to embodiment 4, wherein the infectious disease includes viral infection.

[0236] 6. The method according to any one of the foregoing embodiments, wherein the inflammation-related condition includes a cytokine storm.

[0237] 7. According to the method of embodiment 6, the inflammation-related condition includes autoimmune diseases.

[0238] 8. The method according to embodiment 7, wherein the autoimmune disease includes scleroderma or systemic sclerosis.

[0239] 9. The method according to any one of the foregoing embodiments, the conditions related to aging, atrophy, and fibrosis include symptoms or sequelae of infectious diseases, idiopathic pulmonary fibrosis, or cirrhosis.

[0240] 10. A method of treating heart disease or its symptoms, comprising: administering to a subject requiring treatment for heart disease or its symptoms an effective amount of an agent that enhances the expression of a Trex1 gene product, wherein said agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0241] 11. The method according to embodiment 10, wherein the cardiac disease includes symptoms and / or sequelae of heart failure.

[0242] 12. The method according to embodiment 10 or 11, wherein the cardiac condition includes hypertrophic cardiomyopathy.

[0243] 13. The method according to any one of embodiments 10 to 12, wherein the cardiac condition includes heart failure with preserved ejection fraction (HFpEF).

[0244] 14. The method according to any one of embodiments 10 to 13, wherein the cardiac disease includes symptoms or sequelae of infectious diseases.

[0245] 15. The method according to embodiment 14, wherein the infectious disease includes viral infection.

[0246] 16. The method according to any one of embodiments 10 to 15, wherein the subject suffers from heart disease.

[0247] 17. The method according to any one of embodiments 10 to 15, wherein the subject is at risk of developing heart disease.

[0248] 18. A method of treating a muscle disease or its symptoms, comprising: administering to a subject requiring treatment for a muscle disease or its symptoms an effective amount of an agent that enhances the expression of a Trex1 gene product, wherein said agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0249] 19. The method according to embodiment 18, wherein the muscle disease includes muscular dystrophy or cardiomyopathy.

[0250] 20. The method according to embodiment 18 or 19, wherein the muscle disease includes Duchenne muscular dystrophy.

[0251] 21. The method according to any one of embodiments 18 to 20, wherein the subject suffers from a muscle disease.

[0252] 22. The method according to any one of embodiments 18 to 20, wherein the subject is at risk of developing muscle disease.

[0253] 23. The method according to embodiment 22, wherein the subject is genetically predisposed to muscle diseases.

[0254] 24. A method for treating a disease associated with aging, tissue aging, or atrophy, comprising: administering to a subject requiring treatment for a disease associated with aging, tissue aging, or atrophy an effective amount of an agent that enhances the expression of a Trex1 gene product, wherein said agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0255] 25. The method according to any one of the foregoing embodiments, wherein the reagent does not contain isolated RNA comprising a nucleotide sequence having at least 95% identity with CGICCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0256] 26. The method according to any one of the foregoing embodiments, wherein the Trex1 gene product comprises Trex1 mRNA.

[0257] 27. The method according to any one of the foregoing embodiments, wherein the reagent comprises a nucleic acid that anneals to a first sequence in the Trex1 mRNA 5' UTR, the first sequence being different from a second sequence in the Trex1 mRNA 5' UTR, the second sequence being annealed to a nucleic acid comprising a nucleotide sequence including CGCCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0258] 28. The method according to embodiment 27, wherein the first sequence does not overlap with the second sequence.

[0259] 29. The method according to any one of embodiments 26 to 28, wherein the reagent stabilizes Trex1 mRNA or prolongs the half-life of Trex1 mRNA.

[0260] 30. The method according to any one of embodiments 1 to 28, wherein the reagent comprises a nucleic acid encoding a Trex1 gene product.

[0261] 31. The method according to embodiment 30, wherein the nucleic acid includes a promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product, wherein the promoter drives the expression of the Trex1 gene product.

[0262] 32. The method according to embodiment 30 or 31, wherein the nucleic acid comprises a vector.

[0263] 33. The method according to embodiment 32, wherein the vector is a viral vector or a plasmid.

[0264] 34. The method according to any one of embodiments 30 to 33, wherein the nucleic acid is contained in macrophages.

[0265] 35. The method according to embodiment 34, comprising administering a population of macrophages, wherein the population comprises an effective amount of an agent that enhances the expression of the Trex1 gene product.

[0266] 36. The method according to embodiment 30, wherein the nucleic acid comprises stable Trex1 mRNA.

[0267] 37. The method according to embodiment 36, wherein the stabilized Trex1 mRNA includes an engineered poly(A) tail.

[0268] 38. The method according to any one of the foregoing embodiments, wherein the reagent comprises one or more chemically modified nucleotides.

[0269] 39. The method according to embodiment 38, wherein the chemically modified nucleotide includes main chain modification.

[0270] 40. The method according to embodiment 39, wherein the main chain modification includes main chain sugar modification.

[0271] 41. The method according to any one of embodiments 38 to 40, wherein the one or more chemically modified nucleotides include locked nucleic acids (LNAs) and / or methylated nucleotides.

[0272] 42. The method according to any one of the foregoing embodiments, wherein the reagent alleviates DNA damage in inflamed and / or fibrotic tissue or in tissue at risk of inflammation and / or fibrosis.

[0273] 43. The method according to any one of the foregoing embodiments, wherein when an effective amount of the reagent is administered to the subject, the reagent enhances the expression of the Trex1 gene product in macrophages.

[0274] 44. A method for treating a condition associated with inflammation and / or fibrosis, comprising: upregulating Trex1 in macrophages of a subject requiring treatment for a condition associated with inflammation and / or fibrosis.

[0275] 45. A method of treating a condition associated with inflammation and / or fibrosis, comprising: administering to a subject requiring treatment for a condition associated with inflammation and / or fibrosis an effective amount of an agent that reduces DNA damage in inflamed and / or fibrotic tissue or in tissue at risk of inflammation and / or fibrosis, wherein said agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

[0276] 46. ​​The method according to any one of the foregoing embodiments, comprising administering an effective amount of the reagent intravenously, intramuscularly, intracardiacly, or orally.

[0277] 47. A method for promoting the anti-inflammatory activity of macrophages, comprising contacting a population of macrophages with an agent that enhances the expression of the Trex1 gene product, wherein the agent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CCUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), thereby promoting the anti-inflammatory activity of the macrophage population.

[0278] 48. The method according to embodiment 47, wherein the contact comprises administering an effective amount of the agent to a subject who requires treatment for conditions related to aging, atrophy, inflammation, and / or fibrosis, thereby promoting the anti-inflammatory activity of macrophages in the subject.

[0279] 49. The method according to embodiment 48, wherein the condition associated with aging, atrophy, inflammation, and / or fibrosis includes inflammation and / or fibrosis of the heart, skeletal muscle, or skin.

[0280] 50. The method according to embodiment 48 or 49, wherein the condition associated with aging, atrophy, inflammation, and / or fibrosis includes symptoms and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma.

[0281] 51. The method according to any one of embodiments 48 to 50, wherein the nucleic acid comprises a promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product, wherein the promoter drives the expression of the Trex1 gene product.

[0282] 52. The method according to embodiment 51, wherein the nucleic acid comprises a vector.

[0283] 53. The method according to embodiment 52, wherein the vector is a viral vector or a plasmid.

[0284] 54. The method according to any one of embodiments 47 to 50, wherein the reagent stabilizes Trex1 mRNA or prolongs the half-life of Trex1 mRNA.

[0285] 55. The method according to any one of embodiments 47 to 54, wherein the macrophage population comprises human macrophages.

[0286] 56. A composition for treating conditions associated with aging, atrophy, inflammation, and / or fibrosis, comprising: Nucleic acid that anneals to a first sequence in the 5' UTR of Trex1 mRNA, the first sequence being different from a second sequence in the 5' UTR of Trex1 mRNA, the second sequence annealing to a nucleic acid including the nucleotide sequence CGICCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), wherein the nucleic acid enhances the expression of the Trex1 gene product; Nucleic acid encoding the Trex1 gene product, wherein the nucleic acid is configured to overexpress the Trex1 gene product; and A population of macrophages with enhanced anti-inflammatory activity, wherein the macrophages in the population have enhanced expression of the Trex1 gene product and do not include exogenous RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3); Or a combination thereof.

[0287] 57. The composition according to embodiment 56, wherein the composition further comprises a pharmaceutically acceptable carrier.

[0288] 58. The composition according to embodiment 57, wherein the macrophages in the population are genetically modified to overexpress the Trex1 gene product.

[0289] 59. The composition according to embodiment 57 or 58, wherein the macrophages in the population are genetically modified to include nucleic acids, the nucleic acids including a promoter operatively linked to a nucleotide sequence encoding a Trex1 gene product, wherein the promoter drives the expression of the Trex1 gene product in the macrophages.

[0290] 60. The composition according to embodiment 59, wherein the nucleic acid comprises a vector.

[0291] 61. The composition according to embodiment 60, wherein the vector is a viral vector or a plasmid.

[0292] 62. Use of the composition according to any one of embodiments 56 to 61 in treating heart disease, muscle disease, inflammatory disease, or conditions related to aging and / or atrophy in subjects in need.

[0293] 63. Use of the compositions according to embodiments 56 to 61 in the preparation of a medicament for treating heart disease, muscle disease, inflammatory disease, or conditions related to aging and / or atrophy in subjects in need.

[0294] 64. An in vitro method for identifying a reagent that enhances the expression of a Trex1 gene product in target cells, comprising: contacting a candidate reagent with target cells; and measuring the expression level of a Trex1 gene product in the target cells after contact, wherein the candidate reagent is determined to be a reagent that enhances the expression of a Trex1 gene product when the measured expression level and / or activity level of the Trex1 gene product is higher than a suitable reference value.

[0295] All patents and other publications cited in this application; including references, granted patents, published patent applications, and co-pending patent applications, are expressly incorporated herein by reference for the purpose of describing and disclosing methods described in these publications, for example, that may be used in conjunction with the techniques described in this application. These publications were only published prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventor had no right to disclose prior information for any prior invention or any other reason. All statements regarding the dates or contents of these documents are based on information available to the applicant and do not constitute any admission of the accuracy of the dates or contents of these documents.

[0296] The description of embodiments in this application is not intended to be exhaustive or to limit the application to the precise forms disclosed. While specific embodiments and examples of this application are described for illustrative purposes, various equivalent modifications are possible within the scope of this application, as will be recognized by those skilled in the art. For example, although method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order or may perform functions substantially simultaneously. The teachings provided in this application can be suitably applied to other operational processes or methods. The various embodiments described in this application can be combined to provide other embodiments. If desired, aspects of this application may be modified to incorporate the composition, function, and concepts of the foregoing references and applications to provide other embodiments of this application. Furthermore, due to considerations of biological functional equivalence, some changes may be made to the protein structure without affecting the type or amount of biological or chemical action. These and other changes may be made to this application based on the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0297] Specific elements in any of the above embodiments may be combined with or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of this application have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments are required to exhibit such advantages to fall within the scope of this application.

[0298] The technology described in this application is further illustrated by the following embodiments, which should in no way be construed as further limitation.

[0299] Example Example 1: This non-limiting embodiment demonstrates the potential mechanism of action of the biological activity of non-coding RNA (ncRNA) synthesized from naturally occurring human small Y RNAs.

[0300] Non-coding RNAs (ncRNAs) mined from extracellular vesicles (EVs) are increasingly considered to be biologically active. This application reports the development of TY1, a synthetic ncRNA inspired by naturally occurring human small Y RNA, which is abundant in EVs derived from cardiac stromal / progenitor cells with immunomodulatory properties. Structural optimization yielded TY1, a 24-nucleotide chemically modified lead compound that alleviates cellular stress, inflammation, and fibrosis gene pathways in rodent and human macrophages and increases IL-10 secretion. RNA-RNA pull-down assays showed that TY1 interacts with Trex1's messenger RNA (mRNA). Trex1 is a DNA damage repair enzyme and a rapidly degrading exonuclease of cytoplasmic DNA. By binding to the trex1 5' UTR, TY1 (but not the disordered control RNA) stabilized Trex1 mRNA levels, thereby increasing IL-10 expression in macrophages. Intravenous administration of TY1 demonstrated cardioprotective effects in rat and porcine models of myocardial infarction (MI), which were eliminated by pre-depletion of macrophages and mimicked by adoptive transfer of macrophages treated with TY1 or Trex1. In a preclinical model of ischemia / reperfusion-induced MI, TY1 reduced scar size. Consistent with the core action of Trex1, TY1 alleviated DNA damage and aggregate body accumulation in the heart after MI. Inhibition of TREX1 in macrophages blocked the cardioprotective effect of TY1. Consistent with the core action of Trex1, TY1 alleviated DNA damage in the heart after MI. In conclusion, TY1, as a prototype of a novel ncRNA drug targeting genotoxic stress, thus exhibits superior disease-modifying bioactivity. This novel mechanism—pharmacological upregulation of TREX1 in macrophages—establishes TY1 as a prototype of a novel ncRNA drug with disease-modifying bioactivity.

[0301] Regenerative therapies have long been known for being more hype than for successful commercialization. 1 Mechanistic studies have shaken the classic paradigm of traditional stem cell transplantation, proliferation, and differentiation; instead, adult regenerative cell therapy works indirectly through the secretion of extracellular vesicles (EVs), which deliver their diverse molecular contents to target tissues. 2 Extracellular vesicles themselves possess disease-modifying biological activity. 3 Furthermore, by mining extracellular vesicles, specific factors can be identified as new therapeutic candidates. This "from cell therapy to specific factors" discovery paradigm is being explored in Cardiac Sphere-derived Cells (CDCs). 2 This has been fully demonstrated in extensive research. These cardiac stromal / progenitor cells 4 Clinical efficacy demonstrated in advanced Duchenne muscular dystrophy.5,6 They secrete non-coding RNA-rich (ncRNA) 7 Extracellular vesicles of microRNAs play a role. Although previous studies have primarily focused on the role of microRNAs (miRs) as potential effector molecules. 7-9 However, miRs are present in extracellular vesicles. 10 Relatively rare. Small Y RNAs, especially EV-YF1, are more prominent in human CDC EV cargoes. 4 The 56-nucleotide (nt) truncated product of a gene 10 When synthesized and packaged into lipid nanoparticles (LNPs), EV-YF1 showed efficacy in myocardial infarction (MI). 10 Angiotensin-induced cardiac hypertrophy 11 and hypertrophic cardiomyopathy 12 It has shown beneficial effects in the model. However, the clinical translation of EV-YF1 faces challenges: its length of 56 nucleotides is relatively long (all FDA-approved ncRNA drugs are 18-30 nt in length). 13 Moreover, it is unmodified, expected to be unstable and immunogenic. 14 To circumvent these limitations, TY1 was created, a novel, smaller (24 nt) chemical entity inspired by EV-YF1. This application demonstrates that TY1 exhibits significant therapeutic effects on myocardial infarction (MI) through inhibition of genotoxic stress in a macrophage-dependent mechanism.

[0302] Example 2: Structure-activity relationship study yielded the lead compound TY1.

[0303] This non-limiting example illustrates the development process of TY1. TY1 is a shorter and more stable novel chemical entity that conforms to the structural conventions of FDA-approved ncRNA drugs while retaining the biological activity of EV-YF1.

[0304] Drug development efforts began with small Y RNA species whose localization function was unknown but which were highly enriched in CDC EVs, and the bioactivity of the species in which they were particularly abundant was tested. One such species, EV-YF1, was extensively characterized and showed efficacy in a variety of MI and / or hypertrophy models. 10-12 . Figure 1A The aligned sequences of EV-YF1 (top; SEQ ID NO:1) and NT4 (end; SEQ ID NO:2) are shown. NT4 is the CDC EV. 15 Truncated compounds are also abundant in this group. Both EV-YF1 and NT4 increased the expression of the anti-inflammatory cytokine Il10 in rat bone marrow-derived macrophages (BMDM). Figure 1B This in vitro finding is highly correlated with in vivo disease-modifying bioactivity.10-12 Using NT4 to define a key target region of 24 nucleotides in length within EV-YF1, various modified versions were systematically prepared and screened in vitro for their performance in BMDM. 10 The ability to upregulate Il10 expression. First, the native sequence is mutated, then locked nucleic acid (LNA) is introduced, and finally methylated nucleotides or adenine are added. Figure 1C The overall goal is to optimize the structure while maintaining biological activity, following the structure-activity relationship knowledge learned from successful ncRNA drug development research. 16-18 Replace the first residue (guanine) with cytosine (NT4). 1G-C Replacing it with uracil or adenine (the latter being largely inert) produced a greater upregulation of Il10. Figure 1D Then, locked nucleic acid (LNA) that increases stem-loop structure stability was added to NT4. 1G-C In the structure 16 The oligonucleotide includes three alternating LNA residues (NT4) at each end. 1G-C Triple alternating LNAs enhanced NT4 1G-C The function of using whole LNA nucleotides (NT4) 1G-C (all LNA) or three consecutive LNA residues at each end (NT4) 1G-C Triple continuous LNA completely eliminates biological activity ( Figure 1E The optimal lead compound is NT4. 1G-C Triple alternating LNAs are named therapeutic YRNA 1, or TY1 ( Figure 1E ).

[0305] Subsequently, further modifications aimed at minimizing RNA degradation were investigated. Exonucleases targeting the 3' end can be modified by adding a methyl group (2'-O-methylation) to the ribose of the dNTP. 19 Alternatively, add adenine residues (studies have shown that adding one or two adenine residues provides maximum stability). 20 To inhibit it. In mouse BMDM, the addition of a single adenine (TY11m) or a methylated residue (at the 3' end guanine; TY11A) moderately increased Il10 expression. Figure 1F However, this observation does not hold true in human macrophages. Figure 1G Based on these combined results, TY1 was selected for further development.

[0306] In summary, compared to NT4, TY1 contains a point mutation (G to C) at its 5' end, and six LNA modifications at the underlined residues. Figure 1HAs a control, a randomized version (Scr) was created, which included the same nucleotides as TY1 but in a randomized order (and was confirmed to have no sequence homology with either the mouse or human genome), and had 6 LNA modifications at the same positions. Figure 1H Finally, to quantify stability, TY1 and its precursor molecules (EV-YF1 and NT4) were subjected to exonuclease degradation (RNAseR), which is the main degradation pathway for small RNAs in vivo. 21-23 Unlike the unmodified variants, which are degraded by RNase R in a concentration-dependent manner, TY1 exhibits significant stability upon treatment with increasing concentrations of RNase R. Figure 1I Finally, to determine therapeutic effects other than Il10 production, LPS-stimulated macrophages were treated with TY1, Scr, or a solvent. This mimicked EV-YF1. 10 and NT4 24 TY1 reduces the biological activity of stress and inflammatory markers (including P21) in BMDM. Figure 1J ), NFkb ( Figure 1K ), and Il6 ( Figure 1L Therefore, TY1 is a shorter and more stable novel chemical entity that conforms to the structural conventions of FDA-approved ncRNA drugs while retaining the biological activity of EV-YF1.

[0307] Figure 1: TY1 is an engineered small RNA with anti-inflammatory properties. (A) Comparison of EV-YF1 and NT4, both abundant in extracellular vesicles (EVs) secreted by glomerulonephritis-derived cells (CDCs). (B) As shown by EV-YF1, NT4 upregulated Il10 expression in rat bone marrow-derived macrophages (BMDMs) compared to the solvent control group (n=6 biological replicates per group). (C) Schematic diagram of a three-step screening process for NT4-derived structural variants to optimize activity. Step 1 (top): Mutagenesis; Step 2 (middle): Introduction of locked nucleic acid (LNA; Stage 2); Step 3 (bottom): Polyadenylation and methylation of 3' residues. (DG) Compound screening was performed in mouse and human macrophages using an Il10 expression assay, with n=3-4 biological replicates per group. (D) Step 1 screening: Different nucleotide substitutions were performed on the 5' nucleotide (guanine) (all groups compared to NT4). (E) Step 2 screening: including LNA variants (all groups are related to NT4) 1G-C(Comparison). (F, G) Step 3 screening: Evaluation of the effects of 3' end adenylation and methylation of TY1 in mouse and human macrophages (all groups compared with TY1). (H) Comparison of naturally occurring NT4 with its optimized, nature-inspired derivative (TY1). The sequence of the out-of-order variant (Scr) with the same nucleotide content and LNA is also depicted in (H) and used as a control in Figures (F and G). (I) Stability of TY1, NT4, and EV-YF1 under treatment with increasing concentrations of the exonuclease RNase R (n=3 biological replicates per group). Pretreatment of BMDM with TY1 before treatment with lipopolysaccharide (LPS) resulted in reduced levels of aging markers (P21; J) and inflammatory markers (Nfkb and IL6; K, L) compared with the solvent or out-of-order sequence groups (n=3 biological replicates per group). Columns and line dots represent group means, and error bars represent standard deviations (sd). Significance was determined using one-way ANOVA; ; ; P < 0.001. : indicates a comparison between each group and the solvent group; †: indicates a comparison between each group and the control group.

[0308] Example 3: TY1 activates genotoxic response genes and reduces cellular stress by stabilizing Trex1 mRNA.

[0309] The non-limiting embodiments described above demonstrate the biological activity of TY1 in mitigating cellular stress through the stabilization of Trex1 mRNA.

[0310] In BMDM, TY1 induced significant transcriptomic changes (heatmap, Figure 2A Ingenuity pathway analysis indicated that the DNA damage response is the main pathway activated by TY1. Figure 2B Analysis of differentially expressed DNA damage response genes revealed that the Trex1-cGAS / STING pathway was particularly enriched (marked by dashed boxes). Figure 2C , 2D Downstream of the genotoxic stress pathway, anti-inflammatory mediators ( Figure 2E ), endoplasmic reticulum unfolded protein response sensor (UPR: Figure 2F ), and the effector E1 to E3 ubiquitin system were all upregulated ( Figure 2I The reduced genotoxic stress, coupled with the enhanced ability to clear misfolded proteins, should theoretically suppress cellular stress signaling more broadly. The finding that TY1 downregulates MAPK signaling precisely confirms this prediction. Figure 2JOxidative DNA damage promotes endoplasmic reticulum stress, leading to decreased protein folding ability and the accumulation of stress particles containing misfolded proteins. Consistent with the inhibition of unfolded protein responses, TY1 reduced the accumulation of endoplasmic reticulum stress-induced misfolded proteins (aggregates) in LPS-treated BMDM compared to Scr or the solvent. Figure 2G ,2H).

[0311] To investigate the mechanism by which TY1 exerts its transcriptomic effects, the subcellular localization of TY1 under baseline and stress conditions was determined. In LPS-stressed BMDM, TY1 was preferentially located in the nuclear component, contrary to its predominantly cytoplasmic location in unstressed BMDM. Figure 2K To further investigate proteins that bind to TY1, a protein pull-down experiment was performed. Biotinylated TY1 (or native NT4) was incubated with BMDM lysis buffer, and the bound fragment was then analyzed by mass spectrometry. Figure 2L Both TY1 and NT4 are associated with nucleoporins, shuttle proteins (Ran GTPase system), and mRNA-binding proteins. Figure 2M and 2N ).

[0312] Figure 2: TY1 reduces cellular stress in macrophages by mitigating genotoxicity and is located on the nuclear membrane under stress conditions. Figure 2A A heatmap of RNA sequencing data from rat bone marrow-derived macrophages (BMDM) treated with solvent (PBS) or TY1 (n=4 biological replicates per group). Figure 2B Ingenuity pathway analysis (IPA) identified DNA repair as the primary associated pathway in TY1-treated macrophages (dashed box). Figure 2C , 2D The heatmap shows all differentially expressed DNA repair genes, with a particular enrichment of the Trex1 signaling pathway. Figure 2E Downregulation of inflammatory genes, Figure 2F Downregulation of the unfolded protein response (UPR) gene. Compared to disordered and solvent-treated LPS-stressed macrophages, TY1-treated LPS-stressed macrophages exhibited a lower load of misfolded protein aggregates (aggregates), as determined by the amyloid aggregate dye ProteoStat. Figure 2G , 2H Co-stained with DAPI; n=7-8 biological replicates per group. Scale bar: 100μm. Columns represent group means, and error bars represent standard deviation (SD). Two-tailed Student's t-tests (95% confidence intervals) were used to analyze two groups. One-way ANOVA was used to analyze three or more groups. P<0.05; P<0.01; . ( Figure 2I In bone marrow-derived macrophages, TY1 upregulated genes involved in the ubiquitination pathway and suppressed stress-induced ( Figure 2J MAP-ERK signal path. Figure 2K Compared to solvent-stimulated macrophages, TY1 was enriched in the nuclear components of LPS-stimulated macrophages (n=3 biological replicates per group). Figure 2L Biotinylated TY1 was incubated with macrophage lysate, followed by protein downsampling mass spectrometry analysis, which showed that TY1 and ( Figure 2M It is related to nucleoporins, RAN GTPase proteins, and mRNA-binding proteins. In summary, ( Figure 2N These findings suggest that TY1 is associated with nuclear membrane proteins.

[0313] Given that TY1 is located in the cell nucleus, the possibility of TY1 directly interacting with specific mRNA transcripts was explored. Therefore, two complementary methods were used for mRNA pull-down experiments: the "bait method," which involved incubating biotinylated TY1 with BMDM lysis buffer; or the "probe method," which involved treating rat BMDM with TY1 and then recovering it using a biotinylated antisense probe. Figure 3A The types of bound mRNAs recovered by either method were evaluated using RNA sequencing. A total of 99 common mRNAs were obtained by both methods. Figure 3B ), and then these mRNAs were compared with previous sequencing data ( Figures 2A to 2D Cross-matching was performed. Among the 99 genes identified by both the bait and probe methods, 14 were upregulated and 8 were downregulated. Figure 3C In rat BMDM, the gene with the greatest upregulation induced by TY1 was Trex1, namely 3' repair exonuclease 1 (previously in...). Figure 2C , 2D (As determined in the study), this gene is also upregulated in mouse macrophages. Figure 3M ).

[0314] In the mouse mononuclear cell line (Raw264.7 cells), TY1 increased the expression of TREX1 protein. Figure 3N , 3O Finally, Raw264.7 cells pre-incubated with TY1 were protected from serum starvation-induced DNA damage. Figure 3P , 3Q ).

[0315] Both mRNA pull-down methods identified Trex1 as a potential binding partner for TY1. Figure 3D , 3ESmall RNAs regulate mRNA transcripts through their 3' or 5' untranslated regions (UTRs). 28 UTR-luciferase assays showed that, compared to disordered binding, TY1 preferentially binds to the 5' UTR of human Trex1 (…). Figure 3F ), but not combined with 3' UTR ( Figure 3G Small RNA binding to 5' UTR can enhance mRNA stability, promote its loading into the ribosome complex, and increase its resistance to mRNA degradation. 29-31 Therefore, the idea that TY1 binds to and stabilizes Trex1 mRNA, thereby enhancing its expression, was verified. Treatment of BMDM with TY1 significantly upregulated Trex1 expression. Figure 3H Furthermore, in BMDM transfected with Trex1-silencing RNA (siRNA), TY1 partially restored Trex1 expression. Figure 3I ) and Il10 expression ( Figure 3J Furthermore, overexpression of Trex1 via plasmid knock-in (Trex1 OE) significantly increased Il10 expression in BMDM. Figure 3K In summary, TY1 upregulates the genotoxic stress mediator Trex1 by binding to and enhancing the expression of the Trex1 transcript. The upregulation of Trex1 enhances the expression of the anti-inflammatory cytokine IL-10, prompting us to examine whether Trex1 upregulation is sufficient to explain the beneficial effects of TY1.

[0316] Raw264.7 macrophages were treated with TY1, Scr, or solvent followed by the transcription inhibitor actinomycin D. The results showed that the mRNA lifetime curves of TREX1 were similar, thus ruling out the mRNA stabilizing effect of TY1. Figure 3L ).

[0317] Figure 3: TY1 alleviates cellular stress by stabilizing Trex1 mRNA and upregulates Trex1 expression in mouse macrophages. Figure 3A A schematic diagram illustrating two orthogonal methods used to identify TY1 RNA targets. Figure 3B The Venn diagram shows the genes identified using TY1 RNA targets. Figure 3C TY1 RNA targets upregulated and downregulated in RNA sequencing of TY1-treated macrophages (compared to solvent-treated macrophages; n=5 biological replicates per group). Figure 3D , 3E RNA-RNA sequencing readouts from the drop-down sequence indicate that the RNA was captured via a bait trapping method. Figure 3D ) and probe capture method ( Figure 3ETrex1 was enriched (n=3 biological replicates per group). Untranslated region (UTR)-luciferase assay showed that Trex1 was enriched via its 5' UTR (…). Figure 3F ) instead of 3' UTR ( Figure 3G This binding stabilizes the luciferase signal. Figure 3H The upregulation of Trex1 in bone marrow-derived macrophages was verified by qPCR (n=3 biological replicates per group). The inhibition of Trex1 in macrophages could be partially restored by TY1 treatment. Figure 3I ), and Il10 expression also partially recovered ( Figure 3J (Each group has n=4 biological replicates). Figure 3K Trex1 upregulation led to enhanced Il10 expression in macrophages (n=3 biological replicates per group). Bars represent group means, and error bars represent standard deviations (SD). Significance was determined by one-way ANOVA and Tukey analysis after the test. ; P<0.01; P < 0.001. Figure 3L TY1 does not affect the stability of existing TREX1 mRNA. For example, raw 264.7 macrophages treated with the transcription inhibitor actinomycin D (10 μg / ml) showed a comparable mRNA decay rate (as measured by qPCR). Figure 3M qPCR on mouse bone marrow-derived macrophages showed that Trex1 was upregulated in a dose-dependent manner with increasing TY1 concentration (n=3 biological replicates per group). Analysis was performed using Student's t-test with 95% CI. ; P<0.01; P < 0.001. Figure 3N , 3O In the mouse mononuclear cell line (Raw264.7 cells), TY1 increased TREX1 protein expression. Figure 3P , 3Q Comet experiments showed that Raw264.7 cells pre-incubated with TY1 were protected from serum starvation-induced DNA damage.

[0318] Example 4: TY1 enhances tissue repair in MI.

[0319] The non-limiting embodiments described show that TY1 enhances tissue repair in MI.

[0320] In vivo studies were initiated to investigate the toxicity of TY1. Healthy mice received intravenous injections of TY1 twice weekly (0.15 mg / kg, based on previous dose optimization of EV-YF1 (23), and also formulated in DharmaFECT®) for 4 weeks. Figure 4Z The results showed that, compared with the solvent or Scr control group (also formulated in DharmaFECT®), body weight ( Figure 4AA ), blood cell count ( Figure 4BB Organ weight () Figure 4CC ), and blood biochemistry analysis ( Figure 4DD None of them changed. The precursor molecule EV-YF1 10 and NT4 24 It exerts a cardioprotective effect in MI; therefore, we tested the in vivo bioactivity of TY1 in two MI models. Figure 4A and 4W In the first model, rats received an intravenous infusion of TY1, Scr, or a solvent (0.15 mg / kg) 20 minutes after MI. At 48 hours post-MI, a single dose of TY1 administered after reperfusion was sufficient to reduce the level of the ischemic biomarker cardiac troponin I in circulation compared to solvent or Scr. Figure 4B and 4L ), and reduce the infarct area ( Figure 4C , 4D (and 4K). The reduction in infarct area directly demonstrates the cardioprotective effect, while the lower cardiac troponin I level indicates a reduction in cardiomyocyte necrosis.

[0321] Consistent with the mechanism of action proposed by TY1, TREX1 protein levels are elevated ( Figure 4M ).

[0322] To verify the consistency with the in vitro study results (Figure 3), left ventricular sections of rats after MI were stained with macrophage markers CD68 and Trex1. Figure 4E , 4EE There was no change in tissue CD68 levels in all groups. Figure 4E , 4F TY1 levels (4EE, 4FF) indicate that TY1 does not affect overall macrophage infiltration. Tissue Trex1 levels were also similar across all groups. Figure 4E , 4G ,4EE); However, in the hearts of MI rats treated with TY1, the Trex1 level in macrophages (CD68+ cells) was significantly higher than that in the Scr or solvent group ( Figure 4H , 4GGMacrophages are relatively rare in the myocardium compared to cardiomyocytes, endothelial cells, and other more abundant cell types, which explains why a selective increase in Trex1 in macrophages is not discernible in the overall cardiac tissue. Despite their scarcity, macrophages can significantly alter the balance between death and recovery after myocardial infarction (MI). In fact, evidence that enhancing Trex1 in macrophages is sufficient to alleviate myocardial genotoxic stress after MI comes from phosphorylation of histone 2AX (pH2AX), a DNA damage marker. Figure 4I , 4N Staining of the heart tissue. Whole heart tissue analysis showed that, compared with the solvent or Scr group, the DNA damage in animals given TY1 was significantly reduced ( Figure 4J , 4O ).

[0323] The benefits of treatment last at least 3 weeks after MI. Figure 4P At this point, compared with the solvent group, rats treated with TY1 showed enhanced left ventricular function. Figure 4Q , 4R ), ventricular remodeling reduction ( Figure 4S , 4T ), and reduction of myocardial scarring ( Figure 4U , 4V ).

[0324] To determine whether these cardioprotective effects are not limited to rodents, researchers tested whether the cardioprotective effects of TY1 could be reproduced in clinically relevant porcine MI models. Figure 4W Similar to the rat model, intravenous infusion of TY1 after myocardial infarction (MI) in pigs reduced the infarct area. Figure 4X , 4Y ).

[0325] In summary, the results of the two complementary models demonstrate that TY1 is highly effective in cardiac tissue repair after myocardial infarction (MI). TY1 upregulates TREX1 (especially in infiltrating macrophages), reduces DNA damage, and enhances cardiac tissue repair after MI. Furthermore, TY1 upregulates Trex1 in infiltrating macrophages, thereby reducing DNA damage and tissue necrosis after MI.

[0326] Figure 4: TY1 reduces infarct area in a rat MI model; TY1 reduces infarct area in a pig MI model, and healthy animals tolerate chronic intravenous treatment with TY1 well. Figure 4A Study design for TY1 administration in a rat model of acute myocardial infarction (n=4 to 5 animals per group). Rats underwent ischemia-reperfusion injury (45 minutes of ischemia), followed by intravenous administration of TY1 (0.15 mg / kg), a TY1 randomized control (0.15 mg / kg), or a solvent. 48 hours post-injury, animals treated with TY1 showed ( Figure 4BLower cardiac troponin levels, and ( Figure 4C , 4D ( ) Reduced infarct area. Figure 4E Immunofluorescence images of the left ventricle in MI animals (DAPI, CD68, and Trex1; scale bar: 100 μm). Pooled data (n=3 to 4 animals per group) showed considerable macrophage infiltration (CD68; Figure 4F ) and Trex1 ( Figure 4G ).However,( Figure 4H Compared to the solvent group or the disordered group, macrophages in the TY1-treated group showed significantly higher Trex1 levels. Figure 4I , 4J Compared with the solvent group and the disordered group, the TY1-treated group showed lower levels of genotoxic stress, as measured by the DNA damage marker phosphorylated H2AX (pH2AX, scale bar: 1 mm). Lines represent group means, and error bars represent standard deviations (sd). Significance was determined by one-way ANOVA. ; ; . ( Figure 4K 48 hours after injury (see) Figure 4A Animals receiving TY1 showed a reduction in infarct size. Figure 4L 48 hours after injury (see) Figure 4A Animals receiving TY1 had lower levels of cyclic cardiac troponin (cTNI). Figure 4M Western blot analysis showed that TREX1 levels were increased in the left ventricular tissue of animals receiving TY1 compared to the disordered group or the control group. Figure 4N Compared to the solvent group and the disordered group, the TY1-treated animals showed lower levels of genotoxic stress, as measured by phosphorylated H2AX (pH2AX, scale bar: 1 mm), a DNA damage marker. Figure 4O Compared to the solvent group and the disordered group, the TY1-treated animals showed lower levels of genotoxic stress, as measured by the DNA damage marker phosphorylated H2AX (pH2AX). Figure 4P A study design involving long-term follow-up of rats with myocardial infarction (MI) after a single dose of TY1, Scr, and solvent. Rats receiving TY1 maintained their ejection fraction (...). Figure 4Q ), minor axis shortening rate ( Figure 4R ), end of systole ( Figure 4S ), and end-diastolic volume ( Figure 4T ), and reduced the fibrous load ( Figure 4U , 4V The line represents the group mean, and the error bars represent the standard deviation (sd). Significance was determined by one-way ANOVA. ; ; . ( Figure 4W Study design for the administration of TY1 in a pig model of acute myocardial infarction (n=5 animals per group). Pigs underwent ischemia-reperfusion injury (90 minutes of ischemia), followed by intravenous infusion of TY1, a TY1 randomized control (0.15 mg / kg), or a solvent. Figure 4X , 4Y 48 hours after injury, pigs receiving TY1 showed a smaller infarct area compared to those receiving disordered or solvent-based treatment. Lines represent group means, and error bars represent standard deviations (SD). Significance was determined by one-way ANOVA. ; ; . ( Figure 4Z Study design for chronic intravenous (retroorbital) administration toxicity studies (n=5 animals per group). Figure 4AA The curves showing changes in animal body weight over several cycles of the TY1 treatment. Figure 4BB Complete blood cell count, ( Figure 4CC Organ weight, and ( Figure 4DD Blood biochemical parameters of animals at week 4. Immunofluorescence images of the left ventricle of (EE)MI animals (DAPI, CD68, and TREX1, scale bar: 100 μm). Pooled data (n=3 to 4 animals per group) showed comparable macrophage infiltration (CD68; Figure 4FF ). Figure 4GG Compared with the solvent group or the disordered group, TREX1 was also enriched in the macrophages of animals treated with TY1. Columns represent group means, and error bars represent standard deviations (SD). Significance was determined by one-way ANOVA. ; ; Scale bar: 100μm.

[0327] Example 5: Cardioprotective effect of TY1 mediated by macrophages The non-limiting embodiments described above demonstrate that macrophages mediate the cardioprotective effect of TY1.

[0328] TY1 upregulates Trex1 in cardiac macrophages, but not extensively in cardiac tissue. This observation prompted us to investigate the role of macrophages as potential effector cells that benefit from TY1. Therefore, we studied macrophages in exhausted rats before myocardial infarction (MI). Figures 5A to 5C When TY1 was administered, animals with depleted macrophages did not show a reduction in infarct area compared to the Scr group, while animals with functional macrophages showed a significant cardioprotective effect. Figure 5B , 5C This indicates that macrophages are essential for TY1 to exert its beneficial effects in vivo. To determine whether macrophages are sufficient to confer cardioprotective effects, plasmids overexpressing TY1, Scr, or Trex1 were used. Figure 5D ), or TY1 plus anti-TREX1 siRNA (siTREX1: Figure 5G TY1-treated macrophages or Trex1-enriched macrophages were used to transfect rat BMDM cells and then adopted. Animals receiving TY1-treated macrophages or Trex1-enriched macrophages had significantly smaller infarct areas compared to the Scr or solvent groups. Figure 5E , 5H 5F and 5I). Therefore, adoptive transfer of TY1-treated macrophages was sufficient to induce cardioprotective effects, while infusion of macrophages overexpressing Trex1 mimicked this effect. In summary, these findings suggest that macrophages are a necessary and sufficient mediator for TY1 therapy. Additional findings regarding siTREX1 blocking the cardioprotective effect of TY1 ( Figure 5H and 5I This directly links the upregulation of TREX1 in macrophages to the mechanism of action of TY1 and the conclusion that "macrophages are essential and sufficient for the cardioprotective effect of TY1," which is caused by the upregulation of TREX1.

[0329] Figure 5: Cardioprotective effects of TY1 mediated by macrophages. Figure 5A (B, C) Macrophages in rats were depleted by daily intravenous injection of clophosphate prior to induction of myocardial infarction. Twenty minutes after reperfusion, animals were given TY1, randomized, or control. In animals containing functional macrophages, TY1 reduced scar size (compared to the solvent and randomized groups). However, macrophage depletion in rats attenuated the therapeutic activity of TY1, resulting in scar size comparable to the solvent or randomized groups (B, C; n=4 animals per group). (D) In ​​another study, MI rats received tail vein infusion of macrophages transfected with TY1, randomized, solvent, or Trex1-activating plasmids (3 × 10⁻⁶). 6 (D; n = 3 to 5 animals per group). (E, F) MI animals given macrophages overexpressing TY1 or Trex1 showed significantly reduced scar size compared to animals given macrophages transfected with disordered or solvent-mediated macrophages. (G) In another study, MI rats received tail vein infusion of macrophages transfected with TY1, disordered, solvent-mediated, or TREX1-activating plasmids (3 × 10⁻⁶ cells / animal). 6 (1 cell / animal) (G; n = 3 to 5 animals per group). (H, I) MI animals given macrophages overexpressing TY1 or TREX1 showed significantly reduced scar size compared to animals given macrophages transfected with disordered or solvent-transfected macrophages. Lines represent group means, and error bars represent standard deviations (SD). Significance was determined by one-way ANOVA; ; ; .

[0330] Example 6: The non-limiting embodiments summarized the results shown in Examples 2 through 5. Small synthetic non-coding RNA molecules, inspired by the natural cargo components of EVs, exhibited significant biological activity in MI, a disease characterized by inflammation and loss of healthy cardiac tissue. The benefits of TY1 are specific: the out-of-order version is ineffective, and its direction of change is opposite to that expected from the non-specific immunogenicity that plagues many other non-coding RNA drugs. 17 This application demonstrates that this novel bio-based drug is effective in two different animal models of myasthenia gravis (MI). TY1 is the product of a novel discovery paradigm: mining previously unrecognized ncRNAs from EVs and then using these natural compounds as bioinspiration for novel chemical entities. Unlike previous ncRNA drugs designed to target specific genetic sites, TY1... 37 TY1 is derived from a natural product whose mechanism of action is not yet fully understood. This invention first documented its biological activity and then explored its mechanism of action.

[0331] TY1 exerts its tissue repair function by enhancing cells' ability to alleviate genotoxic stress. Mechanistic analysis identified Trex1 as a target of TY1. By binding to the 5' UTR of Trex1 mRNA, TY1 enhances the translation and biological activity of Trex1. Trex1 degrades DNA fragments that would otherwise activate cGAS-STING innate immune signaling and promote inflammation. 38 In fact, TREX1 deficiency is associated with systemic lupus erythematosus and other autoimmune diseases. 39,40 Although Trex1 has not been previously identified as a drug target, it is logically predicted that its enhancement will reduce tissue damage associated with aseptic inflammation, as seen in MI.

[0332] Furthermore, the study showed that the cardioprotective effect of TY1 in vivo requires the participation of macrophages, and this effect can be mimicked by adoptive transfer of macrophages overexpressing Trex1. This finding is not surprising, as macrophages are known to be key mediators of extracellular vesicle (EV) cardioprotective effects. 9,41,42 However, the fact that macrophages are both essential and sufficient for the biological activity of TY1 in vivo significantly simplifies the process of elucidating the mechanism. This novel, nature-inspired chemical entity functions in a way never before seen in approved non-coding RNA drugs, none of which rely on macrophages to exert their effects (at least not by design).

[0333] These findings have profound implications. Although this application focuses on MI, the same cellular stress pathways play important roles in a variety of pathological processes. Therefore, TY1 warrants testing in other disease models driven by DNA damage and / or inflammation, including but not limited to scleroderma. 43,44 Duchenne muscular dystrophy 45,46 Unlike existing ncRNA drug libraries, TY1 does not function as a miR or small interfering RNA, nor is it an aptamer or antisense molecule, thus becoming a prototype for a new class of RNA drugs. These findings highlight the potential of studying previously overlooked ncRNA molecules from EVs in developing next-generation therapeutic candidates.

[0334] Example 7: Experimental Procedure The non-limiting embodiments illustrate the experimental materials and procedures used in Examples 2 to 5.

[0335] Macrophage drug screening Synthesis and Formulation of RNA Compounds: RNA compound TY1 and its derivatives (IDT) were synthesized, and the synthesized product was mixed with 3 μl of DharmaFECT® transfection reagent (Horizon Discovery) in serum-free medium to a final volume of 100 μl. After shaking incubation (to form liposome-RNA complexes), the formulation was added to macrophage culture medium to a final concentration of 80 nM for in vitro experiments. For in vivo (intravenous) application, a similar formulation method was used to achieve a dose of 0.15 mg / kg. The same procedure was repeated for each new chemical variant of TY1 and for Scr.

[0336] Rodent bone marrow cell isolation, macrophage differentiation and activationFemurs were isolated from 7- to 10-week-old Wistar Kyoto rats or C57BL6 mice according to experimental requirements. The bone marrow was washed with phosphate-buffered saline (PBS) and then filtered through a 70 μm filter. Red blood cells were lysed with ACK lysis buffer (A1049201, Invitrogen); the remaining cells were resuspended in IMDM medium (Gibco) containing 20 ng / ml M-CSF (RP8643, Fisher Scientific) and plated. The medium was changed every 2 to 3 days until day 7, at which point bone marrow-derived macrophages (BMDM) were produced. BMDM were encapsulated in DharmaFECT® and transfected with small Y RNA (or Scr; 80 nM). For lipopolysaccharide (LPS) treatment, macrophages were pretreated for 3 hours with a solvent (DharmaFECT® + PBS), TY1 (80 nM, dissolved in DharmaFECT® + PBS), or a TY1 Scr control (80 nM, dissolved in DharmaFECT® + PBS), followed by LPS treatment (10 ng / ml; Cayman Chemical). RNA was extracted and sequenced 24 hours after each test reagent treatment (see below), or analyzed by quantitative polymerase chain reaction (qPCR) to determine transcriptional levels (depending on experimental requirements).

[0337] Human bone marrow-derived macrophages Human peripheral blood mononuclear cells (STEMCELL Technologies) were purchased and cultured in RPMI 1640 medium containing 10% FBS and human M-CSF (Invitrogen) to prepare macrophages. After encapsulation in DharmaFECT®, the macrophages were transfected with small Y RNA (or Scr; 80 nM). RNA was extracted 24 hours after treatment with each assay reagent and analyzed by quantitative polymerase chain reaction (qPCR) to determine the transcriptional levels of the anti-inflammatory cytokine IL10 and the housekeeping enzyme HPRT1 as an endogenous control.

[0338] Comet Experiment: Transfect BMDM cells cultured in IMDM and 2% FBS in Opti-MEM with TY1, solvent (Dharmafect only), or control (untreated) for 4 to 5 hours. After transfection, replace the medium with fresh IMDM containing 2% FBS and incubate overnight. Transfect Raw264.7 cells cultured in DMEM (ATCC) and 2% FBS in Opti-MEM with TY1, randomized, or control (untreated) for 4 to 5 hours. After transfection, replace the medium with fresh DMEM containing 2% FBS and incubate overnight.

[0339] Cells were washed twice with PBS, then incubated at 37°C with CTS Versene (Gibco) for 5 minutes, and gently scraped off with a cell scraper to separate the cells. Cells were centrifuged at 700×g for 2 minutes, the supernatant was discarded, and the cell pellet was washed once with cold PBS. Cells were centrifuged again and resuspended in 25 μL of cold PBS. Cells were frozen at -80°C to permeabilize the cell membrane. A positive control was prepared using healthy cells subjected to serum starvation on ice for 6 hours. After permeabilization, cells were resuspended at 1×10⁻⁶. 5 cells / mL to 5×10 5 Cells / mL concentration. Mix cells with low-melting-point comet agarose at a 1:10 volume ratio, then pipette onto a microscope slide pre-coated with 1% agarose. Fix the agarose using a glass coverslip. Incubate the slide at 4°C in the dark for 15 minutes, then remove the coverslip. Incubate the slide at 4°C for another 15 minutes to allow it to solidify completely. Immerse the slide in cold lysis buffer (2.5M NaCl, 100mM EDTA, 10% DMSO, 10% 10X lysis buffer (from Cell Biolabs), pH 10.0) at 4°C in the dark for 60 minutes to further permeate the cells. Remove the lysis buffer and immerse the slide in cold alkaline solution (300mM NaOH, 1mM EDTA) at 4°C for 30 minutes to denature the DNA. Remove the alkaline solution and transfer the slide to a horizontal cold electrophoresis tank. Add cold alkaline electrophoresis buffer (300 mM NaOH, 1 mM EDTA). Apply a voltage of 1 volt / cm for 45 minutes and a current of 300 mA. Remove the slide from the electrophoresis tank and wash it three times with pre-cooled deionized water for 2 minutes each time. Wash the slide with cold 70% ethanol for 5 minutes. Dry the slide at 37°C for 30 minutes. Stain the slide with diluted Vista Green DNA dye from CellBiolabs (dissolved in TE buffer, pH 7.5) at room temperature for 15 minutes, then dry it and observe it using Cytation 5 with a GFP FITC filter. Quantify the comet images using the "Cell Analysis" program in Cytation 5, measuring the size, area, and fluorescence intensity of the comet's head and tail to calculate the olive tail moment.

[0340] RNA extraction and quantitative PCRTotal RNA was extracted from mouse, rat, and human cells using the RNeasy Plus Kit (74136, QIAGEN), MaXtract HighDensity (129056, QIAGEN), and / or the miRNeasy Mini Kit (217004, QIAGEN). cDNA was synthesized from the RNA using the High-capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems) according to the manufacturer's instructions. Real-time PCR was performed in triplicate on a QuantStudio 12K Flex Real-Time PCR system (Thermo Fisher Scientific) using the following TaqMan gene expression assay probe (CAT#: 4331182; corresponding assay IDs are shown in Table 2); differential gene expression analysis was performed using the ΔΔCt method.

[0341] Table 2: TaqMan gene expression assay probe ID

[0342] RNA sequencing Following the method described in reference 47, cellular and tissue RNA samples were sequenced at the Cedars-Sinai Genomics Core. Total RNA concentration was assessed using a Qubit fluorometer (Thermo Fisher Scientific, Waltham, MA), and its quality was evaluated using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Ribosomal RNA was removed using the QIAseq Chain-Specific RNA Library Kit (Qiagen, Hilden, Germany) and the QIAseq FastSelect-rRNA HMR Kit (Qiagen). Library concentration was measured using a Qubit fluorometer, and library size was assessed using a bioanalyzer. After multiplexing, the libraries were sequenced using 75 bp single-end sequencing on a NovaSeq 6000 (Illumina, San Diego, CA). An average of approximately 50 million reads were generated per sample.

[0343] Data AnalysisThe raw sequencing data were split and converted to FASTQ format using bcl2fastq v2.20 (Illumina, San Diego, California). Reads were aligned to the GRCm38 reference genome (http: / / www.gencodegenes.org) using STAR (version 2.6.1) with default parameters. Gene expression was quantified using RSEM (version 1.2.28) to generate a raw expression count matrix with genes as rows and samples as columns. The raw expression counts were normalized and batch effects corrected using DESeq2 (version 1.26.0) 6.

[0344] Intracellular protein aggregate assay BMDM cells were pretreated with TY1 or Scr for 4 hours, followed by overnight treatment with LPS (10 ng / ml). After washing twice with PBS, cells were fixed in 4% PFA for 15 minutes, permeabilized, and incubated with PROTEOSTAT dye (1:10,000 dilution) at room temperature for 30 minutes (ENZ-51035-K100, Enzo Life Sciences). PROTEOSTAT-stained cells were imaged using epifluorescence microscopy to observe aggregates and aggregate-like inclusion bodies.

[0345] Nuclear / cytoplasmic RNA isolation and qPCR analysis Nuclear and cytoplasmic RNA were purified using a cytoplasmic and nuclear RNA purification kit (NorgenBiotek) according to the manufacturer's instructions. Reverse transcription was performed using the TaqMan® microRNA Reverse Transcription Kit (Applied Biosystems) with TY1-specific primers according to the manufacturer's instructions. Real-time PCR was performed using the TaqMan Fast Advanced Master Mix and an appropriate TaqMan gene expression assay kit (Thermo Fisher Scientific). Reactions were performed in triplicate on a QuantStudio™ 12K Flex real-time PCR system, with snu6 as an internal control (Life Technologies) for calibration. Cycling conditions were performed according to the TaqMan protocol. Where appropriate, the fold change in gene expression was determined using the 2-ΔΔCt method.

[0346] Protein pull-down experimentThe 3' end of the RNA strand was labeled with desulfurized biotinylated cytidine diphosphate (CYP2P) using T4 RNA ligase (Thermo Fisher Scientific Pierce RNA 3' Desulfurization Biotinylation Kit). The labeled RNA was captured by incubating 50 μL of streptavidin magnetic beads in RNA capture buffer at room temperature for 30 min. The beads were washed twice with 20 mM Tris (pH 7.5), once with protein-RNA binding buffer, and then 400 μg of BMDM extract was added to each sample. Samples were incubated at 4°C for 2 h, washed three times with washing buffer, and eluted after incubation at 37°C for 15 min with biotin elution buffer. Samples were then analyzed by mass spectrometry (Molecular Instrument Center, UCLA).

[0347] RNA-RNA pulldown experiment Bait trapping method: To identify the TY1 mRNA target by bait capture, lysis buffer (400 μg protein extract per sample) was incubated with 3' biotinylated TY1 and Scr sequences. Samples were washed with binding buffer and wash buffer to remove unbound material (using a magnetic rack), and RNA was extracted using a column-based RNA purification kit (miRNAeasy; Qiagen). After purification, RNA concentration was measured and normalized, and then sent to Cedars-Sinai Genomics Core for RNA quality assessment (to ensure RNA integrity index [RIN]), followed by total RNA sequencing.

[0348] Probe-based mRNA capture: BMDM was incubated with 80 nM TY1, Scr, or solvent for 18 hours. Cell lysates were then obtained and incubated with the corresponding probe sequences for each group (i.e., TY1 probes were used for TY1-treated samples; Scr-specific probes were used for Scr-treated samples; and two probe types were used as negative controls for the solvent group; 100 pmol per sample) for 18 hours. RNA was then extracted and sequenced according to the method described in the bait capture method above.

[0349] 3'UTR and 5'UTR binding assay 3'UTR Binding Assay: HT1080 cells were cultured in IMDM containing 10% FBS and plated to 60%-80% confluence prior to transfection. Cells were transfected for 4 hours with plasmids containing the 3' UTR sequence of human TREX1, located upstream of the Gaussian luciferase reporter gene, at a concentration of 120 ng / well (in FuGene HD transfection reagent [Promega], Fugene:vector = 5:1) (or the corresponding control; Gene Copoeia). Conditioned medium was then collected from the wells, and luminescence intensity was measured using a microplate reader with the Secrete-Pair Dual Luciferase Assay Kit (Gene Copoeia).

[0350] 5'UTR Binding Assay: HEK293 T cells were cultured in EMEM containing 10% FBS and plated to 60%-80% confluence before transfection. Cells were transfected for 4 hours with plasmids containing the human TREX15' UTR sequence located upstream of the firefly luciferase reporter gene at a concentration of 120 ng / well (in DNAfectin 2100 transfection reagent [ABM]) (or the corresponding control; ABM, Inc.). The medium was then replaced with complete medium and incubated overnight. Cells were then transfected for 5 hours with 80 nM TY1, Scr, or solvent prepared in DharmaFECT®. The luminescence intensity of each well was measured the next day using a luciferase assay kit (ABM) via a microplate reader.

[0351] Transcriptional repression assay: Raw 264.7 cells (ATCC) were cultured in DMEM containing 2% FBS until 80% confluence, and transfected with solvent (DharmaFECT® only) or 8 nM randomized or TY1 for 4 hours. The medium was then replaced with fresh medium containing 10 μg / ml actinomycin D (in DMSO; Sigma Aldrich). Cellular RNA was collected at 0, 1, 2, and 3 hours after actinomycin treatment to measure the attenuation of existing TREX1 mRNA.

[0352] Laboratory animals: All studies were conducted at Cedars-Sinai Medical Center in accordance with the Institutional Animal Care and Use Committee guidelines.

[0353] Rat ischemia / reperfusion modelFemale Wistar Kyoto rats aged 7 to 10 weeks (Charles River Laboratories, Wilmington, MA) were housed in a pathogen-free facility (cage bedding: Sani-Chips, PJ Murphy) under a 14-hour / 10-hour light / dark cycle, with free access to food (PicoLab Rodent Diet 20 [number: 5053], Lab Diet) and water. To induce myocardial infarction (MI), anesthetized rats underwent open-chest surgery at the fourth intercostal space to expose the heart. The left anterior descending (LAD) coronary artery was ligated with 7-0 silk sutures for 45 minutes, and then the ligation was released to allow reperfusion. Twenty minutes later, solvent (PBS containing DharmaFECT®), TY1, or Scr (all at a dose of 0.15 mg / kg, prepared in DharmaFECT® as described above) was injected into the retroorbital space.

[0354] Depletion of macrophages using chlorphospholiposomes To deplete macrophages, rats were pre-infused with 1 mL of clophosphamide liposomes via tail vein for 3 consecutive days prior to MI induction. 41 .

[0355] Adoptive transfer of macrophages Rat BMDM (prepared as described above) was incubated with solvent (DharmaFECT® + PBS), 80 nM TY1, or 80 nM Scr (prepared in DharmaFECT®), or transfected with the Trex1 activation plasmid (Trex1 (untagged ORF) - rat triple repair exonuclease 1 (Trex1); CAT#: RN203882, ORIGENE) prepared in FuGENE HD (Promega) transfection reagent for 24 hours. In the MI model, 20 minutes after reperfusion, each animal received a single tail vein infusion of 3 × 10⁻⁶ saturates. 6 Several BMDMs, which have been treated with TY1, Scr, or solvent for 24 hours as described above.

[0356] Measurement of infarct area in rats Two days after the initial myocardial infarction (MI), 10% KCl was injected into the left ventricular lumen. The heart was removed, washed with PBS, and sectioned into 1 mm thick sections from the apex to the base above the infarct area. The sections were incubated with 1% 2,3,5-triphenyl-2H-tetrazole chloride (TTC, Sigma-Aldrich) solution at 37°C in the dark for 30 minutes and then washed with PBS. The sections were then imaged and weighed. The infarct area (white) was delineated from the biopsy tissue (red) and analyzed (ImageJ software). The infarct mass in the tissue section was calculated using the following formula: (infarct area / total area) / weight (g).

[0357] Cardiac troponin-I ELISA Blood was collected from the animals into EDTA tubes at 24 hours (from the tail vein) or at the study endpoint (from the LV cavity). Plasma was obtained by centrifugation at 4000 rpm for 15 minutes after incubation at 4°C for 30 minutes. Cardiac troponin I was quantified using a rat cardiac troponin-I ELISA kit (Life Diagnostics) according to the manufacturer's instructions.

[0358] Immunohistochemistry Tissue was embedded in an OCT compound and frozen in pre-cooled 2-methylbutane in liquid nitrogen, then stored at -80°C until sectioning. Using a cryostat (CM3050S, Leica), the heart was sectioned horizontally at the midpoint of the papillary muscle in transverse sections into 6 μm thick continuous sections, which were then mounted on ultra-resistant microscope slides. The frozen heart sections were fixed with 4% paraformaldehyde solution (Fisher Scientific, AAJ19943K2) for 10 minutes, washed with cold PBS, permeabilized with 0.25% Triton™ X-100 (Millipore Sigma, T8787), and blocked at room temperature (protein blocking solution, Dako [Sigma-Aldrich, S4521] containing 0.05% saponin) for 30 minutes. After 30 minutes of blocking, the sections were incubated overnight at 4°C with primary antibody diluted in blocking solution. Primary antibodies were used as follows: CD68 (Abcam ab125212), TREX1 (NBP1-76977, NovusBiologicals), and pH2AX (D27C4, Cell Signaling Technologies). After overnight incubation, sections were washed with PBS (3 times, 5 minutes each) and incubated with a suitable Alexa Fluor-conjugated secondary antibody (1:500, Invitrogen) at room temperature for 2 hours. After a second incubation, sections were washed with PBS (3 times, 10 minutes each) and mounted with DAPI-containing Fluoroshield mounting medium (Sigma-Aldrich). Sections were imaged using a fluorescence microscope (Cytation 5, Biotek) and quantified using Cytation 5 or ImageJ software. Summary data were generated using data from at least 4 fields of view per cardiac section on average.

[0359] porcine ischemia / reperfusion modelAdult female Yucatan miniature pigs were sedated beforehand by intramuscular injection of ketamine 20 mg / kg, atropine 0.05 mg / kg, and acepromazine 0.25 mg / kg. Subsequently, the animals were intubated by intravenous administration of propofol 2 mg / kg to 4 mg / kg until effective, and anesthesia was maintained with 2% to 3% isoflurane. For treatment of ventricular arrhythmias, a loading dose of amiodarone 10 mg / kg was administered intravenously, followed by 0.5 mg / kg intravenously as needed, along with lidocaine 2 mg / kg / min. Anticoagulation therapy was administered via intravenous heparin 100 IU / kg. The proximal left anterior descending artery was blocked for 90 minutes using an angioplasty balloon placed under fluorescein guidance, followed by balloon removal to achieve reperfusion. Twenty (±10) minutes after MI, animals received an intravenous injection of 0.15 mg / kg of TY1 or Scr (prepared in DharmaFECT® + PBS), or the solvent (DharmaFECT® + PBS). Blood samples were collected before balloon occlusion, after reperfusion, and at the study endpoint. Two days after MI, pigs were anesthetized and underwent thoracotomy. During the MI procedure, the angioplasty balloon was placed at the level of the original occlusion. With the balloon deflated, thioflavin T (50 ml, 2% solution diluted in PBS) was injected directly into the left atrium for 60 seconds. The angioplasty balloon was then inflated, and gentian violet (50 ml, 1.6% solution diluted in 40 ml PBS and 10 ml ethanol) was injected directly into the left atrium for 60 seconds. Finally, the piglets were euthanized, and the heart was removed and sectioned into 1 cm thick short-axis sections. Gentian violet stains non-ischemic areas blue; areas of the heart not perfused with gentian violet represent areas of ischemic risk (AAR). Thioflavin T, a fluorescent dye (observed under UV light), stains the vascular endothelium that receives blood flow. Ventricular transverse sections were then incubated with 2% TTC at 37°C for 20 minutes. TTC stained viable myocardium brick red, while infarcted areas appeared white / yellow.

[0360] Statistical analysis: Statistical parameters, including sample size (n), descriptive statistics (mean and standard deviation), and significance, are reported in the figures and captions. The statistical significance of differences between groups is tested using Student's test or ANOVA combined with Tukey's post-hoc test. Differences with a p-value < 0.05 are considered significant.

[0361] Example 8: Graphical Summary: Two naturally occurring small Y RNAs with therapeutic bioactivity, namely EV-YF1 and its shorter truncated version NT4, provided bioinspiration for structure-activity relationship optimization studies, leading to the development of the lead candidate TY1. TY1 alleviates cardiac damage by enhancing the translation of the genotoxic stress regulator Trex1. Upregulation of Trex1 and inhibition of genotoxic stress in macrophages are beneficial for tissue repair of damaged myocardium. Figure 6 ).

[0362] Example 9: Pharmacodynamics Given that TY1's mechanism of action involves upregulating TREX1 in monocyte-derived macrophages, animals were fed TY1, peripheral blood mononuclear cells (PBMCs) were isolated, and TREX1 levels were assessed at 3, 6, and 12 hours post-administration. Figure 7A Three hours after feeding, TREX1 levels in PBMCs significantly increased. Figure 7B Therefore, although TY1 was undetectable in plasma, there was clear evidence of a mechanism-driven biomarker in circulating PBMCs 3 hours after ingestion, indicating that it played a role.

[0363] Figure 7: In vivo pharmacodynamics of TY1 (A) Schematic diagram of pharmacodynamic studies. Animals were fed a predetermined dose of TY1 (0.2 mg / kg), and blood samples were collected at baseline, 3 hours after administration, and 12 hours after administration. (B) Peripheral blood mononuclear cells were isolated, and RNA was purified to assess TREX1 expression by qPCR. Columns represent the mean, and error bars represent the standard deviation (sd). Significance was determined by one-way ANOVA. ; ; .

[0364] Increased TREX1 levels reduce DNA damage responses, thereby inhibiting the innate immune cascade and reducing inflammation (e.g., Figure 8 (As shown).

[0365] References 1. Blau, HM&Daley, GQ Stem Cells in the Treatment of Disease. N Engl J Med 380, 1748-1760 (2019). 2. Marban, E. A mechanistic roadmap for the clinical application of cardiac cell therapies. Nat Biomed Eng 2, 353-361 (2018). 3. Marban, E. The Secret Life of Exosomes: What Bees Can Teach UsAbout Next-Generation Therapeutics. J Am Coll Cardiol 71, 193-200 (2018). 4. Smith, R.R. et al. Regenerative potential of cardiosphere-derivedcells expanded from percutaneous endomyocardial biopsyspecimens. Circulation 115, 896-908 (2007). 5. McDonald, C.M. et al. Repeated intravenous cardiosphere-derivedcell therapy in late-stage Duchenne muscular dystrophy (HOPE-2): amulticentre, randomised, double-blind, placebo-controlled, phase 2trial. Lancet 399, 1049-1058 (2022). 6. Taylor, M. et al. Cardiac and skeletal muscle effects in therandomized HOPE-Duchenne trial. Neurology 92, e866-e878 (2019). 7. Ibrahim, A.G., Cheng, K.&Marban, E. Exosomes as critical agents ofcardiac regeneration triggered by cell therapy. Stem Cell Reports 2, 606-619(2014). 8. Walravens, A.S. et al. Mechanistic and therapeutic distinctionsbetween cardiosphere-derived cell and mesenchymal stem cell extracellularvesicle non-coding RNA. Sci Rep 11, 8666 (2021). 9. de Couto, G. et al.Exosomal MicroRNA Transfer Into MacrophagesMediates Cellular Postconditioning. Circulation 136, 200-214 (2017). 10. Cambier, L. et al. Y RNA fragment in extracellular vesiclesconfers cardioprotection via modulation of IL-10 expression andsecretion. EMBO Mol Med 9, 337-352 (2017). 11. Cambier, L. et al. Angiotensin II-Induced End-Organ Damage inMice Is Attenuated by Human Exosomes and by an Exosomal Y RNAFragment. Hypertension 72, 370-380 (2018). 12. Huang, F. et al. Exosomally derived Y RNA fragment alleviateshypertrophic cardiomyopathy in transgenic mice. Mol Ther Nucleic Acids 24, 951-960 (2021). 13. Zogg, H., Singh, R.&Ro, S. Current Advances in RNA Therapeuticsfor Human Diseases. Int J Mol Sci 23(2022). 14. Egli, M.&Manoharan, M. Re-Engineering RNA Molecules intoTherapeutic Agents. Acc Chem Res 52, 1036-1047 (2019). 15. Ciullo, A. et al. Biodistribution of unmodified cardiosphere-derived cell extracellular vesicles using single RNA tracing. J Extracell Vesicles 11, e12178 (2022). 16. Schmidt, K.S. et al. Application of locked nucleic acids toimprove aptamer in vivo stability and targeting function. Nucleic Acids Res 32,5757-5765 (2004). 17. Winkle, M., El-Daly, S.M., Fabbri, M.&Calin, G.A. Noncoding RNAtherapeutics - challenges and potential solutions. Nat Rev Drug Discov 20, 629-651 (2021). 18. Yu, A.M., Choi, Y.H.&Tu, M.J. RNA Drugs and RNA Targets for SmallMolecules: Principles, Progress, and Challenges. Pharmacol Rev 72, 862-898(2020). 19. Abou Assi, H. et al. 2'-O-Methylation can increase the abundanceand lifetime of alternative RNA conformational states. Nucleic Acids Res 48,12365-12379 (2020). 20. Chung, C.Z., Seidl, L.E., Mann, M.R.&Heinemann, I.U. Tipping thebalance of RNA stability by 3'editing of the transcriptome. Biochim Biophys Acta Gen Subj 1861, 2971-2979 (2017). 21. Houseley, J.&Tollervey, D. The Many Pathways of RNADegradation. Cell 136, 763-776 (2009). 22. Ghildiyal, M.&Zamore, P.D. Small silencing RNAs: an expandinguniverse. Nat Rev Genet 10, 94-108 (2009). 23. Ji, L.J.&Chen, X.M. Regulation of small RNA stability:methylation and beyond. Cell Res 22, 624-636 (2012). 24. Ciullo A, P.K., Jones XM, Yamaguchi S, Morris AA, Kumar AN, Li L,Lee J, dos Santos RM, Cingolani E, and Ibrahim AG TDO2-augmented fibroblastssecrete EVs enriched in immunomodulatory Y-derived small RNA. Journal of Extracellular Biology .2023;2:e73(2023). 25. Deng, J.H., Bai, X., Tang, H.Q.&Pang, S.S. DNA damage promotes ERstress resistance through elevation of unsaturated phosphatidylcholine inCaenorhabditis elegans. J Biol Chem 296(2021). 26. Gonzalez-Quiroz, M. et al. When Endoplasmic ReticulumProteostasis Meets the DNA Damage Response. Trends Cell Biol 30, 881-891(2020). 27. Johnston, J.A., Ward, C.L.&Kopito, R.R. Aggresomes: A cellularresponse to misfolded proteins. J Cell Biol 143, 1883-1898 (1998). 28. Vasudevan, S., Tong, Y.C.&Steitz, J.A. Switching from repressionto activation: MicroRNAs can up-regulate translation. Science 318, 1931-1934(2007). 29. Jia, L.F. et al. Decoding mRNA translatability and stability fromthe 5'UTR. Nat Struct Mol Biol 27, 814-+ (2020). 30. Leppek, K., Das, R.&Barna, M. Functional 5'UTR mRNA structures ineukaryotic translation regulation and how to find them (vol 19, pg 158,2018). Nat Rev Mol Cell Bio 19, 673-673 (2018). 31. Mignone, F., Gissi, C., Liuni, S.&Pesole, G. Untranslated regionsof mRNAs. Genome Biol 3(2002). 32. Mylonas, K.J. et al. The adult murine heart has a sparse,phagocytically active macrophage population that expands through monocyterecruitment and adopts an'M2'phenotype in response to Th2 immunologicchallenge. Immunobiology 220, 924-933 (2015). 33. de Couto, G. Macrophages in cardiac repair: Environmental cuesand therapeutic strategies. Exp Mol Med 51(2019). 34. Sager, H.B., Kessler, T.&Schunkert, H. Monocytes and macrophagesin cardiac injury and repair. J Thorac Dis 9, S30-S35 (2017). 35. Halade, G.V.&Lee, D.H. Inflammation and resolution signaling incardiac repair and heart failure. Ebiomedicine 79(2022). 36. Sharma, A., Singh, K.&Almasan, A. Histone H2AX phosphorylation: amarker for DNA damage. Methods Mol Biol 920, 613-626 (2012). 37. Shah, A.M.&Giacca, M. Small non-coding RNA therapeutics forcardiovascular disease. Eur Heart J (2022). 38. Motwani, M., Pesiridis, S.&Fitzgerald, K.A. DNA sensing by thecGAS-STING pathway in health and disease. Nat Rev Genet 20, 657-674 (2019). 39. Grieves, J.L. et al. Exonuclease TREX1 degrades double-strandedDNA to prevent spontaneous lupus-like inflammatory disease. Proc Natl Acad Sci U S A 112, 5117-5122 (2015). 40. Peschke, K. et al. Loss of Trex1 in Dendritic Cells Is SufficientTo Trigger Systemic Autoimmunity. J Immunol 197, 2157-2166 (2016). 41. de Couto, G. et al. Macrophages mediate cardioprotective cellularpostconditioning in acute myocardial infarction. J Clin Invest 125, 3147-3162(2015). 42. Mentkowski, K.I., Mursleen, A., Snitzer, J.D., Euscher, L.M.&Lang, J.K. CDC-derived extracellular vesicles reprogram inflammatorymacrophages to an arginase 1-dependent proangiogenic phenotype. Am J Physiol Heart Circ Physiol 318, H1447-H1460 (2020). 43. Vlachogiannis, N.I. et al. Association Between DNA DamageResponse, Fibrosis and Type I Interferon Signature in SystemicSclerosis. Front Immunol 11(2020). 44. Avouac, J., Borderie, D., Ekindjian, O.G., Kahan, A.&Allanore, Y.High DNA oxidative damage in systemic sclerosis. J Rheumatol 37, 2540-2547(2010). 45. Tichy, E.D. et al. Persistent NF-kappa B activation in musclestem cells induces proliferation-independent telomere shortening. Cell Rep 35(2021). 46. Chang, A.C.Y. et al. Telomere shortening is a hallmark of geneticcardiomyopathies. P Natl Acad Sci USA 115, 9276-9281 (2018). 47. Ibrahim, A.G.E. et al.Augmenting canonical Wnt signalling intherapeutically inert cells converts them into therapeutically potent exosomefactories. Nat Biomed Eng 3, 695-705 (2019). References 1. M. Algoet et al. , Myocardial ischemia-reperfusion injury and theinfluence of inflammation. Trends Cardiovasc Med 33, 357-366 (2023). 2. S. Frantz, M. J. Hundertmark, J. Schulz-Menger, F. M. Bengel, J.Bauersachs, Left ventricular remodelling post-myocardial infarction:pathophysiology, imaging, and novel therapies. Eur Heart J 43, 2549-2561(2022). 3. N. Dicks, K. Gutierrez, M. Michalak, V. Bordignon, L. B. Agellon,Endoplasmic reticulum stress, genome damage, and cancer. Front Oncol 5, 11(2015). 4. S. J. Forrester, D. S. Kikuchi, M. S. Hernandes, Q. Xu, K. K.Griendling, Reactive Oxygen Species in Metabolic and InflammatorySignaling. Circ Res 122, 877-902 (2018). 5. P. Zheng et al. , DNA damage triggers tubular endoplasmic reticulumextension to promote apoptosis by facilitating ER-mitochondria signaling. Cell Res 28, 833-854 (2018). 6. A. Decout, J. D. Katz, S. Venkatraman, A. Ablasser, The cGAS-STINGpathway as a therapeutic target in inflammatory diseases. Nat Rev Immunol 21,548-569 (2021). 7. D. J. Cao et al., Cytosolic DNA Sensing Promotes MacrophageTransformation and Governs Myocardial Ischemic Injury. Circulation 137, 2613-2634 (2018). 8. K. Hamidzadeh, S. M. Christensen, E. Dalby, P. Chandrasekaran, D.M. Mosser, Macrophages and the Recovery from Acute and ChronicInflammation. Annu Rev Physiol 79, 567-592 (2017). 9. S. Pereira-Lopes et al. , The exonuclease Trex1 restrains macrophageproinflammatory activation. J Immunol 191, 6128-6135 (2013). 10. K. Peschke et al. , Loss of Trex1 in Dendritic Cells Is SufficientTo Trigger Systemic Autoimmunity. J Immunol 197, 2157-2166 (2016). 11. N. Yan, Immune Diseases Associated with TREX1 and STINGDysfunction. J Interferon Cytokine Res 37, 198-206 (2017). 12. H. Du et al. , Suppression of TREX1 deficiency-induced cellularsenescence and interferonopathies by inhibition of DNA damageresponse. iScience 26, 107090 (2023). 13. M. A. Matter et al., Inflammation in acute myocardial infarction:the good, the bad and the ugly. Eur Heart J 45, 89-103 (2024). 14. E. Marban, A mechanistic roadmap for the clinical application ofcardiac cell therapies. Nat Biomed Eng 2, 353-361 (2018). 15. A. G. Ibrahim, K. Cheng, E. Marban, Exosomes as critical agentsof cardiac regeneration triggered by cell therapy. Stem Cell Reports 2, 606-619(2014). 16. G. de Couto et al. , Exosomal MicroRNA Transfer Into MacrophagesMediates Cellular Postconditioning. Circulation 136, 200-214 (2017). 17. R. Gallet et al. , Exosomes secreted by cardiosphere-derived cellsreduce scarring, attenuate adverse remodelling, and improve function in acuteand chronic porcine myocardial infarction. Eur Heart J 38, 201-211 (2017). 18. R. G. Rogers et al. , Disease-modifying bioactivity of intravenouscardiosphere-derived cells and exosomes in mdx mice. JCI Insight 4,(2019). 19. G. de Couto ​, Mechanism of Enhanced MerTK-DependentMacrophage Efferocytosis by Extracellular Vesicles. ​ ​ 39, 2082-2096 (2019). 20. J. F. Dawkins ​ , Biological substrate modification suppressesventricular arrhythmias in a porcine model of chronic ischaemiccardiomyopathy. ​ 43, 2139-2156 (2022). 21. L. Cambier ​ , Y RNA fragment in extracellular vesiclesconfers cardioprotection via modulation of IL-10 expression andsecretion. ​ 9, 337-352 (2017). 22. L. Cambier ​ , Angiotensin II-Induced End-Organ Damage in MiceIs Attenuated by Human Exosomes and by an Exosomal Y RNAFragment. ​ 72, 370-380 (2018). 23. F. Huang ​ , Exosomally derived Y RNA fragment alleviateshypertrophic cardiomyopathy in transgenic mice. ​ 24, 951-960 (2021). 24. M. Winkle, S. M. El-Daly, M. Fabbri, G. A. Calin, Noncoding RNAtherapeutics - challenges and potential solutions. ​ 20, 629-651 (2021). 25. A. Ciullo ​ , Biodistribution of unmodified cardiosphere-derived cell extracellular vesicles using single RNA tracing. ​ ​ 11, e12178 (2022). 26. K. S. Schmidt ​ , Application of locked nucleic acids toimprove aptamer in vivo stability and targeting function. ​ 32,5757-5765 (2004). 27. A. M. Yu, Y. H. Choi, M. J. Tu, RNA Drugs and RNA Targets forSmall Molecules: Principles, Progress, and Challenges. ​ 72, 862-898 (2020). 28. H. Abou Assi ​ , 2'-O-Methylation can increase the abundanceand lifetime of alternative RNA conformational states. ​ 48,12365-12379 (2020). 29. C. Z. Chung, L. E. Seidl, M. R. Mann, I. U. Heinemann, Tippingthe balance of RNA stability by 3'editing of the transcriptome.​ ​ 1861, 2971-2979 (2017). 30. J. Houseley, D. Tollervey, The Many Pathways of RNADegradation. ​ 136, 763-776 (2009). 31. M. Ghildiyal, P. D. Zamore, Small silencing RNAs: an expandinguniverse. ​ 10, 94-108 (2009). 32. L. J. Ji, X. M. Chen, Regulation of small RNA stability:methylation and beyond. ​ 22, 624-636 (2012). 33. P. K. Ciullo A, Jones XM, Yamaguchi S, Morris AA, Kumar AN, Li L,Lee J, dos Santos RM, Cingolani E, and Ibrahim AG, TDO2-augmented fibroblastssecrete EVs enriched in immunomodulatory Y-derived small RNA. ​ ​ .2023;2:e73,(2023). 34. J. H. Deng, X. Bai, H. Q. Tang, S. S. Pang, DNA damage promotesER stress resistance through elevation of unsaturated phosphatidylcholine inCaenorhabditis elegans. J Biol Chem 296,(2021). 35. M. Gonzalez-Quiroz et al. , When Endoplasmic Reticulum ProteostasisMeets the DNA Damage Response. Trends Cell Biol 30, 881-891 (2020). 36. J. A. Johnston, C. L. Ward, R. R. Kopito, Aggresomes: A cellularresponse to misfolded proteins. J Cell Biol 143, 1883-1898 (1998). 37. S. Vasudevan, Y. C. Tong, J. A. Steitz, Switching from repressionto activation: MicroRNAs can up-regulate translation. Science 318, 1931-1934(2007). 38. L. F. Jia et al. , Decoding mRNA translatability and stability fromthe 5'UTR. Nat Struct Mol Biol 27, 814-+ (2020). 39. K. Leppek, R. Das, M. Barna, Functional 5'UTR mRNA structures ineukaryotic translation regulation and how to find them (vol 19, pg 158,2018). Nat Rev Mol Cell Bio 19, 673-673 (2018). 40. F. Mignone, C. Gissi, S. Liuni, G. Pesole, Untranslated regionsof mRNAs. Genome Biol 3,(2002). 41. Y. Lim et al. , Multiplexed functional genomic analysis of 5'untranslated region mutations across the spectrum of prostate cancer. Nat Commun 12, 4217 (2021). 42. S. Nikfarjam, K. K. Singh, DNA damage response signaling: Acommon link between cancer and cardiovascular diseases. Cancer Med 12, 4380-4404 (2023). 43. B. Schumacher, J. Pothof, J. Vijg, J. H. J. Hoeijmakers, Thecentral role of DNA damage in the ageing process. Nature 592, 695-703 (2021). 44. G. Robert, J. R. Wagner, ROS-Induced DNA Damage as an UnderlyingCause of Aging. Advances in Geriatric Medicine and Research 2, e200024 (2020). 45. M. Motwani, S. Pesiridis, K. A. Fitzgerald, DNA sensing by thecGAS-STING pathway in health and disease. Nat Rev Genet 20, 657-674 (2019). 46. Y. G. Yang, T. Lindahl, D. E. Barnes, Trex1 exonuclease degradesssDNA to prevent chronic checkpoint activation and autoimmunedisease. Cell 131, 873-886 (2007). 47. J. L. Grieves et al. , Exonuclease TREX1 degrades double-strandedDNA to prevent spontaneous lupus-like inflammatory disease. Proc Natl Acad Sci U S A 112, 5117-5122 (2015). 48. G. de Couto et al. , Macrophages mediate cardioprotective cellularpostconditioning in acute myocardial infarction. J Clin Invest 125, 3147-3162(2015). 49. K. I. Mentkowski, A. Mursleen, J. D. Snitzer, L. M. Euscher, J.K. Lang, CDC-derived extracellular vesicles reprogram inflammatorymacrophages to an arginase 1-dependent proangiogenic phenotype. Am J Physiol Heart Circ Physiol 318, H1447-H1460 (2020). 50. N. Salari et al. , The global prevalence of myocardial infarction:a systematic review and meta-analysis. BMC Cardiovasc Disord 23, 206 (2023). 51. L. Gross, L. Blum, G. Silverman, Experimental Attempts toIncrease the Blood Supply to the Dog's Heart by Means of Coronary SinusOcclusion. J Exp Med 65, 91-108 (1937). 52. D. J. Lefer, E. Marban, Is Cardioprotection Dead Circulation 136,98-109 (2017). 53. K. K. Cho JH, Ibrahim A, Cingolania E, and Marban E, in Heart Rhythm . (2023), vol. 20, pp. S731. 54. C. A. Jones XM, Mesquita T, Fournier M, Liu W, Li L, Ibrahim AGand Marban E, in AHA, Circulation, Ed. (2023), vol. 148, pp. A14651. 55. R. Phillips, Targeting the DNA damage response attenuates SLE-associated B cell characteristics. Nat Rev Rheumatol 19, 2 (2023). 56. T. Manolakou et al. , ATR-mediated DNA damage responses underlieaberrant B cell activity in systemic lupus erythematosus. Sci Adv 8, eabo5840(2022). 57. E. D. Tichy et al. , Persistent NF-kappa B activation in musclestem cells induces proliferation-independent telomere shortening. Cell Rep 35,(2021). 58. A. C. Y. Chang et al. , Telomere shortening is a hallmark ofgenetic cardiomyopathies. P Natl Acad Sci USA 115, 9276-9281 (2018). 59. M. Hoss et al. , A human DNA editing enzyme homologous to theEscherichia coli DnaQ / MutD protein. EMBO J 18, 3868-3875 (1999). 60. S. R. Margolis, S. C. Wilson, R. E. Vance, Evolutionary Originsof cGAS-STING Signaling. Trends Immunol 38, 733-743 (2017). 61. A. G. E. Ibrahim et al. , Augmenting canonical Wnt signalling intherapeutically inert cells converts them into therapeutically potent exosomefactories. Nat Biomed Eng 3, 695-705 (2019).

Claims

1. A method for treating conditions associated with aging, atrophy, inflammation, and / or fibrosis, comprising: Administering an effective amount of a reagent that enhances the expression of the Trex1 gene product to a subject requiring treatment for conditions associated with aging, atrophy, inflammation, and / or fibrosis, wherein the reagent is not an isolated RNA comprising a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

2. The method according to claim 1, wherein, The reagent comprises a nucleic acid encoding the Trex1 gene product, optionally wherein the Trex1 gene product comprises a truncated TREX1 protein having exonuclease activity.

3. The method according to claim 2, wherein, The nucleic acid includes a vector.

4. The method according to claim 3, wherein, The vector is a viral vector or plasmid.

5. The method according to claim 2, wherein, The nucleic acid is contained in macrophages.

6. The method of claim 5, further comprising administering a macrophage population to the subject, wherein an effective amount of an agent for enhancing Trex1 gene product expression is contained in the macrophage population.

7. The method according to claim 2, wherein, The nucleic acid includes a promoter operatively linked to a nucleotide sequence encoding the Trex1 gene product, wherein the promoter drives the expression of the Trex1 gene product in the subject.

8. The method according to claim 2, wherein, The nucleic acid will anneal to a first sequence in the Trex1 mRNA 5' UTR, which is different from a second sequence in the Trex1 mRNA 5' UTR. The second sequence will anneal to a nucleic acid containing a nucleotide sequence including CGCCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

9. The method according to claim 1, wherein, The Trex1 gene product includes Trex1 mRNA.

10. The method according to claim 12, wherein, The reagent increases the transcription of the Trex1 mRNA.

11. The method according to claim 12, wherein, The reagent stabilizes the Trex1 mRNA or prolongs the half-life of the Trex1 mRNA.

12. The method according to claim 1, wherein, The conditions associated with aging, atrophy, inflammation, and / or fibrosis include inflammation and / or fibrosis of the heart, skeletal muscle, or skin.

13. The method according to claim 1, wherein, The conditions associated with aging, atrophy, inflammation, and / or fibrosis include symptoms and / or sequelae of heart failure, hypertrophic cardiomyopathy, heart failure with preserved ejection fraction (HFpEF), Duchenne muscular dystrophy, or scleroderma.

14. The method according to claim 1, wherein, Inflammation-related conditions include symptoms or sequelae of infectious diseases, or conditions associated with immunotherapy.

15. The method according to claim 1, wherein, Inflammation-related conditions include cytokine storms.

16. The method according to claim 1, wherein, Conditions associated with aging, atrophy, and fibrosis include infectious diseases, symptoms or sequelae of idiopathic pulmonary fibrosis, or cirrhosis.

17. The method according to claim 1, wherein, The reagent does not include the isolated RNA, which comprises a nucleotide sequence having at least 95% identity with CUGCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3).

18. The method according to claim 1, wherein, The reagent reduces DNA damage in inflamed and / or fibrotic tissues or tissues at risk of inflammation and / or fibrosis.

19. The method according to claim 1, wherein, When an effective amount of the reagent is administered to the subject, the reagent enhances the expression of the Trex1 gene product in macrophages.

20. A composition for treating conditions associated with aging, atrophy, inflammation, and / or fibrosis, comprising: Nucleic acid that anneals to a first sequence in the 5' UTR of Trex1 mRNA, the first sequence being different from a second sequence in the 5' UTR of Trex1 mRNA, the second sequence annealing to a nucleic acid including the nucleotide sequence CGICCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3), wherein the nucleic acid enhances the expression of the Trex1 gene product; Nucleic acid encoding the Trex1 gene product, wherein the nucleic acid is configured to overexpress the Trex1 gene product; as well as A population of macrophages exhibiting enhanced anti-inflammatory activity, wherein the macrophage population has enhanced expression of the Trex1 gene product and does not include exogenous RNA comprising a nucleotide sequence having at least 95% identity with CGICCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 3). Or a combination thereof.

21. A method for in vitro identification of a reagent that enhances the expression of the Trex1 gene product in target cells, comprising: To bring the candidate reagent into contact with the target cells; And after the contact, the expression level of the Trex1 gene product in the target cells is measured, wherein when the measured expression level of the Trex1 gene product increases compared to a suitable reference value, the candidate reagent is identified as a reagent that enhances the expression of the Trex1 gene product.