Small interfering RNA for regulating the activity of TRPV1 gene and application thereof

By designing specific small interfering RNA sequences and combining them with modified nucleotides and ligands, the TRPV1 channel protein is directly inhibited, solving the problem that existing dry eye treatments cannot cure pain and inflammation, and achieving a highly effective treatment with low side effects.

CN122256340APending Publication Date: 2026-06-23YOUJIA (HANGZHOU) BIOMEDICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-06-23

Smart Images

  • Figure CN122256340A_ABST
    Figure CN122256340A_ABST
Patent Text Reader

Abstract

The application belongs to the field of biological medicine, and particularly relates to small interfering RNA for regulating TRPV1 gene activity, which comprises a sense strand and an antisense strand, the sense strand and the antisense strand are at least partially reverse complementary to form a double-stranded region, the sense strand or the antisense strand is composed of 19 nucleotide blunt-ended complementary nucleotide sequences, or 21-27 nucleotide sequences with overhanging ends. The small interfering RNA of the application directly acts on the key molecule TRPV1 channel protein causing symptoms of dry eye by specifically inhibiting the expression of TRPV1 gene, so as to fundamentally reduce pain and inflammatory reaction. Moreover, the therapeutic effect is durable, the side effect is low, and the patient compliance is high.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to small interfering RNAs that regulate TRPV1 gene activity and their applications. Background Technology

[0002] RNA interference (RNAi) is a molecular biological phenomenon of gene silencing induced by double-stranded RNA. Its mechanism involves inhibiting gene expression by blocking the transcription or translation of specific genes. When a double-stranded RNA homologous to the coding region of endogenous messenger RNA (mRNA) is introduced into a cell, the mRNA degrades, leading to gene silencing. Small interfering RNAs (SRNAs), with a length of 20-25 nt, can trigger RNAi, specifically downregulating or shutting down the expression of specific genes. They are highly efficient, easy to synthesize, and easy to manipulate, making this technology widely used in exploring gene function and in gene therapy for infectious diseases and malignant tumors.

[0003] TRPV1 (a member of the transient receptor potential cation channel V subfamily 1) is a non-selective cation channel involved in pain perception and inflammatory responses. TRPV1 siRNA, an emerging gene silencing technology, aims to achieve therapeutic goals by specifically inhibiting TRPV1 gene expression. TRPV1 siRNA directly targets the TRPV1 channel protein, a key molecule contributing to dry eye symptoms, potentially reducing pain and inflammation at its root and providing a more lasting therapeutic effect.

[0004] Dry eye disease (DED) is a multifactorial chronic condition characterized by tear film instability and insufficiency, affecting approximately 11.59% of the global population. This disease not only disrupts daily life but also threatens mental health and imposes a significant socioeconomic burden. It is estimated that the direct medical costs of dry eye disease in the United States amount to approximately $3.8 billion annually, while the total social cost reaches $55 billion. Prevalence varies globally, with approximately 11.59% of the population experiencing dry eye symptoms to varying degrees. The prevalence is 9.5% in women and 6.8% in men. North America has the lowest prevalence at approximately 4.6%, while Africa has the highest at 47.9%. East Asia also has a relatively high prevalence at 42.8%. The risk of developing dry eye disease increases significantly with age, especially after the fifth decade, when the prevalence rises markedly.

[0005] Risk factors for dry eye syndrome include demographic factors, environmental exposure, lifestyle, and health status. Age and sex are important risk factors, especially for women who are more likely to develop the condition after menopause. Air pollution, excessive screen time, and meteorological conditions such as temperature and humidity all significantly influence the development of dry eye syndrome. People living in semi-arid or subtropical desert climates are more prone to dry eye syndrome. Prolonged use of electronic devices, wearing contact lenses, and smoking are also considered to increase the risk of dry eye syndrome. In addition, the incidence of dry eye syndrome is significantly higher in people with autoimmune diseases (such as primary Sjögren's syndrome, rheumatoid arthritis, and systemic lupus erythematosus) than in the general population. These factors work together to make certain groups high-risk for dry eye syndrome.

[0006] While existing medications and technologies for treating dry eye disease (DED) can alleviate symptoms to some extent, they still have limitations and drawbacks. Current treatments, such as artificial tears, anti-inflammatory drugs, and immunomodulators, primarily focus on symptom relief rather than addressing the underlying cause. These therapies may not provide adequate symptom relief for all patients, especially those with moderate to severe dry eye, where their efficacy is often less than ideal. Furthermore, some medications require frequent or prolonged use to maintain their effectiveness, which can lead to decreased patient adherence, and prolonged use may cause side effects or discomfort. For some refractory cases of dry eye, more invasive surgical methods, such as punctal closure, may be necessary. However, such surgeries not only carry certain risks but are not effective for all patients and sometimes require repeat procedures. More importantly, most current treatments fail to address the fundamental pathological mechanisms of dry eye, particularly those related to neuroinflammation, meaning that even if symptoms are temporarily relieved, the disease may still recur. Therefore, there is an urgent need to develop effective drugs specifically targeting dry eye disease. Summary of the Invention

[0007] This invention relates to the design of corresponding small interfering RNAs for TRPV1, their modified sequences, and their application in the treatment of dry eye syndrome.

[0008] The first technical solution of this invention discloses a small interfering RNA that regulates the activity of the TRPV1 gene, comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded region, and the sense strand or the antisense strand consists of a complementary nucleotide sequence of 19 nucleotides with blunt ends, or consists of a nucleotide sequence of 21 to 27 nucleotides with protruding ends.

[0009] Furthermore, the small interfering RNA is any one of the following (1) to (10),

[0010] The justice chain is CACAGACAACGAGUUCAAA (SEQ ID NO:1), and the antisense chain is UUUGAACUCGUUGUCUGUG (SEQ ID NO:13).

[0011] The justice chain is CCAGCUACACGGACAGCUA (SEQ ID NO:2), and the antisense chain is UAGUGUCCGUGUAGCUGG (SEQ ID NO:14).

[0012] The justice chain is GCUCACGGACAGCUACUA (SEQ ID NO:3), and the antisense chain is UAGUAGCUGUCCGUGUAGC (SEQ ID NO:15).

[0013] The justice chain is GACUUCUUUAAGAAAACCANn (SEQ ID NO:25), and the antisense chain is UGGUUUUCUUAAAGAAGUCNn (SEQ ID NO:26).

[0014] The justice chain is CUUCUUUAAGAAAACCAAANn (SEQ ID NO:27), and the antisense chain is UUUGGUUUUCUUAAAGAAGNn (SEQ ID NO:28).

[0015] The justice chain is GUUUGUGACGAGCAUGUACAAUGNn (SEQ ID NO:29), and the antisense chain is NnCAUUGUACAUGCUCGUCACAAACNn (SEQ ID NO:30).

[0016] The justice chain is CGAUGAAGACCCUGUUUGUNn (SEQ ID NO:31), and the antisense chain is ACAAACAGGGUCUUCAUCGNn (SEQ ID NO:32).

[0017] The justice chain is GUCAUGAUAGAGAAGAUGAUCCUNn (SEQ ID NO:33), and the antisense chain is NnAGGAUCAUCUUCUCUAUCAUGACNn (SEQ ID NO:34).

[0018] The justice chain is GUCUACAUCGUCUUCUUGUNn (SEQ ID NO:35), and the antisense chain is ACAAGAAGACGAUGUAGACNn (SEQ ID NO:36).

[0019] The justice chain is GGUGGUGACGCUGAUUGAA (SEQ ID NO:10), and the antisense chain is UUCAAUCAGCGUCACCACC (SEQ ID NO:22).

[0020] Where N is any one of G, U, A, C, T, dG, dU, dA, dC, dT; n is the number of N, and n is an integer from 0 to 3.

[0021] Furthermore, n is 2.

[0022] Furthermore, n is 0.

[0023] Furthermore, the combination of 2 Ns includes one or both of AA, CC, GG, UC, CU, UU, AG, AC, and GA.

[0024] Furthermore, at least one nucleotide in the small interfering RNA is modified; the modified nucleotide is selected from those with a sugar moiety modified at the 2' position, or at least one phosphate ester group containing a modified group, or one or more nucleotide analogs.

[0025] Furthermore, the nucleotide modified at the sugar portion of the 2' position comprises nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

[0026] Furthermore, the phosphate ester group containing the modifying group is specifically a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond with a sulfur atom.

[0027] Furthermore, the nucleotide analogue is selected from one of the following: isonucleotide, LNA, ENA, cEtBNA, UNA, or GNA.

[0028] The second technical solution of the present invention discloses a small interfering RNA conjugate containing any of the small interfering RNAs described above and a ligand conjugated to the small interfering RNA. The ligand includes GalNAc, aliphatic, alicyclic, polyalicyclic compounds, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, and N-acetylglucosamine derivatives or analogs.

[0029] One of the ligands is L96, and the structural formula of L96 is as follows:

[0030]

[0031] The second ligand is C16, with the following structural formula (illustrated for uracil bases; however, the linkage of the C16 ligand is conceivable for any nucleotide presenting any base (C, G, A, etc.) or having any other modifications presented in this invention, provided that the 2' ribose linkage is preserved and the linkage is at the 2' position of the ribose of such modified residues):

[0032]

[0033] This conjugate can help small interfering RNA be delivered to target organs or tissues and enter cells.

[0034] Or it may be without a ligand.

[0035] The third technical solution of this invention discloses a biomaterial, which is any one of the following:

[0036] 1) A vector containing the small interfering RNA as described in the first technical solution or the small interfering RNA conjugate as described in the second technical solution;

[0037] 2) A reagent or kit containing the small interfering RNA as described in the first technical solution or the small interfering RNA conjugate as described in the second technical solution or the vector described in 1);

[0038] 3) A pharmaceutical composition comprising the small interfering RNA as described in the first technical solution or the small interfering RNA conjugate as described in the second technical solution and other pharmaceutically acceptable components.

[0039] The pharmaceutically acceptable other components include, but are not limited to, water, saline, pH buffer, protectant, osmotic pressure regulator, excipient, diluent, disintegrant, binder, lubricant, sweetener, preservative, or combinations thereof. The protectant may be at least one selected from inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose.

[0040] The aforementioned carriers include, but are not limited to, one or more of the following: magnetic nanoparticles (such as Fe2O3), carbon nanotubes, mesoporous silica, calcium phosphate nanoparticles, polyethyleneimine, polyamide amine dendritic polymers, polylysine, chitosan, poly-D or L-type lactic acid / hydroxyacetic acid copolymers, poly(aminoethyl ethylene phosphate), and poly(N,N-dimethylaminoethyl methacrylate) and their derivatives.

[0041] The dosage form of the pharmaceutical composition may be a liquid formulation (e.g., injection, eye drops) or a lyophilized powder for injection. When administering the lyophilized powder for injection, it is mixed with liquid excipients to form a liquid formulation. The liquid formulation may be used, but is not limited to, for subcutaneous, intramuscular, or intravenous administration; in this invention, it may be an eye drop. It may also be administered via spray to the lungs, or via spray through the lungs to other organs or tissues (e.g., the liver).

[0042] The small interfering RNA, small interfering RNA conjugates, and related biomaterials and pharmaceutical compositions described in this invention are used for the treatment of dry eye syndrome and their application in dry eye medications.

[0043] Beneficial effects

[0044] The small interfering RNA of this invention specifically inhibits TRPV1 gene expression, directly acting on the TRPV1 channel protein, a key molecule causing dry eye symptoms, thereby fundamentally reducing pain and inflammation. Furthermore, it offers long-lasting efficacy, low side effects, and high patient compliance, reducing the frequency of medication and helping to maintain stable treatment results, avoiding discomfort or fatigue caused by frequent medication. Attached Figure Description Figure 1 The figure shows the results of the in vitro gene silencing effect verification of siRNA. Figure 2 The image shows the results of verifying the analgesic effect of siRNA. Figure 3 The figure shows the results of verifying the gene silencing effect of siRNA in ocular tissue. Detailed Implementation

[0046] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0047] The term "connection" as used in this invention, when referring to a link between two molecules, means that the two molecules are connected by a covalent bond or that the two molecules are associated via a non-covalent bond (e.g., a hydrogen bond or an ionic bond).

[0048] The term "inhibition" as used in this invention refers to the reduction in gene expression when a given gene is treated with the small interfering RNA, pharmaceutical composition, or small interfering RNA conjugate described in this invention, compared to untreated cells, cell populations, or tissues.

[0049] The term "inhibition" as used in this invention is used interchangeably with "reduction," "silence," "downregulation," "suppression," and other similar terms, and includes any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.

[0050] Each nucleotide in the sense and antisense strands is independently a modified or unmodified nucleotide. In the context of this invention, unless otherwise stated, "conjugation" refers to the covalent connection between two or more chemical parts, each with a specific function, also called "coupling"; correspondingly, "conjugate" refers to a compound formed by the covalent connection of these chemical parts, also called "coupling compound". Further, "small interfering RNA conjugate" refers to a compound formed by the covalent attachment of one or more chemical parts with specific functions to small interfering RNA, also called "small interfering RNA conjugate".

[0051] Unless otherwise specified, in the foregoing and hereinafter, “G”, “C”, “A”, “T” and “U” generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively. However, it should be understood that the term “ribonucleotide” or “nucleotide” may also refer to modified nucleotides, nucleotide analogues (surrogate replacement moiety), as further detailed below.

[0052] In the context of this invention, the terms "complementary" and "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired complementaryly with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair comprises one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, "mismatch" in the art means, in a double-stranded nucleic acid, that the bases at corresponding positions are not paired complementaryly.

[0053] Unless otherwise specified, in the preceding and following text, "substantially inversely complementary" means that there are no more than three base mismatches between the two nucleotide sequences involved; "substantially inversely complementary" means that there are no more than one base mismatch between the two nucleotide sequences; and "completely inversely complementary" means that there are no base mismatches between the two nucleotide sequences. In the preceding and following text, a "nucleotide difference" between two nucleotide sequences refers to a change in the type of bases at the same position of the nucleotides compared to the latter. For example, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, then a nucleotide difference is considered to exist between the two nucleotide sequences at that position. In some embodiments, replacing the nucleotide at the original position with a baseless nucleotide or its equivalent can also be considered as a nucleotide difference at that position.

[0054] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0055] Example 1: Design of Small Interfering RNA

[0056] To screen for siRNA sequences with high gene silencing potential in rabbit models, candidate molecules were first identified through systematic sequence alignment and structural analysis. The specific screening process is as follows:

[0057] Homology comparison: Using the reference sequence of the rabbit TRPV1 gene (accession number: NM_001082166.1) as the target template, a series of designed siRNA candidate sequences were compared with the template to evaluate their matching degree and potential off-target risk.

[0058] Screening criteria: Based on the mechanism of action of siRNA and its conservation characteristics among species, the following two core screening conditions are set:

[0059] Seed region matching: The seed region of the siRNA (usually the 2nd to 8th nucleotides of the guide strand) must be within one base of the rabbit TRPV1 target sequence to ensure targeting specificity and silencing efficiency.

[0060] Full-length high homology: Except for the seed region, the full-length match between the candidate siRNA and the rabbit target sequence must be controlled within 2 base differences to maintain sequence complementarity and binding stability to the greatest extent.

[0061] Candidate selection: Based on the above criteria, we screened out several siRNA molecules that met the requirements from the initial sequence library, as shown in Table 1.

[0062] Table 1

[0063] name SEQ ID NO: siTRPV1 justice chain sequence (5'-3') SEQ ID NO: siTRPV1 antisense sequence (5'-3') Position in NM_080706.3 YJH-011-959 1 CACAGACAACGAGUUCAAA 13 UUUGAACUCGUUGUCUGUG 959 YJH-011-1105 2 CCAGCUACACGGACAGCUA 14 UAGCUGUCCGUGUAGCUGG 1105 YJH-011-1108 3 GCUACACGGACAGCUACUA 15 UAGUAGCUGUCCGUGUAGC 1108 YJH-011-1230 4 GACUUCUUUAAGAAAACCAAA 16 UGGUUUUCUUAAAGAAGUCCC 1230 YJH-011-1232 5 CUUCUUUAAGAAAACCAAAGG 17 UUUGGUUUUCUUAAAGAAGUC 1232 YJH-011-1439 6 GUUUGUGACGAGCAUGUACAAUGdAdG 18 CUCAUUGUACAUGCUCGUCACAAACUU 1439 YJH-011-2032 7 CGAUGAAGACCCUGUUUGUGG 19 ACAAACAGGGUCUUCAUCGAC 2032 YJH-011-2226 8 GUCAUGAUAGAGAAGAUGAUCCUdGdA 20 UCAGGAUCAUCUUCUCUAUCAUGACGG 2226 YJH-011-2274 9 GUCUACAUCGUCUUCUUGUUC 21 ACAAGAAGACGAUGUAGACAA 2274 YJH-011-2309 10 GGUGGUGACGCUGAUUGAA 22 UUCAAUCAGCGUCACCACC 2309 YJH-011-s1 11 AAGCGCAUCUUCUACUUCA 23 UGAAGUAGAAGAUGCGCUU NA NC 12 UUCUCCGAACGUGUCACGUTT 24 ACGUGACACGUUCGGAGAATT NA

[0064] Among them, YJH-011-1439 (SEQ ID NO: 6 and 18), YJH-011-2226 (SEQ ID NO: 8 and 20), and YJH-011-2309 (SEQ ID NO: 10 and 22) fully met the stringent screening criteria, namely, the seed region was within 1 base, and the difference between the seed region and the full-length target sequence was controlled within 2 bases. This screening fully considered the high conservation and structural integrity of the sequences, laying a solid and reliable design foundation for the subsequent systematic validation of gene silencing function in rabbit models.

[0065] Example 2: Preparation of small interfering RNA

[0066] All small interfering RNA sequences used in Example 1 were synthesized by Suzhou Ouli Biomedical Technology Co., Ltd.

[0067] Example 3: Sequence knockdown effect screening

[0068] 1) Human conjunctival epithelial cells in the logarithmic growth phase were digested with trypsin (purchased from Fenghui Biotechnology), and digestion was terminated with complete medium supplemented with 10% FBS. The cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, and counted with a hemocytometer. Then, 50,000 cells were added to each 24-well plate for culture.

[0069] 2) Preparation of the LipoRNAiMAX (invitrogen) and siRNA mixture: The sequences in Table 1 were used. 10 nM siRNA / well and 1.5 μl LipoRNAiMAX (invitrogen) were diluted separately in 25 μl serum-free culture medium (Opti-MEM, Gibco). The siRNA solution and LipoRNAiMAX solution were then mixed and incubated at room temperature for 5 minutes.

[0070] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX mixed solution to each well.

[0071] 4) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add lysis buffer to lyse the cells, add chloroform for extraction, vortex to mix, let stand at room temperature for 2-3 minutes, centrifuge, transfer the supernatant after separation to a well plate and bind with binding buffer, and use a nucleic acid extractor to extract RNA according to the kit.

[0072] 5) Prepare the qPCR system and perform it on ice. PCR reaction conditions: 50℃ for 15 minutes of pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds of annealing, 60℃ for 1 minute of extension, for 39 cycles.

[0073] PCR primers:

[0074] Target name Sequence (5'-3') TRPV1 hYJH-011-2P F TTTGAACTCGTTGTCTGTGAGG (SEQ ID NO:37) TRPV1 hYJH-011 2P R TTTGAACTCGTTGTCTGTGAGG (SEQ ID NO:38)

[0075] The results of the screening are shown in Table 2.

[0076] Table 2

[0077] sequence name Inhibition rate (%) YJH-011-959 -33% YJH-011-1105 13% YJH-011-1108 7% YJH-011-1230 59% YJH-011-1232 60% YJH-011-1439 68% YJH-011-2032 63% YJH-011-2226 75% YJH-011-2274 64% YJH-011-2309 70%

[0078] Example 4: Validation of in vitro gene silencing effect.

[0079] The in vitro gene silencing effect was validated using the following protocol: Rabbit corneal epithelial primary cells were used as a model. Candidate siRNAs (YJH-011-1439, YJH-011-2226, YJH-011-2309), negative control siRNA, and a blank control were transfected using Lipofectamine RNAiMAX transfection reagent. 48-72 hours after transfection, total RNA was extracted from the cells, and the expression level of TRPV1 mRNA was detected by real-time quantitative PCR (qPCR). After normalization with the internal reference gene (GAPDH), the inhibition rate of each candidate siRNA on TRPV1 mRNA was calculated to evaluate its in vitro gene silencing effect.

[0080] like Figure 1 As shown, all three sequences have good inhibitory effects, with YJH-011-2309 showing the best inhibitory effect.

[0081] Example 5: In vivo pharmacodynamics and gene silencing effect verification.

[0082] In an experiment using a standard eye pain model (Gonzalez et al., 1993), corneal pain was induced by instilling 30 μl of 1% capsaicin into the eye. Eyelid opening was measured at 1, 5, 10, 15, 20, 25, and 30 minutes after pain induction. The degree of eyelid opening was used as an indicator of pain recovery. The eye closed in response to pain, and as pain subsided, the eyelid opening increased back to normal levels.

[0083] Animals treated with capsaicin had previously received a 5 mM dose of anticapsaicin. In the right eye, the siRNA sequence group and anticapsaicin were instilled once daily from day 1 to day 3, and twice daily (60 minutes apart) on day 4. On day 4, corneal pain was induced in the right eye by a single instillation of 1% capsaicin 15 minutes after the last instillation. The contralateral eye was instilled with PBS throughout the study and served as a control.

[0084] The results are as follows Figure 2 As shown, compared with the known capsaicin antagonists anticapsaicin, YJH-011-1439 (SEQ ID NO: 6 and 18), YJH-011-2226 (SEQ ID NO: 8 and 20) and YJH-011-2309 (SEQ ID NO: 10 and 22) all induced stronger analgesic effects, manifested as more significant eyelid opening recovery, thus proving their effective therapeutic effect on eye discomfort.

[0085] In addition, in another in vivo experiment, YJH-011-1439 (SEQ ID NO:6 and 18), YJH-011-2226 (SEQ ID NO:8 and 20), and YJH-011-2309 (SEQ ID NO:10 and 22) were administered to rabbit eyes daily for three consecutive days. Eye tissue was collected two hours after the last administration, and TRPV1-specific mRNA levels were analyzed by RT-PCR. Figure 3 As shown, the data indicate that YJH-011-1439, YJH-011-2226, and YJH-011-2309 all achieved high levels of TRPV1 gene silencing in ocular tissues, demonstrating significant inhibitory effects.

[0086] In summary, YJH-011-1439, YJH-011-2226, and YJH-011-2309 all yielded positive results in in vivo experiments, demonstrating not only superior analgesic efficacy compared to the control drug, but also effective inhibition of TRPV1 at the gene silencing level, further supporting their development value as potential therapeutic agents for dry eye and eye pain.

[0087] Reference: GonzaIez, GG, Garcia, P. et al. (1993). "Reduction of capsacin-induced ocuiarpain and neurogenic inflammation by calcium antagonists." Invest OphthaImoI Vis Sci 34(12):3329-3335.

[0088] The detailed descriptions listed above are merely specific illustrations of feasible embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art can devise many other modifications and embodiments, which will fall within the principles and spirit of this application. More specifically, within the scope of this application, the drawings, and the claims, various variations and improvements can be made to the components and / or layout of the subject matter combination layout. Besides variations and improvements to the components and / or layout, other uses will be apparent to those skilled in the art.

Claims

1. A small interfering RNA that regulates TRPV1 gene activity, characterized in that, Includes a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded region, wherein the sense strand or the antisense strand consists of a 19-nucleotide blunt-ended complementary nucleotide sequence or a 21-27-nucleotide sequence with overhangs, and the small interfering RNA is any one of the following (1) to (10). The justice chain is CACAGACAACGAGUUCAAA (SEQ ID NO:1), and the antisense chain is UUUGAACUCGUUGUCUGUG (SEQ ID NO:13). The justice chain is CCAGCUACACGGACAGCUA (SEQ ID NO:2), and the antisense chain is UAGUGUCCGUGUAGCUGG (SEQ ID NO:14). The justice chain is GCUCACGGACAGCUACUA (SEQ ID NO:3), and the antisense chain is UAGUAGCUGUCCGUGUAGC (SEQ ID NO:15). The justice chain is GACUUCUUUAAGAAAACCAAA (SEQ ID NO:4), and the antisense chain is UGGUUUUCUUAAAGAAGUCCC (SEQ ID NO:16). The justice chain is CUUCUUUAAGAAAACCAAAGG (SEQ ID NO:5), and the antisense chain is UUUGGUUUUCUUAAAGAAGUC (SEQ ID NO:17). The justice chain is GUUUGUGACGAGCAUGUACAAUGdAdG (SEQ ID NO:6), and the antisense chain is CUCAUUGUACAUGCUCGUCACAAACUU (SEQ ID NO:18). The justice chain is CGAUGAAGACCCUGUUUGUGG (SEQ ID NO:7), and the antisense chain is ACAAACAGGGUCUUCAUCGAC (SEQ ID NO:19). The justice chain is GUCAUGAUAGAGAAGAUGAUCCUdGdA (SEQ ID NO:8), and the antisense chain is UCAGGAUCAUCUUCUCUAUCAUGACGG (SEQ ID NO:20). The justice chain is GUCUACAUCGUCUUCUUGUUC (SEQ ID NO:9), and the antisense chain is ACAAGAAGACGAUGUAGACAA (SEQ ID NO:21). The justice chain is GGUGGUGACGCUGAUUGAA (SEQ ID NO:10), and the antisense chain is UUCAAUCAGCGUCACCACC (SEQ ID NO:22).

2. The small interfering RNA as described in claim 1, characterized in that, At least one nucleotide in the small interfering RNA is modified.

3. The small interfering RNA according to claim 2, characterized in that, The modified nucleotide is selected from those with a sugar moiety modified at the 2' position, or at least one phosphate ester group that is a phosphate ester group containing the modified group, or one or more nucleotide analogs.

4. The small interfering RNA as described in claim 3, characterized in that, The nucleotides modified at the sugar portion of the 2' position include nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T0-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

5. The small interfering RNA as described in claim 3, characterized in that, Specifically, a phosphate ester group containing a modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in a phosphate diester bond with a sulfur atom.

6. The small interfering RNA as described in claim 3, characterized in that, Nucleotide analogs are selected from one of the following: isonucleotides, LNA, ENA, cEtBNA, UNA, or GNA.

7. A biological material, which is any one of the following: 1) A vector containing the small interfering RNA as described in any one of claims 1 to 6; 2) A reagent or kit containing the small interfering RNA as described in any one of claims 1 to 6 or the vector described in 1); 3) A pharmaceutical composition comprising the small interfering RNA as described in any one of claims 1 to 6 and other pharmaceutically acceptable components.

8. The small interfering RNA as described in claims 1 to 6, characterized in that, The small interfering RNA is in liquid form.

9. The use of the small interfering RNA as described in any one of claims 1 to 6 or the biomaterial as described in claim 7 in a medicament for treating dry eye syndrome.