A method for enrichment and specific detection of extrachromosomal circular DNA binding to a target protein

By combining cross-linking fixation, immunoprecipitation, and selective enrichment of circular DNA with high-throughput sequencing, this method solves the problem of difficulty in identifying target protein-bound eccDNA in existing technologies. It achieves accurate and highly specific enrichment and detection of target protein-bound eccDNA, supporting gene expression regulation and disease research.

CN122279004APending Publication Date: 2026-06-26ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610746528.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-27
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing technologies struggle to systematically and specifically identify the association between target proteins and extrachromosomal circular DNA (eccDNA), especially in distinguishing or preserving circular eccDNA structures in complex genomic backgrounds. This makes it difficult to accurately enrich and identify target proteins binding to eccDNA.

Method used

The method employed cross-linking fixation, immunoprecipitation, selective enrichment of circular DNA, and high-throughput sequencing. Cross-linking fixation maintained the protein-DNA binding state, immunoprecipitation was performed using specific antibodies targeting the protein, and linear DNA was removed by treatment with ATP-dependent exonucleases. The eccDNA bound to the target protein was retained and enriched, followed by amplification and high-throughput sequencing analysis.

Benefits of technology

It achieves precise and highly specific enrichment and detection of target protein-bound eccDNA, significantly improving the reliability and sensitivity of detection results. It enables genome-wide localization and systematic study of target protein-bound eccDNA, supporting multidimensional research on functional eccDNA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122279004A_ABST
    Figure CN122279004A_ABST
Patent Text Reader

Abstract

This invention provides a method for the enrichment and specific detection of extrachromosomal circular DNA (eccDNA) bound to target proteins, belonging to the field of gene-protein interaction technology. This invention provides a method for enriching eccDNA bound to target proteins. Based on the conventional chromatin immunoprecipitation procedure, it introduces a circular DNA enrichment step involving selective enzymatic digestion to remove linear DNA, achieving precise and highly specific enrichment of eccDNA bound to target proteins. This invention combines immunoprecipitation, selective enrichment of circular DNA, amplification, and high-throughput sequencing, and analyzes the results based on the identification of circular junctions, enabling genome-wide localization and systematic study of eccDNA bound to target proteins. This invention can accurately identify eccDNA bound to target proteins, providing important technical support for studying the role of eccDNA in gene expression regulation, chromatin conformation formation, and diseases such as tumors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene-protein interaction detection technology, specifically relating to a method for enriching and specifically detecting extrachromosomal circular DNA that binds to target proteins. Background Technology

[0002] Extrachromosomal circular DNA (eccDNA) is a circular DNA molecule that exists independently of chromosome structure and is widely distributed in various normal and pathological tissues. The formation of eccDNA is closely related to processes such as genome damage repair, recombination, and replication stress. Its sequence origin is complex and its structure is diverse, making it potentially important in the study of genome stability maintenance and gene regulation.

[0003] Current research on eccDNA mainly relies on high-throughput sequencing combined with circular DNA enrichment strategies to analyze its sequence composition, length distribution, and genomic origin at a holistic level. These techniques have advanced the systematic understanding of the basic characteristics of eccDNA, but they primarily focus on the overall features of eccDNA and cannot distinguish subgroups with specific biological functions, especially eccDNA associated with key chromatin regulatory factors.

[0004] Various chromatin regulatory factors are known to play a central role in gene expression regulation and chromatin conformation maintenance. For example, CCCTC binding factor (CTCF) and RNA polymerase II (RNAPII) can directly bind to specific sites in the genome, participating in the construction of three-dimensional genome structure, transcription initiation, and transcriptional regulation. Previous studies have shown that RNAPII can also bind to eccDNA and mediate its transcription, suggesting that eccDNA may possess independent regulatory activity. Unlike these proteins that can directly bind DNA, the acetylation modification at position 27 of histone H3 (H3K27ac) is an epigenetic modification occurring in the nucleosome histone tail and is a characteristic marker of active enhancer and promoter regions. The discovery of H3K27ac enrichment in eccDNA-derived regions suggests that some eccDNA may retain the active regulatory characteristics of their genomic origin sites. Although H3K27ac does not directly bind to DNA sequences, it can be recognized by specific antibodies and therefore can be used to enrich eccDNA subsets with active chromatin states. The above studies suggest that CTCF, RNAPII, and H3K27ac-related active regions may be involved in the formation, function, or regulation of eccDNA. However, there is currently a lack of technical means to systematically and specifically identify the association between these regulatory factors and eccDNA. In particular, due to the unique structure, low abundance, and diverse sizes of eccDNA, existing immunoprecipitation techniques that rely on chromatin cross-linking and random fragmentation are difficult to effectively distinguish between linear chromosomal DNA and eccDNA, making it difficult to accurately enrich and identify protein-bound or epigenetic eccDNA.

[0005] While traditional chromatin immunoprecipitation (ChIP) is widely used to study protein-DNA interactions, its underlying principle makes it difficult to distinguish or preserve circular eccDNA structures in complex genomic contexts. Furthermore, eccDNA is present in low absolute quantities in cells and is easily diluted, lost, or mixed with linear DNA during the ChIP process, thus hindering reliable detection of target protein-bound eccDNA.

[0006] Therefore, current technologies lack an efficient method for specifically detecting extrachromosomal circular DNA bound to target proteins, and cannot systematically identify eccDNA bound to key chromatin regulatory proteins. This technological limitation restricts the application of eccDNA in gene expression regulation and related disease mechanism research. Summary of the Invention

[0007] This invention provides a method for enriching and specifically detecting extrachromosomal circular DNA that binds to target proteins, enabling precise and highly specific detection of target protein-bound eccDNA and facilitating genome-wide localization and systematic study of target protein-bound eccDNA.

[0008] The present invention provides a method for enriching extrachromosomal circular DNA that binds to a target protein, comprising the following steps: (1) cross-linking and fixing the tissue or cells to keep the chromatin in a protein-DNA bound state, and then lysing it to obtain a lysate; (2) The chromatin in the lysate obtained in step (1) is fragmented and immunoprecipitated using a specific antibody against the target protein to obtain an immunoprecipitation complex. (3) After washing the immunoprecipitation complex described in step (2), it is treated with protease to obtain DNA solution; (4) The DNA solution in step (3) is treated with an ATP-dependent exonuclease to obtain an enriched subpopulation of extrachromosomal circular DNA that binds to the target protein.

[0009] In one specific embodiment of the present invention, the cross-linking fixation method in step (1) includes formaldehyde cross-linking fixation.

[0010] In one specific embodiment of the present invention, the cells in step (1) include cell lines derived from mice or humans.

[0011] In one specific embodiment of the present invention, the fragmentation in step (2) includes cutting the chromatin into fragments of 200~600 bp using an ultrasonic fragmentation method.

[0012] In one specific embodiment of the present invention, the target protein in step (2) includes chromatin regulatory factors.

[0013] The present invention also provides an enriched subpopulation of extrachromosomal circular DNA that binds to target proteins, obtained using the above-described enrichment method.

[0014] The present invention also provides a method for the specific detection of extrachromosomal circular DNA that binds to a target protein, comprising the following steps: amplifying the enriched subpopulation of the extrachromosomal circular DNA that binds to the target protein, and fragmenting the amplification product. A high-throughput sequencing library was constructed from fragmented DNA and sequenced. Based on the sequencing results, specific detection and whole-genome analysis of extrachromosomal circular DNA that binds to target proteins were achieved.

[0015] In one specific embodiment of the present invention, the amplification includes utilizing 29. DNA polymerase is used for amplification.

[0016] In one specific embodiment of the present invention, after sequencing, the extrachromosomal circular DNA is identified and located genomically using characteristic split-read and circular junction information in the sequencing data, thereby achieving specific detection and whole-genome analysis of eccDNA that binds to target proteins.

[0017] The present invention also provides extrachromosomal circular DNA that binds to the target protein obtained using the above-described specific detection method.

[0018] Beneficial effects: This invention provides a method for enriching eccDNA that binds to target proteins. Based on the conventional chromatin immunoprecipitation process, a circular DNA enrichment step is introduced to selectively remove linear DNA by enzyme digestion, thereby retaining and enriching DNA molecules with circular structures, achieving precise and highly specific enrichment of eccDNA that binds to target proteins.

[0019] This invention combines immunoprecipitation, selective enrichment and amplification of circular DNA, and high-throughput sequencing, and analyzes the results based on the identification of circular junctions to achieve genome-wide localization and systematic study of target protein-bound eccDNA. By introducing a circular DNA-specific enrichment step, this invention effectively removes linear DNA, significantly improving the detection specificity of target protein-bound eccDNA and solving the problem that traditional ChIP-seq cannot distinguish between linear and circular DNA, making it difficult to detect eccDNA bound to target proteins. This invention combines immunoprecipitation, selective retention of circular DNA, and high-throughput sequencing to ensure that the detected DNA is indeed circular and accurately reflects the binding status of target proteins, significantly improving the reliability and sensitivity of the detection results. The method described in this invention can target various chromatin regulatory proteins, providing a universal technical platform for multidimensional research on screening functional eccDNA. This invention can accurately identify target protein-bound eccDNA, providing important technical support for studying the role of eccDNA in gene expression regulation, chromatin conformation formation, and diseases such as tumors, and has significant scientific research and application value. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the eccChIP-seq test procedure of the present invention; Figure 2 This is a quality control diagram of the eccChIP-seq experiment of the present invention. In the diagram, A: gel electrophoresis before and after chromatin fragmentation; B: electrophoresis before and after Covaris sonication of circular DNA amplification products, showing that the amplification products are effectively cleaved into fragments suitable for library construction; C: quality control diagram of fragmented eccDNA library, showing the distribution and quality of library fragments. Figure 3This figure shows the comparison results of eccDNA split-read signal and eccDNA number in eccChIP-seq and ChIP-seq of this invention. In the figure, A: the proportion of split-reads supporting eccDNA circular structure to total effective reads in each sequencing sample, showing that eccChIP-seq has a higher circular DNA signal than ChIP-seq; B: statistics of eccDNA number identified using Circle-Map. Figure 4 The figure shows the results of the enrichment analysis of antibody-enriched eccDNA relative to unenriched eccDNA (input eccDNA) in the corresponding protein binding region. Figure A: The overlap ratio of eccDNA identified by eccChIP-seq with ChIP-seq peaks is compared with the peak drop ratio of input eccDNA; Figure B: The enrichment score of antibody-enriched eccDNA relative to input eccDNA in the ChIP-seq peak region, showing the specific enrichment effect of eccChIP-seq in the protein binding region. Figure 5 The figure shows the correlation analysis between CTCF binding characteristics and eccDNA enrichment. Figure A shows the result that as the CTCF ChIP-seq peak signal intensity increases, the eccChIP-seq enrichment level of CTCF-bound eccDNA also increases accordingly. Figure B shows the result that as the length of the CTCF binding region increases, the eccChIP-seq enrichment level of CTCF-bound eccDNA also shows an upward trend. Figure 6 The figure shows the results of eccChIP-seq detection of protein binding to eccDNA based on in vitro synthesized eccDNA. A: Schematic diagram of experimental procedure, B: qPCR results of transfection efficiency, C: qPCR results of eccDNA enrichment relative to control after CTCF immunoprecipitation. Detailed Implementation

[0021] The present invention provides a method for enriching extrachromosomal circular DNA that binds to a target protein, comprising the following steps: (1) cross-linking and fixing the tissue or cells to keep the chromatin in a protein-DNA bound state, and then lysing it to obtain a lysate; (2) The chromatin in the lysate obtained in step (1) is fragmented and immunoprecipitated using a specific antibody against the target protein to obtain an immunoprecipitation complex. (3) After washing the immunoprecipitation complex described in step (2), it is treated with protease to obtain DNA solution; (4) The DNA solution in step (3) is treated with an ATP-dependent exonuclease to obtain an enriched subpopulation of extrachromosomal circular DNA that binds to the target protein.

[0022] This invention does not specifically limit the type of tissue or cell. Examples of cells are used in the embodiments, and these cells can be derived from human or mouse cell lines. One embodiment uses human colorectal adenocarcinoma cells as an example, but this should not be considered as the entire scope of protection of this invention. In this invention, the cells to be tested are cross-linked and fixed, followed by lysis to release chromatin into the lysis buffer while maintaining protein-DNA binding.

[0023] In this invention, the target cells are cultured using conventional methods until they reach approximately 70%–80% confluence, at which point they are collected by centrifugation at a concentration of 5 × 10⁻⁶ cells / year. 6 In one embodiment, the collected cells were resuspended in PBS buffer and cross-linked and fixed using a formaldehyde aqueous solution with a volume fraction of 37%, added until the final volume concentration of formaldehyde reached 1%. The cross-linking and fixation described in this invention is performed at room temperature, specifically including cross-linking by shaking. For example, in one embodiment, the well-mixed liquid is placed on a shaker at 110 rpm for 20 minutes for cross-linking. In this invention, room temperature refers to 20-25°C.

[0024] After the fixation and crosslinking, the present invention terminates the crosslinking by using sodium glycate aqueous solution, and the amount of glycine aqueous solution added is sufficient to achieve a final glycine concentration of 0.2 M. After adding the glycine aqueous solution, the mixture is shaken at 110 rpm for 5 min at room temperature.

[0025] In this invention, cells are collected after the cross-linking is terminated, and the collected cells are lysed using a lysis buffer, which includes sodium dodecyl sulfate (SDS) solution. Specifically, before lysis, the cells are first treated with SDS solution, and then lysed with the lysis buffer. In one embodiment, a 0.55% (g / mL) SDS solution is used for treatment. This treatment is performed at room temperature, with incubation at room temperature for 10 min, followed by heating at 62°C for 10 min and then at 37°C for 10 min. Lysis is then performed by adding the lysis buffer, which is a mixture of Tris-Acetate 40 mM, EDTA 1 mM, sodium acetate 20 mM, and 0.1% SDS, referred to as 0.1% SDS lysis buffer. After adding the 0.1% SDS lysis buffer, the mixture is mixed, incubated at room temperature for 2 min, centrifuged to discard the supernatant, and resuspended in the 0.1% SDS lysis buffer to obtain cell lysate. In one embodiment, the centrifugation force is 1500 g, and the centrifugation time is 5 min.

[0026] This invention fragments the chromatin in the cell lysate. In one embodiment, an ultrasonic disruption method is used to cut the chromatin into fragments of 200-600 bp to obtain a chromatin solution suitable for subsequent immunoprecipitation. The ultrasonic disruption method used in this invention has a power of 500 W, a cycle of 30 seconds on, 30 seconds off, and 30% AMP (amplitude unit), for a total of 10 cycles. The solution is then centrifuged at 4°C and 10,000 g for 10 minutes, and the supernatant is collected as the fragmented chromatin solution.

[0027] This invention utilizes specific antibodies to precipitate and enrich DNA targeting proteins via chromatin immunoprecipitation. The target proteins include chromatin regulatory factors, such as CTCF, H3K27ac, or RNA polymerase II. In one embodiment of this invention, a specific antibody against the target protein is used to perform immunoprecipitation on fragmented chromatin, enriching the DNA bound to the target protein onto magnetic beads.

[0028] This invention involves eluting the immunoprecipitation complex adsorbed on the magnetic beads through multiple washing steps, followed by reverse cross-linking under the action of a protease to release protein-bound DNA molecules and obtain purified DNA suitable for subsequent processing. After removing impurities adsorbed on the magnetic beads, the invention uses an elution buffer to elute the target protein-bound DNA adsorbed on the magnetic beads, and then uses a protease to decross-link it.

[0029] After the decrosslinking process, the present invention selectively removes linear DNA and enriches eccDNA. Specifically, the obtained DNA is treated with an ATP-dependent exonuclease, which specifically degrades the linear double-stranded DNA, while the eccDNA with a circular topology is selectively retained, thereby enriching the eccDNA subset that targets protein binding.

[0030] The present invention also provides an enriched subpopulation of extrachromosomal circular DNA that binds to target proteins, obtained using the above-described enrichment method.

[0031] The present invention also provides a method for the specific detection of extrachromosomal circular DNA that binds to a target protein, comprising the following steps: amplifying the enriched subpopulation of the extrachromosomal circular DNA that binds to the target protein, and fragmenting the amplification product. A high-throughput sequencing library was constructed from fragmented DNA and sequenced. Based on the sequencing results, specific detection and whole-genome analysis of extrachromosomal circular DNA that binds to target proteins were achieved.

[0032] The amplification described in this invention utilizes phi29 ( 29) DNA polymerase amplification is performed using random primers. The amplification procedure includes: pre-denaturation at 95°C for 3 min; incubation at 30°C for 8 h; and heating at 65°C for 10 min. After obtaining the amplified product, the present invention can further purify it. For example, in the embodiments, the amplified product was purified using VAHTS DNA CleanBeads (Novizan N411-02) according to the manufacturer's instructions. The present invention utilizes… 29 DNA polymerase amplifies enriched circular DNA to increase the sequencing input of eccDNA.

[0033] The present invention fragments the amplification product to make the amplified eccDNA reach a fragment length range suitable for sequencing library construction. The fragmentation can be performed by ultrasonic disruption, for example, by setting the peak incident power to 175 W, the duty cycle to 10%, the number of cycles per pulse train to 200, and the total duration to 180 s, to obtain fragmented eccDNA with a size of 250~750 bp.

[0034] This invention utilizes fragmented eccDNA to construct high-throughput sequencing libraries and performs sequencing. It then uses characteristic split-read and circular junction information from the sequencing data to identify and genomically locate the eccDNA, thereby achieving specific detection and whole-genome analysis of eccDNA binding to target proteins. In one embodiment, the fragmented eccDNA is constructed using the VAHTS Universal DNA Library Prep Kit for Illumina V4 (Novizan, catalog number ND610-01). The library is quality-controlled using an Agilent Bioanalyzer, and PE150 paired-end sequencing is performed using the BGI T7 platform, denoted as eccChIP-seq Rep1 and eccChIP-seq Rep2. Sequencing is then performed by Tianjin Novogene Co., Ltd.

[0035] The present invention also provides extrachromosomal circular DNA that binds to the target protein obtained using the above-described specific detection method.

[0036] The target protein-binding eccDNA identified in this invention can be used to elucidate the transcriptional regulation mechanism mediated by eccDNA, screen for functional eccDNA, elucidate the mechanisms of disease development and drug resistance, and explore potential diagnostic biomarkers and therapeutic targets.

[0037] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a method for enriching and specifically detecting extrachromosomal circular DNA that binds to target proteins, should not be construed as limiting the scope of protection of the present invention.

[0038] Example 1 The detection method for extrachromosomal eccDNA targeting protein binding is named eccChIP-seq, and the experimental design is as follows: Figure 1 As shown, the main steps include cell cross-linking, immunoprecipitation, decross-linking, linear DNA removal, circular DNA amplification, and library construction and sequencing.

[0039] 1. Cell cross-linking and lysis COLO320 DM cells (human colorectal adenocarcinoma cells, ATCC catalog number CCL-220) were seeded in 30 mL of RPMI 1640 medium (Sevier, catalog number: G4535-500 mL), containing 10% fetal bovine serum and 1% penicillin-streptomycin. The cells were cultured at 37°C in a 5% CO2 incubator until they reached 70%–80% confluence, at which point they were collected by centrifugation at 5 × 10⁻⁶ cells / mL. 6 Centrifuge each cell at 1000 rpm for 5 min at room temperature and discard the supernatant culture medium.

[0040] Cells were washed once with 10 mL of 1×PBS (Seville, catalog number: G4202-500ML), then resuspended in 15 mL of 1×PBS, and 417 μL of 37% formaldehyde aqueous solution (Sigma-Aldrich, catalog number: F8775) was added to bring the final formaldehyde concentration to 1%. After gently inverting to mix, the cells were crosslinked at 110 rpm for 20 min at room temperature. Then, 1.34 mL of 2.5 M glycine aqueous solution (Aladdin, catalog number: A111465, prepared by the user) was added to terminate the crosslinking, bringing the final glycine concentration to 0.2 M; the cells were then shaken at 110 rpm for 5 min at room temperature. The cells were then centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the cells were washed twice with 10 mL of 1×PBS. Finally, the cells were resuspended in PBS and divided into 3 × 10⁶ cells per tube. 6 Each cell was aliquoted into a 1.5 mL centrifuge tube. Centrifuged at 2000 rpm for 5 min at 4 °C, the supernatant was discarded, and the cell pellet was stored at -80 °C for later use.

[0041] Add 100 μL of 0.55% SDS solution (Sigma-Aldrich, catalog number: 436143, prepared by adding 0.55 g sodium dodecyl sulfate to water to a final volume of 100 mL) to each 1.5 mL centrifuge tube containing cell pellet. Incubate at room temperature for 10 min, then heat in a 62°C water bath for 10 min and incubate in a 37°C water bath for 10 min, respectively. Next, add 900 μL of 0.1% SDS lysis buffer (Sigma-Aldrich, catalog number: 436143, Tris-Acetate 40 mM, EDTA 1 mM, sodium acetate 20 mM, 0.1% SDS), gently invert to mix, incubate at room temperature for 2 min, and centrifuge at 1500 g for 5 min. Discard the supernatant, and resuspend the pellet in 500 μL of 0.1% SDS lysis buffer to obtain cell lysis buffer.

[0042] 2. Chromatin fragmentation The cell lysate was ultrasonically disrupted using a Sonics VCX-500 ultrasonic disruptor under ice-water bath conditions. The power was set to 500W, and the program was "30 s on, 30 s off, AMP (amplitude unit) 30%", for a total of 10 cycles. The cells were then centrifuged at 10,000 g for 10 min at 4°C, and the supernatant was collected, which was the fragmented chromatin solution.

[0043] 50 μL of cell lysis buffer and fragmented chromatin solution were taken as samples before and after fragmentation, respectively, and detected by 1% agarose gel electrophoresis. Figure 2 (A) The results showed that the chromatin fragments were mainly concentrated between 200 and 600 bp, which met the requirements of the ChIP test.

[0044] 3. Chromatin immunoenrichment 15 μL of Protein A magnetic beads (Invitrogen, catalog number 10002D) and 15 μL of Protein G magnetic beads (Invitrogen, catalog number 10004D) were mixed separately. Before use, the magnetic beads were washed twice with 500 μL of PBST buffer (PBS and 0.1% Triton X-100) and then resuspended in 750 μL of PBST buffer to obtain a magnetic bead suspension. 250 μL of the magnetic bead suspension was transferred to centrifuge tube A for pre-removal of non-specific chromatin, and 500 μL of the magnetic bead suspension was transferred to centrifuge tube B for antibody conjugation.

[0045] Pre-removal of nonspecific chromatin (Centrifuge tube A): Place centrifuge tube A on a magnetic rack to separate the magnetic beads, discard the supernatant, add 9 μg of fragmented chromatin (supernatant from step 2), and make up the total volume to 500 μL with 0.1% SDS lysis buffer. Incubate slowly at 4°C for 2-3 h.

[0046] Antibody conjugation (Center B): Add 1 μL of H3K27ac antibody (Active Motif, catalog number 39135) to centrifuge tube B, and add PBST buffer to bring the total volume to 500 μL. Incubate at 4°C for 2 h. Then wash the magnetic beads in centrifuge tube B twice with 500 μL of PBST buffer to obtain the antibody-loaded magnetic beads.

[0047] After pre-removing non-specific chromatin from centrifuge tube A, all samples were transferred to centrifuge tube B, and the total volume was brought up to 1 mL with 0.1% SDS lysis buffer. The samples were then incubated overnight at 4°C by rotation.

[0048] Under the same conditions, the antibodies were replaced with (CTCF, Abclonal, catalog number A19588) and RNAPII (BioLegend, catalog number 664906), respectively, and other operations were the same. Two parallel samples were set up for each antibody.

[0049] 4. Elution and decrosslinking Elution: After incubation overnight at 4°C, place centrifuge tube B on a magnetic rack. Once the magnetic beads are completely adsorbed, slowly aspirate the supernatant. Then, wash the chromatin-antibody complex bound to the magnetic beads sequentially, following these steps: Wash three times with 1 mL of low-salt washing buffer (0.1% SDS lysis buffer containing 0.15 M NaCl), gently inverting to mix each time, incubate at room temperature for 3 min, let stand on a magnetic rack for 1 min, and then discard the supernatant. Wash three times with 1 mL of high-salt washing buffer (0.1% SDS lysis buffer containing 0.35 M NaCl), each time as above. Wash twice with 1 mL of LiCl washing buffer (components: 10 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% Nonident P-40, 0.5% Sodium Deoxycholate), each time as above. Wash once with 1 mL of TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA), each time as above.

[0050] Decrosslinking: After washing, resuspend the magnetic beads in 100 μL of elution buffer (components: 1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.0) and incubate at 65°C and 900 rpm for 60 min. After separating the magnetic beads using a magnetic rack, transfer the supernatant to a new 1.5 mL centrifuge tube and add 15 μL of proteinase K (Thermo Fisher Scientific, catalog number AM2548). Incubate at 65°C and 900 rpm for 60 min to reverse crosslinking and remove the protein.

[0051] DNA was purified using a ChIP DNA purification kit (ChIP DNA Clean & Concentrator, ZYMO Research, catalog number: D5205). Elution was performed according to the instructions, and finally, 22 μL of elution buffer was used to elute the DNA.

[0052] 5. Linear DNA removal and eccDNA enrichment The DNA obtained from the decrosslinking process in step 4 was selectively digested with Plasmid-Safe™ ATP-Dependent DNase (Epicentre, catalog number E3101K) to enrich circular DNA (eccDNA). The specific steps are as follows: The reaction mixture was constructed in a 50 μL volume: 20 μL DNA product, 5 μL 10×Reaction Buffer, 2 μL 25 mM ATP, 1 μL DNase, and the remainder sterile water. It was incubated at 37 °C for 16 h. After digestion, the DNA was purified using VAHTS DNA CleanBeads (Novizan N411-02) according to the manufacturer's instructions, and eluted with 20 μL TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The supernatant was collected by centrifugation, yielding the enriched circular DNA product.

[0053] 6. Circular DNA amplification Add 20 μL of the eccDNA obtained in step 5, 2.5 μL of random primers (Thermo Fisher Scientific, catalog number: N8080127), and 5 μL of 10×Reaction Buffer (Novizan, catalog number: N106-02) from the phi29 DNA polymerase kit to a 0.2 mL centrifuge tube, and bring the volume to 44 μL with RNase-free water. After mixing, incubate at 95 °C for 3 min to denature the DNA, and then immediately cool on ice for 5 min. Next, add 5 μL of dNTP mixture (Novizan, catalog number: P031-01) and 1 μL of phi29 DNA polymerase (Novizan, catalog number: N106-02) to the above reaction system, mix well, and incubate at 30 °C for 8 h, followed by heating at 65 °C for 10 min to terminate the reaction. Purify the amplified products using VAHTS DNA Clean Beads (Novizan N411-02) according to the manufacturer's instructions.

[0054] 7. Fragmentation of circular DNA amplification products The eccDNA amplification product obtained in step 6 was fragmented using a Covaris S220 non-contact ultrasonic disruptor. Operating conditions were set according to the manufacturer's recommendations (Peak Incident Power: 175 W, Duty Factor: 10%, Cycles / Burst: 200, time: 180 s), yielding fragmented eccDNA ranging in size from 250 to 750 bp. The eccDNA fragments before and after fragmentation were detected by agarose gel electrophoresis. Figure 2 (B) shows that the interruption effect is good.

[0055] 8. Library construction and sequencing Fragmented eccDNA was constructed using the VAHTS Universal DNA Library Prep Kit for Illumina V4 (Novizan, catalog number ND610-01), and the library was quality controlled using an Agilent Bioanalyzer. Figure 2 The sequences were obtained from the C-ends of the PE150 sequence and were performed using the BGI T7 platform, denoted as eccChIP-seq Rep1 and eccChIP-seq Rep2. Sequencing was performed by Tianjin Novogene Co., Ltd.

[0056] Comparative Example 1 To obtain a control library (eccChIP-seq input) that is comparable to the eccChIP-seq sample, the input uses fragmented chromatin from the same source as the ChIP experiment in Example 1, but without performing an immunoprecipitation step.

[0057] The specific procedure is as follows: Take 100 μL of fragmented chromatin from step 2 (the supernatant obtained after chromatin fragmentation) of eccChIP-seq in Example 1, skip the ChIP immunoenrichment step (i.e., do not perform step 3 in Example 1), and directly proceed to the same processing flow as the eccChIP-seq sample. First, complete the decrosslinking treatment according to the conditions in step 4 of eccChIP-seq; then, perform linear DNA removal according to the method in step 5 to enrich eccDNA. Afterwards, perform circular DNA amplification, fragmentation, and library construction sequentially according to steps 6–8, and finally sequence the same batch as the eccChIP-seq sample. The resulting library is denoted as input. This input library reflects the overall background level of eccDNA and is used for comparative analysis of eccDNA that binds to target proteins.

[0058] Comparative Example 2 To obtain traditional ChIP-seq data for comparison with eccChIP-seq, the same cell crosslinking, lysis, fragmentation, and immunoprecipitation procedures as eccChIP-seq were used, but the eccDNA enrichment-related steps were omitted, including: Step 5: linear DNA removal; Step 6: circular DNA amplification; Step 7: fragmentation of amplification products. The remaining steps were kept consistent to ensure that ChIP and eccChIP-seq were comparable in experimental systems.

[0059] The specific process is as follows: 1. Perform steps 1-4 of Example 1 (cell cross-linking, lysis, chromatin fragmentation, chromatin immunoenrichment and decross-linking), and the resulting DNA and eccChIP-seq samples are treated under the same conditions at this stage.

[0060] 2. Skip the steps related to circular DNA enrichment (i.e., do not perform linear DNA removal, and do not use Plasmid-SafeDNase). The decrosslinked and purified ChIP DNA is directly used for library construction.

[0061] 3. Library construction used the same library construction kit as eccChIP-seq (VAHTS Universal DNALibrary Prep Kit for Illumina V4, Novizan ND610-01), and quality control was performed using Agilent Bioanalyzer.

[0062] 4. PE150 sequencing was performed using the BGI T7 platform, denoted as ChIP-seq.

[0063] Traditional ChIP-seq libraries are used to identify the binding regions of target proteins to linear genomic DNA and can serve as a supplementary reference for target protein binding to eccDNA.

[0064] Experimental Example 1 The same analysis was performed on the eccChIP-seq Rep1 and eccChIP-seq Rep2 obtained in Example 1, the input obtained in Comparative Example 1, and the raw ChIP-seq sequencing data obtained in Comparative Example 2: First, FastQC was used for initial quality assessment, including indicators such as base quality distribution, GC content, adapter contamination, and sequence repetition. Then, FAP was used to preprocess the raw data, including removing adapter sequences and filtering low-quality reads to obtain high-quality clean reads. The processed clean reads were aligned to the human reference genome hg38 using BWA-MEM. After obtaining high-quality BAM files, Circle-Map was used to detect eccDNA structure in eccChIP-seq Rep1, Rep2, input, and ChIP-seq samples. Circle-Map identifies reads crossing circular junctions based on split-read and discrete read-pair information, thereby inferring potential eccDNA sites. The number of split-reads identified by Circle-Map for each sample was counted, and their proportion of the total valid aligned reads was calculated.

[0065] The comparison results are as follows Figure 3 As shown. The eccChIP-seq described in this invention has a structural recognition advantage over traditional ChIP-seq: one of the typical characteristics of eccDNA is the generation of split-reads at the circularization breakpoint (i.e., the two segments of a read are respectively aligned to regions on the genome that are discontinuous but closed in eccDNA). Traditional ChIP-seq does not include linear DNA removal and circular DNA amplification steps, therefore it is almost impossible to detect circular structural features. Figure 3 As shown in Figure A, the proportion of split-reads in traditional ChIP-seq is extremely low, while the split-read signal is significantly increased in eccChIP-seq; in addition, eccChIP-seq can identify a large number of eccDNAs with well-defined circular junctions. Figure 3 (B) This demonstrates that eccChIP-seq can capture true circular DNA molecules with high sensitivity, and its structure recognition capability is far superior to that of traditional ChIP-seq.

[0066] Experimental Example 2 Building upon Experiment 1, to obtain the binding regions of target proteins on the genome, peak identification was performed on the ChIP-seq data using MACS2. The sorted, low-quality, and duplicate reads-removed ChIP-seq BAM file was used as input, and the macs2 callpeak module was invoked to perform peak detection in a mode without a genome input control. The ChIP-seq peaks output by MACS2 were used as the binding regions of the corresponding target proteins on the genome for subsequent enrichment analysis.

[0067] To assess whether the target protein binding eccDNA detected by eccChIP-seq is specifically enriched, rather than originating from the overall cellular eccDNA background, this invention performs interval overlap analysis on the eccDNA genomic sites identified by Circle-Map in eccChIP-seq and the ChIP-seq peaks of the same sample. Specifically, firstly, the input eccDNA (i.e., circular DNA not enriched by antibodies) is processed using the same procedure as eccChIP-seq to obtain its eccDNA site set, which is then used as the background set. Subsequently, BEDTools is used to calculate the interval intersection between the eccDNA identified by eccChIP-seq and the corresponding target protein's ChIP-seq peaks. The proportion of eccDNA falling into the ChIP-seq peak region is calculated and compared with the proportion of input eccDNA peaks, thereby assessing the degree of specific enrichment of the target protein binding eccDNA. The analysis results are shown below. Figure 4 Input eccDNA represents the background of eccDNA from all sources in the cell and lacks protein binding-related selectivity. eccChIP-seq, however, through a ChIP enrichment step, can specifically capture eccDNA subsets that bind to target proteins (such as CTCF, H3K27ac, and RNAPII). Figure 4 As shown in Figure A, the distribution of eccDNA identified by eccChIP-seq on the genome is significantly enriched in the corresponding ChIP-seq peak regions. Figure 4 As shown in Figure B, the signal enrichment score of eccChIP-seq was significantly higher than that of Input eccDNA. This indicates that eccChIP-seq can specifically enrich the eccDNA subsets that bind to the target protein, reflecting its significant advantage in the detection of functional eccDNA.

[0068] Experimental Example 3 To further verify the relationship between target protein binding strength, binding region length, and eccDNA enrichment, CTCF was used as a representative target protein, and CTCF ChIP-seq peaks were analyzed in groups. Specifically, CTCF ChIP-seq peaks were sorted from low to high peak signal intensity and divided into 10 groups, denoted as S1 to S10. The normalized enrichment ratio of CTCF-binding eccDNA identified by eccChIP-seq in each group's ChIP-seq peak region was then calculated, with input eccDNA used as a background control. Results are as follows: Figure 5 As shown in Figure A, with the gradual increase in the peak signal intensity of CTCF ChIP-seq, the enrichment ratio of CTCF-binding eccDNA detected by eccChIP-seq in the corresponding peak region showed a significant upward trend; while the proportion of Input eccDNA in each group remained at a low level and did not increase significantly with the enhancement of peak signal. Furthermore, the CTCF ChIP-seq peaks were sorted according to peak length from shortest to longest and divided into 10 groups, denoted as L1 to L10. The normalized enrichment ratio of CTCF-binding eccDNA in each group was calculated using the same method and compared with the Input eccDNA. The results are as follows: Figure 5 As shown in Figure B, with the increase of the CTCF ChIP-seq peak length, the enrichment ratio of CTCF-binding eccDNA detected by eccChIP-seq gradually increases and is significantly higher than the background level of input eccDNA. These results indicate that the binding strength of eccDNA captured by eccChIP-seq to the target protein and the length of its genomic binding region are closely related. The stronger the CTCF binding signal and the longer the binding region, the higher the enrichment degree of CTCF-binding eccDNA in the corresponding region, indicating that the method of this invention can effectively identify functional eccDNA subsets associated with binding to specific proteins.

[0069] Experiment Example 4 To verify the ability of the eccChIP-seq method to specifically capture eccDNA bound to target proteins, this study constructed in vitro synthesized eccDNA, transfected it into cells, and used eccChIP-seq to detect the enrichment of CTCF protein binding to different eccDNAs.

[0070] 1. Selection and Sequence Design of eccDNA Two eccDNAs containing the CTCF binding motif (denoted as eccDNA#1 and eccDNA#2) and one eccDNA without the CTCF binding motif (denoted as Control eccDNA) were selected as controls. The sequence information of the three is as follows: eccDNA#2(SEQ ID No.2):5’-CCCAAGCTTCAACTCTACTCCCAGATGTGCAATAATTTCTCTGGCCACCAGGAGGCATCACAGCTATCTTCATCTTTGTCGTTCTTTTTTAATGAACAGAAGTGTATTCTACAGAGTAATGAATGTTATGAAAATATTTATTATAATAACAATTCTGTTTGGAAAATTCACATGCATATTAAAAACAGTCCTATTTGCTGTTCACCCCAAATCTACATCGAATTCATTGATTTATCTCTTCCCTCCTCGGTGTAGATTGAGGTGTCCACACTGTAGAGGGGTGCCTTCCAGAGAGCTGGGTGTTCACCCTCCGTTACCCTACCGTTGTACAGGCTTCTCAAACCTCTCACTCCCTCTCACTCATCCCCTCTCCAGGACATTATGGACGCAGCTGCCCAGGACCCACTTAGGCACGCCCATACTCTCTCAGTCACCTTCTGCCTGCCTTGCACTATTAATGCTAATGATTGCCAACGTGTGCTAGAGCTGTCTGGTGTTTCATTGTTGATGCCATACATATATACAGACTTATTTTACACCTATCATCAGGTTTTTTTCTGACAGAATTAGAATTACTCTGTAATCTAGATTCATAAGCTAAGTTTTAAGGGAGGTATTTTATTTTTTGCTCCTTGCAGACCCTTCTTGATAGAGTTCGATAATGGTGGTACCGTGGTGCCCTCTCGTGACAGAAGGCTGAACTACAGCTAGAACATCGCGAGCAAGCTTGGG-3’; Control eccDNA (SEQ ID No.3): 5’-CCCAAGCTTCTCCCTGGAGAAACAGGTATGATGGGGAGGGCCCTGCACAGCCCTGGGGTTGATTGCACAGCCCATAAGAGAGAAAAAGCCCAAACACGTGAACATAAGAGGTCAAGTTAGAAGAACCTAGAGAGATAACCTGGCTTCCAGAGACCCAGATATATCACATCCATCCATCCATCCATCCATCCATCCATCCATCCATCATCCCATCCACCTGCTCAGAAGTGGTCCCAGCCTATGGAGGGAGGGCCTCATCAATCCCTGGCCATAACCCAAGGGTGGCTCAAGCCCCAGGGAAAAGTGGCCGAGGAGAGCAGAACAAGTTCTGGCCTAAAAGTCAAGACCCCTGGTTCCTCTTTTTGGCTCGCCATTAGCTAACTACATGAACCAGATCATTTGGCTTGACTTTCTGGACCTCAGTCTCCCCACCTGTAAAATGGGGACAGTTGGACCAGGAGGTGGATGGGGATTTCCAGTTCTAACATTCTGTAGCTGAGCCTCTGGCCTCTGACGTCACAATATGGAGCTGGCCTCACCCAGCTCTGCTGCTCTGTTGGTCATGGGAGCAAGGTGGACTTGCCCTGGACCTTCCCTACTTGTGCTCCTCTGTTATGGGCAGCTCTTGCCTTGGCTCAGGATCAAGGGTGAACACAGTTTAGGTGTGGCTGGGACCCCAAGAAGCATGGGACCAGACAAAGGGACTGGGTGCGGACAGGACCTTCTCAGAAGCTTGGG-3’。

[0071] 2. In vitro eccDNA synthesis Primers were designed based on the ligation site of eccDNA (introducing HindIII restriction sites), and linear DNA fragments were obtained by PCR amplification using COLO320-DM cell genomic DNA as a template. After purification, the fragments were digested with HindIII (NEB, catalog number R3104) and then ligated into circular DNA using T4 DNA ligase (Vazyme, catalog number C301). The ligation product was then treated with Plasmid-Safe R3104 DNase (Epicentre, catalog number E3110K) to remove residual linear DNA, finally yielding the in vitro synthesized eccDNA.

[0072] eccDNA#1_forward (SEQ ID No.4): 5'-CCCAAGCTTAAGAAGCATGAAGACTAGTTTC-3'; eccDNA#1_reverse (SEQ ID No.5): 5'-CCCAAGCTTATCAGAACTTCTGGGAGACAAC-3'; eccDNA#2_forward (SEQ ID No.6): 5'-CCCAAGCTTCAACTCTACTCCCAGATGTGCA-3'; eccDNA#2_reverse (SEQ ID No.7): 5'-CCCAAGCTTGCTCGCGATGTTCTAGCTGTAG-3'; Control_forward (SEQ ID No.8): 5'-CCCAAGCTTCTCCCTGGAGAAACAGGTATG-3'; Control_reverse (SEQ ID No. 9): 5'-CCCAAGCTTCTGAGAAGGTCCTGTCCGCA-3'.

[0073] 3. In vitro eccDNA transfection eccDNA#1, eccDNA#2, and Control eccDNA were mixed in equimolar proportions (total 200 ng) and transfected into COLO320-DM cells using linear polyethyleneimine (PEI) (Yeasen, catalog number 40816ES02). Prior to transfection, cells were sputtered at 8 × 10⁸ cells per well. 5 In 6-well plates, cells were seeded at a density of [number] cells / well; an equal volume of nuclease-free water was used as a negative control (mock group). Approximately 2 × 10⁶ cells / well were collected 24 hours after transfection. 5DNA was extracted from cells using a DNA / RNA co-extraction kit (TIANGEN, catalog number DP422), and transfection efficiency was detected by qPCR across the eccDNA ligation site. Figure 6 (B)

[0074] eccDNA#1_qPCR_forward (SEQ ID No.10): 5'-TCTTTTTCTCTTAGCACTGC-3'; eccDNA#1_qPCR_reverse (SEQ ID No.11): 5'-GGTCCTTTACTGAAACAGTC-3'; eccDNA#1_qPCR_forward (SEQ ID No.12): 5'-CGATAATGGTGGTACCGTGG-3'; eccDNA#1_qPCR_reverse (SEQ ID No.13): 5'-GATAGCTGTGATGCCTCCTG-3'; eccDNA#1_qPCR_forward (SEQ ID No.14): 5'-GAACACAGTTTAGGTGTGGC-3'; eccDNA#1_qPCR_reverse (SEQ ID No. 15): 5'-CTCTCTTATGGGCTGTGCAA-3'.

[0075] 4. Crosslinking and CTCF eccChIP-seq detection Twenty-four hours after transfection, the remaining cells were cross-linked with 1% formaldehyde. After lysis and chromatin fragmentation, CTCF antibody was added for immunoprecipitation to enrich CTCF-bound eccDNA. The immunoprecipitated products were decross-linked and purified, and the enrichment of eccDNA#1, eccDNA#2, and control eccDNA was detected using specific qPCR primers across the eccDNA linker sites. The H2O transfection group was used as a negative control, and control eccDNA was used as a non-specific binding control. The enrichment degree of eccDNA was calculated by qPCR and normalized based on the signal of control eccDNA.

[0076] 5. Experimental Results The experimental procedure is as follows Figure 6 As shown in Figure A: Two types of eccDNA containing the CTCF motif and one control eccDNA were synthesized, mixed, transfected into cells, and detected by eccChIP-seq.

[0077] Transfection efficiency verification ( Figure 6 (B) Compared with the H2O negative control, Control eccDNA, eccDNA#1 and eccDNA#2 were significantly enriched after transfection, indicating that the in vitro synthesized eccDNA successfully entered the cells.

[0078] CTCF combined with specificity verification ( Figure 6 (C) In CTCF immunoprecipitation samples, eccDNA#1 and eccDNA#2 containing the CTCF motif were significantly enriched relative to control eccDNA (consistent across three replicates); control eccDNA without the CTCF motif showed only a low background signal.

[0079] The above results indicate that CTCF can specifically bind to eccDNA containing the CTCF motif, and the eccChIP-seq method can effectively identify and enrich eccDNA bound to CTCF. This experiment further demonstrates that this method can not only detect endogenous protein-binding eccDNA, but also distinguish between eccDNA containing and lacking specific protein-binding motifs in in vitro systems, exhibiting good specificity and reliability.

[0080] In summary, eccChIP-seq outperforms traditional ChIP-seq in recognizing circular DNA structures and surpasses conventional Circle-seq in protein binding specific enrichment, demonstrating significant technological uniqueness and application prospects.

[0081] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for enriching extrachromosomal circular DNA that binds to a target protein, characterized in that, The steps include: (1) cross-linking and fixing the tissue or cells to keep the chromatin in a protein-DNA bound state, and then lysing it to obtain a lysate; (2) The chromatin in the lysate obtained in step (1) is fragmented and immunoprecipitated using a specific antibody against the target protein to obtain an immunoprecipitation complex. (3) After washing the immunoprecipitation complex described in step (2), it is treated with protease to obtain DNA solution; (4) The DNA solution in step (3) is treated with an ATP-dependent exonuclease to obtain an enriched subpopulation of extrachromosomal circular DNA that binds to the target protein.

2. The enrichment method according to claim 1, characterized in that, The cross-linking fixation method in step (1) includes formaldehyde cross-linking fixation.

3. The enrichment method according to claim 1, characterized in that, The cells in step (1) include cell lines derived from mice or humans.

4. The enrichment method according to claim 1, characterized in that, The fragmentation in step (2) includes using an ultrasonic fragmentation method to cut the chromatin into fragments of 200~600 bp.

5. The enrichment method according to claim 1, characterized in that, The target protein in step (2) includes chromatin regulatory factors.

6. An enriched subpopulation of extrachromosomal circular DNA bound to a target protein, obtained by the enrichment method according to any one of claims 1 to 5.

7. A method for the specific detection of extrachromosomal circular DNA that binds to a target protein, characterized in that, The steps include: amplifying the enriched subpopulation of extrachromosomal circular DNA that binds to the target protein as described in claim 6, and fragmenting the amplification product; A high-throughput sequencing library was constructed from fragmented DNA and sequenced. Based on the sequencing results, specific detection and whole-genome analysis of extrachromosomal circular DNA that binds to target proteins were achieved.

8. The specific detection method according to claim 7, characterized in that, The amplification includes utilizing 29. DNA polymerase is used for amplification.

9. The specific detection method according to claim 7, characterized in that, After sequencing, the characteristic split-read and circular junction information in the sequencing data are used to identify and locate extrachromosomal circular DNA in the genome, enabling specific detection and whole-genome analysis of eccDNA that binds to target proteins.

10. Extrachromosomal circular DNA bound to a target protein obtained using the specific detection method according to any one of claims 7 to 9.