Construction Method and Application of Fatty Liver Zebrafish Model Based on Glucokinase Overexpression

By constructing a zebrafish model of fatty liver with glucokinase overexpression, the problem of the lack of GCK overexpression models in the existing technology has been solved, enabling the study of lipid transport abnormalities caused by GCK overexpression and drug screening, and providing a platform for metabolic disease research and drug testing.

CN122303322APending Publication Date: 2026-06-30EAST CHINA NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
EAST CHINA NORMAL UNIV
Filing Date
2026-02-27
Publication Date
2026-06-30

Smart Images

  • Figure CN122303322A_ABST
    Figure CN122303322A_ABST
Patent Text Reader

Abstract

This invention discloses a method for constructing a zebrafish model of fatty liver based on glucokinase overexpression and its application. The method includes the following steps: using cDNA as a template, a zebrafish GCK gene fragment is obtained by PCR amplification; the vector fragment and the GCK gene fragment are homologously recombined using a homologous recombinase to obtain a recombinant plasmid; the recombinant plasmid is transformed into competent cells, and an endotoxin-free plasmid is extracted as a zebrafish GCK expression vector; a microinjection system is used to inject the plasmid into one-cell-stage fertilized eggs; after the fertilized eggs hatch into juveniles, fluorescent juveniles are selected for further culture until sexual maturity; sexually mature males and females are paired to spawn, and a stably heritable GCK-overexpressing zebrafish strain is selected from the offspring. This invention can obtain a zebrafish strain with stable high GCK expression, which can be used as a zebrafish model of fatty liver based on GCK overexpression.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for constructing a fatty liver zebrafish model based on glucokinase overexpression and its application. Background Technology

[0002] Metabolic fatty liver disease (MAFLD) has gradually become the most common chronic liver disease. The core factors in the pathogenesis of MAFLD are excessive energy intake leading to obesity and insulin resistance. Impaired lipid transport in the liver further aggravates the accumulation of fat in the liver, which in turn leads to inflammation and fibrosis, resulting in liver disease.

[0003] Patients with MAFLD often exhibit impaired glucokinase (GCK) activity. Meanwhile, research on fatty liver and even MAFLD caused by high GCK expression is still lacking, and no animal models related to it have yet been developed. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a method for constructing a zebrafish model of fatty liver based on glucokinase overexpression and its application. This method can obtain zebrafish strains that stably and highly express GCK, which can be used as a zebrafish model of fatty liver based on GCK overexpression for research on the mechanism of lipid transport in glucose metabolism-related diseases and metabolic disorder syndromes, as well as for drug screening and drug testing experiments targeting GCK activators.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] On the one hand, a method for constructing a fatty liver zebrafish model based on glucokinase overexpression is provided, which includes the following steps:

[0007] S1. Using zebrafish (Danio rerio) liver cDNA as a template, PCR amplification was performed using upstream primer GCK-gene-F and downstream primer GCK-gene-R. The amplification products were verified and purified by agarose gel electrophoresis to obtain the zebrafish GCK gene fragment.

[0008] S2. The pTOL2 plasmid vector was double-digested with restriction endonucleases ECORI and KPNI to divide the pTOL2 plasmid vector into a large fragment of 4995bp and a small fragment of 20bp. After verification by agarose gel electrophoresis, the large fragment was recovered by gel extraction.

[0009] S3. The recovered large vector fragment and GCK gene fragment are homologously recombined using homologous recombinase to obtain recombinant plasmids.

[0010] S4. Transform the recombinant plasmid into competent cells;

[0011] S5. Select a single competent cell colony that has completed transformation from the culture medium plate and carry out scale-up culture; after the scale-up culture is completed, extract the endotoxin-free plasmid to be used as a zebrafish GCK expression vector.

[0012] S6. Mix the zebrafish GCK expression vector and transposase Tol 2 mRNA to obtain a microinjection system;

[0013] After the AB line wild-type zebrafish pair up and produce one-cell stage fertilized eggs, the microinjection system is injected into the one-cell stage fertilized eggs using a microinjection device.

[0014] After injection, the fertilized eggs were cultured at 37°C until they hatched into juveniles. During the culture process, dead fertilized eggs were removed every 4 hours. The fluorescence of the juveniles was further observed using a fluorescence microscopy device, and the juveniles that emitted fluorescence were selected for further culture until they reached sexual maturity.

[0015] Sexually mature male and female fish are paired to spawn, and zebrafish strains with stable, systemic GCK overexpression are selected from the offspring.

[0016] Preferably, the sequences of the upstream primer GCK-gene-F and the downstream primer GCK-gene-R are as follows:

[0017] GCK-gene-F:

[0018] CGGAATTCATGCATCATCACCATCATCCGTGTCTTACTTCAGCCCG

[0019] GCK-gene-R: GGGGTACCAGGCGTCAGCATGCAGG.

[0020] Preferably, the microinjection system comprises: a GCK expression vector at a final concentration of 50 ng / μL, Tol 2 mRNA at a concentration of 20 ng / μL, and a color indicator, with a final volume of 3 μL.

[0021] Preferably, the injection volume of the microinjection system is 1-2 nl.

[0022] Preferably, the microinjection system is injected into the animal pole of a fertilized egg in the one-cell stage.

[0023] Preferably, the method for constructing the fatty liver zebrafish model further includes the following steps:

[0024] S7. Both the overexpressing GCK zebrafish strain and wild-type zebrafish were subjected to overnight fasting treatment. After the overnight fasting treatment, tissue samples were collected from each parallel zebrafish. The tissue samples included whole fish tissue, serum samples, liver samples, and muscle samples. The biochemical indicators of the zebrafish were statistically analyzed based on the tissue samples.

[0025] Preferably, the physiological indicators include: liver TG, serum TG, muscle TG, and total fat of the whole fish.

[0026] Preferably, the competent cells comprise competent Escherichia coli DH5α.

[0027] Preferably, before expanding the culture of a single competent cell colony that has been transformed, PCR amplification is performed using the upstream validation primer GCK-test-F and the downstream validation primer GCK-test-R, and the amplification products are subjected to gel electrophoresis and sequencing.

[0028] The sequences of the upstream validation primer GCK-test-F and the downstream validation primer GCK-test-R are as follows:

[0029] GCK-test-F:GCAGAGCTCGTTTAGTGAAC

[0030] GCK-test-R: TACTGTTGTCGTTCACCATGG.

[0031] On the other hand, this study provides an application of the aforementioned fatty liver zebrafish model in the research of metabolic diseases and / or metabolic disorder syndromes caused by GCK overexpression.

[0032] On the other hand, an application of the aforementioned fatty liver zebrafish model in drug screening and / or drug testing targeting GCK activators is provided.

[0033] This invention has at least the following beneficial effects:

[0034] This invention obtains a zebrafish strain that stably and highly expresses GCK through GCK overexpression vector construction and microinjection, which can be used as a fatty liver zebrafish model based on GCK overexpression for the study of lipid transport mechanisms in glucose metabolism-related diseases and metabolic disorder syndromes, as well as for drug screening and drug testing experiments targeting GCK activators. Attached Figure Description

[0035] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0036] Figure 1 This is a map of the pTOL2-CMV-6×HIS-GCK-P2A-EGFP plasmid used in this invention;

[0037] Figure 2 This is an electrophoresis diagram of the zebrafish GCK gene fragment in this invention;

[0038] Figure 3 This is an electrophoresis diagram of the single-colony PCR product in this invention;

[0039] Figure 4 These are fluorescence micrographs of F1 generation zebrafish overexpressing GCK in this invention.

[0040] Figure 5 This invention relates to changes in liver TG levels in GCK OE and WT.

[0041] Figure 6 This refers to the changes in serum TG levels of GCK OE and WT in this invention;

[0042] Figure 7 This invention describes the changes in liver TG content after lipidomics analysis of GCK OE and WT.

[0043] Figure 8 This invention describes the changes in phospholipid content of GCK OE and WT after lipidomics analysis.

[0044] Figure 9 These are oil red staining images of liver fat from GCK OE and WT in this invention;

[0045] Figure 10 This refers to the changes in muscle TG levels of GCK OE and WT in this invention;

[0046] Figure 11 This refers to the changes in total fat levels of whole fish in GCK OE and WT in this invention. Detailed Implementation

[0047] To make the technical means, creative features, achieved objectives, and effects of this invention easier to understand, the invention is further described below with reference to specific embodiments and accompanying drawings. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the protection scope of this invention.

[0048] Specific embodiments of the present invention are described below with reference to the accompanying drawings.

[0049] Example:

[0050] This embodiment provides a method for constructing a fatty liver zebrafish model based on glucokinase overexpression, which includes the following steps:

[0051] S1. Using zebrafish (Danio rerio) liver cDNA as a template, PCR amplification was performed using upstream primer GCK-gene-F and downstream primer GCK-gene-R, and the amplification products were verified by agarose gel electrophoresis (e.g., Figure 2 The zebrafish glucokinase gene fragment (hereinafter referred to as "GCK gene fragment") was obtained by purification, and the nucleotide sequence of the GCK gene fragment is shown in SEQ ID NO.1. In this embodiment, the sequences of the upstream primer GCK-gene-F and the downstream primer GCK-gene-R are as follows:

[0052] GCK-gene-F:

[0053] CGGAATTCATGCATCATCACCATCATCCGTGTCTTACTTCAGCCCG

[0054] GCK-gene-R: GGGGTACCAGGCGTCAGCATGCAGG

[0055] S2. The pTOL2 plasmid vector was double-digested with restriction endonucleases ECORI and KPNI to divide the pTOL2 plasmid vector into a large fragment of 4995bp and a small fragment of 20bp. After verification by agarose gel electrophoresis, the large fragment was recovered by gel extraction.

[0056] S3. The recovered vector fragment and GCK gene fragment are homologously recombined using a homologous recombinase to obtain a recombinant plasmid. In this embodiment, the homologous recombinase is Novitan homologous recombinase, and the reaction system is prepared according to the product instructions.

[0057] S4. Transform the recombinant plasmid into competent Escherichia coli DH5α. Specifically, the transformation process is as follows:

[0058] 10 μL of recombinant plasmid and 100 μL of competent Escherichia coli DH5α were mixed to obtain a mixture. The mixture was then placed in an ice bath for 30 min, followed by heat shock at 42 °C for 45 s, and then in an ice bath for 2 min.

[0059] Add 500 μL of non-resistant LB liquid medium to the mixture, place it on a shaker, and incubate at 200 rpm for 1 h. After the incubation is complete, spread the mixture evenly on LB solid medium plates with Kana resistance and incubate overnight at 37°C.

[0060] S5. Select a single competent *E. coli* DH5α colony that has completed transformation from the culture medium plate, perform PCR amplification using the upstream validation primer GCK-test-F and the downstream validation primer GCK-test-R, and perform agarose gel electrophoresis on the amplification products (e.g., ...). Figure 3 As shown in the figure, a band with a fragment size of approximately 756 bp was selected for sequencing. If the sequencing results were correct, the single colony corresponding to the band (i.e., the single colony corresponding to the band with a fragment size of approximately 756 bp) was added to 100 mL of LB liquid medium with Kana resistance for expansion culture for 12-14 h.

[0061] The sequences of the upstream validation primer GCK-test-F and the downstream validation primer GCK-test-R are as follows:

[0062] GCK-test-F:GCAGAGCTCGTTTAGTGAAC

[0063] GCK-test-R: TACTGTTGTCGTTCACCATGG

[0064] After the expansion culture was completed, endotoxin-free plasmids were extracted to serve as the zebrafish GCK-specific expression vector pTOL2-CMV-6×HIS-GCK-P2A-EGFP (e.g., ...). Figure 1 As shown below, the "GCK expression vector" is shown.

[0065] S6. Mix the GCK expression vector and Tol 2 mRNA obtained in S5 to obtain a microinjection system, wherein the microinjection system comprises: GCK expression vector with a final concentration of 50 ng / μL, Tol 2 mRNA with a concentration of 20 ng / μL, and a color indicator (such as 10% phenol red staining solution), with a final volume of 3 μl.

[0066] The male and female AB-type wild zebrafish were isolated one night in advance, and the isolation was lifted the next day to allow the male and female wild zebrafish to pair up and spawn. After the fertilized eggs of the one-cell stage were laid, the microinjection system was injected into the animal pole of the one-cell stage fertilized eggs through a microinjection device, with an injection volume of 1-2 nl.

[0067] After injection, the fertilized eggs were cultured at 37°C until they hatched into fry. Dead eggs were removed every 4 hours during the culture process. The fluorescence of the fry was then observed using a fluorescence microscopy device, and fry that emitted fluorescence (such as...) were selected. Figure 4 (As shown) Continue to cultivate until the juvenile fish reach sexual maturity;

[0068] Sexually mature male and female fish (i.e., F1 generation of GCK-overexpressing zebrafish) are paired to spawn, and a strain of zebrafish with stable heritability of whole-body GCK overexpression (i.e., "GCK OE") is selected from the offspring.

[0069] S7. Both the systemically overexpressing GCK zebrafish strain and wild-type zebrafish (i.e., "WT") were subjected to a 12-hour overnight fasting treatment. After the overnight fasting treatment, tissue samples were collected from each parallel zebrafish. In this embodiment, the tissue samples included whole fish tissue, serum samples, liver samples, and muscle samples. The biochemical indicators of the zebrafish were statistically analyzed based on the tissue samples. The biochemical indicators included: liver TG (i.e., "liver TG", where TG is triglycerides), serum TG (i.e., "serum TG"), muscle TG (i.e., "muscle TG"), and total lipids (i.e., "Total PL"). At the same time, the collected liver samples were subjected to lipidomics detection.

[0070] like Figure 5-6 As shown, the detection results showed that the liver TG content of WT zebrafish was approximately 12.5 mmol / gprot and the serum TG content was approximately 1.78 mmol / L, while the liver TG content of GCK OE zebrafish was approximately 24.4 mmol / gprot and the serum TG content was approximately 1.12 mmol / L. This demonstrates that overexpression of GCK can lead to a significant increase in liver TG and a significant decrease in serum TG content in zebrafish.

[0071] Furthermore, such as Figure 7-8 As shown ( Figure 7-8 In the text, WT1, WT2, and WT3 represent three replicates of WT, and GCK OE1, GCKOE2, and GCK OE3 represent three replicates of GCK OE. Lipidome analysis of zebrafish livers revealed that the levels of 24 triglycerides were significantly increased in the livers of zebrafish with GCK OE (e.g., ...). Figure 7 As shown), the content of various phospholipids was significantly reduced (e.g. Figure 8As shown), and as Figure 9 As shown, after liver sample sections were stained with Oil Red chromatogram, significant accumulation of lipid droplets of GCK OE was observed, indicating that GCK overexpression can cause fatty liver in zebrafish.

[0072] like Figure 10-11 As shown, the TG content in the muscle of WT zebrafish was approximately 5.12 mmol / gprot and the whole fish phospholipid content was approximately 5.01%, while the TG content in the muscle of GCK OE was approximately 3.38 mmol / gprot and the whole fish phospholipid content was approximately 3.57%, demonstrating that overexpression of GCK led to a significant reduction in both TG in the muscle and phospholipids in the whole fish of zebrafish.

[0073] The above results indicate that GCK overexpression can lead to significant accumulation of TG in the liver of zebrafish, while the levels of TG in serum and muscle, as well as the total phospholipid content of the fish, are significantly reduced. This suggests that GCK overexpression affects the transport of TG in the liver, leading to the obstruction of TG transport in the zebrafish liver, which in turn accumulates in the liver and cannot be transported to the serum and muscle, eventually causing fatty liver. This demonstrates that the above-mentioned GCK-overexpressing zebrafish strain is a fatty liver zebrafish model based on glucokinase overexpression. This model has been successfully constructed and can be used for research on metabolic diseases caused by GCK.

[0074] Example 2:

[0075] This embodiment provides an application of the fatty liver zebrafish model described in Embodiment 1 in the study of metabolic diseases and / or metabolic disorder syndromes caused by GCK overexpression.

[0076] Furthermore, this embodiment provides an application of the fatty liver zebrafish model described in Embodiment 1 in drug screening and / or drug testing for GCK activators.

[0077] In summary, during metabolism, GCK acts as a glucose responder, initiating a hypoglycemic mechanism to lower blood glucose levels when blood glucose rises after eating. However, GCK expression and activity are often impaired in patients with metabolic disorders and diabetes. Nevertheless, obese individuals (especially those with fatty liver disease) typically exhibit higher hepatic GCK expression. Therefore, high GCK expression is closely related to fatty liver disease. Currently, however, no animal model of fatty liver disease induced by GCK overexpression has been developed.

[0078] This invention can obtain a zebrafish strain with stable high expression of GCK through GCK overexpression vector construction and microinjection. Biochemical indicators show that GCK overexpression in zebrafish strains leads to the inhibition of phospholipid synthesis, thereby affecting the transfer of triglycerides from the liver to the muscle via serum, further resulting in fatty liver. Therefore, the above-mentioned GCK overexpression zebrafish strain can be used as a fatty liver zebrafish model based on GCK overexpression for the study of lipid transport mechanisms in glucose metabolism-related diseases and metabolic disorders, as well as for drug screening and drug testing experiments targeting GCK activators.

[0079] The technical features in embodiments 1-2 above can be combined arbitrarily, and all combined technical solutions fall within the protection scope of this application. The basic principles, main features, and advantages of this invention have been shown and described above. Those skilled in the art should understand that this invention is not limited to the above embodiments; the embodiments and descriptions in the specification are merely the principles of the invention. Various changes and modifications can be made to this invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the invention as claimed. The scope of protection claimed by this invention is defined by the appended claims and their equivalents.

[0080] Nucleotide sequence listing:

[0081] SEQ ID NO.1:

[0082] zebrafish glucokinase gene fragment

[0083]

Claims

1. A method for constructing a zebrafish model of fatty liver based on glucokinase overexpression, characterized in that, Includes the following steps: Using zebrafish cDNA as a template, PCR amplification was performed using upstream primer GCK-gene-F and downstream primer GCK-gene-R to obtain the zebrafish GCK gene fragment. The pTOL2 plasmid vector was double-digested with restriction endonucleases to divide it into a large fragment of 4995 bp and a small fragment of 20 bp. The recovered large vector fragment and GCK gene fragment were homologously recombined using homologous recombinase to obtain recombinant plasmids. Transform the recombinant plasmid into competent cells; Select single competent cell colonies that have completed transformation and expand them into a large-scale culture. After the expansion culture is completed, extract endotoxin-free plasmids to serve as zebrafish GCK expression vectors. The zebrafish GCK expression vector and transposase Tol 2 mRNA were mixed to obtain a microinjection system, and the microinjection system was injected into a one-cell stage fertilized egg using a microinjection device. After the fertilized eggs hatch into fry, select the fry that emit fluorescence and continue to raise them until they reach sexual maturity. Sexually mature male and female fish are paired to spawn, and GCK-overexpressing zebrafish strains that can be stably inherited are selected from the offspring.

2. The construction method as described in claim 1, characterized in that, The sequences of the upstream primer GCK-gene-F and the downstream primer GCK-gene-R are as follows: GCK-gene-F: CGGAATTCATGCATCATCACCATCATCCGTGTCTTACTTCAGCCCG GCK-gene-R: GGGGTACCAGGCGTCAGCATGCAGG.

3. The construction method as described in claim 1, characterized in that, The microinjection system comprises: a GCK expression vector at a final concentration of 50 ng / μL, Tol 2 mRNA at a concentration of 20 ng / μL, and a color indicator, with a final volume of 3 μL.

4. The construction method as described in claim 1, characterized in that, The injection volume of the microinjection system is 1-2 nl.

5. The construction method as described in claim 1, characterized in that, The microinjection system was injected into the animal pole of a fertilized egg in the one-cell stage.

6. The construction method as described in claim 1, characterized in that, The method for constructing the fatty liver zebrafish model also includes the following steps: Both the GCK-overexpressing zebrafish strain and wild-type zebrafish were subjected to overnight fasting treatment. After the overnight fasting treatment, tissue samples were collected from each parallel zebrafish. The tissue samples included whole fish tissue, serum samples, liver samples, and muscle samples. The biochemical indicators of the zebrafish were statistically analyzed based on the tissue samples.

7. The construction method as described in claim 6, characterized in that, The biochemical indicators include: liver TG, serum TG, muscle TG, and total fat of the whole fish.

8. The construction method as described in claim 1, characterized in that, Preferably, the competent cells comprise competent Escherichia coli DH5α.

9. The application of a fatty liver zebrafish model obtained by the construction method according to any one of claims 1-8 in the study of metabolic diseases and / or metabolic disorder syndromes caused by GCK overexpression.

10. The application of a fatty liver zebrafish model obtained by the construction method according to any one of claims 1-8 in drug screening and / or drug testing for GCK activators.