Application of haplotype molecular marker related to body height trait of mutton sheep

Abstract

This invention relates to the field of genetic breeding technology, specifically to the application of a haplotype molecular marker related to the body height trait of meat sheep. The haplotype molecular marker is one of the following three types: ① the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at the 101bp site is C or T; ② the nucleotide sequence shown in SEQ ID NO.3, where the nucleotide at the 101bp site is G or A; ③ the nucleotide sequence shown in SEQ ID NO.5, where the nucleotide at the 101bp site is C or T; the application refers to any one of the following (1) and (2): (1) identifying the body height of meat sheep; (2) increasing the body height of offspring of meat sheep. This haplotype molecular marker can be used to identify the body height trait of meat sheep and for genetic breeding of meat sheep.

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology, specifically to the application of a haplotype molecular marker associated with the body height trait in meat sheep. Background Technology

[0002] The Dorper sheep is a new meat sheep breed developed through crossbreeding and systematic selection, using Dorper sheep as the sire and Mongolian sheep as the dam. This breed retains the advantages of Dorper sheep—rapid growth, good meat quality, hornless growth, and easy management—while also possessing the characteristics of Mongolian sheep—strong adaptability, tolerance to roughage, and cold and drought resistance. Its typical physical characteristics include a white heterogeneous wool coat and black sides of the head, making it suitable for large-scale breeding in arid and semi-arid grassland regions of northern China.

[0003] However, in the actual breeding and promotion process, it was found that there are still significant individual differences in the growth performance of the Dumont sheep population, especially in the consistency of body height, which restricts the improvement of its overall production efficiency and standardized breeding level. Body height, as a key trait reflecting skeletal development and body structure, is an important basis for early selection and shortening the breeding cycle. Currently, the selection of body height in traditional Dumont sheep mainly relies on traditional phenotypic selection methods, that is, screening by directly measuring the body height of adult individuals. However, this method has the problems of long cycle, low efficiency, and difficulty in achieving early and accurate selection.

[0004] Therefore, there is an urgent need to develop a new technology that can accurately identify and screen genetic potential associated with high-quality traits at an early stage. Summary of the Invention

[0005] To address the above problems, this invention provides an application of haplotype molecular markers related to the body height trait in meat sheep. Haplotype molecular markers can be used to identify the body height trait in Dumont sheep, thereby selecting Dumont sheep individuals with excellent body height traits.

[0006] This invention is achieved through the following technical solution: Application of a haplotype molecular marker associated with body height trait in meat sheep, wherein the haplotype molecular marker is one of the following three types: ①The nucleotide sequence shown in SEQ ID NO.1 has a C or T nucleotide at the 101 bp position.

[0007] ②The nucleotide sequence shown in SEQ ID NO.3 has a nucleotide at position 101 bp that is either G or A.

[0008] ③The nucleotide sequence shown in SEQ ID NO.5 has a C or T nucleotide at the 101 bp site.

[0009] The application refers to any one of the following (1) and (2): (1) Identifying the height of meat sheep: When the haplotype combination formed by the genotype at 101bp of SEQ ID NO.1, the genotype at 101bp of SEQ ID NO.3 and the genotype at 101bp of SEQ ID NO.5 is TTAATT, the height of the meat sheep is higher than that of meat sheep with the haplotype combination TCAGTC or CCGGCC. (2) Improve the height of offspring of meat sheep: Select meat sheep individuals with a haplotype combination of 101bp of SEQ ID NO.1, 101bp of SEQ ID NO.3 and 101bp of SEQ ID NO.5 as parents for breeding in order to improve the height of offspring of meat sheep.

[0010] Preferably, the method for determining the body height of meat sheep is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.

[0011] The genotype of the meat sheep at position 101bp of SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 was determined.

[0012] If the haplotype combination formed by the genotypes at 101bp of SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5 is TTAATT, then the sheep is of tall stature, where tall stature refers to a height of 67.392cm to 70.289cm.

[0013] Preferably, the method for increasing the body height of offspring sheep is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the meat sheep at position 101 bp in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5; By selecting meat sheep individuals with a haplotype combination of TTAATT formed by the genotypes at 101bp of SEQ ID NO.1, 101bp of SEQ ID NO.3, and 101bp of SEQ ID NO.5 as parents for breeding, the body height of offspring meat sheep can be increased.

[0014] Preferably, the genomic DNA is derived from the blood of sheep.

[0015] Preferably, the genomic DNA is extracted using the phenol-chloroform method.

[0016] Preferably, the mutton sheep is a Dumont sheep.

[0017] Preferably, the body height refers to the vertical distance from the highest point of the withers to the ground.

[0018] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of haplotype molecular markers related to the body height trait of meat sheep. The haplotype molecular markers are of the following three types: ① the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at the 101bp site is C or T; ② the nucleotide sequence shown in SEQ ID NO.3, where the nucleotide at the 101bp site is G or A; ③ the nucleotide sequence shown in SEQ ID NO.5, where the nucleotide at the 101bp site is C or T. The application refers to any one of the following (1) and (2): (1) identifying the body height of meat sheep; (2) increasing the body height of offspring of meat sheep. Based on the molecular markers described in this invention, an efficient molecular-assisted selection method is provided for the genetic breeding of meat sheep. Compared with traditional breeding methods that rely on phenotypic measurements, this invention allows for genetic assessment of the body height trait in meat sheep early in their growth and development by detecting the genotype of the molecular markers, which significantly shortens the breeding cycle. Secondly, based on the three SNP loci and their dominant genotypes that affect the height trait of Dumont sheep in this invention, selecting individuals with the TTAATT haplotype combination as parents can increase the height of offspring. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This invention provides a population variation characteristic diagram of the Dumont genus; Figure 1 In the diagram, A is a statistical chart of SNP types; B is a statistical chart of SNP location annotation results for Dumont sheep, with the X-axis representing various functional regions and the Y-axis representing the number of genetic variations in different functional regions; C is a statistical chart of SNP functional annotation in the CDS region, with the X-axis representing various functions and the Y-axis representing the number of genetic variations in various functions.

[0021] Figure 2 This is a visualization of the G matrix of the present invention.

[0022] Figure 3 This is the principal component analysis plot of the present invention; the first three explained variance percentages PC1, PC2 and PC3 are used as the X, Y and Z axes.

[0023] Figure 4The Manhattan Plots and QQ-plots of this invention show the GWAS results of body height in Dumont sheep, with significant genome-wide SNPs highlighted in red; Figure 4 In the diagram, A is the Manhattan diagram of Dumont sheep's body height, and B is the QQ diagram of Dumont sheep's body height.

[0024] Figure 5 For chromosome 9 of this invention TRNAS-GGA-73 The image shows the results of haplotype block analysis of three SNPs at positions 9907701bp, 9911485bp, and 9924010bp of the gene; A represents the haplotype block on chromosome 9 of the Dumont sheep. TRNAS- GGA-73 Visualization of linkage disequilibrium at three SNPs at positions 9907701bp, 9911485bp, and 9924010bp of the gene (D' diagram); B represents the linkage disequilibrium of chromosome 9 of the Dumont sheep. TRNAS-GGA-73 Visualization of linkage disequilibrium at three SNPs at positions 9907701bp, 9911485bp, and 9924010bp of the gene. 2 Figure C shows the haplotype results of highly correlated SNPs in Dumont sheep. Detailed Implementation

[0025] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0026] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0027] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0028] The following is a list of abbreviations related to this invention: LD: Linkage Disequilibrium.

[0029] Manhattan Plot.

[0030] QQ chart: Quantile-Quantile Plot.

[0031] SNP: Single nucleotide polymorphism.

[0032] GWAS: Genome-wide association analysis.

[0033] IBS: Identity-by-State.

[0034] Example 1 Test animals and phenotypic sources: The sheep used in this invention were all from Inner Mongolia Sainuo Sheep Breeding Technology Co., Ltd. Phenotypic records of the body height trait of live Dumont sheep from 2023 to 2024 are shown in Table 1. Blood samples were collected from 300 Dumont sheep individuals. All samples were immediately stored at -80℃ after collection and transported to the laboratory on dry ice for long-term storage at -80℃.

[0035] Table 1. Description of body height traits in Dumont sheep. I. Genomic DNA Extraction and Quality Inspection DNA was extracted from blood samples using the phenol-chloroform method. The concentration of DNA, the ratio of the absorption wavelengths of the highest absorption peaks of nucleic acids, proteins, and phenolic substances (260 nm / 280 nm), and the ratio of the absorption wavelengths of the highest absorption peaks of carbohydrates (260 nm / 230 nm) were detected using a NanoDrop2000 spectrophotometer. The DNA quality was assessed by 1% w / v agarose gel electrophoresis.

[0036] II. Library Construction and Sequencing After processing qualified genomic DNA samples, the genomic DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly A addition, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation process. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality checks, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.

[0037] III. Identification, screening, and annotation of variant sites The raw sequencing data was quality controlled and preprocessed using FastP software version V0.20.0 to obtain Clean reads. A genome index was built on the reference genome. The quality-controlled Clean reads were aligned with the reference genome of meat sheep, Oar_v4.0, GCF_000298735.2, using Burrows-Wheeler Aligner software version V0.7.17. The aligned SAM files were converted into BAM files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in Genome Analysis Toolkit software version V3.8 was used to remove duplicate data from the sorted BAM files to obtain the final BAM files. An index was built on the final BAM files, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. After obtaining the VCF files, the VariantFiltration module was used for filtering. The ANNOVAR software package is used to perform functional annotation on detected gene variations. Based on the location of the variant site on the reference genome and the gene location information on the reference genome, the region in which the variant site occurs in the genome, such as intergenic regions, intronic regions, or CDS regions, can be determined, as well as the impact of the variation, such as synonymous and non-synonymous mutations.

[0038] Whole-genome resequencing was performed on 300 individuals of the Dumont sheep, and a genotype database was established. A total of 73,286,363 SNP variant sites were detected, of which 48,482,526 were transition types C / T and G / A, and 24,803,837 were transversion types A / C, A / T, C / G, and G / T, with a transition-to-transversion ratio of 200.00%. Figure 1 As shown in a. Then, gene annotation files downloaded from the Ensembl database were used to annotate all detected variations in the Dumont sheep, revealing that the most variations were found in intergenic regions (56.35%) and intronic regions (34.22%), as shown in a. Figure 1 As shown in b, this includes 787,027 synonymous mutations and 425,427 non-synonymous mutations, such as... Figure 1 As shown in c in the figure. These potential functional variations provide valuable genetic resources for exploring the genetic structure and functional genes of the Dumont sheep.

[0039] IV. Data quality control and population stratification correction The obtained genotyping data underwent quality control using Plink software version 1.90, removing individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and Hardy-Weinberg equilibrium test p-values ​​of less than 10.-6 SNPs were analyzed in this population. Genomic kinship analysis based on a G-matrix was performed using Plink v1.90, where each small square represents the pairwise kinship value between the first and last samples. A larger value, closer to black, indicates a closer kinship between the two individuals, and vice versa. The results are shown below. Figure 2 As shown. The first three principal components were calculated using the "-pca3" parameter in Plink V1.90 software, and the PCA plot was drawn using R language V3.6.0. The results are as follows. Figure 3 As shown, the experimental samples did not exhibit stratification within the population, and there was no need to correct for the stratification phenomenon in the Dumont sheep population.

[0040] V. Genome-wide association analysis The association between SNPs and body height traits was analyzed using the fastGWA-mlm model in GCTA software version V1.94.0beta.

[0041] y=X snp β snp +X c β c +g+e.

[0042] Where y is the phenotypic vector; X snp It is a genotype vector, and its effect is β. snp ;X c It is the correlation matrix between the field area and the first three PCA variables as fixed covariates, and its corresponding coefficient is β. c ;g is the vector of total genetic effects captured by the genetic relationship matrix derived from SNPs, g~N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).

[0043] Using the Bonferroni correction method of 0.05 / number of SNPs to determine the significance threshold of GWAS is too stringent. Instead, a linkage disequilibrium screening process is used to remove redundancy, resulting in independent SNPs, which are then used to calculate the threshold.

[0044] The parameters are: 50: Window size, i.e., the number of SNPs.

[0045] 10: Step length, i.e., the number of SNPs.

[0046] 0.2: r 2 Delete one of the SNP pairs where LD is greater than 0.2.

[0047] The threshold for genome-wide significant association was adjusted to P=1 / 933699, where 933699 is the number of independent SNPs screened by LD. The genome expansion factor, λ, was calculated using the slope of a linear regression between observed quantiles and theoretical quantiles in R version V3.6.0. The calculated λ value for the body height trait was 0.987, indicating no genome expansion. Based on resequencing data from 300 Dumont sheep, five significant SNP loci associated with the body height trait were detected, located on chromosomes 9, 10, and 19. Gene annotation and enrichment analysis of these significant SNPs revealed… TRNAS-GGA- 73 Genes are associated with the body height trait in meat sheep, as shown in Table 2 and Figure 4 As shown.

[0048] Table 2 Significant SNP loci associated with body height trait VI. Construction of TRNAS-GGA-73 gene haplotype combinations Data statistics and analysis were performed on significant SNP loci obtained from GWAS. Based on the calculation principles of parameters such as allele frequency, genotype frequency, homozygosity, and heterozygosity, a self-developed Excel function was used to calculate population genetic parameters. Simultaneously, the conformity of significant SNPs to Hardy-Weinberg equilibrium was tested, as shown in Table 3. Subsequently, haplotypes were constructed using Haploview software, revealing significant SNPs on chromosome 9. TRNAS-GGA-73 Three SNPs at positions 9907701bp, 9911485bp, and 9924010bp of the gene constitute a haplotype block. These three SNPs are labeled as... TRNAS-GGA-73 -SNP1~ TRNAS-GGA-73 -SNP3, this field includes 6 haplotypes, named D1, D2, D3, D4, D5, and D6, as shown in Table 4 and... Figure 5 As shown.

[0049] in, TRNAS-GGA-73 The nucleotide sequence of the -SNP1 molecular marker is shown in SEQ ID NO.1 and SEQ ID NO.2, with a C to T mutation occurring at position 101 bp.

[0050] SEQ ID NO.1: CAACATCAACAACTAAGCAAAATGAAACAGACAGGAAAGGTATGATAGTGATAAGATTTTCCTGATGTCTTATCTATCAGTGTTCTAGTTCCCATAACATCCCAAAGCCAATCCCTGCCTCCTCAAGAGGCCCTCCATTTTCCTATAGAGGTCTCTGAACCTGCTGTGGGATCTGTGGCATCAGCTGGCACTCTGACTTG.

[0051] SEQ ID NO.2: CAACATCAACAACTAAGCAAAATGAAACAGACAGGAAAGGTATGATAGTGATAAGATTTTCCTGATGTCTTATCTATCAGTGTTCTAGTTCCCATAACATTCCAAAGCCAATCCCTGCCTCCTCAAGAGGCCCTCCATTTTCCTATAGAGGTCTCTGAACCTGCTGTGGGATCTGTGGCATCAGCTGGCACTCTGACTTG.

[0052] TRNAS-GGA-73 The nucleotide sequence of the -SNP2 molecular marker is shown in SEQ ID NO.3 and SEQ ID NO.4, with a G to A mutation occurring at position 101 bp.

[0053] SEQ ID NO. 3: ACTCAGCATTTTAAAGCAACTATTCCTTGACATTCTAGAAATCAGCGAATTAAAATGGACTGGTGAATTTAACTCAGATGAATAGTATATCTACTATTGTGGGCAGGAATCCATTAGAAGAAATGGAGTAGCCATCATGGTCAACAAAAGATTCCAAAATACAGTACTTTGATGCAATCTCAAGAGCAAAATAATGATCTC.

[0054] SEQ ID NO. 4: ACTCAGCATTTTAAAGCAACTATTCCTTGACATTCTAGAAATCAGCGAATTAAAATGGACTGGTGAATTTAACTCAGATGAATAGTATATCTACTATTGTAGGCAGGAATCCATTAGAAGAAATGGAGTAGCCATCATGGTCAACAAAAGATTCCAAAATACAGTACTTTGATGCAATCTCAAGAGCAAAATAATGATCTC.

[0055] TRNAS-GGA-73 The nucleotide sequence of the -SNP3 molecular marker is shown in SEQ ID NO.5 and SEQ ID NO.6, with a C to T mutation occurring at position 101 bp.

[0056] SEQ ID NO.5: GTGAGAATAGTAATAGAAATGAAGTGGGACTTTATGATCCTTGCCACTACCCACCCCTCCACCCCACCATGTCTTCTGCCTGCCTTTTGCCTGTGGAAAGCTTTAATCAAAGAATAACTTTAATCAGATAAATGAGAAATGCTGAAACAAAGGAAAACAAGTCTAAGGAGACTAAAATAATAATAATTTGGTCATAGTCAAG.

[0057] SEQ ID NO.6: GTGAGAATAGTAATAGAAATGAAGTGGGACTTTATGATCCTTGCCACTACCCACCCCTCCACCCCACCATGTCTTCTGCCTGCCTTTTGCCTGTGGAAAGTTTTAATCAAAGAATAACTTTAATCAGATAAATGAGAAATGCTGAAACAAAGGAAAACAAGTCTAAGGAGACTAAAATAATAATAATTTGGTCATAGTCAAG.

[0058] Table 3 Body height traits of Dumeng sheep TRNAS-GGA-73 Intragenic SNPs population genetic parameters Table 4 TRNAS-GGA-73 Construction of different haplotypes of genes seven, TRNAS-GGA-73Association analysis between haplotype combinations and body height trait in Dumont sheep The relationship between haplotype combinations and body height traits in individuals was analyzed using SAS 9.2 software. Low-frequency haplotype combinations were removed, and the remaining three combinations were used for subsequent analysis. Table 5 lists the results. TRNAS-GGA-73 -SNP1~ TRNAS-GGA-73 Statistical data on body height of Dumont sheep under haplotype combinations of the -SNP3 gene. TRNAS-GGA-73 -SNP1~ TRNAS-GGA-73 The D2D2 haplotype combination of the -SNP3 gene had a significantly higher body height than other combinations. P <0.05, see Table 5. Therefore, select TRNAS-GGA-73 The D2D2,TTAATT haplotype combination of the gene was used as a selection marker to screen for Dumont sheep with excellent body height traits.

[0059] Table 5 TRNAS-GGA-73 Body height of Dumont sheep under different haplotype combinations Note: Analysis of variance was performed among haplotype combinations marked with "D". Different letters indicate significant differences. P <0.05, the same letter indicates no significant difference. P >0.05.

[0060] In summary, this invention provides four haplotype molecular markers associated with the height of Dumont sheep. The haplotype combination formed by these four haplotype molecular markers is TTAATT. This combination can be used as a screening marker to screen or detect Dumont sheep with excellent height traits. In addition, Dumont sheep individuals with the haplotype combination TTAATT can be bred as paternal or maternal lines to increase the height trait of offspring Dumont sheep.

[0061] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0062] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. The use of a haplotype molecular marker associated with a body height trait in a meat sheep, characterized in that, The haplotype molecular markers are of the following three types: ①The nucleotide sequence shown in SEQ ID NO.1 has a C or T nucleotide at position 101 bp; ②The nucleotide sequence shown in SEQ ID NO.3 has a nucleotide at position 101 bp that is either G or A; ③The nucleotide sequence shown in SEQ ID NO.5 has a C or T nucleotide at the 101 bp position; The application refers to any one of the following (1) and (2); (1) Identifying the height of meat sheep: When the haplotype combination formed by the genotype at 101bp of SEQ ID NO.1, the genotype at 101bp of SEQ ID NO.3 and the genotype at 101bp of SEQ ID NO.5 is TTAATT, the height of the meat sheep is higher than that of meat sheep with the haplotype combination TCAGTC or CCGGCC. (2) Improve the height of offspring of meat sheep: Select meat sheep individuals with a haplotype combination of 101bp of SEQ ID NO.1, 101bp of SEQ ID NO.3 and 101bp of SEQ ID NO.5 as parents for breeding in order to improve the height of offspring of meat sheep.

2. Use according to claim 1, wherein The methods for determining the body height of meat sheep are as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the meat sheep at position 101 bp in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5; If the haplotype combination formed by the genotypes at 101bp of SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5 is TTAATT, then the sheep is of tall stature, where tall stature refers to a height of 67.392cm to 70.289cm.

3. The use according to claim 1, wherein Methods to increase the body height of offspring sheep include: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the meat sheep at position 101 bp in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5; By selecting meat sheep individuals with a haplotype combination of TTAATT formed by the genotypes at 101bp of SEQ ID NO.1, 101bp of SEQ ID NO.3, and 101bp of SEQ ID NO.5 as parents for breeding, the body height of offspring meat sheep can be increased.

4. Use according to claim 2 or claim 3, wherein the compound is of formula (I) ###00002### (I) or a pharmaceutically acceptable salt thereof. The genomic DNA was derived from the blood of sheep.

5. The use as claimed in claim 2 or claim 3, wherein, The genomic DNA was extracted using the phenol-chloroform method.

6. The use according to claim 1, wherein The sheep in question are Dumont sheep.

7. The use according to claim 1, wherein the compound is ###0002### The body height refers to the vertical distance from the highest point of the withers to the ground.

Images