Application of CTL-S1 gene and miR-let-7 in regulating the reproductive development of Bactrocera cucurbitae

Abstract

The application discloses CTL-S1 A gene and an application of miR-let-7 in regulation of reproductive development of drosophila bacterea CTL-S1 The gene is specifically highly expressed in ovaries of drosophila bacterea, and the expression of the gene is inhibited by RNA interference CTL-S1 The expression of the gene can reduce the hatching rate of offspring. Through analysis of an RNA immunoprecipitation double luciferase reporter system, it is found that miR-let-7 and CTL-S1 there is a target relationship. Overexpression of miR-let-7 can cause CTL-S1 the expression amount of the gene to be significantly reduced, and a phenotype similar to the expression of the gene being inhibited by RNA interference CTL-S1 CTL-S1 CTL-S1 CTL-S1 CTL-S1 CTL-S1 CTL-S1 CTL-S1 CTL-S1 CTL-S1 CTL-S is generated, and the hatching rate of offspring is reduced. The application provides a potential gene target for developing a genetic control strategy for destroying the reproduction of drosophila bacterea, provides a new idea for subsequent biological control of insects by using the sterile technique, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically involving CTL-S1 Application of genes and miR-let-7 in regulating the reproductive development of the melon fly. Background Technology

[0002] melon fly ( Zeugodacus cucurbitae The melon fly (Coquillett) is a globally significant agricultural pest, one of the most destructive cucurbit pests across the Pacific, Asia, and Africa, severely damaging cucurbits, solanaceous crops, and other economically important crops. The common use of broad-spectrum insecticides for management has led to significant problems such as pest resurgence, pesticide resistance, and pesticide residues. Resistance has become a major challenge in controlling the melon fly, making the research and development of novel, environmentally friendly insecticides urgently needed.

[0003] miRNA is a small non-coding RNA, approximately 22 nt in length, encoded by endogenous genes in the organism. It was first discovered in 1993 in *C. elegans* (Caenorhabditis elegans). Caenorhabditis elegans First discovered in mRNA. miRNAs do not encode proteins, but can regulate gene expression by targeting mRNAs. The main mechanisms include mRNA degradation and translational repression, and they can also promote gene expression.

[0004] C-type lectins (CTLs) are a class of sugar-binding proteins widely distributed in the animal lectin family, dependent on Ca²⁺. + This protein mediates carbohydrate recognition and is widely found in different insect species, playing an important role in insect immunity, pathogen recognition, and reproductive development. Summary of the Invention

[0005] In view of the above-mentioned shortcomings of the prior art, the purpose of this invention is to provide a melon fly. CTL-S1 The application of genes and miR-let-7 in regulating the reproductive development of the melon fly provides a new option for the green control of the melon fly.

[0006] This invention provides a melon fly CTL-S1 The application of genes in the control of melon flies, the melon fly mentioned CTL-S1 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0007] Preferably, to reduce melon fly... CTL-S1 Application of gene expression levels in reducing the hatching rate of melon fly eggs.

[0008] This invention also provides the application of melon fly miR-let-7 in the control of melon flies, the nucleotide sequence of which is shown in SEQ ID No. 3.

[0009] Preferably, increasing the expression level of miR-let-7 in the melon fly is used to reduce the hatching rate of melon fly eggs.

[0010] This invention also provides a method for controlling melon flies, by reducing the amount of melon fly in its body. CTL-S1 Prevention and treatment are achieved by controlling gene expression levels. CTL-S1 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0011] Preferably, the method of reducing the amount of fruit flies in the body CTL-S1 Gene expression levels were reduced in melon flies using RNAi technology. CTL-S1 Gene expression levels.

[0012] Preferably, the RNAi technology is administered by injection or feeding of ds CTL-S1 In the body of the melon fly, the ds CTL-S1 The amplification primers are shown in SEQ ID No. 20 and SEQ ID No. 21.

[0013] The present invention also provides a method for controlling melon fly, which achieves control by increasing the expression level of miR-let-7 in melon fly, wherein the nucleotide sequence of miR-let-7 is shown in SEQ ID No. 3.

[0014] Preferably, the increase in miR-let-7 expression in the melon fly is achieved by injecting or feeding miR-let-7 into the melon fly.

[0015] Preferably, the melon fly is a female melon fly.

[0016] The beneficial effects of this invention are:

[0017] This invention specifically high-expression of the ovary of the melon fly CTL-S1 The genes were studied. Inhibition was achieved through RNA interference. CTL-S1 Gene expression can reduce offspring hatchability. Analysis using a dual-luciferase reporter system with RNA immunoprecipitation revealed miR-let-7 and... CTL-S1 There is a targeting relationship. Overexpression of miR-let-7 leads to... CTL-S1 Gene expression levels were significantly reduced, and RNA interference-like inhibition was observed. CTL-S1 The phenotype of gene expression reduces the hatching rate of offspring. miR-let-7 targets downstream... CTL-S1 Genes influence the hatching rate of offspring, thereby affecting the fertility of female melon fly through a negative feedback regulatory mechanism. The findings of this invention reveal a previously unreported miR-let-7-mediated... CTL-S1This invention identifies a mechanism crucial for the reproductive development of the melon fly, providing potential gene targets for developing genetic control strategies to disrupt its reproduction. This invention offers a new approach for the subsequent use of sterility techniques in insect biological control and has broad application prospects. Attached Figure Description

[0018] Figure 1 It's a melon fly. CTL-S1 Gene expression patterns at different ages and in different tissues; A is CTL-S1 Relative expression levels at different stages: Egg: egg; L1 / 3 / 7: 1 / 3 / 7 day old larvae; P1 / 5 / 9: 1 / 5 / 9 day old pupae; F1 / 3 / 5 / 7 / 9 / 10: 1 / 3 / 5 / 7 / 9 / 10 day old female adults; B is... CTL-S1 Relative expression levels in different tissues of female insects: OV: ovary; FB: fat body; MG: midgut; MT: Malpighian tubules; Data analysis was performed using one-way ANOVA, with the error bar being the standard error of the mean of three biological replicates. Different letters represent significant differences. P <0.05, one-way ANOVA, LSD).

[0019] Figure 2 It's a melon fly. CTL-S1 The effects of interference on the development and reproduction of melon fruit flies; A is the effect of injecting ds CTL-S1 back CTL- S1 The relative expression level; B is the fluorescence in situ hybridization localization of CTL-S1 in the ovary of *Fructus melonae* after RNAi interference; FAM: green fluorescence is... CTL-S1 Probe, DAPI: blue nuclear dye, Oocyte: oocyte, Trophoblast: trophoblast cell; C is injection of ds CTL-S1 Post-ovarian development; D is the status of ds injection. CTL-S1 The total number of eggs laid by the fruit fly within 3 days; E is the number of eggs injected with ds CTL-S1 Hatching rate of fruit flies within 3 days; F is the injection ds CTL-S1 The length of the fruit fly egg; G is the injection ds CTL- S1 The area of ​​the ovary of the melon fly;* P <0.05, *** P <0.001, **** P <0.0001.

[0020] Figure 3 It is the miRNA binding site; A is the predicted site for the melon fly. CTL-S1 The binding site with miR-315-1; B is the predicted binding site for melon fly. CTL-S1 The binding site with miR-971-1; C is the predicted binding site for melon fly. CTL-S1 The binding site with miR-let-7.

[0021] Figure 4 The data represent the expression patterns of miRNAs in different age groups and tissues of the fruit fly; A represents the relative expression level of miR-315-1 at different age stages; B represents the relative expression level of miR-971-1 at different age stages; C represents the relative expression level of miR-let-7 at different age stages; D represents the relative expression level of miR-315-1 in different tissues; E represents the relative expression level of miR-971-1 in different tissues; F represents the relative expression level of miR-let-7 in different tissues; F1 / 3 / 5 / 7 / 9: 1 / 3 / 5 / 7 / 9 instar female adults; OV: ovary; FB: fat body; MG: midgut; MT: Malpighian tubules; Data analysis used one-way ANOVA, different letters represent significant differences (…). P <0.05).

[0022] Figure 5 It is a candidate miRNA of the melon fly and the melon fly CTL-S1 The expression regulation relationship; A is the miRNA overexpression efficiency; B is... CTL-S1 Expression efficiency; C is miRNA inhibition efficiency; D is... CTL-S1 Efficiency of expression;* P <0.05,** P <0.01, *** P <0.001, **** P <0.0001.

[0023] Figure 6 It is miR-let-7 / miR-971-1 and melon fly CTL-S1 Combined with validation and tissue localization of miR-let-7 fluorescence in situ hybridization; A is miR-971-1 dual-luciferase reporter assay; B is miR-let-7 dual-luciferase reporter assay; C is RNA immunoprecipitation; D is tissue localization of miR-let-7 in the ovary of *Flycoperdon perlatum*, Cy3: red is the miR-let-7 probe; DAPI: blue nuclear dye; data analysis used one-way ANOVA, different letters represent significant differences (…). P <0.05).

[0024] Figure 7 This is a fertility test of *Melia toosendan* after stimulant injection; A is the total number of eggs laid by *Melia toosendan* three days after stimulant injection; B is the egg hatching rate of *Melia toosendan* three days after stimulant injection; **** P <0.0001. Detailed Implementation

[0025] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0026] Example 1: Melon fly CTL-S1 Acquisition of gene open reading frames

[0027] Full-length cloning PCR-specific primers were designed using the NCBI Primer BLAST online website (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast). The upstream and downstream primer sequences are shown in Table 1.

[0028] Table 1 Primer pairs used for cloning, qRT-PCR, and dsRNA synthesis

[0029]

[0030] The PCR amplification conditions were as follows: pre-denaturation: 95℃ for 3 min; followed by denaturation at 95℃ for 15 s, annealing at 57℃ for 15 s, extension at 72℃ for 2 min, for 35 cycles; and a final extension at 72℃ for 5 min. The 25 μL reaction mixture contained 8.5 μL nuclease-free water, 12.5 μL 2×Phanta Max buffer (Vazyme, China), 0.5 μL dNTP Mix, 0.5 μL Phanta Max Super-Fidelity DNA Polymerase, 1 μL each of forward and reverse primers (10 μM), and 1 μL of adult fruit fly ovarian cDNA as template.

[0031] PCR amplification products were detected by 1% agarose gel electrophoresis, and the target band was recovered. Then, the product was ligated into pESI-Blunt vector (specific procedures are described in Yeasen's TOPO-Blunt blunt-end cloning kit). 5 μL of the ligation product was added to 50 μL of DH5α competent cells, mixed, and incubated on ice for 30 min. The mixture was then heat-shocked at 42℃ for 90 s, followed by 1 min on ice. 500 μL of LB liquid medium was added to the reaction system, and the mixture was incubated at 37℃ with shaking at 200 rpm for 1 h. 50 μL of the activated bacterial culture was evenly spread onto LB solid medium containing ampicillin, and incubated overnight at 37℃. White, circular colonies were picked and incubated at 37℃ for 4 h. 2 μL of the colony was used as a template for PCR verification. Positive single-clone colonies were sent to Shangya Biotechnology for sequencing. The sequencing results were verified by alignment with the original sequence using SnapGene software. *Flytis mellea* was obtained. CTL-S1 ( ZcCTL-S1The open reading frame sequence has the nucleotide sequence shown in SEQ ID No. 1 and the amino acid sequence of the protein it encodes is shown in SEQ ID No. 2.

[0032] Example 2: Melon fly CTL-S1 Different developmental stages and tissue expression profiles

[0033] Detection using qRT-PCR technology CTL-S1 The relative expression levels of the gene in different developmental stages of *F. melonfield*, including eggs, larvae (1, 3, and 7 days old), pupae (1, 5, and 9 days old), and females (1, 3, 5, 7, 9, and 10 days old), as well as the relative expression levels in different tissues of adult females, including the fat body, midgut, Malpighian tubules, and ovary. qRT-PCR specific primer sequences are shown in Table 1, with Rpl13 used for evaluation. CTL-S1 Internal reference genes expressed at different developmental stages and in different tissues.

[0034] from Figure 1 The melon fly can be seen in A. CTL-S1 The peak of gene expression occurs in 5-day-old female adults, from Figure 1 The melon fly can be seen in B. CTL-S1 The gene is highly expressed in the ovaries of female adults, but is not expressed in other tissues.

[0035] Example 3

[0036] 1. Melon fly CTL-S1 Ovarian tissue localization

[0037] Fluorescent probes were synthesized using the nucleic acid sequences shown in Table 1 for in situ hybridization analysis. First, the ovaries of 2–5 day old female melon fly larvae were dissected in 1×PBS buffer and fixed overnight at 4°C in 4% paraformaldehyde solution. Then, the samples were washed three times with 2% PBST (containing Triton X-100) for 5 min each time, followed by soaking in 0.25% hydrochloric acid solution for 30 min to reduce background, and then washed three times with 2% PBST for 5 min each time. Next, the samples were permeabilized with 30 μg / mL proteinase K at room temperature for 20 min, followed by three more washes with 2% PBST for 5 min each time. Finally, the samples were fixed twice with 4% paraformaldehyde at room temperature for 20 min, and then washed three times with 2% PBST for 5 min each time. The samples were then incubated with the probe (500-fold dilution) at 68°C for 72 h, and washed three times with 2% PBST for 15 min each time, followed by a final wash with 0.5 μg / mL... The samples were stained with 4'6'-diamino-2-phenylindole (DAPI) (Sigma, USA) for 10 minutes and images were taken using an LSM780 laser confocal microscope (Leica, USA).

[0038] Figure 2 B in the display CTL-S1 Localization in the ovarian tissue of *Melon Fly* showed that the target signal appeared in trophoblast cells and oocytes. It is speculated that the target gene may exert its physiological function by participating in oocyte morphological transformation. 2. *Melon Fly* CTL-S1 Preparation of dsRNA of genes

[0039] Based on the above CTL-S1 Based on the open reading frame sequence of the gene, dsRNA primers were designed using the SnapDragon-dsRNA Design online website (https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl), and a T7 promoter sequence (TAATACGACTCACTATAGGG) was added to the 5' end of the primer sequence. The sequence information is shown in Table 1.

[0040] Using cDNA from the ovarian tissue of a 5-day-old female melon fly as a template, conventional PCR was performed using gene dsRNA-specific primers. CTL-S1 Partial gene sequences and positive clones were sent to Shangya Biotechnology for sequencing. After sequencing was confirmed to be correct, PCR amplification was performed using dsRNA primers with their respective bacterial cultures as templates. The reaction system and conditions were the same as for the full-length clones. The PCR products were recovered and purified. Using a higher concentration of the PCR product as a template, dsRNA was synthesized and purified according to the instructions of the T7 RiboMAX™ Express RNAi System (Promega, USA). The purity and integrity of the dsRNA were then detected by 1.2% agarose gel electrophoresis, and its concentration was measured at 260 nm using a UV spectrophotometer (Thermo, USA). The final concentration was set at 2000 ng / μL and then stored at -80℃ for later use.

[0041] 3. Injection CTL-S1 ds of gene fragment synthesis CTL-S1 Experiment to inhibit the reproductive capacity of female melon flies

[0042] (1) Injection CTL-S1 Gene fragment synthesis ds CTL-S1

[0043] Collect adult melon flies that emerged on the same day and raise them normally until the second day. Then, separate the male and female adults for single-sex rearing. Starting from the third day, inject each female adult with 2 μg of dsRNA every other day until the 11th day.

[0044] (2) CTL-S1 Detection of gene silencing efficiency

[0045] Female melon fly larvae were collected at 24, 48, and 72 h post-injection. Total RNA was extracted using the SteadyPure RNA extraction kit, and cDNA was obtained by reverse transcription using the Evo M-mLV reverse transcription kit. cDNA was then used as a template for qRT-PCR detection. CTL-S1 The relative expression levels of the genes were determined, with Rpl13 as the internal reference gene. qRT-PCR was performed using the primers and methods described above to calculate the silencing efficiency of the target gene. Figure 2 Results A in the study showed that after a single injection of dsRNA, CTL-S1 The expression levels were significantly downregulated compared to the control group ( t =12.98, df =3, P =0.0009; t =4.578, df =3, P =0.0196; t =9.44, df =4, P =0.0007).

[0046] (3) Observe the changes in the reproductive capacity of female melon flies by observing changes in ovarian development, egg production, and egg hatching rate.

[0047] To ensure the interference continued to affect the mating and egg-laying of the melon fly, each female was injected every other day starting from day 5, continuing until day 11. Male and female flies of the same age were then mated, and the total number of eggs laid and the egg hatching rate of each group of melon flies were recorded for 3 consecutive days. Ovarian development was also observed.

[0048] Figure 2 The results showed that the injected ds CTL-S1 The total number of eggs laid by the melon fly within 3 days was not significantly different from that of the control group. t =0.093, df =4, P =0.931)( Figure 2 (D in the text), but the total hatching rate decreased from 73.4% to 40.5% ( t =7.868, df =16, P =0.000)( Figure 2 (E in the text). ZcCTL-S1 There was no significant difference in the length of melon fly eggs after the disturbance. t =0.329, df =37, P =0.744)( Figure 2 (F in the text). Select injection ds CTL-S1 Dissection of 11-day-old female melon fly larvae and measurement of ovarian area showed no significant difference. t=0.400, df =10, P =0.698)( Figure 2 (C, G in the text).

[0049] Example 4

[0050] 1. CTL-S1 Gene-binding miRNA prediction

[0051] Using miRanda and RNAhybrid on the melon fly CTL-S1 Possible binding sites on the 3'UTR and CDS regions were predicted. The miRNA was sourced from http: / / v2.insect-genome.com / miRNA. The intersection of the results from the two software programs was used as a potential target. CTL-S1 Candidate miRNAs ( Figure 3 The nucleotide sequences are miR-315-1 (the nucleotide sequence is TTTGATTGTTGCTCAGAAAGC, SEQ ID No. 4), miR-971-1 (the nucleotide sequence is TTGGTGTTACTTCTTACAGTGA, SEQ ID No. 5), and miR-let-7 (the nucleotide sequence is CTATACAATGTGCTAGCTTTCT, SEQ ID No. 3).

[0052] 2. Verification CTL-S1 There is a targeting relationship between genes and miRNAs.

[0053] (1) Spatiotemporal expression pattern analysis of miRNA

[0054] The relative expression levels of miRNA genes in different developmental stages of *F. melonfieldii*, including females (1, 3, 5, 7, and 9 days old), and in the tissues of adult females, including the fat body, midgut, Malpighian tubules, and ovary, were detected using qRT-PCR. The qRT-PCR-specific primer sequences are shown in Table 1. U6 As an internal reference gene for evaluating miRNA gene expression at different developmental stages and in different tissues, expression pattern analysis of three miRNAs showed that miR-let-7 was specifically highly expressed in the ovary. F （3,12） =46.806, P =0.000)( Figure 4 ),and ZcCTL-S1 The gene expression patterns are basically the same.

[0055] (2) miRNA regulation ZcCTL-S1 Gene expression

[0056] Figure 5The results showed that after treatment with miR-315-1 / miR-971-1 / miR-let-7 mimics, the expression levels of the corresponding miRNAs all increased significantly. t =7.356, df =10, P =0.000; t =2.877, df =14, P =0.012; t =4.055, df =8, P =0.004)( Figure 5 (A in the middle), however ZcCTL-S1 The gene was significantly downregulated after treatment with miR-971-1 / miR-let-7 mimic. t =4.948, df =7, P =0.002; t =2.404, df =10, P =0.037)( Figure 5 In the case of B), the expression level did not change after treatment with miR-315-1mimic. t =1.998, df =7, P =0.086)( Figure 5 (B in the text); After treatment with the inhibitors miR-315-1 / miR-971-1 / miR-let-7, the expression levels of the corresponding miRNAs were significantly reduced (B in the text). t =3.725, df =6, P =0.0098; t =3.683, df =10, P =0.0042; t =3.017, df =8, P =0.0166)( Figure 5 (C in the middle), however ZcCTL- S1 The gene expression significantly increased after treatment with miR-971-1 / miR-let-7 inhibitor. t =2.838, df =7, P =0.0251; t =6.033, df =8, P =0.0003)( Figure 5In the miR-315-1 inhibitor treatment, the expression level of D did not change. t =0.551, df =7, P =0.5987)( Figure 5 (D in the middle); the target relationship between miR-let-7 and miR-971-1 will be verified subsequently.

[0057] (3) miR-let-7 and ZcCTL-S1 Combining

[0058] Will CTL-S1 The miRNA-mRNA binding sites and surrounding fragments predicted by the gene sequence were cloned into the GLO vector (Promega, USA) using Sac I and Sal I restriction sites, respectively. The miRNA agomir / agomir NC was co-transfected into HEK293T cells with WT, MUT or GLO plasmids (sequences shown in Table 1). 24 h after transfection, Luciferase AssayReagent II was added to detect the enzyme activity of luciferase in fireflies and sea cucumbers.

[0059] Three-day-old female melon fly larvae were injected with 250 nL miRNA mimic (100 μM). Flies injected with miRNA NC served as a control group. Samples were collected 48 h later. Total RNA was obtained using the RNA Binding Protein Immunoprecipitation (RIP) Kit (Absin, China) and detected by qRT-PCR. ZcCTL-S1 The expression.

[0060] Dual-luciferase reporter gene assays showed no significant differences after transfection of pmirGLO-miR-971-1 plasmid with miR-97-1mimic and mimic NC, respectively. F （5,50） =2.338, P =0.053)( Figure 6 A in the text indicates that... ZcCTL-S1 In this sequence, ATGTCAC is not a binding site for miR-971-1, and there is no targeting relationship between the two. Significant differences were observed in the results after co-transfection of pmirGLO-miR-let-7 plasmid with mimic NC and miR-let-7 mimic, respectively. F （5,66） =67.488, P =0.000)( Figure 6 (B in the text) Explanation ZcCTL-S1A binding site exists on the TCGAAAG seed sequence. Co-transfection of the pmirGLO-mut-let-7 plasmid with mimic NC and miR-let-7 mimic showed no significant difference in results, indicating that... ZcCTL-S1 The TCGAAAG in this sequence is the binding site for miR-let-7. RNA immunoprecipitation results showed that when AGO-1 antibody was incubated with lysate, miR-let-7 mimic treatment was effective. ZcCTL-S1 The expression level of was significantly increased ( t =11.740, df =2, P =0.007)( Figure 6 (C) in the text, while when incubated with IgG antibody, ZcCTL-S1 There was no significant difference in expression levels. t =0.365, df =2, P =0.750)( Figure 6 (C) indicates miR-let-7 and ZcCTL-S1 It can bind directly. Using the nucleic acid sequences shown in Table 1, a probe with Cy3 red fluorescence was synthesized for tissue localization. The results showed that the miR-let-7 probe signal was concentrated in the follicular cells of *Flococcus melonans* (*Flococcus pulcherrima*). Figure 6 (D in the middle).

[0061] Example 5: Effects of miR-let-7 on female fertility

[0062] Adult melon flies that emerged on the same day were collected and reared normally until day 2. Male and female adults were then separated and reared asexually. Starting from day 3, each female was injected with 250 nL miRNA mimic / NC (100 μM) every other day until day 11. The melon flies injected with miRNA mimic served as the experimental group, and those injected with miRNA NC served as the control group. Eleven-day-old adults were paired 1:1 after injection, with 15 pairs per group, for a total of three groups. Egg production and hatching rate were measured over three days.

[0063] Figure 7 The results showed no significant change in the total number of eggs laid within 3 days. t =0.496, df =10, P =0.631)( Figure 7 (A in the middle), but the hatching rate dropped significantly ( t =10.200, df =10, P =0.000)( Figure 7 (B in the original text), the result is consistent with ZcCTL-S1 The results of the interference were consistent.

Claims

1. Reduce female melon flies CTL-S1 Application of gene expression levels in reducing the hatching rate of melon fly eggs, wherein the melon fly... CTL-S1 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The application of increasing the expression level of miR-let-7 in female melon fly in reducing the hatching rate of melon fly eggs, wherein the nucleotide sequence of the melon fly miR-let-7 is shown in SEQ ID No.

3.

3. A method for reducing the hatching rate of female melon fly eggs, characterized in that, By reducing the levels of [something] in female melon flies CTL- S1 The expression level of the gene reduces the hatching rate of melon fly eggs. CTL-S1 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. The method according to claim 3, characterized in that, The reduction of female melon fly's body CTL-S1 Gene expression levels were reduced in female melon flies using RNAi technology. CTL-S1 Gene expression levels.

5. The method according to claim 4, characterized in that, The RNAi technology mentioned is the injection of ds CTL-S1 In the body of the melon fly, the ds CTL-S1 The amplification primers are shown in SEQ ID No. 20 and SEQ ID No.

21.

6. A method for reducing the hatching rate of female melon fly eggs, characterized in that, The hatching rate of melon fly eggs is reduced by increasing the expression level of miR-let-7 in female melon flies, and the nucleotide sequence of miR-let-7 is shown in SEQ ID No.

3.

7. The method according to claim 6, characterized in that, The aforementioned increase in miR-let-7 expression in female melon flies is achieved by injecting miR-let-7 into the melon fly.

Images