Use of miRNA as a target in preparation of a drug for treating non-small cell lung cancer
By regulating the expression levels of miR-423-5p and miR-135a-5p, combined with chemotherapy, the shortcomings in early diagnosis and treatment of non-small cell lung cancer were addressed, achieving effective inhibition and apoptosis of non-small cell lung cancer cells, and providing a new treatment option.
Patent Information
- Application Number
- CN202610372637.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-25
- Publication Date
- 2026-07-03
AI Technical Summary
Current technologies are not ideal for the early diagnosis and treatment of non-small cell lung cancer. The lack of effective biomarkers and therapeutic targets leads to limited treatment options and poor prognosis.
Using miR-423-5p and miR-135a-5p as targets, their expression levels in non-small cell lung cancer cells were regulated by expression inhibitors or overexpression agents. Combined with treatment with tumor chemotherapy drugs cisplatin or carboplatin, cell growth and migration were inhibited and apoptosis was promoted.
It significantly inhibits the proliferation and migration of non-small cell lung cancer cells, promotes apoptosis, and enhances the effect of chemotherapy, providing new therapeutic targets and biomarkers, and has important therapeutic value.
Smart Images

Figure CN122320985A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedical technology, specifically to the application of miRNA as a target in the preparation of drugs for the treatment of non-small cell lung cancer. Background Technology
[0002] Lung cancer is a leading cause of cancer death worldwide. Its early stages are often insidious, with approximately 75% of lung cancer patients diagnosed at an advanced stage, resulting in limited treatment options and poor prognosis. Non-small cell lung cancer (NSCLC) accounts for 80% of all lung cancers, with its main pathological subtypes including adenocarcinoma (60%) and squamous cell carcinoma (30-35%). The survival rate of NSCLC is closely related to tumor stage; early detection significantly improves survival and prognosis. Currently, early diagnosis methods for lung cancer include chest imaging, bronchoscopy, and sputum cytology, but the detection effectiveness of these methods is not ideal. Initial diagnosis of lung cancer mainly relies on imaging techniques, but imaging diagnostic efficacy is low and early detection is difficult. MicroRNAs (miRNAs) are endogenous non-coding small RNA molecules expressed in eukaryotes. Studies have shown that approximately 60% of human protein-coding genes are regulated by miRNAs. In recent years, aberrant expression of miRNAs has been found in various diseases, including malignant tumors, and the expression profiles of aberrant miRNAs vary depending on the tumor type. In lung cancer, miRNAs not only serve as dynamic biomarkers for disease prevention and treatment but also demonstrate significant potential in tumor therapy. Current research has confirmed that various miRNAs can act as therapeutic targets for tumors. The aberrant expression of these miRNAs in the plasma and cancerous tissues of lung cancer patients may involve multiple signal transduction pathways, such as inflammation, apoptosis, and cell cycle. Certain specific miRNAs are aberrantly expressed in lung cancer, and perturbing these specific miRNAs can affect malignant cellular phenotypes such as proliferation, metastasis, and invasion. These advances suggest that miRNAs hold promise as biomarkers for early diagnosis of lung cancer and novel therapeutic targets. Summary of the Invention
[0003] This invention provides the application of miR-423-5p and miR-135a-5p as targets in the preparation of drugs for treating non-small cell lung cancer (NSCLC). It discloses the application of miR-423-5p expression inhibitors or miR-135a-5p overexpression agents in the preparation of drugs for treating NSCLC. The expression inhibitors or overexpression agents are used to inhibit the cell growth and migration of representative NSCLC cells A549 and NCI-H1703, and promote their apoptosis. Combined treatment with the anti-tumor chemotherapy drugs cisplatin or carboplatin enhances the growth inhibition on these two cell lines.
[0004] According to a first aspect of the present invention, the use of miR-423-5p or miR-135a-5p as a target in the preparation of a drug for treating non-small cell lung cancer is provided, wherein the nucleotide sequence of miR-423-5p is shown in SEQ ID NO.1 and the nucleotide sequence of miR-135a-5p is shown in SEQ ID NO.4.
[0005] Preferably, the miR-423-5p expression inhibitor or miR-135a-5p overexpression agent is used in the preparation of drugs for treating non-small cell lung cancer.
[0006] Preferably, the nucleotide sequence of the miR-423-5p expression inhibitor is shown in SEQ ID NO.3.
[0007] Preferably, the nucleotide sequence of the miR-135a-5p overexpression reagent is a double-stranded RNA formed by SEQ ID NO.4 and SEQ ID NO.6.
[0008] Preferably, the miR-423-5p expression inhibitor or miR-135a-5p overexpression agent is used to induce growth inhibition in non-small cell lung cancer cells A549 and NCI-H1703.
[0009] Preferably, the miR-423-5p expression inhibitor or miR-135a-5p overexpression agent is used to induce a decrease in the proliferation and migration of non-small cell lung cancer cells A549 and NCI-H1703.
[0010] Preferably, the miR-423-5p expression inhibitor or miR-135a-5p overexpression agent is used to induce apoptosis in non-small cell lung cancer cells A549 and NCI-H1703.
[0011] Preferably, the expression inhibitor or overexpression reagent is used in combination with the tumor chemotherapy drug cisplatin or carboplatin in the preparation of a drug for treating non-small cell lung cancer.
[0012] In summary, compared with the prior art, the above-described technical solutions conceived by this invention mainly possess the following technical advantages: (1) This invention discloses for the first time that miR-423-5p and miR-135a-5p show statistically significant differences in plasma between non-small cell lung cancer (NSCLC) patients and healthy controls. It was found that the expression level of miR-423-5p in the plasma of NSCLC patients was significantly higher than that in the control group, and its expression was upregulated in cancer tissue samples from NSCLC patients compared to adjacent normal tissues. However, the expression level in postoperative plasma of NSCLC patients was significantly lower than that in preoperative plasma. Simultaneously, it was found that the expression level of miR-135a-5p in the plasma of NSCLC patients was significantly lower than that in the control group, and its expression was downregulated in NSCLC tissue samples. Furthermore, the expression level in postoperative plasma of NSCLC patients was significantly higher than that in preoperative plasma. Therefore, developing therapeutic agents or drugs for NSCLC using miR-423-5p and miR-135a-5p as therapeutic targets for lung cancer is of great significance and has promising application prospects.
[0013] (2) This invention also found that inhibiting miR-423-5p expression or increasing miR-135a-5p expression can promote apoptosis in representative non-small cell lung cancer cells A549 and NCI-H1703, and inhibit the proliferation and migration of non-small cell lung cancer cells. Combined treatment with the tumor chemotherapy drugs cisplatin or carboplatin can enhance the growth inhibition on the above two cell lines. Therefore, miR-423-5p expression inhibitors or miR-135a-5p overexpression agents have important value in the application as therapeutic agents or drugs for non-small cell lung cancer. Attached Figure Description
[0014] Figure 1 The expression levels of miR-423-5p(a) and miR-135a-5p(b) in the plasma of non-small cell lung cancer patients vs. healthy controls.
[0015] Figure 2 The expression levels of miR-423-5p(a) and miR-135a-5p(b) in cancerous tissues vs. adjacent tissues of patients with non-small cell lung cancer.
[0016] Figure 3 The expression levels of miR-423-5p(a) and miR-135a-5p(b) in preoperative vs. postoperative plasma in patients with non-small cell lung cancer.
[0017] Figure 4 The effects of miR-423-5p Inhibitor (a) and miR-423-5p Mimic (b) on miR-423-5p expression levels in non-small cell lung cancer cells.
[0018] Figure 5The effects of miR-135a-5p Inhibitor (a) and miR-135a-5p Mimic (b) on miR-135a-5p expression levels in non-small cell lung cancer cells.
[0019] Figure 6 The effects of inhibiting miR-423-5p expression (a) and increasing miR-135a-5p expression (b) on the growth of non-small cell lung cancer cells.
[0020] Figure 7 The effects of inhibiting or increasing miR-423-5p expression (a) and inhibiting or increasing miR-135a-5p expression (b) on the migration of non-small cell lung cancer cells.
[0021] Figure 8 The effects of inhibiting or increasing miR-423-5p expression (a) and inhibiting or increasing miR-135a-5p expression (b) on apoptosis in non-small cell lung cancer cells.
[0022] Figure 9 To investigate the effects of treatment with cisplatin or carboplatin, combined with inhibition of miR-423-5p expression and enhancement of miR-135a-5p expression, on the growth of non-small cell lung cancer cells. Detailed Implementation
[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.
[0024] In this invention, the nucleotide that downregulates miR-423-5p expression is used as an expression inhibitor. It is a nucleotide that targets and downregulates miR-423-5p expression, and the effective sequence is the reverse complementary sequence of the original miR-423-5p sequence.
[0025] SEQ ID NO.1 (miR-423-5p sequence): 5'-UGAGGGGCAGAGAGCGAGACUUU-3' SEQ ID NO.2 (DNA sequence corresponding to miR-423-5p sequence): 5'-tgaggggcagagagcgagacttt-3' SEQ ID NO.3 (complementary sequence to SEQ ID NO.1): 5'-AAAGUCUCGCUCUCUGCCCCUCA-3' The miR-423-5p inhibitor competitively binds to the mature miR-423-5p sequence (SEQ ID NO.1) via a chemically modified RNA single-stranded nucleotide (SEQ ID NO.3), thereby weakening the transcriptional efficiency of endogenous miR-423-5p in tissues / cells and downregulating miR-423-5p expression. Specifically, the miR-423-5p inhibitor is a chemically synthesized inhibitor specifically designed to target miR-423-5p expression in tissues / cells, and it can specifically target and downregulate miR-423-5p expression levels.
[0026] In this invention, the nucleotide that upregulates miR-135a-5p expression is used as an overexpression reagent (Mimic). It is a nucleotide that targets and upregulates miR-135a-5p expression, and the effective sequence is a double-stranded RNA with the same sequence as the original sequence.
[0027] SEQ ID NO.4 (miR-135a-5p sequence): 5'-UAUGGCUUUUUAUUCCUAUGUGA-3' SEQ ID NO.5 (DNA sequence corresponding to miR-135a-5p sequence): 5'-tatggctttttattcctatgtga-3' SEQ ID NO.6 (complementary sequence to SEQ ID NO.4): 5'-UCACAUAGGAAUAAAAAGCCAUAUU-3' Mimics typically need to be designed as double-stranded structures; therefore, the effective sequence of miR-135a-5p mimic is a double-stranded RNA with the same sequence as the original (SEQ ID NO.4 and SEQ ID NO.6). The mechanism of action of miR-135a-5p mimic is that it is synthesized chemically to mimic the endogenous maturation of miR-135a-5p in cells, thereby specifically targeting and upregulating the expression level of miR-135a-5p. Specific examples are as follows.
[0028] Example 1: Distribution of plasma miR-423-5p and miR-135a-5p expression levels in lung cancer case-control populations 1. Experimental Methods A case-control population of 136 pairs of non-small cell lung cancer (NSCLC) patients was designed and established using age ± 2 years and sex-matched controls. Information such as patients' smoking history was collected. Peripheral blood samples were obtained from lung cancer patients and healthy controls. Additionally, peripheral blood samples were collected from 21 NSCLC patients who had undergone lung cancer resection surgery, both preoperatively and one week postoperatively. Plasma and blood cells were separated from the peripheral blood. Lung cancer tissue and adjacent normal tissue were also collected from 30 NSCLC patients who underwent lung cancer resection surgery (i.e., 30 pairs). Total RNA was extracted from plasma and tissues using TRIzol® LS lysis buffer pretreatment combined with the miRNeasy Serum / Plasma Kit (catalog no. 217184). Using 5 μL of total RNA as the starting RNA template, plasma small RNA libraries were constructed according to the procedures outlined in the QIAseq® miRNALibrary Kit (QIAGEN, Germany). Sequencing of the small RNA libraries was performed on an Illumina next-generation sequencer. The massive dataset generated by the next-generation sequencer was further analyzed using CLC Genomics Workbench to quantify and compare miRNA counts (miRbase-Release v22.0). MiRNAs with a count per million (CPM) ≥ 1 in 20% of both lung cancer plasma and healthy control plasma samples were included in the analysis.
[0029] (2) The variance stabilizing transformation (VST) method in the DESeq2 software package was used to standardize the miRNA count data of non-small cell lung cancer patients and healthy controls using VST, including preoperative and postoperative plasma data, and data from cancerous and adjacent tissues. Subsequently, the variance stabilizing transformation (VST) method was used... t The expression levels of two plasma miRNAs were evaluated in lung cancer case-control populations. Furthermore, paired assays were used. t The expression levels of miR-423-5p and miR-135a-5p in plasma before and after surgery were compared in 21 patients with non-small cell lung cancer who had undergone lung cancer resection. The expression levels of miR-423-5p and miR-135a-5p in cancerous and adjacent tissues of 30 pairs of lung cancer patients were also compared.
[0030] Specifically, the steps for VST standardization are as follows: First, install and load the DESeq2 package, then load the DESeq2 package into the R environment: `library(DESeq2)`. Input data: Two data sets are input: one is a miRNA count data matrix containing sample IDs and corresponding miRNA count values; the other is a data frame containing sample IDs and sample grouping information (lung cancer status: non-small cell lung cancer patient or healthy control, preoperative or postoperative, cancerous tissue or adjacent normal tissue). Creating a DESeqDataSet object: Use the `DESeqDataSetFromMatrix` function to create a DESeqDataSet object from the input data. This object will contain all the information needed for subsequent analysis.
[0031] dds<- DESeqDataSetFromMatrix(countData = count_matrix, colData = design_table, design = ~ condition) Here, count_matrix is the miRNA count data matrix, design_table is a data frame containing sample grouping information, and condition is the condition variable for comparison.
[0032] Perform VST normalization: Use the `vst` function to perform VST normalization on the `DESeqDataSet` object: vst_dds<- vst(dds, blind = TRUE) vst_dds contains miRNA count data normalized by vst, which can be used for subsequent differential expression analysis or other statistical tests.
[0033] More specifically, through the above steps, the VST method in the DESeq2 software package can be used to perform VST standardization on plasma and tissue miRNA count data. This will help reduce variability between samples and make subsequent differential expression analysis more accurate and reliable.
[0034] 2. Experimental Results like Figure 1 As shown, the expression level of miR-423-5p in the plasma of non-small cell lung cancer patients was higher than that in healthy controls. Figure 1 (Figure a) Compared with adjacent normal tissue, its expression was upregulated in cancer tissue samples from non-small cell lung cancer patients. Figure 2(Figure a) and compared with preoperative levels, its expression level in the plasma of non-small cell lung cancer patients after surgery was significantly reduced ( Figure 3 (Figure a). Furthermore, the expression level of miR-135a-5p in the plasma of non-small cell lung cancer patients was significantly lower than that in healthy controls. Figure 1 (Figure b) The expression level of this substance in cancer tissue samples from non-small cell lung cancer patients was significantly higher than that in adjacent normal tissues. Figure 2 (Figure b), and its expression level significantly increased after surgery ( Figure 3 (Figure b in the middle)
[0035] Example 2: Validation of Inhibitor Silencing Efficiency and Mimic Overexpression Efficiency of miR-423-5p and miR-135a-5p The miR-423-5p expression inhibitor and overexpression reagent used in this embodiment, as well as the miR-135a-5p expression inhibitor and overexpression reagent, had their nucleotide sequences synthesized by Sangon Biotech (Shanghai) Co., Ltd. The expression inhibitor control used the company's Inhibitor negative control, namely the Inhibitor NC group, with the sequence 5'-CAGUACUUUUGUGUAGUACAA-3' (SEQ ID NO.7). The overexpression reagent control used the company's Mimic negative control, namely the Mimic NC group, with the double-stranded RNA of 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO.8) and its complementary sequence 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO.9).
[0036] In this embodiment, all primer pairs for miR-423-5p, miR-135a-5p, and U6 (this gene sequence is a non-coding small RNA of approximately 100 nucleotides in length, stably expressed in various tissues and cells, and does not involve small RNA regulatory pathways; it is often used as a housekeeping gene for experiments to detect the expression level of non-coding RNA in cells, blood, and tissues) were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0037] The reverse transcription primer sequence for miR-423-5p used in the reverse transcription experiment was 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAGTC -3' (SEQ ID NO.10), the reverse transcription primer sequence for miR-135a-5p was 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCACAT -3' (SEQ ID NO.11), and the reverse transcription primer sequence for U6 was 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO.12).
[0038] The upstream primer sequence for miR-423-5p used in the real-time quantitative PCR experiment was 5'-AAGAATTGAGGGGCAGAGAGCG-3' (SEQ ID NO.13), and the upstream primer sequence for miR-135a-5p was 5'-CGCGTATGGCTTTTTATTCCT-3' (SEQ ID NO.14). The downstream primer sequences for both miR-423-5p and miR-135a-5p were 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC-3' (SEQ ID NO.15). The upstream primer sequence for U6 was 5'-CTCGCTTCGGCAGCACA-3' (SEQ ID NO.16), and the downstream primer sequence for U6 was 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO.17).
[0039] 1. Experimental Methods (1) Cell culture: The non-small cell lung cancer cell lines A549 and NCI-H1703 were used as cell models. T25 culture flasks were used, and the cells were cultured in a 37°C, 5% CO2 constant temperature incubator. The A549 cell culture medium was DMEM medium with 10% fetal bovine serum and 1% penicillin-streptomycin antibody added. The NCI-H1703 cell culture medium was RPMI-1640 medium with 10% fetal bovine serum and 1% penicillin-streptomycin antibody added.
[0040] (2) Cell counting: Take cells in the logarithmic growth phase, discard the original culture medium, and wash the cells three times with 1 mL PBS. Then add 1 mL trypsin digestion solution, incubate in an incubator for 2 minutes, and most of the cells will detach when the culture flask is gently shaken. Add 3 mL of complete culture medium to stop digestion, and repeatedly pipette using a sterile Pasteur pipette to prepare a single-cell suspension. After mixing, take 10 μL of the suspension and add it to a cell counting chamber for counting.
[0041] (3) Cell plating and transfection: Cells were plated at a density of 1×10⁶ cells per well. 5 Cells were evenly seeded at a density in 6-well plates and incubated in a constant temperature incubator. Transfection was performed when the cell confluence reached approximately 40%. First, an interference sequence stock solution was prepared: 250 μL of RNase-free ddH2O was added to a reagent bottle containing 5 nmol of lyophilized interference sequence, and the mixture was thoroughly mixed to obtain a 20 μmol / L stock solution, which was then aliquoted and stored at -20°C. On the day of transfection, the transfection complex was prepared as follows: 5 μL of the above interference sequence stock solution was added to 245 μL of antibiotic-free and serum-free basal medium, and the mixture was gently mixed and incubated at room temperature for 5 minutes (Solution A). Separately, 5 μL of Lipofectamine™ 3000 transfection reagent was added to 245 μL of the same basal medium, and the mixture was gently mixed and incubated at room temperature for 5 minutes (Solution B). Solution A and Solution B were gently mixed and incubated at room temperature for 20 minutes to form the transfection complex. Add 1500 μL of basal medium to the complex and mix well to obtain the transfection working solution, with a final concentration of the interfering sequence of 50 nmol / L. Then perform transfection, discarding the original medium in each well, adding 2 mL of transfection working solution to each well, and gently shaking the six-well plate to ensure even distribution. Return the plate to the incubator and continue culturing for 6 hours. Remove the transfection solution and replace it with complete medium containing serum and antibiotics, and continue culturing for another 48 hours.
[0042] The experiment was conducted in the following groups: Inhibitor NC group (negative control inhibitor), Mimic NC group (negative control mimic), miR-423-5p Inhibitor group, miR-423-5p Mimic group, miR-135a-5p Inhibitor group, and miR-135a-5p Mimic group.
[0043] (4) Total RNA extraction: After transfection, discard the culture medium in each well and wash three times with 1 mL of PBS. Then add 1 mL of TRIzol lysis buffer to each well and incubate at 4°C for 15 minutes to allow for complete cell lysis. Use a pipette to repeatedly blow the bottom of the wells to transfer the lysate to 1.5 mL enzyme-free EP tubes. Add 200 μL of chloroform to each tube of lysis buffer, tighten the cap, and vortex vigorously for 15 seconds. Incubate at room temperature for 15 minutes. Then centrifuge at 4°C and 12,000 rpm for 15 minutes. The sample will separate into three layers: an upper colorless aqueous phase, an intermediate protein layer, and a lower organic phase. Carefully aspirate approximately 500 μL of the upper aqueous phase (this can be done in 5 portions of approximately 100 μL each) and transfer it to a new RNase-free EP tube. Add an equal volume of pre-chilled isopropanol, gently invert to mix, and incubate at room temperature for 15 minutes. Centrifuge at 4°C and 12,000 rpm for 10 minutes; a white RNA precipitate will be visible at the bottom of the tube. Discard the supernatant, add 1 mL of 80% ethanol prepared with DEPC water to the precipitate, gently invert and wash the precipitate, then centrifuge at 4°C and 12,000 rpm for 8 minutes. Repeat this washing step three times. Discard the ethanol, and allow the tube to dry at room temperature for approximately 20 minutes until the precipitate becomes translucent. Finally, add 30 μL of RNase-free ddH2O to dissolve the precipitate, and let it stand at room temperature for 20 minutes to allow the RNA to fully dissolve, thus obtaining the total RNA solution.
[0044] (5) Reverse transcription: Step 1: Remove genomic DNA. Take 200 µL of ribozyme-free eight-tube and prepare 20 µL of reaction solution according to the following system: 6 µL RNase-Free ddH2O + 4 µL 5× gDNA Wiper Mix + 10 µL RNA template (concentration >100 ng / µL). Gently mix and briefly centrifuge, then place in a PCR instrument and incubate at 42℃ for 2 minutes. Step 2: First-strand cDNA synthesis. Continue to add the following reagents to the same eight-tube as above to prepare a reverse transcription system with a total volume of 40 µL: 20 µL of the previous step reaction solution + 10 µL RNase-Free ddH2O + 4 µL 10× RT Mix + 4 µL HiScript II Enzyme Mix + 2 µL of 2 µM Stem-loop primer. Mix and centrifuge, then run according to the following program: 25℃ for 5 minutes, 50℃ for 15 minutes, 80℃ for 5 minutes. After the reaction, the resulting cDNA can be stored at -20℃ for later use. The Stem-loop primers (reverse transcription primers) are nucleotide sequences specifically designed for different small RNAs. The reverse transcription primer sequence for miR-423-5p is 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAGTC-3' (SEQ ID NO.10), the reverse transcription primer sequence for miR-135a-5p is 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCACAT-3' (SEQ ID NO.11), and the reverse transcription primer sequence for U6 is 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO.12).
[0045] (6) Real-time quantitative PCR was used to detect the relative expression levels of miR-423-5p and miR-135a-5p. qPCR reaction system preparation: In a 384-well plate, add the following components in 10 µL increments to each well: 5.0 µL 2× miRNA Universal SYBR qPCR Master Mix + 1.0 µL cDNA template + 3.6 µL RNase-Free ddH2O + 0.2 µL of 10 µM specific upstream primer + 0.2 µL of 10 µM universal downstream primer mQ primer R. After adding the samples, gently vortex to mix, seal the wells with a special sealing film, and briefly centrifuge to allow the liquid to accumulate at the bottom of the wells. qPCR reaction program: Place the 384-well plate in an ABI QuantStudio 7 real-time quantitative PCR instrument and run the following program: pre-denaturation 95℃ for 5 minutes; amplification cycles: denaturation 95℃ for 10 seconds, annealing / extension 60℃ for 3 seconds, for a total of 45 cycles; melting curve analysis should be performed according to the instrument's default settings or a preset program. After the reaction, the system automatically generates Ct values, using 2... ΔΔCt The relative expression level of the target miRNA can be calculated using this method.
[0046] The specific primers, or upstream primers, are nucleotide sequences specifically designed for different small RNAs. The upstream primer sequence for miR-423-5p is 5'-AAGAATTGAGGGGCAGAGAGCG-3' (SEQ ID NO.13), and the upstream primer sequence for miR-135a-5p is 5'-CGCGTATGGCTTTTTATTCCT-3' (SEQ ID NO.14). Additionally, the mQ primer R is a universal downstream primer for small RNA reverse transcription products, with the sequence 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC-3' (SEQ ID NO.15), which serves as the downstream primer for miR-423-5p and miR-135a-5p. The upstream primer sequence for U6 is 5'-CTCGCTTCGGCAGCACA-3' (SEQ ID NO.16), and the downstream primer sequence is 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO.17). The results are expressed as 2^-ΔΔCT, and the final treatment group was compared with the NC group.
[0047] 2. Experimental Results like Figure 4 and Figure 5As shown, after 24 and 48 hours of cell transfection culture, the expression levels of miR-423-5p and miR-135a-5p in the Inhibitor NC group and the Mimic NC group did not change significantly. However, the expression level of miR-423-5p in the Inhibitor group decreased, with both cell types dropping below 50%. Figure 4 (Figure a) The expression level of miR-135a-5p in the mimic group was significantly increased, with both cell types showing an increase of more than three times that of the control group. Figure 4 (Figure b); miR-135a-5p expression levels were decreased in the miR-135a-5p Inhibitor group, with both cell types showing a decrease to below 50%. Figure 5 Figure a). The expression level of miR-423-5p in the Mimic group was significantly increased, and the level in both cell types was more than three times that of the control group. Figure 5 (Figure b). The results suggest that miR-423-5p Inhibitor can effectively target and downregulate the expression level of miR-423-5p in non-small cell lung cancer (NSCLC) cells, while miR-135a-5p Mimic can effectively target and upregulate the expression level of miR-135a-5p in NSCLC cells. Combined with the results of Example 1, miR-135a-5p and miR-423-5p are potential specific biomarkers for NSCLC, suggesting that miR-135a-5p and miR-423-5p have the potential to be used as targets for the development of drugs to treat NSCLC.
[0048] Example 3: miR-423-5p expression inhibitors or miR-135a-5p overexpression agents can inhibit the growth of lung cancer cell lines A549 and NCI-H1703 and induce their apoptosis. 1. Experimental Methods (1) Cell culture: The human non-small cell lung cancer cell lines A549 and NCI-H1703 were used as models. The routine cell culture and counting methods were the same as in Example 1.
[0049] (2) Cell viability assay (CCK-8 assay): Cells in the logarithmic growth phase were seeded evenly at a density of 3000 cells per well in 96-well plates and cultured in a 37°C, 5% CO2 incubator. After about 18 hours, when the cell confluence reached about 40%, transfection was performed: the original culture medium was discarded, and 200 µL of serum-free, antibiotic-free medium containing interfering sequences (transfection mixture) was added to each well, and the mixture was gently shaken. After 6 hours of transfection, the transfection solution was removed and replaced with complete culture medium containing serum and antibiotics, and cultured for another 24 or 48 hours. The following transfection groups were set up: Inhibitor NC group (negative control for expression inhibitor), Mimic NC group (negative control for overexpression reagent), miR-423-5p Inhibitor group, and miR-135a-5p Mimic group. The assays were performed at 24 and 48 hours post-transfection: the culture medium in each well was discarded, and 110 µL of fresh complete culture medium containing 10 µL of CCK-8 reagent was added to each well. The wells were incubated in the dark for 40 minutes. The absorbance (OD) of each well was then measured at 450 nm using a microplate reader. The cell proliferation rate was calculated using the following formula: Cell proliferation rate (%) = (Experimental group OD - Blank group OD) / (Control group OD - Blank group OD) × 100%. The experimental group was compared with the corresponding NC group.
[0050] (3) Apoptosis detection (Hoechst 33342 / PI double staining method): Cells were stained at 3 × 10⁶ cells per well. 4 Seeds were planted at a density of [number] cells per well in 12-well plates and cultured until confluence reached approximately 40% (approximately 18 hours). Transfection was then performed: 600 µL of serum-free, antibiotic-free medium containing interfering sequences was added to each well, and the mixture was gently shaken to mix. After 6 hours, the medium was replaced with complete medium, and the plates were cultured for another 48 hours. The experimental groups were as follows: WT group (untransfected wild-type control), miR-423-5p Inhibitor group, miR-423-5p Mimic group, miR-135a-5p Inhibitor group, and miR-135a-5p Mimic group. Forty-eight hours after transfection, staining was performed. The working solution was prepared by adding 500 µL of antibiotic-free medium pre-warmed to 37 °C, 5 µL of Hoechst 33342 (100×), and 5 µL of PI (100×), and mixing thoroughly. Then, staining was performed: the culture medium in the wells was aspirated, the cells were gently washed once with PBS, and 500 µL of staining working solution was added to each well. The cells were incubated at room temperature in the dark for 15 minutes. Finally, the cells were washed and observed: the staining solution was aspirated, the cells were washed once with PBS, and 1 mL of PBS was added to each well to cover the cells to prevent them from drying out. The cells were then observed and images were acquired immediately using an inverted fluorescence microscope.
[0051] 2. Experimental Results The results of the CCK-8 experiment are as follows: Figure 6The results showed that the cell viability of A549 cells in both the Inhibitor NC group and the Mimic NC group was above 90%. Compared with the Inhibitor NC group, the 24-hour cell viability of the miR-423-5p Inhibitor group was 72.20% ± 6.176%, and the 48-hour cell viability was 77.22% ± 1.33%. Compared with the Mimic NC group, the 24-hour cell viability of the miR-135a-5p Mimic group was 74.70% ± 2.08%, and the 48-hour cell viability was 76.89% ± 0.42%. The cell viability of NCI-H1703 cells in both the Inhibitor NC group and the Mimic NC group was above 92%. Compared with the Inhibitor NC group, the 24-hour cell viability of the miR-423-5p Inhibitor group was 55.96% ± 6.07%, and the 48-hour cell viability was 65.32% ± 3.075%. Compared with the Mimic NC group, the 24-hour cell viability of the miR-135a-5p Mimic group was 57.75% ± 1.79%, and the 48-hour cell viability was 69.67% ± 2.49%. Hoechst / PI apoptosis staining results are as follows... Figure 7 As shown, 48 hours after transfection, compared with the control group (Inhibitor NC / Mimic NC), apoptosis was detected in A549 cells and NCI-H1703 cells transfected with miR-423-5pInhibitor or miR-135a-5pMimic (the cells appeared bright blue after Hoechst staining, indicating early apoptosis—nuclear condensation; the cells appeared red after PI staining, indicating late apoptosis). The results suggest that miR-423-5p expression inhibitors or miR-135a-5p overexpression agents can inhibit the growth of A549 and NCI-H1703, representative cells of non-small cell lung cancer, and induce apoptosis. This indicates that miR-423-5p and miR-135a-5p, as targets, can be used to prepare drugs for the treatment of non-small cell lung cancer and have certain application prospects.
[0052] Example 4: miR-423-5p expression inhibitors or miR-135a-5p overexpression agents lead to decreased lung cancer cell migration ability. 1. Experimental Methods (1) Experimental grouping and lower chamber preparation: Take a 12-well Transwell chamber (polycarbonate membrane, pore size 8 μm) and add 750 μL of complete culture medium containing 10% FBS and double antibiotics to its lower chamber (i.e., the well of a 24-well plate). The experiment was divided into the following groups: Inhibitor NC group (negative control for expression inhibitor), Mimic NC group (negative control for overexpression reagent), miR-423-5pInhibitor group, miR-423-5pMimic group, miR-135a-5pInhibitor group, and miR-135a-5pMimic group.
[0053] (2) Cell preparation and seeding: 24 hours after cell transfection, discard the culture medium and wash three times with PBS. Add 0.5 mL of 0.25% trypsin to each well and digest at 37°C for 2 minutes. Add an equal volume of complete culture medium to stop digestion, pipette to prepare a single-cell suspension, centrifuge and discard the supernatant. Resuspend the cells in serum-free and antibiotic-free medium, count and adjust the density to 1×10⁶ cells / well. 5 Cells / mL. Take 200 μL of cell suspension (i.e., 2 × 10⁻⁶ cells / mL). 4 Add (number of cells) to the upper chamber of the Transwell, taking care to avoid generating air bubbles. Incubate the culture plate in a 37°C, 5% CO2 incubator for 24 hours.
[0054] (3) Fixation, staining, and counting: After incubation, discard the upper and lower chamber culture media. Gently wash the upper chamber once with PBS. Add 1 mL of 4% paraformaldehyde and fix at room temperature for 30 minutes. After washing with PBS, add 0.3 mL of 0.1% crystal violet staining solution and stain for 20 minutes. Gently rinse several times with PBS to remove unbound dye and air dry at room temperature. Randomly select 3-5 fields of view for photographing and recording under an optical microscope.
[0055] (4) Data analysis: ImageJ software was used to count the cells that migrated to the subcellular surface. The cell migration rate was calculated as follows: Cell migration rate (%) = (Number of migrating cells in the experimental group / Number of migrating cells in the NC group) × 100%.
[0056] 2. Experimental Results like Figure 8 As shown, the in vitro functional verification results of miR-423-5p and miR-135a-5p in two non-small cell lung cancer cell lines indicated that, compared with the control group, inhibiting miR-423-5p expression or overexpressing miR-135a-5p reduced the migration ability of non-small cell lung cancer cells. Figure 8(See Figures a and b). Therefore, miR-423-5p expression inhibitors or miR-135a-5p overexpression reagents can be used to prepare drugs for treating non-small cell lung cancer. The results of all the above examples suggest that miR-423-5p and miR-135a-5p have significant value as targets in the preparation of drugs for treating non-small cell lung cancer.
[0057] Example 5: Treatment with miR-423-5p expression inhibitors or miR-135a-5p overexpression agents in combination with chemotherapeutic drugs cisplatin or carboplatin can increase the cell growth inhibition of lung cancer cell lines A549 and NCI-H1703 induced by chemotherapy alone. 1. Experimental Methods (1) Cell culture and cell viability assay (CCK-8 assay): Using human non-small cell lung cancer cell lines A549 and NCI-H1703 as models, the routine cell culture, counting, and cell viability assay methods were the same as in Example 3. The following transfection groups were set up: WT group (wild-type cells), cisplatin treatment group, cisplatin treatment + miR-423-5p Inhibitor group, cisplatin treatment + miR-135a-5p Mimic group, carboplatin treatment group, carboplatin treatment + miR-423-5p Inhibitor group, and carboplatin treatment + miR-135a-5p Mimic group. 10 µM cisplatin and carboplatin were used for 24 hours after transfection, respectively. After drug treatment, the culture medium in the wells was discarded, and 110 µL of fresh complete culture medium containing 10 µL of CCK-8 reagent was added to each well. The wells were incubated in the dark for 40 minutes. The absorbance (OD) of each well was then measured at 450 nm using a microplate reader. The cell proliferation rate was calculated using the following formula: Cell proliferation rate (%) = (OD of experimental group - OD of blank group) / (OD of control group - OD of blank group) × 100%. The experimental group was compared with the corresponding NC group.
[0058] 2. Experimental Results The results of the CCK-8 experiment are as follows: Figure 9 The results showed that the cell viability of A549 cells in the WT group was above 95%; compared with the WT group, the cell viability of the miR-423-5p inhibitor group, cisplatin or carboplatin treatment group was significantly reduced. P <0.05), the cell viability of the miR-423-5p Inhibitor combined with cisplatin or carboplatin treatment group was significantly lower than that of the cisplatin or carboplatin treatment group. P<0.05); Compared with the WT group, the cell viability of the miR-135a-5p Mimic group, cisplatin or carboplatin treatment group was significantly reduced, and the cell viability of the miR-135a-5p Mimic combined with cisplatin or carboplatin treatment group was significantly lower than that of the cisplatin or carboplatin treatment group. P <0.05%. The cell viability of NCI-H1703 cells in the WT group was above 95%; compared with the WT group, the cell viability of the miR-423-5p Inhibitor group, cisplatin or carboplatin treatment group was significantly reduced. P <0.05), the cell viability of the miR-423-5p Inhibitor combined with cisplatin or carboplatin treatment group was significantly lower than that of the cisplatin or carboplatin treatment group. P <0.05); Compared with the WT group, the cell viability of the miR-135a-5p Mimic group, cisplatin or carboplatin treatment group was significantly reduced, and the cell viability of the miR-135a-5p Mimic combined with cisplatin or carboplatin treatment group was significantly lower than that of the cisplatin or carboplatin treatment group. P <0.05). The results suggest that treatment with miR-423-5p expression inhibitors or miR-135a-5p overexpression agents in combination with cisplatin or carboplatin can increase the growth inhibition of non-small cell lung cancer representative cells A549 and NCI-H1703 induced by chemotherapy alone. This indicates that miR-423-5p and miR-135a-5p, as targets, can enhance the therapeutic effect of chemotherapy drugs cisplatin or carboplatin on non-small cell lung cancer, and have certain clinical application value.
[0059] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. The application of miR-423-5p or miR-135a-5p as a target in the preparation of a drug for treating non-small cell lung cancer, wherein the nucleotide sequence of miR-423-5p is shown in SEQ ID NO.1 and the nucleotide sequence of miR-135a-5p is shown in SEQ ID NO.
4.
2. The application as described in claim 1, characterized in that, The application of the miR-423-5p expression inhibitor or miR-135a-5p overexpression reagent in the preparation of drugs for treating non-small cell lung cancer.
3. The application as described in claim 2, characterized in that, The nucleotide sequence of the miR-423-5p expression inhibitor is shown in SEQ ID NO.
3.
4. The application as described in claim 2, characterized in that, The nucleotide sequence of the miR-135a-5p overexpression reagent is a double-stranded RNA formed as shown in SEQ ID NO.4 and SEQ ID NO.
6.
5. The application as described in claim 2, characterized in that, The miR-423-5p expression inhibitor or miR-135a-5p overexpression agent was used to induce growth inhibition in non-small cell lung cancer cells A549 and NCI-H1703.
6. The application as described in claim 2, characterized in that, The miR-423-5p expression inhibitor or miR-135a-5p overexpression agent was used to induce a decrease in the proliferation and migration of non-small cell lung cancer cells A549 and NCI-H1703.
7. The application as described in claim 2, characterized in that, The miR-423-5p expression inhibitor or miR-135a-5p overexpression agent was used to induce apoptosis in non-small cell lung cancer cells A549 and NCI-H1703.
8. The application as described in claim 2, characterized in that, The application of the expression inhibitor or overexpression reagent in combination with the tumor chemotherapy drugs cisplatin or carboplatin in the preparation of drugs for the treatment of non-small cell lung cancer.