A recombinant ammonium acetate-producing bacterium and a method for preparing ammonium acetate

By constructing a recombinant Escherichia coli strain and optimizing the fermentation process, the deficiencies of raw materials and processes in the existing ammonium acetate production were solved, achieving efficient, economical, and green ammonium acetate production, and reaching the goals of high yield and high purity.

CN122445552APending Publication Date: 2026-07-24QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Filing Date
2026-06-18
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing ammonium acetate production processes suffer from drawbacks such as non-renewable raw materials, harsh reaction conditions, high energy consumption, large emissions of waste, and products that are prone to containing inorganic impurities. These drawbacks make it difficult to meet the requirements of high-end fields for high-purity, low-residue, and environmentally friendly products. Furthermore, the two-step fermentation process is lengthy, requires significant equipment investment, is complex to operate, has high costs, and involves cumbersome purification steps, making it difficult to achieve efficient, economical, and green large-scale preparation of ammonium acetate.

Method used

By constructing a recombinant Escherichia coli strain, knocking out key subunits of pyruvate oxidase, pyruvate formate lyase, and pyruvate dehydrogenase, and overexpressing genes such as glyoxylate transaminase and hydroxyaspartate aldolase, an acetyl-CoA carbon sequestration pathway was established. Fermentation process parameters, such as integrated pH and CO2 regulation, staged dissolved oxygen control, and fed-batch sugar supplementation, were optimized to achieve the direct conversion of glucose into ammonium acetate.

Benefits of technology

It has achieved efficient, economical and green ammonium acetate production. Single-strain single-step fermentation replaces two fermentation systems, which improves carbon utilization, simplifies process control, reduces impurities, and improves product purity and yield, achieving an ammonium acetate yield of 70 g/L and a yield of 95%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122445552A_ABST
    Figure CN122445552A_ABST
Patent Text Reader

Abstract

The application discloses a recombinant ammonium acetate-producing bacterium and a method for preparing ammonium acetate, and belongs to the technical field of bioengineering.The application aims to provide a method for producing ammonium acetate.The application provides a recombinant ammonium acetate-producing bacterium, which is obtained by knocking out the genes poxB of pyruvate oxidase, pflB of pyruvate formate-lyase and the key subunit aceE of pyruvate dehydrogenase of Escherichia coli as a starting bacterium, and overexpressing the genes Agx1 / BhcA of glyoxylate aminotransferase, Dhaa / BhcC of hydroxyaspartate aldolase, BhcB of beta-hydroxyaspartate dehydratase and BhcD of iminosuccinate reductase.The application combines the carbon sequestration path with the fermentation process optimization, realizes direct and efficient synthesis from glucose to ammonium acetate, significantly simplifies the process flow, and improves the carbon atom utilization efficiency and product yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a recombinant bacterium that produces ammonium acetate and a method for preparing ammonium acetate. Background Technology

[0002] Ammonium acetate is an important chemical raw material and biochemical reagent widely used in biopharmaceuticals, analytical chemistry, food additives, and electronic chemicals, with high market demand and application value. Currently, the industrial production of ammonium acetate mainly relies on chemical synthesis, using petroleum-derived acetic acid and ammonia through a neutralization reaction. This process suffers from drawbacks such as non-renewable raw materials, harsh reaction conditions, high energy consumption, large emissions of waste, and products containing inorganic impurities, making it difficult to meet the requirements of high-end fields for high-purity, low-residue, and environmentally friendly products. The microbial fermentation method for synthesizing ammonium acetate, using renewable biomass as a carbon source, achieves in-situ conversion and directed synthesis of acetic acid and ammonia nitrogen under mild conditions. This method offers advantages such as mild reaction conditions, environmental friendliness, high product purity, and strong sustainability. Developing this new technology for preparing ammonium acetate through microbial fermentation can effectively reduce dependence on petrochemical raw materials, aligning with the national green, low-carbon, and sustainable development strategy. It also addresses the environmental, safety, and product quality bottlenecks of traditional chemical methods, making it significant and necessary for promoting the upgrading of the ammonium acetate industry and achieving the domestic production of high-end products.

[0003] Current biological methods for preparing ammonium acetate mostly employ a two-step fermentation process. The first step uses yeast as the production strain and glucose as the substrate for fermentation to produce ethanol, with an ethanol yield of 127.03 g / L and a mass yield of 48.86%. The second step uses the obtained ethanol as a precursor, which is then oxidized by acetic acid bacteria to produce acetic acid, which is then neutralized with an ammonia source to obtain ammonium acetate, with a yield of 150.41 g / L and a mass yield of 156.86%. The overall yield of ammonium acetate from starch using this two-step fermentation process is 76.64%. For example, in the Baijiu brewing system, the interaction between Saccharomyces cerevisiae and Acetobacter pasteurellium was studied. It was found that by using a sequential inoculation method (inoculating acetic acid bacteria 24 h after yeast fermentation), acetic acid bacteria can use the ethanol produced by yeast metabolism as a substrate for oxidative fermentation to produce products such as acetic acid and ethyl acetate. However, in the mixed fermentation system, the growth and metabolism of acetic acid bacteria are inhibited by live yeast, and the acetic acid synthesis efficiency is affected. The highest theoretical yield is only 66%. Another study showed that in the ethanol fermentation system, acetic acid bacteria contamination leads to inhibited yeast growth and decreased ethanol yield, accompanied by the accumulation of acetic acid. Narendranath N V. Effects and management of lactobacilli in yeast-catalyzed ethanolfermentations [D]. University of Saskatchewan, 2000. The aforementioned two-step process has several inherent drawbacks: the process flow is lengthy, requiring the separate construction of yeast fermentation and acetic acid bacteria fermentation systems, resulting in large equipment investment and complex operation; the two-step fermentation cycle is long, leading to low substrate conversion rate and total product yield, and high production costs; multiple adjustments to pH, temperature, and dissolved oxygen conditions are necessary during fermentation, making process control difficult; ethanol intermediates are easily lost through volatility, resulting in reduced material utilization; product separation and purification steps are cumbersome, easily introducing impurities and making it difficult to obtain high-purity ammonium acetate; furthermore, the stepwise fermentation and subsequent neutralization processes result in high energy consumption and large emissions of waste, failing to meet the requirements of green, low-carbon, and clean production. Therefore, the existing two-step fermentation method is insufficient for the efficient, economical, and green large-scale preparation of ammonium acetate, necessitating the development of novel synthetic processes to overcome these technical bottlenecks. Summary of the Invention

[0004] The purpose of this invention is to provide a method for the efficient production of ammonium acetate.

[0005] This invention provides a recombinant bacterium that produces ammonium acetate. The recombinant bacterium is obtained by using Escherichia coli as the starting bacterium, knocking out the gene poxB of pyruvate oxidase, the gene pflB of pyruvate formate lyase, and the key subunit aceE of pyruvate dehydrogenase, and overexpressing glyoxylate transaminase Agx1 / BhcA, hydroxyaspartate aldolase Dhaa / BhcC, β-hydroxyaspartate dehydratase BhcB, and iminosuccinate reductase BhcD.

[0006] Further specifying, the gene for pyruvate oxidase (poxB) is shown in SEQ ID NO.1, the gene for pyruvate formate lyase (pflB) is shown in SEQ ID NO.2, the key subunit of pyruvate dehydrogenase (aceE) is shown in SEQ ID NO.3, overexpression of glyoxylate transaminase (Agx1 / BhcA) is shown in SEQ ID NO.5, hydroxyaspartate aldolase (Dhaa / BhcC) is shown in SEQ ID NO.5, and β-hydroxyaspartate dehydratase (BhcB) and iminosuccinate reductase (BhcD) are shown in SEQ ID NO.6.

[0007] This invention provides an application of the above-mentioned recombinant bacteria in ammonium acetate.

[0008] This invention provides a method for preparing ammonium acetate, the method being as follows: Step 1: Activate the above-mentioned recombinant Escherichia coli strain, pick single colonies from the plate and transfer them to LB medium, and culture until the OD600 is between 0.8 and 2.0; Step 2: Inoculate the primary seed culture prepared in Step 1 into a fermenter for fermentation culture for at least 87 hours.

[0009] Further specify that the inoculation amount of the recombinant Escherichia coli strain in step 2 is 1%-10%, and the pH is maintained at 6.8-7.2.

[0010] Further specifying, the fermentation parameters are aeration rate of 0.5-3 vvm, with aeration consisting of oxygen and carbon dioxide.

[0011] Further specified fermentation parameters: dissolved oxygen 20%-40% for 0-24h; dissolved oxygen 5%-20% for 24-88h.

[0012] Further specified, the sugar concentration of the feed in step 2 is 400-600 g / L, the feeding time is after fermentation for 10-14 hours, the feeding method is continuous feeding, and the sugar concentration is maintained at 1-20 g / L.

[0013] Further specifying, the organic nitrogen source in the fermentation medium is one or a mixture of several of the following: corn steep liquor, yeast powder, peptone, beef extract, soybean peptone, fish peptone, soybean meal extract, and cottonseed meal, with an addition amount of 1-40 g / L. Further specifying, the amino acids and their derivatives added to the fermentation medium in step 2 are one or a mixture of several of L-aspartic acid, glutamic acid, monosodium glutamate, and monosodium L-aspartate, and the amount added is 1-10 mM.

[0014] Beneficial Effects: This invention addresses the drawbacks of chemical synthesis for ammonium acetate preparation, including non-renewable raw materials, harsh reaction conditions, high energy consumption, large emissions of waste, and products containing inorganic impurities. Furthermore, the two-step fermentation method for ammonium acetate preparation suffers from lengthy processes, high equipment investment, complex operations, long fermentation cycles, low substrate conversion and total product yield, high production costs, and cumbersome product separation and purification steps. Based on the carbon fixation pathway of *E. coli*, this invention develops a highly efficient ammonium acetate synthesis technology with the following advantages: (1) An innovative carbon sequestration pathway for acetyl-CoA was constructed, which is significantly superior to the traditional two-step fermentation method: This invention constructs a recombinant *Escherichia coli* strain A101 using metabolic engineering. This strain, by knocking out the pyruvate oxidase gene (poxB), pyruvate formate lyase gene (pflB), and the key subunit gene of pyruvate dehydrogenase (aceE), overexpresses genes such as glyoxylate transaminase (Agx1 / BhcA) and hydroxyaspartate aldolase (Dhaa / BhcC), successfully constructing a carbon sequestration pathway for the synthesis of acetyl-CoA using glucose to fix carbon dioxide, with a theoretical carbon yield of up to 133%. Compared with existing two-step fermentation methods (yeast ethanol production—acetic acid bacteria oxidation conversion), this invention has significant advantages: ① High process integration: Single-strain, single-step fermentation replaces two fermentation systems, significantly reducing equipment investment and operating costs; ② High carbon utilization: Avoids the loss of ethanol intermediates through volatilization, achieving direct glucose conversion; ③ Simplified process control: Eliminates the need for multiple adjustments to pH, temperature, and other conditions, reducing energy consumption and control difficulty; ④ High product purity: Reduces complex impurities introduced by multi-strain fermentation, facilitating subsequent separation and purification. Studies have shown that knocking out genes related to acetic acid production can effectively reduce the formation of byproducts and increase the yield of target products.

[0015] (2) Precise fermentation regulation to achieve efficient accumulation of ammonium acetate This invention establishes a highly efficient ammonium acetate production system through systematic optimization of fermentation process parameters: ① Integrated pH and CO2 regulation: pH is adjusted to 6.8-7.2 using substances such as ammonium carbonate, while simultaneously providing a CO2 source (concentration 10-40%) for the carbon fixation pathway; ② Staged dissolved oxygen control: dissolved oxygen of 20%-40% from 0-24h promotes cell growth, while dissolved oxygen of 5%-20% from 24-88h facilitates product synthesis; ③ Fed-feed sugar to maintain carbon source balance: 400-600 g / L of glucose is fed after 10-14h of fermentation to maintain a sugar concentration of 1-20 g / L and prevent acetic acid overflow; ④ Nitrogen source and amino acid optimization: organic nitrogen sources such as corn steep liquor (1-40 g / L) and amino acids such as L-aspartic acid (1-10 mM) are added to provide sufficient precursors. Through the above regulation strategies, this invention ultimately achieves an ammonium acetate yield of 70 g / L and a yield of 95%, providing an innovative technical solution for the green biosynthesis of bulk chemicals. Attached Figure Description

[0016] Figure 1 The results are for the liquid phase preparation of ammonium acetate in Specific Example 1.

[0017] Figure 2 The 1H NMR spectrum of ammonium acetate prepared in Specific Implementation 1 is shown.

[0018] Figure 3 The 13C NMR spectrum of ammonium acetate prepared in Specific Implementation 1 is shown. Detailed Implementation

[0019] Example 1. I. Construction of recombinant Escherichia coli strain A101 Vector construction: Recombinant bacteria were obtained by knocking out the gene for pyruvate oxidase (poxB), the gene for pyruvate formate lyase (pflB), and the key subunit of pyruvate dehydrogenase (aceE), and overexpressing glyoxylate transaminase (Agx1 / BhcA), hydroxyaspartate aldolase (Dhaa / BhcC), β-hydroxyaspartate dehydratase (BhcB), and iminosuccinate reductase (BhcD). It is recorded in [1] Bi Yujia. Carbon sequestration pathway for high carbon atom economical synthesis of acetyl-CoA in Escherichia coli [D]. Shandong University [2026-06-17]. It records the knockout of the gene for pyruvate oxidase (poxB) and the gene for pyruvate formate lyase (pflB), followed by knocking out the key subunit of pyruvate dehydrogenase (aceE), and then overexpressing pAC-bhcACBD.

[0020] PoxB(Genbank ID: 946132);pflB(Genbank ID: 945514)aceE(Genbank ID:944834);bhcA(Genbank ID: 6142349);bhcB(Genbank ID: 6142348);bhcC(Genbank ID:93453579); bhcD(Genbank ID: 6142346); PoxB(ID:946132)(SEQ ID NO.1): pflB(ID: 945514)(SEQ ID NO.2): aceE(ID: 944834)(SEQ ID NO.3): bhcA(ID: 6142349)(SEQ ID NO.4): bhcB(ID: 6142348)(SEQ ID NO.5): ATGGAAAGCGCCCTGATCACGCCCACCCTCGACGACGTTCTGGCTGCCCACGCGCGCATCCGGCCGCACATCCACGAGACACCGGTCCTGACCTCGCGGCTCCTCGACGAGGCGGCCTGCGCGCAGCTGTTCTTCAAGTGCGAGAACCTGCAGAAGGCCGGCGCCTTCAAGGCGCGGGGTGCCTCCAACGCCGTCTTCAGCCTCACGGACGCGCAGGCCGCCCGGGGCGTGGCGACCCACTCGTCGGGCAACCACGGCACCTGCCTGTCCTACGCGGCGGGCCGGCGCGGCATCCCCTGCACGGTGGTGATGCCGCGCACCGCGCCCCAGGCGAAGAAGGACGCCGTGCGCGGCTACGGCGGCCGGGTGGTGGAGTGCGAGCCGTCCACCTCCTCCCGCGAGGCCGTCTTCGCCGAGGTCGTCGCCGAGACCGGCGCGGAGTTCGTGCACCCCTACAACGATCCCCGGGTCATCGCCGGGCAGGCGACCTGCGCCCGCGAGCTGATCGCGCAGGTCCCCGATCTCGACGCGGTGATCGCCCCGATCGGCGGCGGCGGCATGGTGTCGGGCACCTGCCTGACCCTGGCCGGGCTCGCCCCGCACATCGCCGTCTACGCGGCCGAGCCCGAGCAGGCGGACGACGCCCATCGCAGCCTGAAGGCCGGGCGGATCATCGCGGACGACGCGCCGGTGACGGTCGCCGACGGGCTGAAGGTGCCGCTGAAGGACCTCACGTGGCACTTCGTCCGCCACCACGTCGCCGACATCCTCACGGTCTCCGAGGCCGAGATCGTCGCGGCGATGCAGCTGATCTGGAAGCGGCTGAAGATCGTCACGGAGCCGTCGAGCGCCGTCGCCCTGGCGGCGGTGCTCAAGAACCGCCCCGTCTTCGCGAACAAGCGGGTGAGCGTGATCATCACGGGCGGGAACGTCGACCTCGACGCGCTGCCCTGGCAATAA; bhcC(ID: 93453579)(SEQ ID NO.6): bhcD(ID: 6142346)(SEQ ID NO.7): ATGATCATCGTTCCCGAGCACGCGATCGACGGGCTGCTGACCGAGGCGGAGTGCTTCGGCGCCGTCGAGCAGGTCTTCGCCTCCATGGCGCGGCGGCGGGCCGGGAACTTCCCGGTCGTCCGGGAAGCCATCGGCCACGCCGACGCGCTCTACGGCTTCAAGTCCGGCTTCGACCGGGACAGCCTCGCGCTCGGGCTCAAGGCCGGCGGCTTCTGGCCCGGCAACGCCGCGAAGGGCCTGACCAACCACCAGTCGACGGTGTTCCTGTTCGACGCCGATACCGGGCGCTGCCGGGCCGTGGTGGGGGGCAACCTCCTCACGGCGCTCCGCACCGCCGCGGCCTGCGCCATCTCCATCCGGCACCTCGCTCGCGAGGGCGCGCGCGTGCTCGGCATGATCGGCGCGGGCCACCAGTCGGCGTTCCAGCTGCGCGCGGCGCTGGCGCAGCGGCCGTTCGAGCGGGTCCTCGCGTGGAACCTGCATCCCGGCATGTTCGGCCGGATGGAGGCGGTGGCGCGGGAGCGCGGCGTGCCGTTCGAGGTGGTGGACCTCGACCGCCTCGGCGCCGAGGCCGACGTCGTCGTGACGATCACGTCCTCCTTCGCGCCGATCCTGAAGGCCGCGCAGGTCCGGCCGGGCACGCACGTCGCCTGCATGGGGACGGACACGCGCGGCAAGCAGGAGGTGGAGGCCGAACTGCTCGCCGCCGCGACGGTGTTCACCGACGAGGTCGCGCAGTCGGTCAGCCTCGGCGAGGCGCAGCACGCCGTCGCGCGGGGGCTCCTCGCCGCGGATTCCATCGTGGAGATCGGCGCGGTGATCAACGGCGATCATCCGGGCCGCGTGTCGGACGCCGAGATCACGGTCTTCGACGGAACCGGGGTCGGACTGCAGGACCTCGCGGTCGCCGCGGTGGCCGTCGACCGCGCGGTGGCCAAGGGGCTGGCGACGGAGGTGGATTTCTGA。

[0021] II. Fermentation Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0022] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0023] The primary seed culture was inoculated at a rate of 5% into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% ammonium carbonate aqueous solution (simultaneously providing CO2), aeration rate of 1.5 vvm, and aeration speed controlled in relation to dissolved oxygen: 30% dissolved oxygen for 0-24h, and 15% dissolved oxygen for 24-87h. After 12h of fermentation, a fed-batch process was initiated, with a sugar concentration of 500g / L. The glucose concentration in the fermenter was maintained at 5-10g / L by controlling the flow rate until fermentation was complete.

[0024] After fermentation, the yield of ammonium acetate in the fermentation broth was measured to be 70.8 g / L, and the yield of glucose from ammonium acetate was calculated to be 95.2%.

[0025] Comparative Example 1. Control strains without an introduced carbon sequestration pathway Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Wild-type Escherichia coli (E. coli W3110) stored at -80℃ without carbon sequestration pathway was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0026] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0027] The primary seed culture was inoculated at a rate of 5% into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% ammonium carbonate aqueous solution (simultaneously providing CO2), aeration rate of 1.5 vvm, and aeration speed controlled in relation to dissolved oxygen: 30% dissolved oxygen for 0-24h, and 15% dissolved oxygen for 24-87h. After 12h of fermentation, a fed-batch process was initiated, with a sugar concentration of 500g / L. The glucose concentration in the fermenter was maintained at 5-10g / L by controlling the flow rate until fermentation was complete.

[0028] After fermentation, the yield of ammonium acetate in the fermentation broth was measured to be 21.36 g / L, and the yield of glucose from ammonium acetate was calculated to be 42.72%.

[0029] The results of Comparative Example 1 and Example 1 show that the recombinant *E. coli* A101 with the introduced carbon sequestration pathway exhibited significantly higher ammonium acetate yield (48.25 g / L) and production rate (96.51%) than the unmodified wild-type strain (21.36 g / L, 42.72%). This demonstrates that the carbon sequestration pathway constructed in this invention has significant advantages in improving acetyl-CoA accumulation and ammonium acetate synthesis efficiency.

[0030] Example 2. Different nitrogen source formulations Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0031] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 15 g / L, corn steep liquor 10 g / L, soybean peptone 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0032] The primary seed culture was inoculated at a rate of 5% into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% ammonium carbonate aqueous solution (simultaneously providing CO2), aeration rate of 1.5 vvm, and aeration speed controlled in relation to dissolved oxygen: 30% dissolved oxygen for 0-24h, and 15% dissolved oxygen for 24-87h. After 12h of fermentation, a fed-batch process was initiated, with a sugar concentration of 500g / L. The glucose concentration in the fermenter was maintained at 5-10g / L by controlling the flow rate until fermentation was complete.

[0033] After fermentation, the ammonium acetate yield was measured to be 69.5 g / L, with a yield of 94.3%.

[0034] Example 3. Different amino acid ratios Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0035] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 10 mM, monosodium glutamate 3 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0036] The primary seed culture was inoculated at a rate of 5% into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% ammonium carbonate aqueous solution (simultaneously providing CO2), aeration rate of 1.5 vvm, and aeration speed controlled in relation to dissolved oxygen: 30% dissolved oxygen for 0-24h, and 15% dissolved oxygen for 24-87h. After 12h of fermentation, a fed-batch process was initiated, with a sugar concentration of 500g / L. The glucose concentration in the fermenter was maintained at 5-10g / L by controlling the flow rate until fermentation was complete.

[0037] After fermentation, the ammonium acetate yield was measured to be 70.2 g / L, with a yield of 94.9%.

[0038] Example 4. Different pH-regulating substances Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0039] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0040] The primary seed culture was inoculated at a rate of 5% into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% sodium carbonate aqueous solution (simultaneously providing CO2), aeration rate of 1.5 vvm, and aeration speed controlled in relation to dissolved oxygen: 30% dissolved oxygen for 0-24h, and 15% dissolved oxygen for 24-87h. After 12h of fermentation, a fed-batch process was initiated, with a sugar concentration of 500 g / L. The glucose concentration in the fermenter was maintained at 5-10 g / L by controlling the flow rate until fermentation was complete.

[0041] After fermentation, the ammonium acetate yield was measured to be 68.3 g / L, with a yield of 93.0%.

[0042] Example 5. Different dissolved oxygen control strategies Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0043] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0044] The primary seed culture was inoculated at a rate of 5% into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% ammonium carbonate aqueous solution (while simultaneously providing CO2), aeration rate 1.5 vvm, and aeration speed controlled in conjunction with dissolved oxygen: dissolved oxygen was maintained at 20% throughout the process. After 12 hours of fermentation, fed-batch feeding began, with a sugar concentration of 500 g / L. The glucose concentration in the fermenter was maintained at 5-10 g / L by controlling the flow rate until fermentation was complete.

[0045] After fermentation, the ammonium acetate yield was measured to be 67.6 g / L, with a yield of 92.1%.

[0046] Example 6. Different feeding start times Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0047] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0048] The primary seed culture was inoculated at a rate of 5% into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% ammonium carbonate aqueous solution (simultaneously providing CO2), aeration rate of 1.5 vvm, and aeration speed controlled in relation to dissolved oxygen: 30% dissolved oxygen for 0-24h, and 15% dissolved oxygen for 24-87h. After 10h of fermentation, a fed-batch process was initiated, with a sugar concentration of 500g / L. The glucose concentration in the fermenter was maintained at 5-10g / L by controlling the flow rate until fermentation was complete.

[0049] After fermentation, the ammonium acetate yield was measured to be 69.8 g / L, with a yield of 94.5%.

[0050] Example 7. Maintenance of different glucose concentrations Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0051] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0052] The primary seed culture was inoculated at a rate of 5% into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% ammonium carbonate aqueous solution (simultaneously providing CO2), aeration rate of 1.5 vvm, and aeration speed controlled in relation to dissolved oxygen: 30% dissolved oxygen for 0-24h, and 15% dissolved oxygen for 24-87h. After 12h of fermentation, a fed-batch process was initiated, with a sugar concentration of 500 g / L. The glucose concentration in the fermenter was maintained at 1-5 g / L by controlling the flow rate until fermentation was complete.

[0053] After fermentation, the ammonium acetate yield was measured to be 70.1 g / L, with a yield of 95.0%.

[0054] Example 8. Different inoculum sizes and ventilation conditions Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0055] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0056] The primary seed culture was inoculated at an 8% inoculation rate into a 5L fermenter containing 3L of fermentation medium. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 by feeding a 20% ammonium carbonate aqueous solution (simultaneously providing CO2), aeration rate of 2 vvm, and aeration speed controlled in relation to dissolved oxygen: 30% dissolved oxygen for 0-24h, and 15% dissolved oxygen for 24-87h. After 12h of fermentation, fed-batch feeding began, with a sugar concentration of 500g / L. The glucose concentration in the fermenter was maintained at 5-10g / L by controlling the flow rate until fermentation was complete.

[0057] After fermentation, the ammonium acetate yield was measured to be 69.2 g / L, with a yield of 93.8%.

[0058] Example 9. Scale-up verification in a 50L fermenter Step 1: Activation of Escherichia coli strains and cultivation of primary seed culture Recombinant Escherichia coli A101 strain, preserved at -80℃, was streaked onto LB solid agar plates and incubated overnight at 37℃. Single colonies were picked and inoculated into LB liquid agar, and cultured at 37℃ with shaking at 200 rpm until OD reached. 600 The concentration was 1.5, resulting in a first-grade seed solution.

[0059] Step 2: Fermentation culture in a fermenter The fermentation medium was prepared with the following composition: glucose 20 g / L, yeast extract 10 g / L, soybean peptone 8 g / L, corn steep liquor 5 g / L, L-aspartic acid 8 mM, monosodium glutamate 5 mM, MgSO4·7H2O 1 g / L, KH2PO4 3 g / L, K2HPO4 3 g / L, and trace element solution 1 mL / L. The medium was sterilized at 121℃ for 20 min.

[0060] The fermentation scale-up was achieved in a 50L fermenter (30L liquid capacity), with three batch replications for validation. Fermentation parameters were controlled as follows: temperature 37℃, pH maintained at 7.0 via a 20% ammonium carbonate aqueous solution (while simultaneously providing CO2), aeration rate of 1.5 vvm, and rotation speed controlled in relation to dissolved oxygen: 30% dissolved oxygen from 0-24h, and 15% dissolved oxygen from 24-87h. After 12h of fermentation, a fed-batch process was initiated with a sugar concentration of 500 g / L. The glucose concentration in the fermenter was maintained at 5-10 g / L by controlling the flow rate until fermentation was complete.

[0061] The yields of ammonium acetate in the three batches were 71.2 g / L, 70.3 g / L, and 71.8 g / L, respectively, with an average yield of 71.1 g / L and an average yield rate of 95.4%. The results indicate that the method of this invention maintains good repeatability and stability even on a large scale.

[0062] In summary, this invention achieves efficient biosynthesis of ammonium acetate by constructing a recombinant *E. coli* A101 with a carbon sequestration pathway, combined with an optimized fermentation medium and refined fermentation control process. Under optimal conditions, the yield of ammonium acetate can reach 70.8 g / L after 87 hours of fermentation, with a yield as high as 95.2%, providing a feasible solution for the green biomanufacturing of ammonium acetate and showing good prospects for industrial application.

Claims

1. A recombinant bacterium that produces ammonium acetate, characterized in that, The recombinant bacteria were obtained by using Escherichia coli as the starting bacteria, knocking out the gene poxB of pyruvate oxidase, the gene pflB of pyruvate formate lyase, and the key subunit aceE of pyruvate dehydrogenase, and overexpressing glyoxylate transaminase Agx1 / BhcA, hydroxyaspartate aldolase Dhaa / BhcC, β-hydroxyaspartate dehydratase BhcB, and iminosuccinate reductase BhcD.

2. The recombinant bacteria according to claim 1, characterized in that, The gene poxB of pyruvate oxidase is shown in SEQ ID NO.1, the gene pflB of pyruvate formate lyase is shown in SEQ ID NO.2, the key subunit aceE of pyruvate dehydrogenase is shown in SEQ ID NO.3, overexpression of glyoxylate transaminase Agx1 / BhcA is shown in SEQ ID NO.5, hydroxyaspartate aldolase Dhaa / BhcC is shown in SEQ ID NO.5, β-hydroxyaspartate dehydratase BhcB and iminosuccinate reductase BhcD are shown in SEQ ID NO.

6.

3. The application of the recombinant bacteria according to claim 1 or 2 in ammonium acetate.

4. A method for preparing ammonium acetate, characterized in that, The method is as follows: Step 1: Activate the recombinant Escherichia coli strain described in claim 1, pick a single colony from the plate and transfer it to LB medium, and culture until the OD600 is between 0.8 and 2.0; Step 2: Inoculate the primary seed culture prepared in Step 1 into a fermenter for fermentation culture for at least 87 hours.

5. The method according to claim 4, characterized in that, In step 2, the inoculation amount of the recombinant Escherichia coli strain is 1%-10%, and the pH is maintained at 6.8-7.

2.

6. The method according to claim 1, characterized in that, The fermentation parameters are an aeration rate of 0.5-3 vvm, with oxygen and carbon dioxide being the aeration sources.

7. The method according to claim 1, characterized in that, . Fermentation parameters: dissolved oxygen 20%-40% for 0-24h; dissolved oxygen 5%-20% for 24-88h.

8. The method according to claim 1, characterized in that, In step 2, the sugar concentration of the feed is 400-600 g / L, the feeding time is 10-14 hours after fermentation, and the feeding method is continuous feeding to maintain a sugar concentration of 1-20 g / L.

9. The method according to claim 1, characterized in that, The organic nitrogen source in the fermentation medium is one or a mixture of several of the following: corn steep liquor, yeast powder, peptone, beef extract, soybean peptone, fish peptone, soybean meal extract, and cottonseed powder, with an addition amount of 1-40 g / L.

10. The method according to claim 1, characterized in that, The amino acids and their derivatives added to the fermentation medium in step 2 are one or a mixture of several of L-aspartic acid, glutamic acid, monosodium glutamate, and monosodium L-aspartate, and the amount added is 1-10 mM.