Intelligent hydrogel for treating skin tissue injury, preparation method and medicine thereof and application thereof

Abstract

The application belongs to the field of biomedical polymer materials and regenerative medicine, and particularly relates to an intelligent hydrogel for treating skin tissue damage, a preparation method and a medicine thereof, and application thereof. The intelligent hydrogel comprises a hydrogel support and a functional module. The hydrogel support takes methacrylated gelatin as a matrix and forms a stable three-dimensional network structure through photo-crosslinking. The functional module comprises two core DNA chains, one of which is a ZnR-Cage chain with a sulfhydryl group directly or indirectly connected to one end of the chain, and the other is a CD44-link chain. The two chains form a non-active assembly through base complementary pairing. The intelligent hydrogel has many advantages such as strong spatiotemporal controllability, overcoming drug burst defects, efficient cascade repair, realizing targeted synergistic treatment, efficient integration, excellent stability and clinical transformation potential. It is particularly suitable for clinical treatment of complex wounds such as diabetic ulcers and infected wounds.

Description

Technical Field

[0001] This invention belongs to the field of biomedical polymer materials and regenerative medicine, specifically relating to a smart hydrogel for treating skin tissue damage, its preparation method, the drug, and its application. Background Technology

[0002] Tissue repair is a multi-stage, highly time-coordinated biological process. Taking skin wound healing as an example, this process sequentially involves four stages: hemostasis, inflammation, proliferation, and remodeling. Each stage relies on the ordered expression of specific signaling molecules under precise spatiotemporal conditions. In the early stage of injury, pro-inflammatory and chemokine-mediated processes accumulate to clear necrotic tissue. During the proliferative phase, the expression of pro-angiogenic factors such as VEGF and PDGF is upregulated, driving the migration and proliferation of endothelial cells, fibroblasts, and keratinocytes. Simultaneously, the neovascularization network coordinates the fate of surrounding cells through paracrine signals. However, current drug delivery strategies typically deliver drugs to the wound at a constant rate, failing to meet the dynamically changing signal requirements of each healing stage: excessive angiogenesis signals in the early stages may exacerbate exudation, while insufficient signals in the later stages of proliferation lead to delayed granulation tissue formation. Therefore, constructing a delivery system that can regulate signal release "on demand" according to the wound healing process, achieving precise spatiotemporal intervention, has become an urgent need in tissue repair research.

[0003] Hydrogels, due to their high water content, tissue-like mechanical properties, and good biocompatibility, have become ideal matrices for constructing functional drug delivery platforms. Methacrylamide gelatin (GelMA) hydrogels not only retain the RGD sequence and matrix metalloproteinase (MMP) hydrolytic sites found in the natural extracellular matrix (ECM), but also possess advantages such as photocrosslinking for in-situ molding and tunable mechanical properties, and have been widely used in tissue repair research. Zhao et al. physically encapsulated pro-angiogenic factors in GelMA hydrogels, achieving sustained release for 14 days and significantly promoting angiogenesis and wound closure in diabetic wounds. However, such release kinetics based on passive diffusion or matrix degradation are predetermined by the intrinsic properties of the material and cannot sense dynamic changes in the wound microenvironment, only achieving "continuous delivery" and failing to meet the requirements of "intelligent delivery." To overcome this limitation, stimulus-responsive elements need to be integrated into the hydrogel platform. However, currently reported pH-responsive, temperature-responsive, and reactive oxygen species (ROS)-responsive systems mostly rely on non-specific physicochemical parameter fluctuations, resulting in insufficient targeting accuracy and signal resolution. Therefore, there is an urgent need to develop an exogenous response controlled release platform with higher specificity and functional correlation.

[0004] The development of DNA nanotechnology has provided novel molecular tools for realizing these needs. Leveraging the high predictability and programmability of Watson-Crick base pairing, DNA molecules can be precisely designed into nanodevices with specific structures and functions, including molecular switches, logic gates, and catalytic machines. Within this framework, deoxyribozymes (DNAzymes) exhibit unique advantages. DNAzymes not only possess protease-level catalytic activity and high selectivity for specific metal ion cofactors, but also retain the inherent chemical stability, low immunogenicity, and ease of synthesis and modification of DNA materials. Using Zn... 2+ Taking DNA-dependent enzymes as an example, their catalytic core can specifically recognize Zn. 2+ This leads to conformational activation, which in turn catalyzes site-directed cleavage of the substrate chain. This metal-ion-dependent conformational switching property makes DNAzymes ideal signal response elements for constructing stimulus-responsive controlled release systems. In recent years, several studies have used DNAzymes for metal ion sensing and molecular logic operations, and have preliminarily explored their application in drug controlled release. However, the functional integration of DNAzyme responsiveness with nucleic acid effector molecules with well-defined therapeutic functions (such as CD44 nucleic acid agonists) and the realization of Zn on a three-dimensional biomaterial platform remains a significant challenge. 2+ On-demand activation of the response has not yet been reported. CD44, as the main receptor for hyaluronic acid, plays a crucial role in wound repair networks by simultaneously regulating keratinocyte migration, fibroblast proliferation, and endothelial cell lumen formation through its signaling pathway. Using CD44 nucleic acid agonists as effector molecules holds promise for achieving synergistic regulation of multiple repair-related cell types. Summary of the Invention

[0005] To address the three core limitations of existing hydrogel wound repair materials: low physical embedding and loading efficiency of active factors and susceptibility to non-specific leakage (burst release); insufficient specificity and sensitivity of traditional stimulus-response systems in recognizing wound microenvironment signals; and the difficulty for single-functional materials to dynamically adjust repair strategies according to the multi-stage "proliferation-remodeling" process of wounds, this invention constructs a Zn... 2+ -GelMA smart hydrogels are designed to enable the spatiotemporally controlled release of bioactive signals to synergistically drive cascaded repair across multiple cell types.

[0006] This invention is the first to construct a Zn 2+ Responsive intelligent controlled-release smart hydrogel (Zn 2+ GelMA (GelMA-based) is used for precise treatment of skin tissue damage. This smart hydrogel uses GelMA hydrogel as a three-dimensional functional carrier, loads a CD44 nucleic acid agonist (CD44-link) as a therapeutic effector molecule, and integrates Zn... 2+Responsive DNAzymes serve as core signal response elements, see Figure 1 Specifically, this invention first utilizes DNA self-assembly technology to hybridize CD44-link with a complementary hanging chain (ZnR-Cage) to form an inactive complex; subsequently, through click chemistry, this complex is covalently anchored in a GelMA hydrogel network, placing the effector molecules in a protected "silent" state; when Zn 2+ In its presence, DNAzyme triggers a specific cleavage reaction, releasing a biologically active CD44 agonist, thereby completing a cascade response process of "signal input-activation-effect output". This invention validated the smart hydrogel from four aspects: construction, in vitro response, cell function regulation, and in vivo repair effects. The results show that this smart hydrogel can utilize Zn... 2+ This invention precisely regulates the release of CD44 nucleic acid agonists through a dependent mechanism, effectively enhancing cell proliferation and migration, and accelerating angiogenesis and wound re-epithelialization. In summary, this invention provides a new strategy and paradigm for the design of stimulus-responsive drug delivery and intelligent tissue repair materials.

[0007] This invention first provides a smart hydrogel for treating skin tissue damage, wherein the smart hydrogel is Zn. 2+ responsive hydrogel Zn 2+ -GelMA, the smart hydrogel includes a hydrogel scaffold and a functional module. The hydrogel scaffold uses methacrylamide gelatin (GelMA) as a matrix and forms a stable three-dimensional network structure through photocrosslinking. The functional module contains two core DNA strands. One DNA strand is a ZnR-Cage strand with thiol groups directly or indirectly attached to one end of the ZnR-Cage strand as shown in SEQ ID NO.1. The other DNA strand is a CD44-link strand as shown in SEQ ID NO.2. The CD44-link strand is a 46bp long CD44-targeting agonist strand containing a CD44 nucleic acid agonist, which is the 1st to 30th bases from the 5' end of the CD44-link strand. The ZnR-Cage strand and the CD44-link strand form an inactive assembly through complementary base pairing.

[0008] SEQ ID NO.1: CAGGTAACGTAGTTGAGCTGTCGTCCC;

[0009] SEQ ID NO. 2: TTGGGACGGTGTTAAACGAAAGGGGACGACGTTGAAGCGTT ACCTG.

[0010] In this invention, the ZnR-Cage is a 27bp long Zn2+ The term "deoxyribonuclease-dependent blocking chain" means that ZnR-Cage can effectively block CD44-link, thereby blocking the activity of CD44-link.

[0011] In this invention, the first to sixth bases starting from the 3' end in SEQ ID NO.1 are complementary to the third to eighth bases starting from the 5' end in SEQ ID NO.2, and the first to ninth bases starting from the 5' end in SEQ ID NO.1 are complementary to the first to ninth bases starting from the 3' end in SEQ ID NO.2.

[0012] The smart hydrogel described in this invention does not need to include fluorescent groups and quenching groups such as FAM and BHQ1.

[0013] The present invention also provides a method for preparing the smart hydrogel as described above, comprising: step A, mixing a solution containing ZnR-Cage chains and a solution containing CD44-link chains in equal molar amounts, and incubating at a temperature above 37°C for a period of time, wherein the two chains complement each other to form an assembly solution, i.e., the functional module; step B, preparing a LAP reservoir and a GelMA precursor solution containing LAP, and heating in the dark to fully dissolve the freeze-dried GelMA sponge; both the GelMA precursor solution containing LAP and the assembly solution are filtered through a sterile filter membrane for sterilization, and the two are fully mixed, and photopolymerization is initiated by ultraviolet light irradiation to obtain the smart hydrogel.

[0014] In one specific embodiment, the solutions described in step A are all PBS solutions, and the assembly solution is obtained by incubation at 37°C for more than 2 hours.

[0015] In one specific embodiment, in step B, a LAP stock solution is first prepared using PBS, and then the GelMA lyophilized sponge is added to the LAP stock solution and fully dissolved to obtain a GelMA precursor solution containing LAP; or, a LAP stock solution is first prepared using PBS, and the GelMA lyophilized sponge is dissolved using PBS, and then the two are mixed to fully dissolve the GelMA lyophilized sponge to obtain the GelMA precursor solution containing LAP; the concentration of LAP in the LAP stock solution is 0.1~0.5%, and the concentration of GelMA in the GelMA precursor solution containing LAP is 5~15%, all percentages being mass to volume ratios; the temperature for light-protected heating is 60~70℃, and the time is 20~30min; the pore size of the sterile filter membrane is 0.2~0.25μm, and it is sterilized by hot filtration; the wavelength of the ultraviolet light for photopolymerization is 400~410nm, and the ultraviolet light irradiation time is 20~40s.

[0016] In this invention, both the ZnR-Cage chain and the CD44-link chain are commercially available, as are the GelMA freeze-dried sponge and LAP. The GelMA freeze-dried sponge is a white to off-white porous sponge-like solid, and the LAP is a white to pale yellow powder.

[0017] The present invention also provides a drug comprising the smart hydrogel as described above or the smart hydrogel prepared by the preparation method as described above, and further comprising Zn-containing... 2+ Compounds.

[0018] In one specific implementation, the Zn-containing 2+ The compound is ZnCl2.

[0019] The present invention also provides an application of the drug as described above, characterized in that the smart hydrogel Zn 2+ - GelMA is placed on the site of skin injury in humans or animals, and starting from day 2 to 4 after the skin injury, Zn-containing hydrogels are dripped around the site of injury. 2+ HEPES buffer, wherein HEPES is (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid).

[0020] This invention provides a Zn based on the combination of DNA nanotechnology and biomacromolecules. 2+ -GelMA hydrogel. This hydrogel consists of a three-dimensional GelMA network and a precisely responsive Zn... 2+ It targets the functional modules of the CD44 receptor and achieves spatiotemporally controlled drug release through a "latch-unlock" mechanism. Compared with existing drug delivery or vascularization modulation tools, this invention has the following beneficial effects.

[0021] 1. Strong spatiotemporal controllability, overcoming the defects of drug burst release: This invention utilizes Zn 2+ DNAzymes, acting as molecular switches, enable the production of Zn-dependent molecules. 2+ Phased and precise drug release driven by increased concentration. Compared with traditional free drug or physically mixed gels, this smart hydrogel significantly inhibits the initial burst release behavior of drugs, enabling on-demand release at specific time points (such as after the inflammation period of the wound), demonstrating excellent spatiotemporal controllability.

[0022] 2. Highly efficient cascaded repair for targeted and synergistic treatment: The CD44 nucleic acid agonist released by this smart hydrogel can specifically activate the downstream PI3K / AKT and Ras / MAPK signaling pathways of CD44, simultaneously inducing angiogenesis and endothelial cell migration, thereby efficiently promoting wound healing. Compared with traditional non-targeted drugs, this cascaded repair mechanism significantly improves the therapeutic effect, achieving an integrated synergistic effect of "release-activation-repair".

[0023] 3. Highly efficient integration and excellent stability, with potential for clinical translation: Through a click chemistry reaction of thiols-acrylates, the nucleic acid functional module (ZnR-Cage) is non-destructively covalently anchored within the GelMA hydrogel network. This anchoring method not only ensures high-efficiency loading of the functional module but also endows the smart hydrogel with excellent resistance to enzymatic degradation and long-term storage stability. Based on these characteristics, this smart hydrogel can be developed into a smart wound dressing, particularly suitable for the clinical treatment of complex wounds such as diabetic ulcers and infected wounds. Attached Figure Description

[0024] Figure 1 Zn 2+ -Structure of GelMA hydrogel and its Zn 2+ A schematic diagram of the mechanism by which CD44 agonists are released in response.

[0025] Figure 2 This is a schematic diagram of ZnR-Cage covalently grafted onto GelMA hydrogel via a click reaction of mercapto-acrylate.

[0026] Figure 3 For functional modules, Zn 2+ The diagram shows the response and cutting efficiency verification. Figure 3 In this context, 'a' represents Zn. 2+ A schematic diagram illustrating the mechanism of the response release function; Figure 3 b represents different Zn 2+ Cutting efficiency curve at different concentrations.

[0027] Figure 4 This is a schematic diagram of the assembly of the polyacrylamide gel electrophoresis analysis functional module and the zinc ion response dissociation characteristics.

[0028] Figure 5 Zn in GelMA hydrogel for functional modules 2+ Response release kinetics diagram.

[0029] Figure 6 Zn 2+ - A schematic diagram illustrating the targeted recognition capability of the GelMA system for HUVECs.

[0030] Figure 7 Zn 2+-The GelMA system activates the CD44 downstream signaling pathway. The results of Western blot analysis of protein signals in different treatment groups are shown in the figure.

[0031] Figure 8 Zn 2+ - Schematic diagram of the promoting effect of GelMA-released CD44 nucleic acid agonist on HUVEC proliferation. In the diagram, a is the fluorescent staining image of cell proliferation in different groups, with blue representing cell nuclei (DAPI staining, i.e., nuclear counterstaining agent), green representing proliferating cells, and the fusion image is a combined image of the two; b is the statistical result of cell proliferation rate in each group.

[0032] Figure 9 Zn 2+ - Schematic diagram of the promoting effect of GelMA system on in vitro angiogenesis of HUVECs. Where a is a representative microscopic image, b is the relative number of branch points (nodes) statistics, and c is the total length of the main tube (total length) statistics.

[0033] Figure 10 Zn 2+ - A schematic diagram illustrating the dynamic process by which the GelMA system promotes skin wound healing in mice. Figure 10 Image a shows macroscopic photographs of wound healing in each group (0, 4, 7, 10, and 14 days). Figure 10 Figure b shows a quantitative comparison of wound healing rates.

[0034] Figure 11 Zn 2+ - Schematic diagram of the promoting effect of the GelMA system on histological remodeling after skin wound healing. Figure 11 Image a shows representative H&E staining and Masson trichrome staining images of wound tissue from each group on postoperative day 14. Figure 11 b represents the quantitative analysis of epidermal thickness; Figure 11 In the figure, c represents the quantitative analysis of the collagen deposition area.

[0035] Figure 12 Zn 2+ - Schematic diagram of how the GelMA system promotes new blood vessel formation in wounds. Figure 12 Image a in the middle is a representative CD31 immunofluorescence staining image. Figure 12 b represents the corresponding quantitative result. Detailed Implementation

[0036] In this invention, a free thiol group (-SH) is introduced at the 5' end of the ZnR-Cage. During the photocrosslinking process, this thiol group undergoes a highly efficient Michael addition reaction with the residual methacryloyl group (C=C) in the GelMA network, forming a stable covalent thioether bond. This invention constructs a ZnR-Cage with zinc ions (ZnR-Cage) based on the Michael addition reaction. 2+A responsive smart hydrogel for wound repair. This smart hydrogel uses methacrylamide gelatin (GelMA) as a three-dimensional hydrogel scaffold and Zn... 2+ Using DNAzyme-dependent deoxyribonuclease as the core signal response element and CD44 nucleic acid agonist as the therapeutic effector molecule, a spatiotemporally controlled delivery of wound repair signals is achieved through a "spatial latch-intelligent unlock" strategy.

[0037] This invention uses Zn 2+ The specific catalytic shearing effect of DNAzyme-dependent deoxyribonuclease is introduced into smart hydrogels, Zn 2+ By specifically coordinating with the DNAzyme catalytic core, the catalytic core is induced to change from an inactive closed conformation to an active open conformation, thus constructing a high-fidelity signal conversion link from "exogenous chemical instructions" to "endogenous biological effects".

[0038] The cutting reaction kinetics of this invention can be achieved through exogenous Zn. 2+ The concentration and timing of administration are precisely tuned to match the release rate and total dose of the active CD44 agonist to clinical treatment needs.

[0039] Figure 1 Zn 2+ -Structure of GelMA hydrogel and its Zn 2+ A schematic diagram illustrating the mechanism by which CD44 agonists are released in response. Zn 2+ Triggered shearing releases activated CD44 agonists (CD44 nucleic acid agonists). The enlarged image in the lower right corner shows the process by which the inactive agonist is converted into its active form after being broken at the cleavage site.

[0040] Further verification was conducted to determine whether ZnR-Cage could be efficiently covalently grafted onto GelMA hydrogel via a mercapto-acrylate click chemistry reaction, wherein the ZnR-Cage is Zn 2+ A responsive DNAzyme-effectant complex. Therefore, a rigorous control experiment was designed.

[0041] Figure 2 This diagram illustrates the covalent grafting of ZnR-Cage onto GelMA hydrogel via a thiol-acrylate click reaction. The thiol (-SH) groups modified at the ends of the ZnR-Cage undergo a click reaction with the acrylate groups on the GelMA backbone, achieving covalent coupling. For example, modules of CD44 nucleic acid agonists are pre-assembled onto the ZnR-Cage through base complementarity pairing and are immobilized together with the ZnR-Cage within the hydrogel matrix. Figure 2The left and middle columns show the reaction of ZnR-Cage with terminal thiol (-SH) groups with GelMA as the experimental group (middle column), and unmodified ZnR-Cage as the control group (left column). FAM fluorescence labeling results showed that only the -SH-modified group exhibited significant fluorescence signals in the hydrogel, while no obvious fluorescence retention was observed in the control group. This confirms that the covalent anchoring of ZnR-Cage in GelMA strictly depends on the thiol-acrylate click reaction, and that this coupling method is highly specific and efficient. Furthermore, the introduction of a CD44 nucleic acid agonist carrying a BHQ1 quenching group (CD44-link) significantly weakened the fluorescence signal (see [reference]). Figure 2 The right column shows that the CD44 nucleic acid agonist has been effectively encapsulated in the hydrogel matrix by ZnR-Cage through base complementarity pairing; the spatial proximity of FAM and BHQ1 induces fluorescence resonance energy transfer (FRET) quenching, thereby achieving precise locking of functional molecules.

[0042] To verify the effect of the functional module (the hybridization complex of ZnR-Cage and CD44-link) on Zn 2+ To assess response sensitivity and cutting efficiency, this invention designs an in vitro fluorescence response experiment.

[0043] Figure 3 For functional modules, Zn 2+ The diagram shows the response and cutting efficiency verification. Figure 3 In this context, 'a' represents Zn. 2+ A schematic diagram illustrating the mechanism of the response release function; Figure 3 b represents different Zn 2+ Cutting efficiency curve at different concentrations.

[0044] Figure 3 In this process, the 3' end of ZnR-Cage is labeled with a FAM fluorescent group, and the 5' end of CD44-link is labeled with a BHQ1 quenching group. After hybridization, the FAM fluorescence is effectively quenched by BHQ1. When Zn 2+ After DNAzyme-catalyzed cleavage is activated, the blocked fragment carrying BHQ1 dissociates from the CD44-link, and FAM fluorescence is restored. The increase in fluorescence intensity directly reflects the cleavage efficiency (cleavage rate). Based on the above principle, different concentrations of Zn were monitored. 2+ Dynamic changes in fluorescence signals under (0.2, 1, 2, and 20 mM) conditions. The results showed that the fluorescence intensity of each concentration group increased with increasing incubation time, with the 1 mM Zn group showing the highest intensity. 2+ The group with the fastest fluorescence recovery rate indicates that the catalytic cleavage efficiency of the DNAzyme reaches its peak at this concentration.

[0045] Example 1

[0046] This embodiment uses Zn2+ responsive hydrogel Zn 2+ - Preparation of GelMA hydrogel.

[0047] Polyacrylamide gel electrophoresis was used to further confirm the successful assembly of the functional module and its zinc ion response characteristics.

[0048] Figure 4 This is a schematic diagram of the assembly of the polyacrylamide gel electrophoresis analysis functional module and the zinc ion response dissociation characteristics. Figure 4 Lane 1: ZnR-Cage single chain; Lane 2: CD44-link single chain; Lane 3: The functional module formed by the hybridization of the two shows a clear high molecular weight band in lane 3, and its migration rate is significantly lower than that of each single chain component, indicating that the functional module has been successfully constructed; Lane 4: Functional module complex + 1mM Zn 2+ After incubation, the functional module dissociated, and the ZnR-Cage and CD44-link bands reappeared, confirming that the functional module has the ability to controllably dissociate by zinc ions. Figure 4 The results show that the functional module can be successfully assembled and respond to Zn. 2+ Controlled dissociation occurs.

[0049] Based on the confirmation of the solution-responsive release of the functional modules, we systematically studied its release kinetics in the hydrogel system.

[0050] Figure 5 Zn in GelMA hydrogel for functional modules 2+ Response release kinetics diagram. Figure 5 In the middle, during 0-3 days without Zn 2+ During the incubation period, the CD44-link release rate remained low in both the experimental and control groups, indicating that this functional module exhibits good sealing stability within the hydrogel. On day 3, 1 mM Zn was introduced. 2+ After adding zinc chloride to the HEPES buffer, the release rate in the experimental group increased significantly within 24 hours, eventually reaching approximately 78.19%. HEPES stands for 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid. HEPES buffer is mainly used in cell culture, biochemical experiments, and other scenarios requiring high pH stability. The release curve exhibited a three-stage characteristic of "delayed trigger - rapid release - plateau maintenance," which met the design expectations. However, the reason why the release plateau did not reach 100% may be that the functional module was embedded in the dense region of GelMA, leading to a decrease in the release rate of Zn. 2+ Diffusion limitations and the irreversibility of DNAzyme-catalyzed cleavage restrict the total release. However, a release rate of approximately 78% is sufficient to initiate the CD44 signaling cascade.

[0051] In this embodiment, Zn 2+ responsive hydrogel Zn2+ The preparation of GelMA hydrogels includes the following steps and contents.

[0052] 1. Stepwise assembly and release of functional modules: To verify the stepwise assembly and release of functional modules, this invention uses non-denaturing PAGE for characterization. Single-stranded oligonucleotides were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0053] The single-chain oligonucleotides include ZnR-Cage as shown in SEQ ID NO.1 and CD44-link as shown in SEQ ID NO.2. The single-chain oligonucleotides also include free CD44 nucleic acid agonists, namely Apt-CD44, Apt-CD44 (FAM), CD44-link (FAM), CD44-link (BHQ1), ZnR-Cage (FAM), ZnR-Cage (SH,FAM), and ZnR-Cage (SH,BHQ1). Apt-CD44 is the 1st to 30th base from the 5' end of CD44-link. Apt-CD44 (FAM) is formed by attaching FAM to one end (preferably the 5' end) of Apt-CD44. CD44-link (FAM) is formed by attaching FAM to one end (preferably the 5' end) of CD44-link. (BHQ1) is a ZnR-Cage connected to one end (preferably the 5' end) of the CD44-link. (FAM) is a ZnR-Cage connected to one end (preferably the 3' end). (SH,FAM) is a ZnR-Cage connected to one end (preferably the 3' end) of the ZnR-Cage and to HS-C6 (preferably the 5' end) at the other end. (SH,BHQ1) is a ZnR-Cage connected to one end (preferably the 3' end) of the ZnR-Cage and to HS-C6 (preferably the 5' end) at the other end. SEQ ID NO.1 to SEQ ID NO.3 are sequences from the 5' end to the 3' end.

[0054] SEQ ID NO. 1: CAGGTAACGTAGTTGAGCTGTCGTCCC.

[0055] SEQ ID NO. 2: TTGGGACGGTGTTAAACGAAAGGGGACGACGTTGAAGCGTT ACCTG.

[0056] All oligonucleotides were purified by HPLC and dissolved in 1×PBS (pH 7.4) to prepare a 10 μM working solution, which was stored at 4 °C for later use. Equimolar amounts of ZnR-Cage and CD44-link chains were mixed and incubated at 37 °C for 2 h to form ZC-CD44 assemblies; subsequently, 1 mM Zn was added. 2+ The solution was incubated for another 30 minutes. 1 μL of sample was mixed with 1 μL of 10× DNA loading buffer and 8 μL of PBS to form a 10 μL system. This mixture was then loaded onto a 12% non-denaturing PAGE (polyacrylamide gel electrophoresis) gel and electrophoresed at 120V for 60 minutes in 1×TBE buffer. After electrophoresis, the gel was rinsed three times with deionized water, stained with GelRed in the dark for 20 minutes, and images were acquired using a gel imaging system. (See...) Figure 4 )

[0057] The preparation process of the smart hydrogel described in this invention does not require the addition of Zn. 2+ Solution; in Example 1 Figure 4 The corresponding experiment used 1mM Zn 2+ The solution is a confirmatory condition used to demonstrate that the assembly formed by the ZnR-Cage chain and the CD44-link chain can be converted by Zn. 2+ Specific cutting.

[0058] 2. Zn 2+ - Preparation of GelMA hydrogel: A 10% (w / v) LAP-containing GelMA precursor solution was prepared under sterile conditions.

[0059] First, a 0.25% (w / v) LAP stock solution was prepared using PBS: 20 mL of PBS was added to a brown bottle containing LAP, and the solution was heated at 40-50°C in the dark for 15 min with intermittent shaking until completely dissolved. The LAP was the photoinitiator lithium phenyl-2,4,6-trimethylbenzoylphosphine. The LAP stock solution was a high-concentration stock solution prepared by pre-dissolving the photoinitiator LAP in a solvent for subsequent experiments. Then, a lyophilized GelMA sponge was weighed into a brown centrifuge tube, and the LAP stock solution was added. The solution was heated at 60-70°C in the dark for 20-30 min with intermittent shaking until fully dissolved. While still hot, the solution was filtered through a 0.22 μm sterile filter to obtain a sterile GelMA precursor solution containing LAP, with a GelMA concentration of 10% (w / v). This solution was stored at 4°C in the dark for later use. The pre-assembled functional module was thoroughly mixed with the LAP-containing GelMA precursor solution, and then irradiated with 405 nm light for 30 s to initiate photopolymerization, thereby obtaining Zn. 2+ -GelMA hydrogel.

[0060] 3. Zn 2+ -Zn GelMA hydrogel 2+Responsive release: Monitoring Zn using the fluorescence quenching-dequenching effect between FAM and BHQ1. 2+ Triggered CD44 nucleic acid agonist release. FAM and BHQ1 are a commonly used fluorescent donor-quencher combination, with FAM as the fluorescent group and BHQ1 as the quencher group. Zn 2+ - GelMA hydrogels were placed in HEPES buffer (50 mM HEPES, 100 mM NaCl, 5 mM MgCl2, pH 7.4) and incubated at 37 °C. Fluorescence intensity was monitored over time at an excitation wavelength of 488 nm and an emission wavelength of 525 nm (Ex / Em: 488 / 525 nm) using a fluorescence spectrometer to assess the release kinetics of the CD44 nucleic acid agonist. (See...) Figure 5 )

[0061] Example 2

[0062] This embodiment uses Zn 2+ - Validation of the in vitro biological functions of the GelMA system.

[0063] First, to verify Zn 2+ Zn after triggering 2+ To investigate whether the GelMA system can effectively activate CD44 receptor targeting recognition, this invention uses human umbilical vein endothelial cells (HUVECs) with high CD44 expression as an in vitro model to conduct a series of experiments. HUVECs were then reacted with equal concentrations of FAM-labeled Zn... 2+ -GelMA extract (Zn-free) 2+ ) and Zn 2+ -GelMA extract (concentrated with 1mM Zn) 2+ Pre-triggered co-incubation was performed, followed by imaging analysis using a confocal laser scanning microscope (CLSM).

[0064] The smart hydrogel Zn 2+ -GelMA has an elastic solid network structure with superior mechanical strength compared to conventional gelatin gels, making it less prone to breakage under external forces. This smart hydrogel is not used directly on cells; instead, it is extracted in HEPES buffer containing 1 mM zinc chloride at 37°C for 24 hours to obtain a Zn-modified hydrogel. 2+ Pre-triggered Zn 2+ -GelMA extract.

[0065] Figure 6 Zn 2+ - Schematic diagram of the GelMA system's targeting ability for HUVECs. FAM represents the fluorescent FITC channel labeling name; orange, green, blue, and gray peaks correspond to Zn, respectively. 2+ -GelMA (+), Zn 2+-GelMA (-), Apt-CD44, control group; the image on the right is a fluorescence micrograph of the corresponding group, with a scale bar of 10 μm. The FITC channel refers to the optical detection path in fluorescence detection instruments (such as fluorescence microscopes) specifically used to receive the yellow-green fluorescence signal emitted by fluorescein isothiocyanate (FITC) after excitation.

[0066] The results showed that the untriggered group (Zn) 2+ Only a very weak fluorescence signal was detected on the cell membrane surface treated with ZnR-Cage (-GelMA), indicating that the CD44 nucleic acid agonist was effectively blocked by ZnR-Cage in the resting state, and the system's ability to recognize CD44 was silenced; in contrast, the cell membrane surface treated with ZnR-Cage showed only a very weak fluorescence signal, indicating that the CD44 nucleic acid agonist was effectively blocked by ZnR-Cage in the resting state, and the system's ability to recognize CD44 was silenced; 2+ Zn after triggering 2+ The GelMA group exhibited a strong and uniformly distributed fluorescence signal on the cell membrane, with signal intensity comparable to the positive control group (free CD44 nucleic acid agonist, Apt-CD44); flow cytometry results further confirmed the above observations. Figure 6 In summary, Zn 2+ Induced DNAzyme catalytic cleavage can effectively unblock the CD44 nucleic acid agonist, transforming the system from a low-activity silencing state to a high-activity target-binding state, thereby achieving specific recognition of CD44-overexpressing cells.

[0067] In Zn 2+ After triggering the system, Western blot analysis was used to detect whether binding to the CD44 receptor activated downstream signaling pathways. CD44 is a multifunctional transmembrane adhesion receptor whose signal transduction mainly relies on two core cascade pathways: PI3K / AKT and Ras / MAPK, which regulate biological processes such as cell survival, metabolism, proliferation, and migration, respectively. The PI3K / AKT pathway primarily mediates cell survival and metabolic regulation, while the Ras / MAPK pathway dominates cell proliferation and differentiation. Existing research has confirmed that CD44 nucleic acid agonists can bind to their receptors with high affinity and trigger the phosphorylation cascade of downstream kinases. This mechanism constitutes the molecular basis for nucleic acid agonists regulating tissue repair. In the experiment, HUVECs were treated with equal concentrations of Zn... 2+ -GelMA extract (Zn-free) 2+ ) and Zn 2+ -GelMA extract (concentrated with 1mM Zn) 2+ The pre-triggered treatment lasted 15 minutes, followed by detection of p-AKT and p-ERK protein levels.

[0068] Figure 7 Zn 2+- The GelMA system activated the CD44 downstream signaling pathway. The results of Western blot analysis of protein expression in the signaling pathway in different treatment groups are shown in the figure. The figure shows the expression levels of phosphorylated Akt (i.e., p-Akt(S473)), phosphorylated Erk (i.e., p-Erk), total Erk (i.e., Erk), and the internal reference protein α-tubulin. Figure 7 The results showed that, compared to the untriggered group, Zn 2+ The levels of p-AKT and p-ERK were significantly increased in the GelMA-treated group, indicating that Zn 2+ The triggered release of CD44 nucleotide agonists effectively initiates phosphorylation activation of the PI3K / AKT and Ras / MAPK dual pathways. This result is for Zn 2+ The GelMA system provides upstream signaling mechanisms to support its role in promoting proliferation and migration during tissue regeneration.

[0069] Endothelial cell proliferation is a core driving event in angiogenesis and tissue repair. This study used an EdU488 incorporation assay to quantitatively analyze Zn. 2+ Trigger Zn 2+ -GelMA releases the effect of CD44 nucleic acid agonists on HUVEC proliferation. EdU is a thymidine nucleoside analog, and EdU-488 is a system for conjugation / detection using a 488nm fluorescent dye label.

[0070] Figure 8 Zn 2+ - Schematic diagram of the promoting effect of GelMA-released CD44 nucleic acid agonist on HUVEC proliferation. In figure a, fluorescence staining images of cell proliferation in different groups are shown; blue represents cell nuclei (DAPI staining, i.e., nuclear counterstaining agent), green represents proliferating cells, and the fusion image is a combined image of both. Figure b shows the statistical results of cell proliferation rate in each group. Data are expressed as mean ± standard deviation (n=3), and statistical significance was assessed using one-way ANOVA combined with Tukey's multiple comparison test. **** P<0.0001. Figure 8 Data shows that Zn 2+ After treatment with GelMA extract for 24 hours, the proportion of EdU-positive cells increased by approximately 1.83 times compared to the control group, confirming that Zn 2+ The CD44 nucleic acid agonist that triggers release can effectively induce HUVECs to enter the DNA synthesis phase and significantly promote their proliferation.

[0071] Figure 9 Zn 2+- Schematic diagram of the promoting effect of the GelMA system on in vitro angiogenesis of HUVECs. In the diagram, a represents a representative microscopic image, b shows the relative number of branch points (nodes), and c shows the total length of the main tube. Data are expressed as mean ± standard deviation (n=3), and statistical significance was assessed using one-way ANOVA combined with Tukey's multiple comparison test. **** P<0.0001. Figure 9 Further in vitro angiogenesis experiments show that Zn 2+ -GelMA group (after 1mM Zn) 2+ (Pre-triggered) Induction of HUVECs in Matrigel matrix resulted in a widely distributed, structurally stable, and highly branched capillary-like network, with significantly higher network integrity and complexity than the control group. Matrigel matrix is ​​a basement membrane extract derived from mouse EHS sarcoma (a transplantable soft tissue sarcoma in mice). Quantitative results showed that Zn 2+ -GelMA group (after 1mM Zn) 2+ The pre-triggered branching point count was the highest among all groups, and the total tube length was 2.17 times that of the blank control group. These quantitative indicators, from different perspectives, collectively support the claim that this system can be utilized by Zn. 2+ It triggers the release of CD44 nucleic acid agonists, which efficiently drive endothelial cells to complete the entire angiogenesis cascade, including proliferation and migration to the lumen, and has outstanding pro-angiogenic potential.

[0072] Zn 2+ The in vitro biological function verification of the GelMA system includes the following steps and contents.

[0073] 1. Cell culture: Human umbilical vein endothelial cells (HUVECs) were cultured in ECM medium (endothelial cell culture medium) at 37°C and 5% CO2.

[0074] 2. Validation of CD44 target recognition capability: HUVECs were compared with Zn labeled with equal concentrations of FAM. 2+ -GelMA extract (Zn-free) 2+ ) and Zn 2+ -GelMA extract (concentrated with 1mM Zn) 2+ Pre-triggered co-incubation was performed, and analysis was conducted using confocal laser scanning microscopy (CLSM) and flow cytometry. Results showed: In the non-triggered group, only a very weak fluorescence signal was detected on the cell membrane surface, indicating that the CD44 agonist was in a blocked state; in the triggered group, a strong and uniform fluorescence signal was observed on the cell membrane, with signal intensity comparable to that of the free CD44 nucleic acid agonist (Apt-CD44) (see [link to relevant documentation]). Figure 6 ).

[0075] 3. Downstream signal path activation verification: HUVECs were tested using untriggered and Zn... 2+ Triggered Zn 2+ After treatment with GelMA extract for 15 minutes, the protein levels of p-AKT (phosphorylated activated protein kinase B) and p-ERK (phosphorylated activated extracellular signal-regulated kinase) were detected by Western blot. The results showed that the levels of both p-AKT and p-ERK were significantly increased in the trigger group, indicating that Zn... 2+ Triggered CD44 nucleic acid agonist release can effectively activate the PI3K / AKT and Ras / MAPK dual pathways (see [link]). Figure 7 ).

[0076] 4. Cell proliferation experiment: The EdU488 incorporation assay was used to evaluate Zn. 2+ The effect of GelMA on HUVEC proliferation. The results showed that Zn 2+ After treatment with GelMA extract for 24 hours, the proportion of EdU-positive cells increased by approximately 1.83 times compared to the control group, indicating that Zn 2+ The triggered release of CD44 nucleic acid agonists can effectively promote the proliferation of HUVECs (see [link]). Figure 8 ).

[0077] 5. In vitro angiogenesis experiment: HUVECs were seeded in Matrigel matrix and co-incubated with different treatment groups. Results showed that Zn 2+ - The GelMA group induced HUVECs to construct a widely distributed, structurally stable, and highly branched capillary-like network, with the highest relative number of branch points among all groups, and the total length of the capillary was 2.17 times that of the blank control group (see...). Figure 9 ).

[0078] Example 3

[0079] This embodiment uses Zn 2+ - Validation of the in vivo wound healing effect of the GelMA system.

[0080] First, further validation of Zn at the animal level. 2+ - In vivo wound repair effect of GelMA hydrogel. This invention uses a C57BL / 6 mouse full-thickness skin defect model: a standardized full-thickness wound with a diameter of 10 mm is prepared on the back of the mouse to simulate the pathological process of clinical full-thickness skin defects. After modeling, the mice are randomly divided into three groups (n=3 / group), receiving PBS (blank control), GelMA (material control), and Zn, respectively. 2+ - GelMA local wound coverage treatment. The wound healing process of each group was continuously recorded.

[0081] Figure 10 Zn2+ - A schematic diagram illustrating the dynamic process by which the GelMA system promotes skin wound healing in mice. Figure 10 Image a shows macroscopic photographs of wound healing in each group (0, 4, 7, 10, and 14 days). Figure 10 Figure b shows a quantitative comparison of wound healing rates. Data are expressed as mean ± standard deviation (n=3), and statistical significance was assessed using one-way ANOVA combined with Tukey's multiple comparison test. **** P<0.0001.

[0082] Figure 10 The results showed that Zn 2+ The wound contraction rate in the GelMA-treated group was significantly better than that in the PBS and GelMA groups at all time points. Quantitative analysis showed that on day 7 of treatment, Zn 2+ The wound closure rate in the GelMA-treated group reached 80.53%; among which, the Zn 2+ -The GelMA treatment group uses the following method: intelligent hydrogel Zn 2+ - GelMA was applied to the wounds of mice. Starting from day 3 post-treatment, HEPES buffer containing zinc chloride was dropped onto the edge of the smart hydrogel to maintain Zn. 2+ The continuous triggering release. In comparison, the wound closure rate was 64.6% in the PBS control group and 50.1% in the ordinary GelMA control group (P<0.0001); by day 14, Zn 2+ - In the GelMA group, wound closure was almost complete (99.5%), while in the GelMA group it was 91.9%, with approximately 8.9% of the wound area still not fully epithelialized. It is worth noting that Zn... 2+ -The wound in the GelMA group closed on day 3 (i.e., Zn). 2+ A clear rate inflection point is observed before and after the application of the node: previously, the closed curves of each group are nearly parallel, and thereafter Zn 2+ The closure rate was significantly accelerated in the GelMA group, a phenomenon highly consistent with the "delayed trigger-rapid release" characteristic of in vitro release kinetics. This further corroborates the findings of Zn. 2+ The triggered release of CD44 nucleic acid agonists is a key factor driving accelerated healing.

[0083] All mice were sacrificed on day 14, and the wounds and surrounding skin tissue were collected for histological analysis. Orderly regeneration of the extracellular matrix (ECM) is the structural basis for the skin to restore its protective barrier function.

[0084] Figure 11 Zn 2+ - Schematic diagram of the promoting effect of the GelMA system on histological remodeling after skin wound healing. Figure 11Image a shows representative H&E staining and Masson trichrome staining images of wound tissue from each group on postoperative day 14. Figure 11 b represents the quantitative analysis of epidermal thickness; Figure 11 In Figure 'c', the quantitative analysis of collagen deposition area is presented. Hematoxylin and eosin staining (H&E staining) stained the cell nucleus purple-blue with hematoxylin, and the cytoplasm and connective tissue pink with eosin. Masson's trichrome staining is a special histological staining method using hematoxylin-pounose-aniline blue to stain the cell nucleus purple, muscle cells / cytoplasm red, and collagen fibers blue. Data are expressed as mean ± standard deviation (n=3). Statistical significance was assessed using one-way ANOVA combined with Tukey's multiple comparison test. **** P<0.0001.

[0085] Figure 11 In the study, hematoxylin-eosin (H&E) staining results showed that Zn 2+ - In the GelMA-treated group, the wound had formed a complete functional healing epidermis with moderate thickness and continuous structure, and the stratum corneum was fully covered. Hair follicles and sebaceous glands in the dermis were evenly distributed and resembled normal skin in morphology, indicating that this system not only promoted wound closure but also stimulated the regeneration of skin appendages. In contrast, the newly formed epithelium in the PBS group was thin and discontinuous, and although the GelMA group had some epidermal coverage, no significant regeneration of appendages was observed. Figure 11 (a) Quantitative analysis of epidermal thickness further revealed its dynamic evolution characteristics: by day 14, Zn 2+ - The epidermal thickness in the GelMA-treated group returned to normal levels, while the control group still showed pathological thickening. Figure 11 b) indicates that Zn 2+ -GelMA-mediated repair processes exhibit both acceleration and ordered structural characteristics. Masson staining further assessed collagen fiber deposition and arrangement, revealing Zn... 2+ - In the GelMA-treated group, collagen deposition in the wound area was significantly enhanced, and the collagen fibers tended to be arranged in an orderly bundle structure, approaching the tissue characteristics of normal skin. Figure 11 (a) Quantitative analysis confirmed Zn 2+ - The collagen deposition level in the GelMA-treated group was significantly higher than that in the PBS and GelMA groups, indicating that ECM remodeling had been successfully completed. Figure 11 (c) The orderly deposition and arrangement of collagen not only restores the mechanical integrity of the skin, but also provides a normalized microenvironment for the subsequent maintenance of stromal cell function.

[0086] Neovascularization is another crucial step in wound healing. The morphological characteristics of new blood vessels in granulation tissue were assessed using CD31 immunofluorescence staining.

[0087] Figure 12 Zn2+ - Schematic diagram of how the GelMA system promotes new blood vessel formation in wounds. Figure 12 Image a in the middle is a representative CD31 immunofluorescence staining image. Figure 12 b represents the corresponding quantitative result. Data are expressed as mean ± standard deviation (n=3), and statistical significance was assessed using one-way ANOVA combined with Tukey's multiple comparison test. **** P<0.0001. Figure 12 In the image above, DAPI staining (nuclear counterstain) stains the cell a blue, and CD31 staining stains it red. The next row is a magnified view of the image above.

[0088] Figure 12 The data in the image shows that after 14 days of treatment, Zn... 2+ The CD31-positive vascular structure and microvascular density were significantly increased in the GelMA-treated group. Figure 12 Quantitative analysis of Znb showed that Zn 2+ The CD31 fluorescence signal intensity (i.e., its expression level) in the GelMA group was 1.68 times that in the GelMA-treated group. These results indicate that the expression level of CD31 in the GelMA-treated group was significantly higher than that in the GelMA-treated group. 2+ The released CD44 nucleic acid agonist can effectively activate the PI3K / AKT and Ras / MAPK signaling pathways in vivo, thereby promoting the budding, migration and luminal maturation of vascular endothelial cells.

[0089] Zn 2+ The verification of the in vivo wound healing effect of the GelMA system includes the following steps and contents.

[0090] 1. Animal Model Establishment: Male C57BL / 6 mice (weighing 20-25g) were used to establish a full-thickness skin defect model on the back (10mm in diameter). Mice were randomly divided into three groups: PBS control group (wound treated with PBS buffer); GelMA group (wound treated with GelMA hydrogel); and Zn... 2+ -GelMA group: Zn applied to the wound 2+ -GelMA hydrogel treatment.

[0091] 2. Observation of wound healing progress: The wound healing progress of each group was continuously recorded until day 14. Results showed: Zn 2+ -The wound contraction rate in the GelMA group was significantly better than that in the PBS group and the GelMA group at all time points; Day 7: Zn 2+ - The wound closure rate in the GelMA group reached 80.53%, significantly higher than that in the PBS group (64.6%) and the GelMA group (50.1%); Day 14: Zn 2+ - The wound closure rate was almost completely achieved in the GelMA group (99.5%), compared to 91.9% in the GelMA group (see [link to other documentation]). Figure 10It is worth noting that Zn 2+ -The wound in the GelMA group closed on day 3 (i.e., Zn). 2+ The rate exhibits a clear inflection point before and after the application of the node, which is highly consistent with the "delayed triggering-rapid release" characteristic in in vitro release kinetics.

[0092] 3. Histological analysis: On day 14 of treatment, wound tissue was taken for H&E staining and Masson's trichrome staining. Results showed: H&E staining: Zn 2+ - The GelMA group showed a significant increase in epidermal thickness and the highest degree of re-epithelialization; Masson staining: Zn 2+ - The collagen fibers in the GelMA group were more densely and orderly arranged, and the collagen deposition area was significantly higher than that in other groups (see...). Figure 11 ).

[0093] 4. Angiogenesis Analysis: CD31 immunofluorescence staining was used to quantitatively analyze the new blood vessels in the granulation tissue of the wound. Results showed that 14 days after treatment, Zn... 2+ -In the GelMA group, the granulation tissue of the wound showed abundant CD31-positive vascular structures and a significantly increased number of small vessels. (See also...) Figure 12 ).

[0094] In summary, the Zn provided by this invention 2+ The -GelMA hydrogel system covalently grafts ZnR-Cage onto GelMA hydrogel via a thiol-acrylate click reaction, and loads the CD44 nucleic acid agonist through base complementarity pairing. This system utilizes Zn... 2+ In its presence, it releases CD44 nucleic acid agonists through DNAzyme-catalyzed cleavage, activating the PI3K / AKT and Ras / MAPK signaling pathways, promoting endothelial cell proliferation, migration, and angiogenesis, ultimately significantly accelerating wound healing and improving the histological quality of the healed tissue, namely re-epithelialization and orderly collagen deposition.

[0095] In summary, this invention provides a smart hydrogel that regulates cascade repair and angiogenesis, the smart hydrogel being named Zn. 2+ -GelMA, this smart hydrogel mainly consists of two parts: a hydrogel scaffold and functional modules; the hydrogel scaffold uses methacrylamide gelatin (GelMA) as a matrix, forming a stable three-dimensional network structure through photocrosslinking; Zn 2+ -GelMA's functional modules contain two core DNA sequences: a 27bp Zn 2+The system consists of a DNA-dependent closed-chain structure, ZnR-Cage, and a 46 bp CD44-targeting agonist chain, CD44-link, containing a 30 bp fragment of a highly active CD44 nucleic acid agonist. These two chains, ZnR-Cage and CD44-link, form an inactive assembly through base pairing. Under normal microenvironment conditions, this inactive assembly covalently anchors and stably integrates into the gel network via a thiol-acrylate click chemistry reaction. The steric hindrance of the DNA backbone effectively shields against enzymatic interference in the microenvironment. When the smart hydrogel is exposed to a high concentration of Zn... 2+ In the microenvironment (exogenous input), Zn 2+ It specifically binds to and triggers site-specific cleavage of DNAzymes, leading to the dissociation of the aforementioned inactive assemblies, thereby precisely releasing biologically active CD44 nucleic acid agonists and activating downstream CD44 signaling pathways.

[0096] The preparation method of the intelligent hydrogel of the present invention includes the following steps: annealing the synthesized ZnR-Cage and CD44-link in a buffer system to form an inactive double-chain assembly (referred to as a functional module); then mixing it with a GelMA matrix, and using mercapto-acrylate click chemistry and photocrosslinking technology to form a gel in situ, thereby preparing the target hydrogel Zn. 2+ -GelMA. After the preparation reaction, its assembly and mechanical properties can be detected by characterization techniques such as fluorescence imaging, gel electrophoresis, and release kinetic testing to determine the anchoring status of functional modules.

[0097] The application of the smart hydrogel includes the following steps: [The text abruptly ends here, likely due to an incomplete sentence or a missing section.] 2+ - GelMA hydrogel is applied to live cell culture systems or damaged areas of living tissue to introduce exogenous Zn. 2+ This triggers drug release, and after a period of time, the expression of cell proliferation, vascularization, wound healing, and angiogenesis markers is detected. The efficacy of the hydrogel is determined based on the observation results.

[0098] This invention achieves high-fidelity, covalent anchoring of nucleic acid functional modules in a gel matrix. It effectively shields the non-specific interference of the complex microenvironment on active fragments, achieving "zero-release" drug latch-up. This invention utilizes Zn... 2+ The specific activation of DNAzyme induces site-specific cleavage, drives conformational dissociation of inactive assemblies, and thus releases biologically active CD44 nucleic acid agonists in situ and precisely at the lesion site.

[0099] In summary, this invention relates to a smart hydrogel for treating skin tissue damage, its preparation method, a drug, and its application. The smart hydrogel comprises a hydrogel scaffold and functional modules. The hydrogel scaffold uses methacrylamide gelatin as a matrix and forms a stable three-dimensional network structure through photocrosslinking. The functional modules contain two core DNA strands: one is a ZnR-Cage strand with thiol groups directly or indirectly connected to one end, and the other is a CD44-link strand. These two strands form an inactive assembly through complementary base pairing. This smart hydrogel possesses numerous advantages, including strong spatiotemporal control, overcoming drug burst release defects, efficient cascade repair and targeted synergistic therapy, high efficiency integration, excellent stability, and clinical translational potential. It is particularly suitable for the clinical treatment of complex wounds such as diabetic ulcers and infected wounds.

[0100] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A smart hydrogel for treating skin tissue damage, characterized in that, The smart hydrogel is Zn 2+ responsive hydrogel Zn 2+ -GelMA, the smart hydrogel includes a hydrogel scaffold and a functional module. The hydrogel scaffold uses methacrylamide gelatin (GelMA) as a matrix and forms a stable three-dimensional network structure through photocrosslinking. The functional module contains two core DNA strands. One DNA strand is a ZnR-Cage strand with thiol groups directly or indirectly attached to one end of the ZnR-Cage strand as shown in SEQ ID NO.

1. The other DNA strand is a CD44-link strand as shown in SEQ ID NO.

2. The CD44-link strand is a 46bp long CD44-targeting agonist strand containing a CD44 nucleic acid agonist, which is the 1st to 30th bases from the 5' end of the CD44-link strand. The ZnR-Cage strand and the CD44-link strand form an inactive assembly through complementary base pairing. SEQ ID NO.1: CAGGTAACGTAGTTGAGCTGTCGTCCC; SEQ ID NO. 2: TTGGGACGGTGTTAAACGAAAGGGGACGACGTTGAAGCGTT ACCTG.

2. A method for preparing the smart hydrogel as described in claim 1, characterized in that, include: Step A: Mix the solution containing ZnR-Cage chain and the solution containing CD44-link chain in equal molar amounts, and incubate at a temperature above 37°C for a period of time. The two chains complement each other to form an assembly solution, which is the functional module. Step B: Prepare LAP stock solution and LAP-containing GelMA precursor solution, and heat in the dark to fully dissolve the GelMA freeze-dried sponge; Both the LAP-containing GelMA precursor solution and the assembly solution are sterilized by filtration through a sterile filter membrane and thoroughly mixed. Photopolymerization is initiated by ultraviolet light irradiation to obtain the smart hydrogel.

3. The preparation method according to claim 2, characterized in that, The solutions described in step A are all PBS solutions, and the assembly solution is obtained by incubation at 37°C for more than 2 hours.

4. The preparation method according to claim 2, characterized in that, In step B, LAP stock solution is first prepared using PBS, and then GelMA lyophilized sponge is added to the LAP stock solution and fully dissolved to obtain GelMA precursor solution containing LAP; or LAP stock solution is first prepared using PBS, and GelMA lyophilized sponge is dissolved using PBS, and then the two are mixed to fully dissolve the GelMA lyophilized sponge to obtain the GelMA precursor solution containing LAP; the concentration of LAP in the LAP stock solution is 0.1~0.5%, and the concentration of GelMA in the GelMA precursor solution containing LAP is 5~15%, and these percentages are mass to volume ratios; the temperature for heating in the dark is 60~70℃, and the time is 20~30min; the pore size of the sterile filter membrane is 0.2~0.25μm, and sterilization is performed by hot filtration; the wavelength of the ultraviolet light for photopolymerization is 400~410nm, and the ultraviolet light irradiation time is 20~40s.

5. A drug, characterized in that, The drug comprises the smart hydrogel as described in claim 1 or the smart hydrogel prepared by any one of the preparation methods described in claims 2 to 4, and further comprises Zn-containing... 2+ Compounds.

6. The drug according to claim 5, characterized in that, The Zn-containing 2+ The compound is ZnCl2.

7. The use of a medicament as described in claim 5 or 6, characterized in that, Zn smart hydrogel 2+ - GelMA is placed on the site of skin injury in humans or animals, and starting from day 2 to 4 after the skin injury, Zn-containing hydrogels are dripped around the site of injury. 2+ HEPES buffer, wherein HEPES is (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid).

Images