Saccharomyces paradoxus strain xqu7 and its application

Abstract

This invention belongs to the field of microbial fermentation and food flavoring technology, and discloses a specific aroma-producing yeast strain XQU7 and its applications. This strain is *Hansenula polymorpha*. Hanseniaspora uvarum The strain, with accession number CCTCC M 2026992, produces a fermentation broth containing various volatile substances including esters, alcohols, acids, aldehydes, terpenes, and sulfur-containing compounds. It significantly enhances the content of characteristic aroma components such as octanoic acid, hexanoic acid, benzaldehyde, decanoic acid, benzyl alcohol, and D-limonene, resulting in complex flavors including fatty, fruity, sweet, ester, and fermented aromas, demonstrating excellent aroma-producing properties. This strain can be used to prepare fermentation flavor enhancers and aroma products, suitable for flavoring processing in food, beverages, seasonings, Fu brick tea, feed, and pet food, with a wide range of applications and significant industrialization value.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation and food flavoring technology, specifically involving a specific aroma-producing yeast strain XQU7, aroma-producing fermentation broth prepared from it, fermentation flavoring agent, fermentation aroma products, and their application in food fermentation and flavoring. Background Technology

[0002] In recent years, utilizing microbial fermentation to create natural complex aromas has become an important direction for the development of food, beverages, condiments, tea products, and fermented aroma bases. Compared with directly adding flavorings and fragrances, aroma production through microbial fermentation has advantages such as natural sources, harmonious aromas, and rich flavor layers, and can impart complex aroma characteristics to food, including fruity, floral, sweet, wine-like, ester-like, and fermented aromas.

[0003] Yeast is an important functional microorganism in food fermentation, capable of producing a variety of volatile aroma compounds, including esters, alcohols, acids, aldehydes, terpenes, and sulfur-containing compounds, from substrates such as sugars, amino acids, and fatty acids. Different yeast strains from different sources and of different species exhibit significant differences in aroma-producing ability, volatile compound composition, and aroma characteristics. Therefore, screening yeast strains with distinctive aroma-producing capabilities is of great significance for improving food flavor and developing naturally fermented flavor-enhancing products.

[0004] Kiwi fruit processing generates byproducts such as pomace, which contain abundant nutrients and natural microbial resources. If stable aroma-producing yeast strains can be screened from kiwi fruit pomace, it will not only expand the high-value utilization pathways of kiwi fruit processing byproducts but also provide new strain resources for the development of food fermentation flavor enhancers, seasoning flavor enhancers, Fu brick tea aroma improvers, and natural aroma bases.

[0005] Currently, most yeast strains used in food fermentation primarily focus on alcoholic fermentation or basal fermentation performance. Some strains lack prominent aroma characteristics, producing a limited variety and quantity of volatile aroma compounds, making it difficult to meet the demands of fermented foods for natural, complex aromas and distinctive flavors. Therefore, it is necessary to provide an aroma-producing yeast strain with a clearly defined origin, easy cultivation, distinct aroma characteristics, and abundant volatile compounds for the preparation of aroma-producing fermentation broths, fermentation flavor enhancers, and related food flavoring products. Summary of the Invention

[0006] This invention provides a specific aroma-producing yeast strain XQU7 and its applications to address the problems of relatively limited aroma-producing strain resources, indistinct aroma-producing characteristics of some strains, and insufficient selectable strains for fermentation aroma base materials and food fermentation flavor enhancers in existing food fermentation systems.

[0007] To achieve the above objectives, the present invention provides the following technical solution: a specific aroma-producing yeast strain, wherein the strain is *Hansenula polymorpha*.Hanseniaspora uvarum XQU7 was deposited at the China Center for Type Culture Collection on May 18, 2026, with accession number CCTCC NO:M 2026992.

[0008] Furthermore, the ITS rDNA gene sequence of the strain is shown in SEQ ID NO:1. The strain colonies are milky white and round with smooth surfaces and regular edges. The cells are oval and exhibit the biological characteristics of yeast budding reproduction.

[0009] This invention also provides a method for preparing aroma-producing fermentation liquid, the specific steps of which are as follows: The specific aroma-producing yeast strain described in claim 1 was activated and cultured to obtain activated cells; The activated bacterial cells were inoculated into a liquid basal medium and cultured under constant temperature and shaking to prepare a fermentation seed liquid. The fermentation seed liquid was inoculated into the fermentation medium at the preset inoculation amount, and the fermentation culture was carried out under controlled temperature and shaking to obtain the aroma-producing fermentation liquid.

[0010] Furthermore, the inoculation amount of the fermentation seed liquid is 1%~5%, the shaking culture speed is 120r / min~200r / min, the fermentation temperature is 25℃~32℃, and the fermentation time is 24h~72h.

[0011] Furthermore, the aroma-producing fermentation broth is enriched with differentially volatile aroma substances such as acids, esters, aldehydes, alcohols, and terpenes, and the enriched characteristic volatile compounds include octanoic acid, hexanoic acid, decanoic acid, benzaldehyde, methyl decanoate, benzyl alcohol, and D-limonene.

[0012] The present invention also provides a food-specific fermentation and flavor-enhancing microbial agent, comprising the above-mentioned specific aroma-producing yeast strain.

[0013] Furthermore, the microbial agent formulation can be any one of liquid fermentation microbial agent, room temperature solid microbial agent, or vacuum freeze-dried microbial powder; after activation, the microbial agent can restore the original aroma-producing metabolic characteristics of the strain.

[0014] The present invention also provides the above-mentioned specific aroma-producing yeast strain, the aroma-producing fermentation liquid prepared by the above-mentioned preparation method, and the application of the above-mentioned food-specific fermentation and aroma-enhancing microbial agent in the fermentation and aroma enhancement of Fu brick tea and the fermentation and flavoring of seasonings.

[0015] Furthermore, the application optimizes the four main flavors of the product: fruity aroma, sweet aroma, fermented mellow aroma, and ester aroma, reduces off-flavors in the fermentation system, and improves the overall aroma harmony.

[0016] This invention also provides a fermentation and aroma enhancement process, in which the above-mentioned food-specific fermentation and aroma enhancement microbial agent is activated and then added to the fermentation system of Fu brick tea or the fermentation system of seasonings, and fermented in synergistic fermentation with the original fermentation conditions to complete the in-situ aroma enhancement and modification of food.

[0017] Compared with the prior art, the present invention has at least the following beneficial effects: The aroma-producing yeast strain XQU7 provided by this invention can produce a variety of volatile aroma substances after fermentation. HS-SPME-GC-MS detection results show that the fermentation broth of XQU7 has a rich composition of volatile compounds, covering esters, alcohols, acids, aldehydes, terpenes, sulfur-containing compounds, and other components, indicating that this strain has good fermentation aroma-producing ability.

[0018] Comparison of the XQU7 fermentation broth with the blank culture medium CK and the fermentation broth of the control strain BY4147 revealed that the XQU7 fermentation broth contained a high level of various candidate volatile compounds, exhibiting significant enrichment characteristics. In particular, acids such as octanoic acid, hexanoic acid, decanoic acid, 2-methylbutanoic acid, and 2-methylpropanoic acid; aldehydes such as benzaldehyde and dodecanal; esters such as methyl 4-decenoate and ethyl decanoate; alcohols such as benzyl alcohol; and terpenes such as D-limonene collectively constitute the material basis for the complex aromas of the XQU7 fermentation broth, including fatty, cheese, fruity, sweet, almond, floral, ester, citrus, and fermented notes.

[0019] The XQU7 aroma-producing yeast strain provided by this invention has simple culture conditions and is easy to expand. Its fermentation broth can be further processed into fermentation broth, fermentation supernatant, concentrated broth, dried powder, fermentation extract or natural aroma base, which can be used for flavoring applications in food, beverages, seasonings, Fu tea, feed or pet food, etc., and has good development and utilization value. Attached Figure Description

[0020] Figure 1 The images show the morphological characteristics of aroma-producing yeast strain XQU7, where A represents the colony morphology of strain XQU7 on solid culture medium, and B represents the microscopic morphology of strain XQU7.

[0021] Figure 2The graphs show the volatile compound composition of groups CK, BY4147, and XQU7. Figure A is a stacked graph of the relative contents of volatile compounds in different groups, and Figure B is a bubble chart showing the concentration and quantity of volatile compound categories in different groups. The graphs indicate that the XQU7 fermentation broth has a richer composition of volatile compounds, and that the concentration and quantity of some volatile compound categories show significant differences.

[0022] Figure 3 The graphs show the differences in volatile compounds between XQU7, BY4147, and CK groups. A is the OPLS-DA score graph for XQU7 and BY4147, B is the VIP value graph for volatile compounds in the comparison between XQU7 and BY4147, C is the OPLS-DA model permutation test graph, and D is the graph showing the fold change of candidate volatile compounds in XQU7 compared to BY4147 and CK.

[0023] Figure 4 This is a radar chart of the aroma and flavor of XQU7 in different application systems. A represents the aroma evaluation results of XQU7 used as a flavor enhancer in the preparation of Fu brick tea fermentation; B represents the aroma evaluation results of XQU7 used as a flavor enhancer in the preparation of seasonings fermentation; and C represents the aroma evaluation results of XQU7 after activation by the microbial preparation. This chart characterizes the improvement effect of XQU7 on total aroma intensity, characteristic aroma, and aroma harmony in different application systems.

[0024] Figure 5 The figure shows the BLAST alignment results of the ITS rDNA sequence of strain XQU7 in the NCBI database. It also shows the alignment of the ITS rDNA sequence of strain XQU7 with that of *Hansenula polymorpha* in the GenBank database. Hanseniaspora uvarum The reference sequence of the strain achieved 100% homology matching, with 100% sequence coverage and an E value of 0. The homology identification results were statistically significant, confirming that the strain is *Hansenula polyspora*. Hanseniaspora uvarum ). Detailed Implementation

[0025] The present invention will be further described below with reference to the embodiments, but the scope of protection of the present invention is not limited to the following embodiments. All equivalent substitutions, improvements, or modifications made within the spirit and principles of the present invention should be included within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods in the art, and the reagents, culture media, and instruments used can all be obtained through conventional commercial channels.

[0026] Example 1: Isolation and Screening of Aroma-Producing Yeast Strains Take samples of kiwifruit processing by-products, add sterile physiological saline, and mix thoroughly by shaking to obtain a bacterial suspension. Perform serial dilutions on the obtained bacterial suspension, and spread the appropriate dilutions onto yeast isolation medium plates, incubating at 28°C for 24–48 hours.

[0027] After cultivation, yeast-like colonies with different morphologies were picked from the plates and purified by streak plating. Purification was repeated until single colonies with consistent morphology were obtained. The purified strains were then inoculated into liquid culture medium and cultured. Their aroma-producing ability was preliminarily evaluated by smell. After screening, a yeast strain with a distinct aroma characteristic was obtained and named XQU7.

[0028] Example 2: Morphological observation of aroma-producing yeast strain XQU7 The aroma-producing yeast strain XQU7 was inoculated onto YPD solid medium and cultured at 28℃ for 24-48 h. Its colony morphology was then observed.

[0029] Figure 1 Results showed that strain XQU7 grew well on YPD solid medium, producing round or nearly round, milky-white colonies with smooth surfaces, relatively regular edges, and a slightly raised center, making them easy to pick up. Single colonies were used to prepare cell smears, and the cell morphology was observed under a microscope. Strain XQU7 cells were oval, ovoid, or nearly round, exhibiting typical budding reproductive characteristics of yeast. Figure 1 B).

[0030] Example 3: Molecular biological identification of aroma-producing yeast strain XQU7 Genomic DNA was extracted from the aroma-producing yeast strain XQU7, and the ITS rDNA region was amplified using universal yeast primers. The PCR amplification products were detected by agarose gel electrophoresis and then sequenced. The sequencing results were submitted to the NCBI database for BLAST alignment for strain classification and identification.

[0031] The results are as follows Figure 5 The results showed that strain XQU7 and Hanseniaspora uvarum The reference strain showed high sequence similarity. Therefore, strain XQU7 was identified as... Hanseniaspora uvarum .

[0032] The ITS rDNA sequence of strain XQU7 is shown in SEQ ID NO:1: GCGCTTAATTGCGCTGCTTCTTTAGAGTGTCGCAGTGAAAGTAGTCTTGCTTGAATCTCAGTCAACGCTACACACATTGGAGTTTTTTACTTTAATTTAATTCTTTCTGCTTTGAATCGAAAGGTTCAAGGCAA AAAACAAACACAAACAATTTTATTTTATTATAATTTTTTAAACTAAACCAAAATTCCTAACGGAAATTTTAAAATAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCGAA TTGCGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTGAATTTTTGAACGCACATTGCGCCCTTGAGCATTCTCAGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAAAGATAATTTATTATTTTTT GGTTGTGGGCGATACTCAGGGTTAGCTTGAAATTGGAGACTGTTTCAGTCTTTTTTAATTCAACACTTAGCTTCTTTGGAGACGCTGTTCTCGCTGTGATGTATTTATGGATTTATTCGTTTTACTTTACAAGGG The above-mentioned aroma-producing yeast strain is *Hansenula polymorpha* ( Hanseniaspora uvarum XQU7 was deposited with the China Center for Type Culture Collection (CCTCC) on May 18, 2026, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M 2026992. The strain was tested by the collection center on May 25, 2026, and the result showed it to be viable.

[0033] Example 4: Preparation of fermentation broth from aroma-producing yeast strain XQU7 The aroma-producing yeast strain XQU7 was removed from the preservation tube or slant and streaked onto YPD solid medium. It was then activated by culturing at 28°C for 24–48 h.

[0034] Activated single colonies were picked and inoculated into YPD liquid medium and cultured with shaking at 28℃ and 150r / min for 18-24h to obtain seed culture.

[0035] The obtained seed liquid was inoculated into fresh YPD liquid culture medium at an inoculation rate of 1-5%, and cultured with shaking at 25-32℃ for 24-72 hours to obtain aroma-producing fermentation broth.

[0036] Preferably, the obtained seed liquid is inoculated into YPD liquid culture medium at an inoculation rate of 2-3%, and cultured with shaking at 28℃ and 150r / min for 48h to obtain aroma-producing fermentation broth with obvious aroma characteristics.

[0037] Preferably, the YPD liquid culture medium consists of yeast extract, peptone, glucose and water, and is used after sterilization.

[0038] Example 5: Determination and analysis of volatile aroma compounds in the fermentation broth of aroma-producing yeast strain XQU7 Fermentation broth of aroma-producing yeast strain XQU7 was used as the test sample. A blank culture medium group (CK) without inoculation and a control strain, *Saccharomyces cerevisiae* BY4147, were also set up. Saccharomyces cerevisiae BY4147) Fermentation broth group. All samples were treated under the same culture conditions. After fermentation, the samples were thoroughly mixed, and the complete fermentation broth was used for the detection of volatile aroma substances.

[0039] This embodiment employs headspace solid-phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) to detect volatile aroma compounds in the sample. Specifically, a certain volume of fermentation broth is placed in a headspace vial, internal standard 2-Octanol is added, and the vial is sealed for headspace equilibration. Subsequently, volatile components are enriched by adsorption using a solid-phase microextraction fiber and thermally desorbed at the gas chromatograph injection port. After separation by gas chromatography, the volatile components are detected by a mass spectrometer detector. Qualitative and relative quantitative analyses are performed using mass spectrometry database matching, retention time comparison, and internal standard methods.

[0040] Test results as follows Figure 2 As shown in Figures AB, the volatile compound composition differs among the three sample groups: CK, BY4147, and XQU7. The XQU7 fermentation broth exhibits a richer composition of volatile compounds, encompassing esters, alcohols, acids, aldehydes, terpenes, sulfur-containing compounds, and other components. Notably, some acids, esters, aldehydes, alcohols, and terpenes closely related to aroma formation show more pronounced compositional characteristics in the XQU7 group, indicating that XQU7 possesses good aroma-producing fermentation capabilities. Further multivariate statistical analysis of the GC-MS data yielded the following results: Figure 3 As shown in the OPLS-DA score plot, the XQU7 group and the BY4147 group are clearly distinguishable, indicating a difference in their volatile compound composition. VIP value analysis shows that some volatile compounds contribute significantly to the inter-group differences. Combined with the substitution test results, this demonstrates that the model can be used for screening candidate differentially expressed volatile compounds. Further analysis using VIP values, fold changes, and relative content changes yielded candidate volatile compounds enriched in XQU7 compared to BY4147 and CK, as shown in Table 1. Table 1 shows the 18 candidate volatile compounds enriched by XQU7 compared to BY4147 and CK.

[0041] Note: FC indicates fold change; FC_XQU7_vs_BY4147 indicates the fold change of the XQU7 group relative to the BY4147 group; FC_XQU7_vs_CK indicates the fold change of the XQU7 group relative to the CK group; CK is the blank culture medium control group without inoculation of the strain, BY4147 is the control strain fermentation group, and XQU7 is the aroma-producing yeast strain fermentation group: The data in the XQU7, BY4147 and CK columns are the average concentrations (μg / mL) of volatile compounds in each group.

[0042] like Figure 3 As shown in Table D and Table 1, several candidate volatile compounds in the XQU7 fermentation broth showed a significant enrichment trend compared to the BY4147 fermentation broth and the CK group. Octanoic acid was one of the candidate compounds with higher content in the XQU7 group, with a relative content of 91.281, significantly higher than that in the BY4147 and CK groups. Hexanoic acid, decanoic acid, 2-methylbutanoic acid, and 2-methylpropanoic acid, among other acidic compounds, also had high contents in the XQU7 fermentation broth, and are important volatile characteristic components that distinguish XQU7 from the control group. In addition, compounds such as benzaldehyde, methyl 4-decenoate, ethyl Decanoate, benzyl alcohol, 1-Propanol (3-(methylthio)-), and D-limonene also showed high levels in group XQU7. These compounds are associated with aroma characteristics such as sweetness, fruitiness, floral notes, ester aromas, sulfur-containing fermented aromas, and citrus freshness, respectively.

[0043] The above results indicate that the aroma-producing yeast strain XQU7 can produce a rich variety and high content of volatile aroma substances after fermentation. Compared with the blank culture medium CK and the control strain BY4147, the XQU7 fermentation broth has advantages in terms of the composition of volatile compounds, the content of candidate characteristic compounds, and the characteristics of complex aromas. It can be used to prepare aroma-producing fermentation broth, fermentation flavor enhancers, fermentation aroma bases, and related food flavoring products.

[0044] Example 6: Application of aroma-producing yeast strain XQU7 in the preparation of aroma enhancer for Fu brick tea fermentation As in Example 4, the aroma-producing yeast strain XQU7 was activated and then cultured in liquid to obtain a seed liquid or aroma-producing fermentation broth containing the strain.

[0045] Take 100 g of Fu brick tea raw material, add sterile water to adjust its moisture content to approximately 30%, and mix thoroughly. Add XQU7 seed liquid at 3% of the mass of the Fu brick tea raw material, i.e., 3 mL of XQU7 seed liquid per 100 g of Fu brick tea raw material. Add the seed liquid in several sprays, stirring constantly during the spraying process to ensure even distribution of the bacterial solution throughout the Fu brick tea raw material. Place the inoculated Fu brick tea sample in a sterile fermentation container and ferment at 28 ℃ for 72 h, stirring once every 24 h during fermentation. After fermentation, dry the sample under the same conditions to a suitable moisture content to obtain the XQU7-treated fermented Fu brick tea sample.

[0046] To evaluate the effect of XQU7 on improving the aroma of Fu brick tea, three groups were set up: CK, BY4147, and XQU7. The total aroma intensity, tea aroma, fruit aroma, sweet aroma, floral aroma, fermentation aroma, and off-odor were scored using the olfactory evaluation method.

[0047] The scoring criteria are as follows: 1 point indicates none or very weak, 2 points indicates weak, 3 points indicates moderate, 4 points indicates strong, and 5 points indicates very strong.

[0048] Evaluation results as follows Figure 4 As shown in Figure A, the overall aroma of the Fu brick tea sample treated with XQU7 was superior to that of the control group, with improvements in total aroma intensity, fruity aroma, sweet aroma, and fermented aroma. Compared to the BY4147 group, the aroma of the XQU7 group was more inclined towards fruity, sweet, and fermented aromas, with the fermented aroma being particularly prominent, indicating that XQU7 can enhance the fermentation characteristics and complex aroma layers in the Fu brick tea system.

[0049] Based on olfactory characteristics, the Fu brick tea samples treated with XQU7 did not show a significant increase in off-odors, indicating that while improving the aroma of Fu brick tea, this strain does not easily introduce obvious unpleasant odors.

[0050] In summary, XQU7 can be used in the fermentation, pile fermentation, post-fermentation, or aroma improvement processes of Fu tea, helping to enhance the fruity, sweet, fermented aromas and overall aroma harmony of the Fu tea system.

[0051] Example 7: Application of aroma-producing yeast strain XQU7 in the preparation of flavor enhancers for seasoning fermentation As in Example 4, the aroma-producing yeast strain XQU7 was activated and then cultured in liquid to obtain a seed liquid or aroma-producing fermentation broth containing the strain. This example uses a plant-based liquid seasoning base as the fermentation material. The seasoning base consists of soybean protein hydrolysate, glucose, salt, and water, wherein the mass fraction of soybean protein hydrolysate is 10%, the mass fraction of glucose is 2%, the mass fraction of salt is 1%, and the remainder is water. The seasoning base was sterilized at 121 ℃ for 15 min and cooled to room temperature for later use. 100 mL of the sterilized seasoning base was placed in a 250 mL Erlenmeyer flask, and XQU7 seed liquid was added to the seasoning base at a 3% volume inoculation rate, i.e., 3 mL of XQU7 seed liquid was added per 100 mL of seasoning base. After inoculation, the mixture was thoroughly mixed and fermented at 28 ℃ and 150 r / min for 48 h with shaking to obtain the XQU7 seasoning fermentation product.

[0052] Using seasoning systems as the application object, olfactory evaluations were conducted on the CK group, BY4147 group, and XQU7 group.

[0053] Evaluation indicators include total aroma intensity, soy sauce / seasoning aroma, fruit aroma, sweet aroma, fermentation aroma, aroma harmony, and off-odors.

[0054] The scoring criteria are as follows: 1 point indicates none or very weak, 2 points indicates weak, 3 points indicates moderate, 4 points indicates strong, and 5 points indicates very strong.

[0055] like Figure 4 As shown in Figure B, the XQU7 group outperformed the CK group in total aroma intensity, soy sauce / seasoning aroma, fruity aroma, sweet aroma, fermentation aroma, and aroma harmony, indicating that XQU7 can significantly improve the aroma fullness of the seasoning system. Compared with BY4147, the XQU7 group showed greater advantages in sweet and fermentation aromas, and maintained a high level of aroma harmony, indicating that this strain can not only enhance the intensity of individual aromas but also improve the overall flavor integration of the seasoning.

[0056] The results indicate that XQU7 is suitable for enhancing the aroma of fermented sauces, compound seasonings, soup bases, sauces, plant-based seasoning bases, fruit and vegetable seasoning bases, or naturally fermented aroma bases. By using the XQU7 strain, its seed culture, fermentation broth, or fermentation products, seasoning systems can be enriched with aromas of soy sauce / seasoning, fruit, sweetness, esters, fermentation, and more harmonious complex aromas.

[0057] Example 8: Preparation of microbial preparations and evaluation of their flavor-enhancing effect As in Example 4, the aroma-producing yeast strain XQU7 was activated and cultured on a large scale, and then prepared into a microbial preparation. The microbial preparation can be a liquid inoculum, a solid inoculum, a freeze-dried inoculum powder, a fermentation seed liquid, a compound fermentation agent, or an aroma-producing fermentation broth.

[0058] In one embodiment, the XQU7 fermentation broth is used directly as a liquid inoculum.

[0059] In another embodiment, the XQU7 fermentation broth is centrifuged to collect the bacterial cells, and after adding a protectant, it is freeze-dried to prepare freeze-dried bacterial powder.

[0060] The resulting microbial preparations can be used to prepare aroma-producing fermentation liquids, fermented aroma bases, food fermentation flavor enhancers, Fu brick tea fermentation flavor enhancers, seasoning fermentation flavor enhancers, or natural aroma products.

[0061] The prepared XQU7 microbial preparation was further evaluated by smell, and the evaluation indicators included total aroma intensity, fruit aroma, sweet aroma, alcohol aroma, fermentation aroma and aroma recovery after activation.

[0062] like Figure 4 As shown in C, the XQU7 microbial preparation, after activation, can restore and maintain relatively obvious aroma characteristics, with its total aroma intensity, fruity aroma, sweet aroma, alcoholic aroma, and fermentation aroma all exceeding those of the CK group. Compared with the BY4147 group, the overall aroma performance of the XQU7 group is relatively similar, but it has a slight advantage in terms of total aroma intensity and alcoholic aroma, indicating that XQU7 still has good aroma production stability and application feasibility after formulation treatment.

[0063] The above results indicate that XQU7 can be used directly as a fermentation broth, or further processed into a microbial preparation. After activation, the preparation can still form obvious fruity, sweet, mellow, and fermented aroma characteristics, and can be used as a functional flavor enhancer in food, seasonings, tea products, or other fermented aroma products.

Claims

1. A specific aroma-producing yeast strain, characterized in that, The strain is *Hansenula polymorpha*. Hanseniaspora uvarum XQU7 was deposited at the China Center for Type Culture Collection on May 18, 2026, with accession number CCTCC NO:M 2026992.

2. The specific aroma-producing yeast strain according to claim 1, characterized in that, The ITS rDNA gene sequence of the strain is shown in SEQ ID NO:

1. The colonies of the strain are milky white and round with smooth surfaces and regular edges. The cells are oval and exhibit the biological characteristics of yeast budding reproduction.

3. A method for preparing an aroma-producing fermentation liquid, characterized in that, The specific steps are as follows: The specific aroma-producing yeast strain described in claim 1 was activated and cultured to obtain activated cells; The activated bacterial cells were inoculated into a liquid basal medium and cultured under constant temperature and shaking to prepare a fermentation seed liquid. The fermentation seed liquid was inoculated into the fermentation medium at the preset inoculation amount, and the fermentation culture was carried out under controlled temperature and shaking to obtain the aroma-producing fermentation liquid.

4. The method for preparing an aroma-producing fermentation liquid according to claim 3, characterized in that, The inoculation amount of the fermentation seed liquid is 1%~5%, the shaking culture speed is 120r / min~200r / min, the fermentation temperature is 25℃~32℃, and the fermentation time is 24h~72h.

5. The method for preparing an aroma-producing fermentation liquid according to claim 3, characterized in that, The aroma-producing fermentation broth is enriched with differentially volatile aroma substances, including acids, esters, aldehydes, alcohols, and terpenes. The characteristic volatile compounds enriched include octanoic acid, hexanoic acid, decanoic acid, benzaldehyde, methyl decanoate, benzyl alcohol, and D-limonene.

6. A food-specific fermentation and flavor-enhancing microbial agent, characterized in that, Includes the specific aroma-producing yeast strain described in claim 1.

7. The food-specific fermentation and flavor-enhancing microbial agent according to claim 6, characterized in that, The microbial agent formulation can be any one of liquid fermentation microbial agent, room temperature solid microbial agent, or vacuum freeze-dried microbial powder; after activation, the microbial agent can restore the original aroma-producing metabolic characteristics of the strain.

8. The application of the specific aroma-producing yeast strain of claim 1, the aroma-producing fermentation liquid prepared by the preparation method of claim 3, and the food-specific fermentation and aroma-enhancing microbial agent of claim 6 in the fermentation and aroma enhancement of Fu brick tea and the fermentation and flavoring of seasonings.

9. The application according to claim 8, characterized in that, The application optimizes the four main flavors of the product: fruity aroma, sweet aroma, fermented aroma, and ester aroma, reduces off-flavors in the fermentation system, and improves the overall aroma harmony.

10. A fermentation and aroma-enhancing process, characterized in that, The food-specific fermentation and aroma-enhancing microbial agent described in claim 6 is activated and then added to the Fu brick tea fermentation system or the seasoning fermentation system, and fermented in synergistic fermentation under the original fermentation conditions to complete the in-situ aroma enhancement and modification of the food.

Images