Colorectal tumor antigens and uses thereof

CN123036305APending Publication Date: 2026-11-03UNIV DE MONTREAL
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202480083532.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-11-06
Filing Date
2024-11-05
Publication Date
2026-11-03

AI Technical Summary

Technical Problem

In the treatment of colorectal cancer, existing technologies show that immune checkpoint inhibitors have little effect on microsatellite stable tumors, and vaccines or T-cell therapies based on tumor-associated antigens have problems with adverse immune responses and limited efficacy.

Method used

A series of tumor-specific antigenic peptides were identified and provided that can bind to HLA molecules for the development of vaccines or T-cell therapies, with or without immune checkpoint inhibitors, to trigger therapeutic immune responses against colorectal cancer.

Benefits of technology

These tumor-specific antigenic peptides can significantly stimulate the immune response, improve the treatment effect of colorectal cancer patients, especially microsatellite stable tumors, and enhance the specificity and safety of immunotherapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN123036305A_ABST
    Figure CN123036305A_ABST
Patent Text Reader

Abstract

Colorectal cancer (CRC) is the third most commonly diagnosed cancer and the second leading cause of cancer death worldwide. This document describes novel tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs) expressed by colorectal tumor cells. This document describes synthetic long peptides, nucleic acids, compositions, cells, TCRs, antibodies, and vaccines derived from these TSAs and TAAs. This document also describes the use of the TSAs / TAAs, nucleic acids, compositions, antibodies, cells, and vaccines in the prevention or treatment of cancers (including CRC) that express these TSAs and / or TAAs.
Need to check novelty before this filing date? Find Prior Art

Description

Cross-reference to related applications

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 596,384, filed November 6, 2023, the entire contents of which are incorporated herein by reference. sequence list

[0002] This application is accompanied by an XML sequence list file named G17971-00098_Seq Listing.xml, created on November 5, 2024, and approximately 474,323 bytes in size. The entire contents of the aforementioned file are incorporated herein by reference. Technical Field

[0003] This invention relates generally to the field of cancer, and more specifically to the treatment of cancers such as colorectal cancer (CRC). Background Technology

[0004] Colorectal cancer (CRC) is the third most common cancer diagnosed globally and the second leading cause of cancer death, with an estimated 1.8 million new cases and 881,000 deaths in 2018 alone (1). With global socioeconomic changes, the incidence of CRC is projected to continue rising, with an estimated 2.2 million new cases and 1.1 million new deaths annually by 2030 (1,2). This heavy disease burden underscores the necessity of developing novel and effective treatments.

[0005] The abundance of tumor-infiltrating lymphocytes (TILs) is positively correlated with prolonged overall survival in colorectal cancer patients, suggesting that T cells can recognize biologically significant tumor antigens in these tumors (3,4). The potential immunogenicity of these antigens makes immune checkpoint inhibitors (ICIs) a promising treatment option for cancer patients; however, early clinical trial results evaluating their efficacy in colorectal cancer have been mixed. Colorectal tumors characterized by mismatch repair protein deficiency, leading to the accumulation of repetitive DNA sequences (microsatellites), i.e., microsatellite instability (MSI) tumors, have shown relatively good efficacy in phase II clinical trials of anti-PD-1 therapy (5). In contrast, such treatments have shown little efficacy in microsatellite stable (MSS) tumors, which account for approximately 80% of colorectal cancer cases and do not have a high mutational burden (5,6).

[0006] Given the importance of the immune response in colorectal cancer and the limited efficacy of immune checkpoint inhibitor therapy alone, a promising research direction in recent years has been neoantigen-based vaccines or T-cell receptor-based therapies. These therapies can be used in combination with immune checkpoint inhibitors or alone, ideally bridging the treatment efficacy gap between microsatellite unstable and microsatellite stable tumors. For example, tumor-associated antigens (TAAs) are antigens expressed in cancer cells at higher levels than in normal cells and have previously been identified in colorectal cancer (7,8). Although various TAAs have been tested in colorectal cancer vaccines and phase I clinical trials, most have ended with limited efficacy, possibly due to the thymus's negative selection for these antigens (9). In one study, only one patient with metastatic colorectal cancer treated with genetically engineered anti-carcinoembryonic antigen T cells experienced tumor regression, while all patients developed severe inflammatory colitis, suggesting that adverse autoimmune reactions that may be triggered by the use of TAAs are another potential negative consequence (10).

[0007] Because clinical responses to tumor-associated antigens vary, effective therapies based on neoantigens are more likely to utilize tumor-specific antigens (TSAs). These antigens can be generated through genetic, epigenetic, and post-translational variations, including but not limited to single nucleotide variants, aberrant transcript expression, or novel splicing events, and are expressed only in tumor cells (11). The prevalence of single nucleotide variants, splicing variations, and insertion / deletion mutations in colorectal cancer suggests that the major histocompatibility complex (MHC) of tumors is highly likely to present unique antigens that can trigger tumor-specific immune responses. Recent studies have identified tumor-specific antigens in colorectal cancer and demonstrated some efficacy in phase I and II vaccine clinical trials. A 2015 vaccine trial using frameshift antigens derived from tumors with high microsatellite instability showed significant and specific immune responses in all patients (13). However, because the antigens used in this study were derived from microsatellite instability frameshift mutations, these findings are not applicable to most colorectal cancer patients. To date, other studies identifying tumor-specific antigens in colorectal cancer have focused only on mutant tumor-specific antigens (mTSAs) derived from genomic coding regions. A study of organoids from microsatellite stable colorectal cancer found that only 0.5% of nonsynonymous mutations were identified as mutant tumor-specific antigens, a proportion far lower than predicted by HLA-based prediction software. Furthermore, previous studies did not employ mass spectrometry (MS) to quantify the expression levels of these tumor-specific antigens on tumor cells, an information that could impact the therapeutic potential of targeting specific tumor-specific antigens.

[0008] Therefore, there is an urgent need to identify tumor-specific antigens that can trigger therapeutic immune responses against colorectal cancer. These antigens could be used as vaccines (with or without immune checkpoint inhibitors) or as targets for T-cell receptor-based therapies (cell therapy, bispecific biologics).

[0009] This manual cites several references, all of which are incorporated herein by reference. Summary of the Invention

[0010] In various aspects and embodiments, this disclosure provides the following items 1 through 96: 1. A tumor antigen peptide (TAP) comprising or consisting of any of the amino acid sequences shown in SEQ ID NO: 1-269.

[0011] 2. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*01:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 20, 169, 173, 254, 265 or 266.

[0012] 3. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*02:01 molecule and comprises or consists of the sequences shown in SEQ ID NO: 6, 27, 30, 44, 58, 84, 124, 132, 154-156, 160, 164, 203, 221, 224, 243, 264 or 267.

[0013] 4. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*02:03 molecule and comprises or consists of the sequence shown in SEQ ID NO: 23, 84, 89, 157, 159, 177, 190, 223 or 225.

[0014] 5. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*03:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 1, 35, 158 or 202.

[0015] 6. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*11:01 molecule and comprises or consists of the sequences shown in SEQ ID NO: 11, 25, 32, 34, 45, 86, 87, 128, 131, 191, 229 or 233-238.

[0016] 7. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*23:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 74, 121, 122, 188, 209 or 210.

[0017] 8. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*24:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 33, 122, 148, 184, 200, 210, 259 or 260.

[0018] 9. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*25:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 16, 17, 90, 92, 104, 112, 115, 120 or 139.

[0019] 10. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*26:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 4, 61, 103, 118 or 242.

[0020] 11. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*29:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 21, 204, 242, 251 or 255.

[0021] 12. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*32:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 153 or 162.

[0022] 13. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-A*68:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 15, 49, 69, 102, 116, 117, 119, 183 or 192.

[0023] 14. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*07:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 38, 47, 54, 66, 88, 205, 227, 228, 245, 246 or 256.

[0024] 15. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*08:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 46, 99, 143 or 182.

[0025] 16. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*13:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 51 or 160.

[0026] 17. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*14:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 101, 126 or 232.

[0027] 18. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*15:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 63, 98, 100, 114, 133, 244 or 248.

[0028] 19. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*15:03 molecule and comprises or consists of the sequence shown in SEQ ID NO: 5, 22, 53, 130, 135, 145, 158, 181, 201, 204, 222, 226 or 257.

[0029] 20. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*15:25 molecule and comprises or consists of the sequence shown in SEQ ID NO: 9, 10, 55, 83, 158, 204, 207, 226, 257 or 258.

[0030] 21. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*18:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 12, 93-96, 105, 108, 215, 219, 239, 261 or 263.

[0031] 22. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*27:05 molecule and comprises or consists of the sequence shown in SEQ ID NO: 68 or 230.

[0032] 23. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*35:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 179 or 206.

[0033] 24. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*35:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 38, 113 or 171.

[0034] 25. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*35:03 molecule and comprises or consists of the sequence shown in SEQ ID NO: 59, 76, 113, 125, 140, 170, 247 or 268.

[0035] 26. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*38:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 65, 75, 134, 180, 189, 200, 220, 241 or 252.

[0036] 27. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*38:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 19, 189 or 252.

[0037] 28. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*40:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 64, 80, 81, 129, 142, 166, 167, 194, 195, 198, 213, 216, 218 or 250.

[0038] 29. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*40:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 18, 29, 52, 56, 151, 185, 198, 216 or 218.

[0039] 30. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*44:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 97, 176, 199 or 215.

[0040] 31. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*44:03 molecule and comprises or consists of the sequences shown in SEQ ID NO: 3, 13, 43, 82, 97, 105-108, 110, 111, 175, 186, 196, 197, 199, 212, 214 or 215.

[0041] 32. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*45:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 14, 24 or 109.

[0042] 33. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*49:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 152, 165, 187, 217, 240 or 262.

[0043] 34. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*51:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 91.

[0044] 35. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*52:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 172 or 190.

[0045] 36. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*54:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 245 or 269.

[0046] 37. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*56:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 7, 8, 67, 71, 85, 137, 161 or 245.

[0047] 38. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-B*57:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 28, 147, 163 or 208.

[0048] 39. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*01:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 37, 40 or 193.

[0049] 40. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*03:03 molecule and comprises or consists of the sequence shown in SEQ ID NO: 72.

[0050] 41. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*03:04 molecule and comprises or consists of the sequence shown in SEQ ID NO: 36, 50, 60, 70, 77, 79, 136, 141, 149 or 174.

[0051] 42. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*04:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 123, 127, 168, 178 or 253.

[0052] 43. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*05:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 253.

[0053] 44. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*06:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 231 or 232.

[0054] 45. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*07:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 68.

[0055] 46. ​​The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*07:04 molecule and comprises or consists of the sequence shown in SEQ ID NO: 39.

[0056] 47. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*08:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 2, 138, 150 or 249.

[0057] 48. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*08:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 144 or 253.

[0058] 49. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*12:03 molecule and comprises or consists of the sequence shown in SEQ ID NO: 26, 42 or 57.

[0059] 50. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*15:02 molecule and comprises or consists of the sequence shown in SEQ ID NO: 136.

[0060] 51. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*15:05 molecule and comprises or consists of the sequence shown in SEQ ID NO: 41, 62 or 136.

[0061] 52. The tumor antigen peptide according to claim 1, wherein the tumor antigen peptide is capable of binding to the HLA-C*16:01 molecule and comprises or consists of the sequence shown in SEQ ID NO: 31, 48, 78, 146, 211 or 257.

[0062] 53. The tumor antigen peptide according to any one of claims 1-52, which is encoded by a sequence located in a non-protein coding region of the genome.

[0063] 54. The tumor antigen peptide according to claim 53, wherein the non-protein coding region of the genome is an intergenic region.

[0064] 55. The tumor antigen peptide according to claim 53, wherein the non-protein coding region of the genome is a long non-coding RNA.

[0065] 56. A composition comprising at least two tumor antigen peptides as described in any one of claims 1-55.

[0066] 57. A synthetic long peptide (SLP) comprising at least one (e.g., at least 5, 10, 15 or 20) amino acid sequences as described in claim 1, or a nucleic acid encoding said synthetic long peptide.

[0067] 58. A nucleic acid encoding the tumor antigen peptide of any one of claims 1-55, the composition of claim 56, or the synthetic long peptide of claim 57.

[0068] 59. The nucleic acid according to claim 58, wherein the nucleic acid is mRNA.

[0069] 60. The nucleic acid according to claim 59, wherein the mRNA comprises one or more 5' end modifications, 3' end modifications and / or modified nucleosides to improve mRNA stability, improve translation efficiency and / or reduce immunogenicity.

[0070] 61. The nucleic acid according to claim 58, wherein the nucleic acid is DNA.

[0071] 62. The nucleic acid according to claim 61, wherein the nucleic acid is a component of a viral vector.

[0072] 63. A vesicle or particle comprising any one of the tumor antigen peptides, compositions, synthetic long peptides, or nucleic acids described in any one of claims 1-62.

[0073] 64. The vesicles or particles according to claim 63 are lipid nanoparticles (LNPs).

[0074] 65. The vesicles or particles according to claim 63 or 64, comprising cationic lipids.

[0075] 66. A composition comprising any of the tumor antigen peptides, compositions, synthetic long peptides or nucleic acids as described in any of claims 1-62, or any of the vesicles or particles as described in any of claims 63-65, and a pharmaceutically acceptable carrier.

[0076] 67. A vaccine comprising the tumor antigen peptide, composition, synthetic long peptide or nucleic acid of any one of claims 1-62, vesicles or particles of any one of claims 63-65, or the composition of claim 66, and an adjuvant.

[0077] 68. An isolated major histocompatibility complex (MHC) class I molecule, wherein the peptide binding groove contains the tumor antigen peptide described in any one of claims 1-55.

[0078] 69. The major histocompatibility complex class I molecules isolated according to item 68, which are in polymeric form.

[0079] 70. The isolated major histocompatibility complex class I molecule according to claim 69, wherein the polymer is a tetramer.

[0080] 71. An isolated cell comprising: (i) a tumor antigen peptide as described in any one of claims 1-55; (ii) the composition as described in claim 56; (iii) the synthetic long peptide as described in claim 57; or (iv) a vector comprising a nucleotide sequence encoding the tumor antigen peptide as described in any one of claims 1-55, the composition as described in claim 56, or the synthetic long peptide as described in claim 57.

[0081] 72. An isolated cell whose surface expresses a major histocompatibility complex class I molecule, the peptide binding groove of said molecule comprising any one of claims 1-56, a tumor antigen peptide or composition thereof.

[0082] 73. The cells described in paragraph 71 or 72 are antigen-presenting cells (APCs).

[0083] 74. The cell according to claim 73, wherein the antigen-presenting cell is a dendritic cell.

[0084] 75. A T-cell receptor (TCR) that specifically recognizes isolated major histocompatibility complex class I molecules as described in any one of claims 68-70 and / or major histocompatibility complex class I molecules expressed on the cell surface as described in any one of claims 72-74.

[0085] 76. The T-cell receptor as described in item 75, which is a soluble T-cell receptor.

[0086] 77. An antibody or an antigen-binding fragment thereof that specifically binds to isolated major histocompatibility complex class I molecules as described in any one of claims 68-70 and / or major histocompatibility complex class I molecules expressed on the cell surface as described in any one of claims 72-74.

[0087] 78. The T-cell receptor as described in claim 75 or 76, or the antibody or antigen-binding fragment thereof as described in claim 77, wherein the T-cell receptor is a bispecific T-cell receptor or a bispecific antibody or antigen-binding fragment thereof.

[0088] 79. The T-cell receptor, antibody, or antigen-binding fragment thereof as described in claim 78, wherein the bispecific antibody or antigen-binding fragment thereof is a single-chain bispecific antibody (scDb).

[0089] 80. The T-cell receptor, antibody, or antigen-binding fragment thereof as described in claim 78 or 79, wherein the bispecific T-cell receptor, antibody, or antigen-binding fragment thereof also specifically binds to T-cell signaling molecules.

[0090] 81. The T-cell receptor, antibody, or antigen-binding fragment thereof as described in claim 80, wherein the T-cell signaling molecule is a CD3 chain.

[0091] 82. A chimeric antigen receptor (CAR) comprising an antibody or an antigen-binding fragment thereof as described in any one of claims 77-81, or a nucleic acid encoding said chimeric antigen receptor.

[0092] 83. An isolated cell whose cell surface expresses the T-cell receptor described in claim 75 or the chimeric antigen receptor described in claim 82.

[0093] 84. The cells isolated according to item 82 are CD8+ T lymphocytes.

[0094] 85. A cell population comprising at least 0.5% or 1% of the isolated cells described in item 83 or 84.

[0095] 86. A method of treating a subject with cancer, comprising administering to the subject an effective amount of: (a) A tumor antigen peptide comprising or composed of any of the sequences shown in SEQ ID NO: 1-269 or any combination thereof, or a synthetic long peptide comprising at least one of the sequences shown in SEQ ID NO: 1-269; (b) At least one nucleic acid encoding the tumor antigen peptide described in (a), a combination thereof, or a synthetic long peptide; (c) Vesicles or particles comprising the tumor antigen peptide described in (a), a composition thereof, or a synthetic long peptide, or at least one nucleic acid described in (b); (d) A composition comprising the tumor antigen peptide described in (a), a composition thereof or a synthetic long peptide, at least one nucleic acid described in (b) or the vesicle or particle described in (c), and a pharmaceutically acceptable carrier; (e) A vaccine comprising the tumor antigen peptide described in (a), a composition thereof or a synthetic long peptide, at least one nucleic acid described in (b), the vesicle or particle described in (c) or the composition described in (d), and an adjuvant; (f) Cells expressing major histocompatibility complex class I molecules on their surface, wherein the peptide binding groove of the molecules contains the tumor antigen peptide or a combination thereof described in (a); (g) Cells expressing T-cell receptors on their cell surface, wherein the T-cell receptors specifically recognize major histocompatibility complex class I molecules expressed on the cell surface in (f); or (h) A soluble T-cell receptor, antibody or antigen-binding fragment thereof, which specifically binds to major histocompatibility complex class I molecules expressed on the cell surface as described in (f).

[0096] 87. The method according to claim 86, wherein the cancer is colorectal cancer.

[0097] 88. The method according to claim 86 or 87 further includes administering at least one additional antitumor agent or therapy to the subject.

[0098] 89. The method according to claim 88, wherein the at least one additional antitumor agent or therapy is a chemotherapeutic agent, immunotherapy, immune checkpoint inhibitor, radiation therapy, or surgery.

[0099] 90. The use of the following substances in treating a subject's cancer or in the preparation of a medicament for treating a subject's cancer: (a) A tumor antigen peptide comprising or composed of any of the sequences shown in SEQ ID NO: 1-269 or any combination thereof, or a synthetic long peptide comprising at least one of the sequences shown in SEQ ID NO: 1-269; (b) At least one nucleic acid encoding the tumor antigen peptide described in (a), a combination thereof, or a synthetic long peptide; (c) Vesicles or particles comprising the tumor antigen peptide described in (a), a composition thereof, or a synthetic long peptide, or at least one nucleic acid described in (b); (d) A composition comprising the tumor antigen peptide described in (a), a composition thereof or a synthetic long peptide, at least one nucleic acid described in (b) or the vesicle or particle described in (c), and a pharmaceutically acceptable carrier; (e) A vaccine comprising the tumor antigen peptide described in (a), a composition thereof or a synthetic long peptide, at least one nucleic acid described in (b), the vesicle or particle described in (c) or the composition described in (d), and an adjuvant; (f) Cells expressing major histocompatibility complex class I molecules on their surface, wherein the peptide binding groove of the molecules contains the tumor antigen peptide or a combination thereof described in (a); (g) Cells expressing T-cell receptors on their cell surface, wherein the T-cell receptors specifically recognize major histocompatibility complex class I molecules expressed on the cell surface in (f); or (h) A soluble T-cell receptor, antibody or antigen-binding fragment thereof, which specifically binds to major histocompatibility complex class I molecules expressed on the cell surface as described in (f).

[0100] 91. According to the use described in item 90, wherein the cancer is colorectal cancer.

[0101] 92. The use as described in claim 90 or 91 further includes administering at least one additional antitumor agent or therapy to the subject.

[0102] 93. The use according to claim 92, wherein the at least one additional antitumor agent or therapy is a chemotherapeutic agent, immunotherapy, immune checkpoint inhibitor, radiotherapy, or surgery.

[0103] 94. A pharmaceutical agent for treating cancer in a subject, wherein the pharmaceutical agent is: (a) A tumor antigen peptide comprising or composed of any of the sequences shown in SEQ ID NO: 1-269 or any combination thereof, or a synthetic long peptide comprising at least one of the sequences shown in SEQ ID NO: 1-269; (b) At least one nucleic acid encoding the tumor antigen peptide described in (a), a combination thereof, or a synthetic long peptide; (c) Vesicles or particles comprising the tumor antigen peptide described in (a), a composition thereof, or a synthetic long peptide, or at least one nucleic acid described in (b); (d) A composition comprising the tumor antigen peptide described in (a), a composition thereof or a synthetic long peptide, at least one nucleic acid described in (b) or the vesicle or particle described in (c), and a pharmaceutically acceptable carrier; (e) A vaccine comprising the tumor antigen peptide described in (a), a composition thereof or a synthetic long peptide, at least one nucleic acid described in (b), the vesicle or particle described in (c) or the composition described in (d), and an adjuvant; (f) Cells expressing major histocompatibility complex class I molecules on their surface, wherein the peptide binding groove of the molecules contains the tumor antigen peptide or a combination thereof described in (a); (g) Cells expressing T-cell receptors on their cell surface, wherein the T-cell receptors specifically recognize major histocompatibility complex class I molecules expressed on the cell surface in (f); or (h) A soluble T-cell receptor, antibody or antigen-binding fragment thereof, which specifically binds to major histocompatibility complex class I molecules expressed on the cell surface as described in (f).

[0104] 95. The pharmaceutical preparation according to claim 94, wherein the cancer is colorectal cancer.

[0105] 96. The pharmaceutical agent according to claim 94 or 95 further includes administration of at least one additional antitumor agent or therapy to the subject.

[0106] 97. The pharmaceutical agent according to claim 96, wherein the at least one additional antitumor agent or therapy is a chemotherapeutic agent, immunotherapy, immune checkpoint inhibitor, radiotherapy, or surgery.

[0107] Other objects, advantages, and features of this disclosure will become more apparent from the following non-limiting description of specific embodiments of the invention (by way of example only and in conjunction with the accompanying drawings). Brief description of the attached figures

[0108] In the attached diagram: Figure 1A-1B This demonstrates a proteogenomic workflow for the discovery of tumor antigens (TAs) in primary colorectal cancer tumor samples. Figure 1APrimary tumor biopsy samples from 26 individuals underwent simultaneous RNA sequencing and major histocompatibility complex class I (MHC-I) immunoprecipitation (IP). RNA sequencing data were used for transcriptomic characterization of the samples and construction of a customized global cancer proteome database. MHC-I-related peptides (MAPs) isolated by immunoprecipitation were analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS), and the mass spectra were compared with corresponding personalized cancer databases using PEAKS X software. After validating candidate peptide sequences, their therapeutic potential was evaluated by assessing their distribution across tumors. Figure 1B For each primary colorectal cancer sample, paired-end RNA sequencing (RNA-seq) was performed to construct a personalized cancer database consisting of classical cancer proteomics and cancer-specific proteomics. Cancer-specific k-mers were generated, spliced ​​into contigs, and then translated in three frames to cover non-classical sequences from any genome source. Cancer-specific k-mers were obtained by subtracting k-mers from medullary thymocyte epithelial cells (mTEC), which approximates the expression of these sequences in normal tissues.

[0109] Figure 2A-2C The sample classification shows different transcriptomic features. Figure 2A Expression heatmap of 20 genes for immune rejection constant characteristics (ICR). Expression values ​​were normalized, log2 transformed, and row z-score processed (7-9). Columns represent samples (n=26) and are labeled with immune rejection constant characteristics, consensus molecular subtypes (CMS) (10) and microsatellite instability (MSS / MSI status) (4). Figure 2B RNA transcript biotype categories and proportions. Transcripts were quantified using Kallisto (v0.43.0) software, and the index included the following biotypes: coding region, non-coding region, long interstitial nuclear element (LINE), long terminal repeat (LTR), and short interstitial nuclear element (SINE). Transcripts annotated in the Ensembl database (v88) for both protein-coding and non-coding biotypes. Endogenous reverse transcription element (ERE) families (LINE, LTR, SINE) were annotated using RepeatMasker (www.repeatmasker.org). Figure 2C Nonsynonymous mutations in colorectal cancer are prevalent in the cohort. Single nucleotide polymorphisms (SNPs) were detected from RNA sequencing data using Freebayes (v1.0.2) software. The list of prevalent SNPs was extracted from the Cancer Somatic Mutation Catalogue (COSMIC). Mutations present in the samples are highlighted in black.

[0110] Figures 3A-3C The distribution of MHC-I related peptides and tumor antigens in the sample is shown. Figure 3ANumber of MHC-I related peptides in each primary sample. An average of 9292 MHC-I related peptides were identified per sample, totaling 115293 unique MHC-I related peptides. Samples were grouped into microsatellite stable and high microsatellite instability states. Figure 3B Distribution of MHC-I related peptides in each allele. The right vertical axis (proportion) shows the relative proportion of MHC-I related peptides identified in a specific allele. Figure 3C The number of tumor-associated antigens (TAAs) and tumor-specific antigens (TSAs) identified in each sample.

[0111] Figure 4 This shows the estimated frequency of presentation of tumor-specific antigens (TBAs) by a single colorectal cancer in four population groups. One million simulated patients were generated for each population. A simulated patient was considered to present a TBA when its mRNA expressed the TBA and the associated HLA allele was present. The mRNA expression frequency of the TBA was calculated using TCGA-COADRNA-seq data. HLA allele frequencies were obtained from the National Marrow Donor Program. The dashed line represents the median shared TBA for each tumor in each population (6 for European Caucasians, Hispanics, Asian Pacific Islanders, and African Americans). Detailed Implementation

[0112] In the context of describing this technology (especially in the context of the following claims), the terms “a,” “an,” and “the,” as well as similar designations, shall be interpreted to cover both the singular and the plural, unless otherwise stated herein or clearly contradicted by the context.

[0113] The terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”) unless otherwise stated.

[0114] All methods described herein may be performed in any suitable order unless otherwise stated herein or clearly contradicted by the context.

[0115] All examples or exemplary language used herein (e.g., "for example") are intended only to better illustrate embodiments of the technology and are not intended to limit the scope, unless otherwise stated.

[0116] Nothing in the language of this specification should be construed as indicating that any non-declarative element is necessary for implementing this technology.

[0117] In this document, the term “about” has its general meaning. The term “about” is used to indicate that a numerical value includes the inherent error of the equipment or method used to determine the value, or covers a value close to the value, such as within 10% of the value (or range of values).

[0118] The description of numerical ranges in this document is intended only as a convenient way to refer to each individual value within the range, unless otherwise stated herein, and each individual value is incorporated into the specification as if it were described separately herein. All subsets of values ​​within the range are also incorporated into the specification as if they were described separately herein.

[0119] When features or aspects of this disclosure are described in the form of a Markush group or alternative list, those skilled in the art will recognize that this disclosure is also described in the form of any single member or subgroup of members in a Markush group or alternative list.

[0120] Unless otherwise expressly defined, all technical and scientific terms used herein should have the same meaning as commonly understood by one of ordinary skill in the art (e.g., stem cell biology, cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0121] Unless otherwise stated, the recombinant proteins, cell culture, and immunological techniques used in this disclosure are standard procedures well known to those skilled in the art. Such techniques are fully described and explained in various literature sources, such as: J. Perbal, *A Practical Guide to Molecular Cloning*, John Wiley International Publishing Co., Ltd. (1984); J. Sambrook et al., *Molecular Cloning: A Laboratory Manual*, Cold Spring Harbor Laboratory Press, Ltd. (1989); TA Brown (ed.), *Basic Molecular Biology: Practical Methods*, Volumes 1–2, IRL Publishing Co., Ltd. (1991); DM Glover and BD Hames (ed.), *DNA Cloning: Practical Methods*, Volumes 1–4, IRL Publishing Co., Ltd. (1995 and 1996); FM Ausubel et al. (ed.), *Laboratory Guide to Molecular Biology*, Green Publishing Co., Ltd. and Wiley-Interdisciplinary Publishing Co., Ltd. (1988, with all subsequent updates); Ed Harlow and David Lane (ed.), *Antibodies: A Laboratory Manual*, Cold Spring Harbor Laboratory, Ltd. (1988); JE Coligan et al. (ed.), *Laboratory Guide to Immunology*, John Wiley International Publishing Co., Ltd. (with all subsequent updates).

[0122] In the study described herein, the inventors used a proteogenomics-based approach to identify tumor-specific antigens and tumor-associated antigen candidates from colorectal cancer samples. The novel tumor-specific antigens and tumor-associated antigen candidates identified herein could be used for immunotherapies and vaccines targeting cancers expressing such antigens, such as colorectal cancer.

[0123] In various aspects and embodiments, this disclosure relates to the use of tumor antigen peptides described herein (e.g., shown in Tables 2A-2D), and / or one or more such tumor antigen peptides in the treatment of cancers (such as colorectal cancer).

[0124] This disclosure relates to a colorectal cancer tumor antigen peptide, which comprises or consists of any of the following amino acid sequences: Peptide sequence (SEQ ID NO) Peptide sequence (SEQ ID NO): Peptide sequence (SEQ ID NO) Peptide sequence (SEQ ID NO) AAAKQSLPK (1) TVFRGGFIWR (69) HNVDHASVL (136) RLWNETVEL (203) AATGHIVAV (2) VAQARGSAM (70) HPTPVSQA (137) RMVEMFLEY (204) AEVLLQPDF (3) VQPSSPISSA (71) HVADGSATEM (138) RPRVSSTEM (205) AGIDFSLSSY (4) VTNPNIHLL (72) HVIEDIKGRW (139) RPVNVVNVY (206) AKKKENITY (5) VVADTKMIEY (73) HVQPGQYVL (140) RQRKLQEY (207) ALIKHVANA (6) YFHVTLTEF (74) IAADGHTDL (141) RTLPVDSSHGF (208) APAGAALRAA (7) YHQTEEHKF (75) IEARNQVFL (142) RYFDALLKL (209) APEGLRTAA (8) YPTAAQVQL (76) IGNIKKTL (143) RYQATGLHF (210) AQLLIKVY (9) AATSRIAEL (77) IIDENFAEL (144) SAGSRAVL (211) AQLQQNTSL (10) AAVFNPRFY (78) IQRGGGIFF (145) SEDRPKQRW (212) ATVPSRGFPK (11) AAVSTHVAL (79) ISVKGRIY (146) SEEETRVVF (213) DEFRQLKTL (12) AEIGYRNSL (80) ITKTLKSNSW (147) SEELHAALSEW (214) EEINQGGRNY (13) AELESKTNTL (81) IYFKNSENLW (148) SENLLGKQF (215) EEQRVLHQA (14) AEYNSDLHQF (82) KAIEVLLTL (149) SEVDGNRMTL (216) EVGEAQLAK (15) AIIDPNHEIEF (83) KATDIVTGL (150) SEVSKIVTV (217) EVLDSLLAQY (16) ALNEQIARL (84) KDVNIPTL (151) SEYSVHSSL (218) EVQNHSTSSY (17) APGPATREA (85) KEKETVQV (152) SEYVHSSF (219) FEAIRLSL (18) ASQESTMPK (86) Kiffkdrf (153) SHVQPGQYVL (220) FHNPSIGNAI (19) ATDIVTGLKQK (87) KIVDFSYSV (154) SILQFVHMV (221) FLGKHTLHY (20) Atregasal (88) KLDEHIAYL (155) SKMSELQTY (222) FVQENYLEY (21) AVADHHLAQL (89) KLGQVFFL (156) SLIEKVTQL (223) GKLDNTNEY (22) DAIIKIQAW (90) KLKEEITQL (157) SLQEKVAKA (224) GLREVSAEL (23) DALQKQREV (91) KLYQSIIGY (158) SLRNGVLLA (225) GQARGPPAA (24) DARDTNMGAW (92) KMNAKLEEL (159) SMYLHTEGF (226) GSSNPLTLK (25) DEENTGADRLM (93) KMSELQTYV (160) SPDWRRLAL (227) HAWPGLVVF (26) Dekvvity (94) KPTVQPWIA (161) SPRPESGTV (228) HLSSSNHQL (27) DEMQDVMHF (95) KQMSISTGL (162) SQQKVVITK (229) HSRGGSSSESF (28) DEMQHVQH (96) KTLKSNSW (163) SRNAQTFGF (230) KDIPSNPVVL (29) DEQTPIHISW (97) KVQEQPPAI (164) SRSMRLLLL (231) KLVELEHTL (30) DIMKIREY (98) LEKAFSEI (165) SRVAKTNSL (232) KSSKPITI (31) DLKKLVDSL (99) LERDQLKESL (166) SSQIPSSVNK (233) KSVYYFIMK (32) DLLQHSEY (100) LEVEDRTSL (167) STIATSHPK (234) KTPTNYYLF (33) DQIIRLEKL (101) LFDKSINEF (168) STIYLPLKR (235) KVIPGVVSK (34) DTAMPAHSR (102) LLDKDVSMY (169) SVIDEPVRLK (236) KVLGGNLTK (35) DVIKEINKA (103) LPAPYQHQL (170) SVPLSDALLNK (237) LAIKQFSI (36) DVMHFNYTAW (104) LPEEQDRLL (171) SVQENIQQK (238) LNPRTSPVL (37) EEFEYQRSY (105) LQRITKTL (172) TEEELKVAH (239) LPDGSRVEL (38) EEINQGGRKY (106) LSDSFSDLY (173) TETSNALKV (240) LSDRVTAL (39) EELHAALSEW (107) LSHTGKLAL (174) THVSQIFNMI (241) LSPRLTVIV (40) EEMEWFNNY (108) MEELGKVGF (175) TIIDRSFRY (242) LSRDISSHL (41) EEQVNNIKP (109) MESPSAPPHRW (176) TLFDYEVRL (243) LTHTDILSL (42) EERFAVDEY (110) MTNEKTTKV (177) TLHDTRTHF (244) MEVEEKKSF (43) EETLNTLRY (111) MWDQRLVRL (178) TPAPVEKSPA (245) MLAHYIISV (44) ELHAALSEW (112) NAYEDLSQKY (179) TPMPKDVRQSL (246) NTLDKHLAK (45) EPEQFVVVM (113) NHENQKVQL (180) TPSPIIQQL (247) NYRLKDTLL (46) EQFWRSVIF (114) NKITTKNAF (181) TVNQFLTQY (248) PSRGGTASL (47) EQTPIHISW (115) NLHLKTTSL (182) VADHHLAQL (249) QATVRNQQY (48) ESESVQRVTR (116) NSTDFTTDR (183) VEDRTSLVL (250) QTILDKNNR (49) ESKSVQRVTR (117) NYPKSIHSF (184) VFMKDGFFY (251) RAFTEASDGSL (50) ESYSFESSKF (118) QEGPKQEAL (185) VHQGGVELQQL (252) RATVLQSEV (51) ETIGTGGFAK (119) QEMEELGKVGF (186) VIDEPVRL (253) REEEAIHHL (52) ETVSEKKTF (120) QEVQLMTKI (187) VLDSFLQGY (254) RKFASQKSSM (53) EYLKVGSEGHF (121) QFYFNKENF (188) VLLHEVFTY (255) RPAVLPLPEL (54) EYNSDLHQF (122) QHQETINTL (189) VPRKDVGNTL (256) RQIILGAAM (55) FFNLTLKQV (123) QQKVVITKV (190) VQAIRITSY (257) SEYFSLLTRA (56) FLFLKEVKV (124) QTNSPPPPK (191) VQRLRFEVY (258) SIKLPMTY (57) FPAGAQVRL (125) QVIETQDPPR (192) VYGIRLEHF (259) SLEHDLILI (58) FQYEVAVL (126) RAPPLGNPL (193) VYKVVGNLL (260) SPSLKFSSL (59) FWDGKIVLV (127) REAGKEAAL (194) YEDLSQKY (261) SSGPSREL (60) GAMGYGYEK (128) REIREENKL (195) YEIEARNQV (262) STIDGKELLGY (61) GEVGSEVHL (129) REIREENKLY (196) YEIEARNQVF (263) STSKPLAF (62) GKFQGLIEKF (130) RELLETERRY (197) YLLDKDVSM (264) SVVAHLSTY (63) GLFTWTHMK (131) RELYANVVL (198) YLLDKDVSMY (265) TEFQQIINL (64) GLTGVIMTI (132) REMPGGPVW (199) YLLDKDVSMYP (266) THEGEPTTF (65) HAINHGTAY (133) RHQEMFHYF (200) YMLEMDNSMKI (267) TPSPARPAL (66) HHSDWGNIMW (134) RKQTQEVSY (201) YPMRILYDL (268) TPVHSSPVA (67) HKVDKNEAF (135) RLSPLSLTGK (202) YPWPYGRQT (269) TRAHVYLLR (68) On the other hand, this disclosure further relates to the use of tumor antigen peptides comprising or consisting of any of the amino acid sequences shown in SEQ ID NO: 1-269 in the treatment of cancers such as colorectal cancer.

[0125] Typically, tumor antigen peptides presented in the context of HLA class I molecules are approximately 7 or 8 to 15 amino acid residues in length, preferably 8 to 14 amino acid residues. In some embodiments of the methods disclosed herein, longer peptides comprising the tumor antigen peptide sequence described herein are artificially loaded into cells such as antigen-presenting cells (APCs). After cellular processing, the tumor antigen peptide is presented on the surface of the antigen-presenting cells by major histocompatibility complex class I molecules. In this method, peptides / polypeptides longer than 15 amino acid residues can be loaded into antigen-presenting cells and processed by proteases in the cytoplasm of the antigen-presenting cells to produce the corresponding tumor antigen peptide described herein for presentation. In some embodiments, the precursor peptides / polypeptides used to generate the tumor antigen peptide described herein are, for example, 1000, 500, 400, 300, 200, 150, 100, 75, 50, 45, 40, 35, 30, 25, 20, or 15 amino acids in length or shorter. Therefore, all methods and processes using the tumor antigen peptides described herein involve using longer peptides or polypeptides (including natural proteins), i.e., tumor antigen precursor peptides / polypeptides, to induce the final 8-14 amino acid tumor antigen peptide after cellular (antigen-presenting cell) processing. In some embodiments, the tumor antigen peptides described herein are approximately 8 to 14, 8 to 13, or 8 to 12 amino acids in length (e.g., 8, 9, 10, 11, 12, or 13 amino acids), a size sufficient to directly adapt to HLA class I molecules. In one embodiment, the tumor antigen peptide contains no more than 20 amino acids, preferably no more than 15 amino acids, more preferably no more than 14 amino acids. In one embodiment, the tumor antigen peptide contains at least 7 amino acids, preferably at least 8 amino acids, more preferably at least 9 amino acids.

[0126] As used herein, the term "amino acid" includes L- and D-isomers of natural amino acids, as well as other amino acids used in peptide chemistry to prepare analogs of tumor antigen peptides (e.g., natural amino acids, non-natural amino acids, amino acids not encoded by nucleic acid sequences, etc.). Examples of natural amino acids include glycine, alanine, valine, leucine, isoleucine, serine, threonine, etc. Other amino acids include, for example, amino acids not encoded by genes, amino acid analogs, and conserved substitutes of L-amino acids. Natural non-genetically encoded amino acids and amino acid analogs include, for example, β-alanine, 3-aminopropionic acid, 2,3-diaminopropionic acid, α-aminoisobutyric acid (Aib), 4-aminobutyric acid, N-methylglycine (sarcosine), hydroxyproline, ornithine (e.g., L-ornithine), citrulline, tert-butylalanine, tert-butylglycine, N-methylisoleucine, phenylglycine, cyclohexylalanine, ortholeucine (Nle), orthovaline, 2-naphthylalanine, pyridylalanine, 3-benzothiophenealanine, 4-chlorophenylalanine, and 2-fluorophenylalanine. The amino acids listed are 3-fluorophenylalanine, 4-fluorophenylalanine, penicillamine, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, β-2-thiophenealanine, methionine sulfoxide, L-homogeneous acid (Hoarg), N-acetyllysine, 2-aminobutyric acid, 2,4-diaminobutyric acid (D- or L-form), p-aminophenylalanine, N-methylvaline, homocysteine, homoserine (HoSer), sulfoalanine, ε-aminohexanoic acid, δ-aminovaleric acid, benzyloxytyrosine, β-phenylalanine, or 2,3-diaminobutyric acid (D- or L-form), etc. These amino acids are well-known in the fields of biochemistry / peptide chemistry. Therefore, one or more amino acids in the tumor antigen peptide (SEQ ID NO: 1-269) described herein may be substituted with non-genetically encoded amino acids and / or amino acid analogs. The tumor antigen peptide may also be modified to improve the peptide's proteolytic stability, for example, by incorporating methyl amino acids, β-amino acids, or peptide-like substances. In one embodiment, the tumor antigen peptide contains only natural amino acids.

[0127] In the embodiments described herein, the tumor antigen peptide comprises an altered sequence containing functionally equivalent amino acid residue substitutions relative to the sequence described herein. For example, one or more amino acid residues within the sequence may be substituted with another amino acid having similar polarity (similar physicochemical properties), which, as a functional equivalent, produces a silent alteration. The substitution of amino acids within the sequence may be selected from other members of their respective classes. For example, positively charged (basic) amino acids include arginine, lysine, and histidine (as well as homoarginine and ornithine). Nonpolar (hydrophobic) amino acids include leucine, isoleucine, alanine, phenylalanine, valine, proline, tryptophan, and methionine. Non-polar amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Negatively charged (acidic) amino acids include glutamic acid and aspartic acid. Glycine may be classified into a nonpolar amino acid family or a neutral (neutral) polar amino acid family. Substitutions within an amino acid family are generally considered conserved substitutions. The tumor antigen peptide described herein may comprise all L-amino acids, all D-amino acids, or a mixture of L- and D-amino acids. In one embodiment, the tumor antigen peptide described herein comprises all L-amino acids.

[0128] In one embodiment, in a tumor antigen peptide sequence comprising or consisting of any of the sequences in SEQ ID NO: 1-269, amino acid residues that do not substantially contribute to the interaction with T cell receptors may be replaced by other amino acids, the incorporation of which does not substantially affect T cell responsiveness and does not eliminate binding to the relevant major histocompatibility complex.

[0129] Tumor antigen peptides can also be modified by replacing one or more peptide bonds, which can improve chemical stability and / or enhance biological / pharmacological properties (e.g., half-life, absorption, potency, efficiency, etc.). Typical peptide bond substitutions include esters, polyamines and their derivatives, as well as substituted alkanes and alkenes, such as aminomethyl and ketomymine. For example, the aforementioned tumor antigen peptides may have one or more peptide bonds substituted with the following bonds: –CH2NH–, –CH2S–, –CH2–CH2–, –CH=CH– (cis or trans), –CH2SO–, –CH(OH)CH2–, or –COCH2–.

[0130] Tumor antigen peptides can also be capped or modified at the N-terminus and / or C-terminus to prevent degradation, improve stability, affinity, and / or uptake. Therefore, in another respect, this disclosure provides modified tumor antigen peptides of formula Z1-X-Z2, wherein X is a tumor antigen peptide comprising or consisting of any of the amino acid sequences in SEQ ID NO: 1-269.

[0131] In one embodiment, the amino-terminal residue of the tumor antigen peptide (i.e., the free amino group at the N-terminus) is modified (e.g., to prevent degradation), for example by covalently linking a group / chemical group (Z1). Z1 may be a straight-chain or branched alkyl group of one to eight carbon atoms, or an acyl group (R-CO-), where R is a hydrophobic group (e.g., acetyl, propionyl, butyryl, isopropionyl, or isobutyryl), or an aromatic acyl group (Ar-CO-), where Ar is an aryl group. In one embodiment, the acyl group is a C1-C16 or C3-C16 acyl group (straight-chain or branched, saturated or unsaturated), and in another embodiment, a saturated C1-C6 acyl group (straight-chain or branched) or an unsaturated C3-C6 acyl group (straight-chain or branched), such as an acetyl group (CH3-CO-, Ac). In one embodiment, Z1 is absent. The carboxyl-terminal residue of the tumor antigen peptide (i.e., the free carboxyl group at the C-terminus of the tumor antigen peptide) can be modified (e.g., to prevent degradation), for example by amidation (the OH group is replaced by an NH2 group), so in this case Z2 is an NH2 group. In one embodiment, Z2 may be an isohydroxamic acid group, a nitrile group, an amide (primary, secondary, or tertiary) group, an aliphatic amine with one to ten carbon atoms (e.g., methylamine, isobutylamine, isopentylamine, or cyclohexylamine), an aromatic or aralkylamine (e.g., aniline, naphthylamine, benzylamine, cinnamylamine, or phenethylamine), an alcohol, or CH2OH. In one embodiment, Z2 is absent. In one embodiment, the tumor antigen peptide comprises any amino acid sequence of SEQ ID NO: 1-269. In one embodiment, the tumor antigen peptide consists of any amino acid sequence of SEQ ID NO: 1-269, i.e., neither Z1 nor Z2 is present.

[0132] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*01:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 20, 169, 173, 254, 265 or 266.

[0133] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*02:01 molecule, comprising or consisting of the sequences shown in SEQ ID NO: 6, 27, 30, 44, 58, 84, 124, 132, 154-156, 160, 164, 203, 221, 224, 243, 264 or 267.

[0134] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*02:03 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 23, 84, 89, 157, 159, 177, 190, 223 or 225.

[0135] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*03:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 1, 35, 158 or 202.

[0136] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*11:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 11, 25, 32, 34, 45, 86, 87, 128, 131, 191, 229 or 233-238.

[0137] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*23:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 74, 121, 122, 188, 209 or 210.

[0138] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*24:02 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 33, 122, 148, 184, 200, 210, 259 or 260.

[0139] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*25:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 16, 17, 90, 92, 104, 112, 115, 120 or 139.

[0140] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*26:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 4, 61, 103, 118 or 242.

[0141] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*29:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 21, 204, 242, 251 or 255.

[0142] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*32:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 153 or 162.

[0143] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-A*68:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 15, 49, 69, 102, 116, 117, 119, 183 or 192.

[0144] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*07:02 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 38, 47, 54, 66, 88, 205, 227, 228, 245, 246 or 256.

[0145] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*08:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 46, 99, 143 or 182.

[0146] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*13:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 51 or 160.

[0147] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*14:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 101, 126 or 232.

[0148] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*15:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 63, 98, 100, 114, 133, 244 or 248.

[0149] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*15:03 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 5, 22, 53, 130, 135, 145, 158, 181, 201, 204, 222, 226 or 257.

[0150] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*15:25 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 9, 10, 55, 83, 158, 204, 207, 226, 257 or 258.

[0151] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*18:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 12, 93-96, 105, 108, 215, 219, 239, 261 or 263.

[0152] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*27:05 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 68 or 230.

[0153] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*35:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 179 or 206.

[0154] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*35:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 38, 113 or 171.

[0155] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*35:03 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 59, 76, 113, 125, 140, 170, 247 or 268.

[0156] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*38:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 65, 75, 134, 180, 189, 200, 220, 241 or 252.

[0157] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*38:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 19, 189 or 252.

[0158] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*40:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 64, 80, 81, 129, 142, 166, 167, 194, 195, 198, 213, 216, 218 or 250.

[0159] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*40:02 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 18, 29, 52, 56, 151, 185, 198, 216 or 218.

[0160] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*44:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 97, 176, 199 or 215.

[0161] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*44:03 molecule, comprising or consisting of the sequences shown in SEQ ID NO: 3, 13, 43, 82, 97, 105-108, 110, 111, 175, 186, 196, 197, 199, 212, 214 or 215.

[0162] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*45:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 14, 24 or 109.

[0163] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*49:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 152, 165, 187, 217, 240 or 262.

[0164] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*51:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 91.

[0165] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*52:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 172 or 190.

[0166] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*54:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 245 or 269.

[0167] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*56:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 7, 8, 67, 71, 85, 137, 161 or 245.

[0168] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-B*57:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 28, 147, 163 or 208.

[0169] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*01:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 37, 40 or 193.

[0170] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*03:03 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 72.

[0171] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*03:04 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 36, 50, 60, 70, 77, 79, 136, 141, 149 or 174.

[0172] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*04:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 123, 127, 168, 178 or 253.

[0173] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*05:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 253.

[0174] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*06:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 231 or 232.

[0175] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*07:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 68.

[0176] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*07:04 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 39.

[0177] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*08:01 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 2, 138, 150 or 249.

[0178] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*08:02 molecule, which comprises or is derived from SEQ ID NO: 144 or 253. On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*12:03 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 26, 42 or 57.

[0179] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*15:02 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 136.

[0180] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*15:05 molecule, which comprises or consists of the sequence shown in SEQ ID NO: 41, 62 or 136.

[0181] On the other hand, this disclosure provides a tumor antigen peptide capable of binding to the HLA-C*16:01 molecule, which comprises or consists of the sequences shown in SEQ ID NO: 31, 48, 78, 146, 211 or 257.

[0182] The tumor antigen peptides disclosed herein can be prepared by expression in host cells containing nucleic acids encoding the tumor antigen peptides (recombinant expression) or by chemical synthesis (e.g., solid-phase peptide synthesis). The peptides can be readily synthesized using manual and / or automated solid-phase methods well known in the art. Suitable synthesis can be performed, for example, using the “T-boc” or “Fmoc” methods. Techniques and methods for solid-phase synthesis are described, for example, in *Solid-Phase Peptide Synthesis: Practical Methods* (E. Atherton and RC Sheppard, IRL Publishing, Oxford University Press, 1989). Alternatively, tumor antigen peptides can be prepared by fragment condensation, as described, for example, in Liu et al., Tetrahedral Communications, 37: 933-936, 1996; Baca et al., Journal of the American Chemical Society, 117: 1881-1887, 1995; Tam et al., International Journal of Peptide and Protein Research, 45: 209-219, 1995; Schnolzer and Kent, Science, 256: 221-221, 1992; Liu and Tam, Journal of the American Chemical Society, 116: 4149-4153, 1994; Liu and Tam, Proceedings of the National Academy of Sciences, 91: 6584-6584, 1994; and Yamashiro and Li, International Journal of Peptide and Protein Research, 31: 322-333, 1988. Other methods for synthesizing the tumor antigen peptides described herein are described in Nakagawa et al., *Journal of the American Chemical Society*, 107: 7087-7090, 1985. In one embodiment, the tumor antigen peptide is chemically synthesized (synthetic peptide). Another embodiment of this disclosure relates to a non-naturally occurring peptide, wherein the peptide consists of or is essentially composed of an amino acid sequence as defined herein and has been prepared as a pharmaceutically acceptable salt (e.g., synthesized). The salts of the tumor antigen peptides according to this disclosure differ significantly from the peptides in their in vivo state because peptides produced in vivo are not salts. The non-natural salt form of the peptide can modulate the solubility of the peptide, particularly in pharmaceutical compositions containing the peptide, such as the peptide vaccines disclosed herein. Preferably, the salt is a pharmaceutically acceptable salt of the peptide.

[0183] In one embodiment, the tumor antigen peptide described herein is substantially pure. A compound is considered "substantially pure" when isolated from its naturally associated components. Typically, a compound is substantially pure when it constitutes at least 60%, more usually 75%, 80%, or 85%, preferably more than 90%, and more preferably more than 95% of the total matter in a sample by weight. For example, chemically synthesized peptides or those produced via recombinant technologies are generally substantially free of their naturally associated components, such as components of the macromolecules from which they originate. A nucleic acid molecule is substantially pure when it is not directly adjacent (i.e., covalently linked) to a coding sequence in a naturally occurring genome that is normally adjacent to it (from an organism that produces nucleic acids). Substantially pure compounds can be obtained, for example, by extraction from natural sources, by expressing recombinant nucleic acid molecules encoding peptide compounds, or by chemical synthesis. Purity can be measured using any suitable method, such as column chromatography, gel electrophoresis, high-performance liquid chromatography, etc. In one embodiment, the tumor antigen peptide is in solution. In another embodiment, the tumor antigen peptide is in solid form, such as lyophilized form.

[0184] In one embodiment, the tumor antigen peptide is encoded by a sequence located in a non-protein coding region of the genome. In another embodiment, the tumor antigen peptide is encoded by a sequence located in an intergenic region. In yet another embodiment, the tumor antigen peptide is encoded by non-coding RNA (ncRNA).

[0185] On the other hand, this disclosure further provides synthetic long peptides (SLPs) comprising at least one tumor antigen peptide described herein. In one embodiment, the synthetic long peptide comprises at least two tumor antigen peptides, wherein at least one tumor antigen peptide is a tumor antigen peptide described herein. In one embodiment, the synthetic long peptide comprises at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, or 40 tumor antigen peptides described herein. In one embodiment, the synthetic long peptide comprises at least one tumor antigen peptide described herein, said tumor antigen peptide being linked to one or more amino acid sequences or domains that confer desired properties to the synthetic long peptide, such as sequences or domains that stabilize the synthetic long peptide and / or improve the processing and presentation of major histocompatibility complex (MHC) molecules, such as sequences comprising motifs that can be cleaved by cellular proteases (e.g., cathepsins). In another embodiment, the synthetic long peptide comprises at least one tumor antigen peptide described herein, and a tumor antigen peptide that binds to a major histocompatibility complex (MHC) class II molecule. Tumor antigen peptides may be directly linked to each other or indirectly linked via linkers (e.g., short amino acid linkers). In embodiments, the linker comprises about 4 to about 20 amino acids, or about 4 to about 15 amino acids, such as 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids. In one embodiment, the linker comprises glycine residues, serine residues, proline residues, threonine residues, or mixtures thereof. The linker may contain a sequence that facilitates the synthesis of long peptides to release tumor antigen peptides, such as a cathepsin-sensitive linker (e.g., a 4-6 amino acid linker comprising the sequences LVGS (SEQ ID NO:539), ASLG (SEQ ID NO:540), PIVG (SEQ ID NO:541), LLSV (SEQ ID NO:542), VLSVG (SEQ ID NO:543), or LLSVGG (SEQ ID NO:544), see Rabu et al., Tumor Immunology, 2019; 8(4): e1560919). In one embodiment, the synthesized long peptide is 500, 400, 300, 200, 150, 100, 90, 80, 70, 60, or 50 amino acids or shorter. In a further embodiment, the synthesized long peptide is 20 to 50, 45, or 40 amino acids, for example, from 20 or 25 amino acids to 30, 35, or 40 amino acids.

[0186] On the other hand, this disclosure further provides nucleic acids (isolated) encoding the tumor antigen peptides or tumor antigen precursor peptides or synthetic long peptides described herein. In one embodiment, the nucleic acid comprises about 24 nucleotides to about 1200 nucleotides, about 24 to about 1000, 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, for example about 24 to about 150 or 100 nucleotides, for example 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 53, 66, 69 or 72 nucleotides. As used herein, "isolated" means a peptide or nucleic acid molecule isolated from other components present in its natural environment or naturally occurring macromolecules (including other nucleic acids, proteins, lipids, carbohydrates, etc.). As used herein, "synthetic" means a peptide or nucleic acid molecule not isolated from a natural source, such as molecules prepared by recombinant technology or chemical synthesis. In one embodiment, the nucleic acid (DNA, RNA) encoding the tumor antigen peptide or synthetic long peptide comprises any of the sequences shown in the table below or the corresponding RNA sequences. In one embodiment, the nucleic acid encoding the tumor antigen peptide or synthetic long peptide is an mRNA molecule. In other embodiments, the nucleic acid encoding the tumor antigen peptide or synthetic long peptide is self-amplified mRNA (saRNA), trans-amplified mRNA (taRNA), or circular mRNA (circRNA) (see, for example, Liu et al., *Nature Reviews Cancer*, Vol. 23, August 2023, pp. 526–543).

[0187] Tumor antigen peptide sequence (SEQ ID NO) Encoding nucleotide sequence (SEQ ID NO) AAAKQSLPK (1) GCCGCTGCAAAGCAGAGCCTGCCCAAA (270) AATGHIVAV (2) GCCGCCACCGGGCACATCGTGGCGGTC (271) AEVLLQPDF (3) GCTGAGGTTCTGCTGCAGCCTGACTTC (272) AGIDFSLSSY (4) GCTGGTATAGACTTCAGTCTAAGCTCTTAC (273) AKKKENITY (5) GCAAAGAAAAAGGAAAATATCACCTAT (274) ALIKHVANA (6) GCGCTAATTAAGCACGTTGCGAACGCA (275) APAGAALRAA (7) GCCCCAGCGGGCGCAGCCCTTCGCGCAGCC (276) APEGLRTAA (8) GCCCCCGAAGGTTTGAGAACTGCCGCT (277) AQLLIKVY (9) GCCCAGCTTTTAATAAAGGTTTAC (278) AQLQQNTSL (10) GCTCAACTGCAACAAAACACTTCCTTG (279) ATVPSRGFPK (11) GCAACAGTCCCCAGCCGCGGGTTCCCTAAG (280) DEFRQLKTL (12) GACGAATTCAGGCAGCTCAAGACCCTC (281) EEINQGGRNY (13) GAAGAAATAAATCAAGGAGGAAGAAACTAT (282) EEQRVLHQA (14) GAGGAACAACGGGTGTTGCACCAAGCC (283) EVGEAQLAK (15) GAAGTGGGAGAGGCACAACTTGCCAAG (284) EVLDSLLAQY (16) GAAGTACTGGACAGCCTGCTGGCTCAGTAT (285) EVQNHSTSSY (17) GAAGTACAGAATCACTCTACTTCCTCCTAT (286) FEAIRLSL (18) TTCGAGGCTATCCGCCTAAGCCTA (287) FHNPSIGNAI (19) TTCCATAACCCAAGCATTGGCAATGCAATT (288) FLGKHTLHY (20) TTTTTAGGAAAGCATACATTGCATTAT (289) FVQENYLEY (21) TTCGTGCAGGAAAACTACCTGGAGTAC (290) GKLDNTNEY (22) GGTAAATTAGACAACACTAACGAATAC (291) GLREVSAEL (23) GGTCTCAGAGAGGTTAGTGCTGAGTTG (292) GQARGPPAA (24) GGCCAAGCGAGGGGCCCACCGGCTGCA (293) GSSNPLTLK (25) GGCTCAAGCAATCCTCTTACCTTGAAG (294) HAWPGLVVF (26) CATGCCTGGCCTGGGCTCGTCGTTTTC (295) HLSSSNHQL (27) CACCTTTCCAGTTCTAATCACCAATTA (296) HSRGGSSSESF (28) CACAGCCGCGGCGGCAGCAGCAGTGAGAGTTTC (297) KDIPSNPVVL (29) AAAGACATTCCCTCAAATCCTGTAGTACTT (298) KLVELEHTL (30) AAGCTGGTTGAACTGGAACATACTCTA (299) KSSKPITI (31) AAATCATCTAAACCCATAACCATA (300) KSVYYFIMK (32) AAATCAGTCTACTACTTCATAATGAAG (301) KTPTNYYLF (33) AAGACGCCCACCAACTACTACCTCTTC (302) KVIPGVVSK (34) AAGGTGATTCCAGGGGTGGTCAGCAAG (303) KVLGGNLTK (35) AAAGTACTAGGAGGAAACCTAACCAAA (304) LAIKQFSI (36) TTAGCCATAAAGCAATTCTCAATA (305) LNPRTSPVL (37) CTTAATCCCAGGACTAGCCCAGTCTTA (306) LPDGSRVEL (38) CTCCCAGACGGCTCCCGCGTGGAGCTG (307) LSDRVTAL (39) CTTTCTGATAGAGTTACTGCTTTA (308) LSPRLTVIV (40) TTAAGCCCTAGACTAACGGTAATTGTG (309) LSRDISSHL (41) TTGAGCAGAGACATTTCATCACATCTT (310) LTHTDILSL (42) CTTACACACACAGACATCCTCTCTCTC (311) MEVEEKKSF (43) ATGGAGGTAGAAGAGAAGAAAAGCTTT (312) MLAHYIISV (44) ATGTTAGCGCATTATATAATTAGTGTA (313) NTLDKHLAK (45) AATACCCTTGACAAACACCTTGCAAAA (314) NYRLKDTLL (46) AACTACAGACTGAAGGATACCCTGTTG (315) PSRGGTASL (47) CCTTCCCGTGGCGGGACGGCATCCCTC (316) QATVRNQQY (48) CAGGCCACAGTGAGGAATCAACAGTAT (317) QTILDKNNR (49) CAAACTATTTTGGACAAAAATAACAGA (318) RAFTEASDGSL (50) CGTGCTTTTACTGAAGCCAGTGATGGCAGTCTG (319) RATVLQSEV (51) AGGGCTACGGTCCTTCAGTCCGAGGTT (320) REEEAIHHL (52) CGCGAGGAAGAGGCCATTCACCACCTG (321) RKFASQKSSM (53) AGAAAATTTGCCAGCCAAAAATCTTCTATG (322) RPAVLPLPEL (54) CGGCCGGCTGTCCTGCCGCTGCCGGAGTTG (323) RQIILGAAM (55) AGGCAGATAATTCTAGGGGCTGCCATG (324) SEYFSLLTRA (56) TCCGAGTACTTCAGCCTGCTCACCCGCGCG (325) SIKLPMTY (57) TCCATCAAGCTACCAATGACTTAC (326) SLEHDLILI (58) TCCTTGGAACATGACCTCATTCTTATA (327) SPSLKFSSL (59) AGTCCTTCTCTCAAGTTTAGCAGCCTC (328) SSGPSREL (60) TCCTCTGGACCTAGCAGAGAACTA (329) STIDGKELLGY (61) AGTACCATTGATGGGAAAGAGCTACTTGGTTAT (330) STSKPLAF (62) AGCACGTCCAAACCCTTGGCTTTC (331) SVVAHLSTY (63) TCCGTGGTGGCTCACCTTTCTACCTAC (332) TEFQQIINL (64) ACAGAGTTTCAGCAAATAATCAATTTA (333) THEGEPTTF (65) ACCCATGAGGGAGAACCTACCACCTTC (334) TPSPARPAL (66) ACCCCCAGCCCCGCCAGGCCCGCACTC (335) TPVHSSPVA (67) ACACCAGTCCACAGCAGCCCAGTTGCA (336) TRAHVYLLR (68) ACACGTGCACACGTATATTTATTGCGG (337) TVFRGGFIWR (69) ACCGTGTTCAGAGGTGGGTTCATCTGGCGT (338) VAQARGSAM (70) GTTGCCCAGGCCAGAGGCAGTGCTATG (339) VQPSSPISSA (71) GTTCAGCCCTCCAGTCCCATCAGTTCAGCC (340) VTNPNIHLL (72) GTGACCAATCCTAATATACACCTTCTG (341) VVADTKMIEY (73) GTGGTGGCCGACACAAAGATGATTGAATAC (342) YFHVTLTEF (74) TACTTCCACGTGACCTTGACTGAGTTT (343) YHQTEEHKF (75) TATCATCAGACAGAAGAACATAAATTT (344) YPTAAQVQL (76) TATCCCACAGCGGCCCAGGTGCAACTG (345) AATSRIAEL (77) GCTGCAACCTCACGAATTGCTGAACTT (346) AAVFNPRFY (78) GCAGCTGTTTTTAACCCACGTTTTTAT (347) AAVSTHVAL (79) GCAGCTGTCTCTACACACGTGGCCCTC (348) AEIGYRNSL (80) GCAGAAATAGGTTACCGGAATTCATTG (349) AELESKTNTL (81) GCTGAACTTGAAAGCAAAACCAATACACTC (350) AEYNSDLHQF (82) GCTAGTACAACAGTGACCTCCATCAATTT (351) AIIDPNHEIEF (83) GCCATAATTGATCCTAAATCATGAAATTGAATTT (352) ALNEQIARL (84) GCATTGAATGAACAGATTGCAAGATTG (353) APGPATREA (85) GCGCCGGGGCCTGCGACCCGCGAGGCG (354) ASQESTMPK (86) GCTTCCCAGGAATCAACAATGCCCAAG (355) ATDIVTGLKQK (87) GCCACTGACATCGTGACAGGTCTGAAACAGAAA (356) Atregasal (88) GCGACCCGCGAGGCGGGCTCGGCGCTG (357) AVADHHLAQL (89) GCCGTGGCTGACCACCACCTGGCTCAGTTG (358) DAIIKIQAW (90) GATGCCATAATCAAGAATCCAGGCCTGG (359) DALQKQREV (91) GATGCTCTCCAGAAACAACGGGAGGTT (360) DARDTNMGAW (92) GATGCTCGGGACACGAACATGGGGGCGTGG (361) DEENTGADRLM (93) GACGAGGAGAACACAGGCGCCCGACCGCCTCATG (362) Dekvvity (94) GATGAAAAGGTGGTTATTACCTAT (363) DEMQDVMHF (95) GACGAGATGCAGGATGTGATGCATTTTT (364) DEMQHVQH (96) GATGAAATGCAGCATGTACAGCAT (365) DEQTPIHISW (97) GATGAACAGACTCCAATTCATATATCATGG (366) DIMKIREY (98) GATATTATGAAAAAATAAGAGAGTAT (367) DLKKLVDSL (99) GATCTCAAGAAGCTCGTTGATTCCCTG (368) DLLQHSEY (100) GATCTTCTCCAACACAGTGAATAT (369) DQIIRLEKL (101) GATCAAATAATACGCTTGGAAAAAGCTC (370) DTAMPAHSR (102) GACACTGCTATGCCTGCCCATTCAAGA (371) DWICK (103) NATIONATAGAAATAWEATHER (372) DVMHFNYTAW (104) GATGTGATGCATTTTAACTACACTGCATGG (373) EEFEYQRSY (105) NATIONSATTACHESATTACHES (374) EEINQGGRKY (106) GAGAAAATCAAGGAGAAAAAAT (375) (107) GAGGAGCTCCATGCGGCACTGAGTGAGTGG (376) EEMEWFNNY (108) GAGAATGGAGTGGTTATTACK (377) EEQVNNIKP (109) BLACKGGTGTWINTCAAACCT (378) EERFAVDEY (110) GAGGAGCGTTTTGCAGTGGACGAGTAC (379) EETLNTLRY (111) COMPACTHELPATACCCTTCGCTAT (380) (112) GAGCTCCATGCGGCACTGAGTGAGTGG (381) EPEQFVVVM (113) GAACCTGAGCAGTTTGTGGTTGTGATG (382) EQFWRSVIF (114) GAGCAATTTTGGCGTTCAGTTATTT (383) REPORT (115) GAACAGACTCCAATTCATATATCATGG (384) ESESVQRVTR (116) GAGAGCGAATCTGTGCAGAGAGTAACCCGG (385) ESKSVQRVTR (117) GAGAGCAAATCTGTGCAGAGAGTAACGCGG (386) ESYSFESSKF (118) GAGTCCTACTCTTTTGAGAGCAGCAAATTT (387) ETIGTGGFAK (119) GAAACTATTGGGACAGGTGGCTTTGCAAAG (388) ETVSEKKTF (120) GAGACTGTCAGTGAAAAAAAAAACTTTT (389) EYLKVGSEGHF (121) GAGTACCTGAAGGTGGGCTCCGAGGGACACTTC (390) EYNSDLHQF (122) GAGTACAACAGTGACCTCCATCAATTT (391) FFNLTLKQV (123) TTCTTCAACCTCACGCTCAAGCAGGTC (392) FLFLKEVKV (124) TTCCTATTTCTTAAAGAAGTAAAAGTT (393) FPAGAQVRL (125) TTCCCTGCCGGAGCCCAGGTACGCCTG (394) FQYEVAVL (126) TTCCAGTATGAAGTGGCTGTGCTG (395) FWDGKIVLV (127) TTTTGGGATGGGAAAATCGTGTTGGTT (396) GAMGYGYEK (128) GGGGCCATGGGCTATGGCTATGAGAAA (397) GEVGSEVHL (129) GGCGAGGTGGGTTCTGAGGTTCACCTA (398) GKFQGLIEKF (130) GGGAAGTTCCAGGGTCTGATTGAGAAGTTT (399) GLFTWTHMK (131) GGTCTCTTCACATGGACGCACATGAAA (400) GLTGVIMTI (132) GGTCTCACTGGAGTGATCATGACAATA (401) HAINHGTAY (133) CATGCCATAAACCATGGTACTGCATAC (402) HHSDWGNIMW (134) CATCACTCAGATTGGGGAAACATCATGTGG (403) HKVDKNEAF (135) CATAAAGTTGATAAAAATGAGGCTTTT (404) HNVDHASVL (136) CATAACGTGGATCACGCCAGTGTGTTG (405) HPTPVSQA (137) CACCCCACCCCAGTGTCACAGGCC (406) HVADGSATEM (138) CATGTTGCTGATGGAAGTGCTACTGAAATG (407) HVIEDIKGRW (139) CATGTAATTGAAGATATCAAAGGGAGGTGG (408) HVQPGQYVL (140) CACGTGCAGCCTGGCCAGTACGTGCTG (409) IAADGHTDL (141) ATCGCTGCAGATGGGCACACGGACCTG (410) IEARNQVFL (142) (411) IGNIKKTL (143) (412) IDENFAEL (144) ATAATTGATGAAACTTTGCHAPTER (413) IQRGGGIFF (145) ATCCAGCGAGGTGGAGGCATCTTTCTTC (414) ISVKGRIY (146) ATTTCGGTTAAAAGGAGAATTTAT (415) ITKTLKSNSW (147) ATCACCAACTGAAAACTACGCTGG (416) IYFKNSENLW (148) FATHERTTAGAATTSPARTATCTATGG (417) KAIEVLLTL (149) AAGGCCATTGAAGTTTTGTTAACTCTC (418) KATDIVTGL (150) AAGGCCACTGACATCGTGACAGGTCTG (419) KDVNIPTL (151) AAAGATGTAAACATCCAACCTTG (420) KEKETVQV (152) NO RESPONSE (421) KIFFFKDRF (153) AAGATCTTTTTCTTCAAAGACAGGTTC (422) KIVDFSYSV (154) AAGATAGTGGACTTTTTCCTACAGTGTT (423) KLDEHIAYL (155) AAACTAGATTATTGCCTACCTG (424) KLGQVFFL (156) AAGCTCGGGCAAGTGTTCTTCTTG (425) KLKEEITQL (157) AAGCTGAAAGAAAWARDWARD (426) KLYQSIIGY (158) NEW CHARACTERISTICS (427) KMNACKLEEL (159) AAAATGAACGCCAAGCTAGAAGAGCTC (428) KMSELQTYV (160) AAAATGTCAGAGCTGCAGACCTATGTT (429) KPTVQPWIA (161) AAGCCTACAGTCCAGCCATGGATAGCA (430) KQMSISTGL (162) AAGCAGATGTCCATTTCAACAGGCTTA (431) KTLKSNSW (163) AAAACACTGAAAAGCAATAGCTGG (432) KVQEQPPAI (164) AAGGTCCAGGAGCAGCCACCGGCGATC (433) LEKAFSEI (165) CTAGAAAAAGCTTTCTCTGAAATA (434) LERDQLKESL (166) CTGGAGAGAGACCAACTCAAGGAAAGCCTG (435) LEVEDRTSL (167) TTGGAAGTTGAAGATCGTACTTCGTTG (436) LFDKSINEF (168) CTTTTCGATAAAAGCATAAATGAATTT (437) LLDKDVSMY (169) CTCCTGGACAAGGACGTGAGCATGTAC (438) LPAPYQHQL (170) CTCCCAGCCCCCTACCAACACCAGCTG (439) LPEEQDRLL (171) CTGCCTGAGGAGCAGGATCGTTTGCTC (440) LQRITKTL (172) CTCCAACGTATCACCAAAACACTG (441) LSDSFSDLY (173) CTGTCTGATTCTTTCAGTGACCTGTAT (442) LSHTGKLAL (174) CTGAGCCACACAGGAAAACTTGCCTTA (443) MEELGKVGF (175) ATGGAGGAATTAGGCAAAGTGGGTTTT (444) MESPSAPPHRW (176) ATGGAGTCTCCCTCGGCCCCTCCCCACAGATGG (445) MTNEKTTKV (177) ATGACTAACGAAAAAACTACCAAAGTA (446) MWDQRLVRL (178) ATGTGGGATCAGAGGCTGGTGAGGTTG (447) NAYEDLSQKY (179) AATGCATATGAGGATCTTAGTCAAAAATAC (448) NHENQKVQL (180) AACCATGAAAATCAGAAAGTGCAGTTA (449) NKITTKNAF (181) AATAAAATCACTACCAAGAATGCTTTT (450) NLHLKTTSL (182) AATCTACATTTGAAGACAACATCACTC (451) NSTDFTTDR (183) AACTCTACAGACTTTACCACTGACAGA (452) NYPKSIHSF (184) AATTATCCCAAGAGCATACATTCTTTT (453) QEGPKQUEST (185) CAAGAGGGGCCTAAGCAAGAGGCACTG (454) QEMEELGKVGF (186) CAGGAGATGGAGGAATTAGGCAAAGTGGGTTTT (455) QEVQLMTKI (187) CAGGAGGTACAACTAATGACCAAATT (456) QFYFNKENF (188) CAATTCTACTTCAACAAAGAAAATTTTT (457) QHQETINTL (189) REGISTRATION REGULATION (458) QQKVVITKV (190) CAGCAGAAGGTTGTGATTACCAAGGTT (459) QTNSPPPPK (191) CAGACGAATTCCCCCCCCCCCCCCAAA (460) QVIETQDPPR (192) CAGGTCATCGAGACTCAGGACCCCCCACGC (461) RAPPLGNPL (193) CGAGCTCCTCCCCTGGGAAATCCACTA (462) REACTION (194) AGGGAAGCTGGAAAAGAAGCGGCCCTG (463) REIREENKL (195) AGGGAGATTCGAGAAGAAAACAAACTC (464) REIREENKLY (196) AGGGAGATTCGAGAAGAAAACAAACTCTAC (465) RELLETERRY (197) CGGGAGCTGCTAGAGACCGAGCGGCGCTAC (466) RELYANVVL (198) CGGGAACTCTACGCCAACGTGGTGCTG (467) REMPGGPVW (199) AGGGAAATGCCAGGGGGGCCCGTATGG (468) RHQEMFHYF (200) AGGCACCAGGAGATGTTCCACTATTTC (469) RCQTQEVSY (201) AGAAAACAAACCCAAAGGTCAGCTAT (470) RLSPLSLTGK (202) CGTCTGTCACCCCTTTCTTTGACTGGGAAA (471) RLWNETVEL (203) AGGCTGTGGAATGAGACCGTGGAGCTT (472) RMVEMFLEY (204) CGAATGGTTGAGATGTTTCTGGAATAT (473) RPRVSSTEM (205) CGGCCTCGAGTATCCTCCACAGAAATG (474) RPVNVVNVY (206) AGGCCAGTCAATGTCGTCAATGTATAC (475) RQRKLQEY (207) CGGCAGAGAAAGCTTCAGGAGTAC (476) RTLPVDSSHGF (208) CGTACATTGCCAGTAGATTCTTCTCATGGTTTC (477) RYFDALLKL (209) CGTTACTTCGATGCCCTGCTGAAATTG (478) RYQATGLHF (210) CGGTACCAGGCAACTGGCTTACATTTC (479) SAGSRAVL (211) TCAGCCGGCTCCCGGGCGGTGCTA (480) SEDRPKQRW (212) AGTGAAGACAGACCAAAACAACGCTGG (481) SEEETRVVF (213) TCAGAAGAGGAGACCCGGGTTGTCTTC (482) SEELHAALSEW (214) TCCGAGGAGCTCCATGCGGCACTGAGTGAGTGG (483) SENLLGKQF (215) TCAGAGAATTTGCTTGGAAAACAGTTT (484) SEVDGNRMTL (216) TCAGAAGTTGATGGTAACAGGATGACCTTG (485) SEVSKIVTV (217) AGTGAAGTCAGCAAAATTGTCACAGTC (486) SEYSVHSSL (218) TCAGAATATTCTGTGCACTCATCTTTG (487) SEYVHSSF (219) TCTGAGTATGTCCACTCCTCTTTC (488) SHVQPGQYVL (220) AGCCACGTGCAGCCTGGCCAGTACGTGCTG (489) SILQFVHMV (221) AGTATCCTGCAGTTTGTACACATGGTC (490) SKMSELQTY (222) TCTAAAATGTCAGAGCTGCAGACCTAT (491) SLIEKVTQL (223) TCTCTGATAGAAAAAGTTACCCAATTA (492) SLQEKVAKA (224) TCATTACAGGAAAAAGTGGCCAAGGCT (493) SLRNGVLLA (225) AGCCTTCGGAATGGAGTGCTGCTGGCC (494) SMYLHTEGF (226) TCAATGTACCTCCACACAGAGGGCTTC (495) SPDWRRLAL (227) TCCCCAGATTGGAGGAGGCTGGCTCTG (496) SPRPESGTV (228) TCTCCCAGACCAGAGTCGGGTACTGTT (497) SQQKVVITK (229) TCCCAGCAGAAGGTTGTGATTACCAAG (498) SRNAQTFGF (230) TCCCGGAATGCTCAAACCTTCGGATTT (499) SRSMRLLLL (231) TCCAGAAGCATGCGGCTGCTCCTATTG (500) SRVAKTNSL (232) AGTCGGGTGGCCAAGACCAACTCCTTA (501) SSQIPSSVNK (233) TCATCTCAAATACCCAGTAGTGTAAATAAG (502) STIATSHPK (234) TCTACAATAGCTACCTCCCACCCCAAG (503) STIYLPLKR (235) TCCACTATTTACTTACCTCTGAAACGA (504) SVIDEPVRLK (236) TCTGTTATTGATGAGCCTGTACGGCTAAAA (505) SVPLSDALLNK (237) AGTGTTCCGCTAAGTGATGCTCTTTTAAATAAA (506) SVQENIQQK (238) AGTGTCCAGGAAAATATACAGCAGAAA (507) TEEELKVAH (239) ACTGAAGAGGAACTTAAAGTTGCTCAT (508) TETSNALKV (240) ACAGAGACTTCAAATGCACTAAAGGTT (509) THVSQIFNMI (241) ACTCATGTTTCTCAGATTTTTAATATGATA (510) TIIDRSFRY (242) ACTATTATTGATCGTTCCTTCAGGTAT (511) TLFDYEVRL (243) ACCCTCTTCGACTACGAGGTCCGCCTG (512) TLHDTRTHF (244) ACTCTTCATGATACAAGAACACATTTT (513) TPAPVEKSPA (245) ACCCCGGCGCCGGTGGAGAAATCCCCGGCT (514) TPMPKDVRQSL (246) ACACCGATGCCAAAAGATGTTCGGCAGAGTCTC (515) TPSPIIQQL (247) ACTCCCAGCCCCATCATCCAGCAGTTG (516) TVNQFLTQY (248) ACAGTAAATCAGTTTCTTACCCAATAC (517) VADHHLAQL (249) GTGGCTGACCACCACCTGGCTCAGTTG (518) VEDRTSLVL (250) GTTGAAGATCGTACTTCGTTGGTTTTA (519) VFMKDGFFY (251) GTTTTCATGAAAGATGGATTTTTCTAT (520) VHQGGVELQQL (252) GTGCACCAGGGAGGCGTGGAGCTGCAGCAGCTG (521) VIDEPVRL (253) GTTATTGATGAGCCAGTACGGCTA (522) VLDSFLQGY (254) GTCCTGGACAGCTTCCTCCAGGGCTAC (523) VLLHEVFTY (255) GTCCTGCTGCACGAGGTTTTCACCTAT (524) VPRKDVGNTL (256) GTACCCAGGAAGGATGTGGGAAACACTTTG (525) VQAIRITSY (257) GTACAGGCTATCAGGATAACTTCCTAT (526) VQRLRFEVY (258) GTGCAGAGGCTGCGCTTTGAGGTGTAC (527) VYGIRLEHF (259) GTATATGGAATTCGACTGGAACATTTT (528) VYKVVGNLL (260) GTCTATAAGGTGGTCGGGAACCTCCTG (529) YEDLSQKY (261) TATGAGGATCTTAGTCAAAAATAC (530) YEIEARNQV (262) TATGAAATTGAAGCCAGAAATCAAGTT (531) YEIEARNQVF (263) TATGAAATTGAAGCCAGAAATCAAGTTTTT (532) YLLDKDVSM (264) TACCTCCTGGACAAGGACGTGAGCATG (533) YLLDKDVSMY (265) TACCTCCTGGACAAGGACGTGAGCATGTAC (534) YLLDKDVSMYP (266) TACCTCCTGGACAAGGACGTGAGCATGTACCCT (535) YMLEMDNSMKI (267) TATATGCTGGAGATGGACAACTCAATGAAAATT (536) YPMRILYDL (268) TATCCAATGAGAATTTTATATGACCTT (537) YPWPYGRQT (269) TACCCCTGGCCCTACGGCCGACAGACG (538)

[0188] Of course, due to the degeneracy of the genetic code, the tumor antigen peptides described in this article can be encoded by variants of the above sequences.

[0189] The nucleic acids disclosed herein can be used for recombinant expression of tumor antigen peptides or synthetic long peptides and can be contained in vectors or plasmids, such as cloning vectors or expression vectors, which can be transfected into host cells. In one embodiment, this disclosure provides a cloning, expression, or viral vector or plasmid containing a nucleic acid sequence encoding a tumor antigen peptide of this disclosure. Alternatively, the nucleic acid encoding a tumor antigen peptide of this disclosure can be integrated into the genome of a host cell. In either case, the host cell expresses the tumor antigen peptide or protein encoded by the nucleic acid. The term “host cell” as used herein refers not only to a specific test cell but also to the progeny or potential progeny of such cells. Host cells can be any prokaryotic cell (e.g., *Escherichia coli*) or eukaryotic cell (e.g., insect cells, yeast cells, plant cells, or mammalian cells) capable of expressing the tumor antigen peptides described herein. The vector or plasmid contains elements required for transcription and translation of the inserted coding sequence and may contain other components such as resistance genes, cloning sites, etc. Methods well known to those skilled in the art can be used to construct expression vectors containing a peptide or polypeptide coding sequence and appropriate transcription and translation control / regulatory elements operatively linked thereto. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo gene recombination. Such techniques are described in Sambrook et al. (1989), *Molecular Cloning: A Laboratory Manual*, Cold Spring Harbor Laboratory Press, Plainview, NY; and Ausubel, FM et al. (1989), *Laboratory Guide to Molecular Biology*, John Wiley International Publishing Co., NY. "Operable linkage" refers to the juxtaposition of components (specifically nucleotide sequences) that enables them to perform their normal functions. Therefore, a coding sequence operablely linked to a regulatory sequence refers to a nucleotide sequence configuration in which the coding sequence can be expressed under the control of the regulatory sequence, i.e., transcriptional and / or translational control. The terms "regulatory / control region" or "regulatory / control sequence" used in this paper refer to non-coding nucleotide sequences involved in regulating the expression of coding nucleic acids. Therefore, the term regulatory region includes promoter sequences, regulatory protein binding sites, upstream activating sequences, etc. Vectors (e.g., expression vectors) may have the necessary 5' upstream and 3' downstream regulatory elements, such as promoter sequences (e.g., cytomegalovirus, phosphoglycerate kinase, and elongation factor-1α promoters), ribosome recognition and binding TATA boxes, and a 3' untranslated region AAUAAA transcription termination sequence to facilitate efficient gene transcription and translation in their respective host cells. Other suitable promoters include the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus long terminal repeat promoter, Moloney murine leukemia virus promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, and Rous sarcoma virus promoter. Human gene promoters may also be used, including but not limited to actin promoters, myosin promoters, hemoglobin promoters, and creatine kinase promoters. In some embodiments, inducible promoters are also considered as part of the expression vector for tumor antigen peptides.This provides a molecular switch that can turn the expression of a target polynucleotide sequence on or off. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, or tetracycline promoters. Examples of vectors include plasmids, autonomously replicating sequences, and transposable factors. Other exemplary vectors include, but are not limited to, plasmids, phages, granules, artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC)), bacteriophages (such as λ phage or M13 phage), and animal viruses. Examples of animal virus classes used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). Examples of expression vectors include Lenti-X for expression in mammalian cells. Bicistronic expression system (neomycin resistance) vector (Contech), pClneo vector (Promega); pLenti4 / V5-DEST for lentivirus-mediated gene transfer and expression in mammalian cells. pLenti6 / V5-DEST And pLenti6.2N5-GW / lacZ (Invitrogen). The tumor antigen peptide coding sequences disclosed herein can be ligated into such expression vectors to express tumor antigen peptides in mammalian cells.

[0190] In some embodiments, the nucleic acid encoding the tumor antigen peptide disclosed herein is provided as a viral vector. The viral vector may be derived from adenovirus, vaccinia virus, retrovirus, lentivirus, or foam virus. As used herein, the term "viral vector" refers to a nucleic acid vector construct containing at least one viral-derived element and having the ability to be packaged into viral vector particles. The viral vector may replace non-essential viral genes with the coding sequence encoding the various tumor antigen peptides or synthetic long peptides described herein. In another embodiment, the nucleic acid encoding the tumor antigen peptide or synthetic long peptide disclosed herein is provided as a self-amplifying or self-replicating RNA (saRNA or srRNA) vector. The self-replicating RNA is derived from a positive-sense RNA virus in which structural proteins have been removed and replaced with the target heterologous gene. Self-replicating RNA has been successfully derived from flaviviruses, nodaviruses, nidoviruses, and alphaviruses. The therapeutic version of this technology trans-provides structural proteins to create single-cycle viral replicon particles (VRPs) (see, for example, Aliahmad et al., Next-Generation Self-Replicating RNA Vectors for Vaccines and Immunotherapy, Cancer Gene Therapy (2022). https: / / doi.org / 10.1038 / s41417-022-00435-8). Vectors and / or particles can be used to transfer DNA, RNA, or other nucleic acids into cells in vitro or in vivo. Various forms of viral vectors are known in the art.

[0191] In one embodiment, the nucleic acid (DNA, RNA) encoding the tumor antigen peptide or synthetic long peptide of this disclosure is contained in vesicles or nanoparticles, such as lipid vesicles (e.g., liposomes) or lipid nanoparticles (LNPs), or any other suitable carrier (e.g., an mRNA packaging system). Therefore, in another aspect, this disclosure provides vesicles or nanoparticles, such as lipid vesicles or nanoparticles, containing nucleic acids (e.g., mRNA) encoding one or more of the tumor antigen peptides or synthetic long peptides described herein.

[0192] As used in this article, liposomes are microscopic lipid vesicles composed of a phospholipid bilayer or any similar amphiphilic lipid (such as sphingolipids) that enclose an internal aqueous medium.

[0193] The term "liposome nanoparticle" refers to a liposome-like structure that may comprise one or more lipid bilayer rings surrounding an internal aqueous medium (similar to liposomes) or a micellar-like structure encapsulating molecules (such as nucleic acids) in a non-aqueous core. Lipid nanoparticles typically contain cationic lipids, such as ionizable cationic lipids. Examples of cationic lipids that can be used in lipid nanoparticles include DOTMA, DOSPA, DOTAP, DOPE, ePC, DLin-MC3-DMA, C12-200, ALC-0315, cKK-E12, Lipid H (SM-102), OF-Deg-Lin, A2-Iso5-2DC18, 306Oi10, BAME-O16B, TT3, 9A1P9, FTT5, and COATSOME. SS-E, COATSOME SS-EC, COATSOME SS-OC and COATSOME SS-OP (see, for example, Hou et al., Nature Review Materials, Vol. 6, pp. 1078-1094 (2021); Tenchov et al., ACS Nano, 15, 16982-17015 (2021)).

[0194] Liposomes and lipid nanoparticles often incorporate other lipid components, such as lipids, lipid-like materials, and polymers, to improve the properties of the liposomes or nanoparticles, such as stability, delivery efficiency, tolerability, and biodistribution. These include phospholipids (such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, and phosphatidylglycerol), such as 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC) and DOPE, sterols (such as cholesterol and cholesterol derivatives), and polyethylene glycol-modified lipids (PEG-lipids), such as 1,2-dimyristoyl-rac-glycerol-3-methoxy polyethylene glycol-2000 (PEG2000-DMG) and 1,2-distearyl-rac-glycerol-3-methoxy polyethylene glycol-2000 (PEG2000-DSG).

[0195] In one embodiment, the lipid nanoparticles according to this disclosure comprise one or more cationic lipids, such as ionizable cationic lipids. Examples of ionizable cationic lipids are listed in PCT Publications WO 2017 / 061150 and WO 2019 / 188867, which cover those marketed under the trade name COATSOME. SS-E, COATSOME SS-EC, COATSOME SS-OC and COATSOME SS-OP is a commercially available ionizable cationic lipid.

[0196] Nucleic acids (such as mRNA) encoding one or more tumor antigen peptides can be modified, for example, to improve stability and / or reduce immunogenicity. For example, a 5' cap can be added to stabilize the molecule and reduce immunogenicity (e.g., as described in U.S. Patents 10,519,189 and 10,494,399). One or more nucleosides of the mRNA can be modified or substituted with 1-methylpseuuridine, pseudouridine (ψ), N6-methyladenosine, 5-methylcytidine, and / or 5-methyluridine to improve molecular stability, improve translation efficiency, and / or reduce the molecule's recognition by the innate immune system. One form of nucleoside modification is described in U.S. Patent 9,371,511. Other types of modifications that can be made to mRNA include incorporation of anti-reverse cap analogs (ARCA), 5'-methyl-cytidine triphosphate (m5CTP), N6-methyl-adenosine-5'-triphosphate (m6ATP), 2-thiouridine triphosphate (s2UTP), pseudouridine triphosphate, N1-methylpseudouridine triphosphate, or 5-methoxyuridine triphosphate (5moUTP). mRNA may also include additional modifications to the 5′- and / or 3′-untranslated region (UTR) and polyadenosine (polyA) tail (see, for example, Kim et al., Molecular and Cytotoxicology, Vol. 18, No. 1 (2022): 1-8). The poly(A) tail preferably comprises 100-200 nucleotides, more preferably 120-150 nucleotides, and may contain modified adenosine. All of these modifications, as well as other modifications to nucleic acids encoding tumor antigen peptides (such as mRNA), are covered in this disclosure.

[0197] On the other hand, this disclosure provides major histocompatibility complex class I molecules that contain (i.e. present or bind) one or more colorectal tumor antigen peptides that contain or consist of the sequences shown in SEQ ID NO: 1-269.

[0198] In one embodiment, the major histocompatibility complex (MHC) class I molecule is HLA-A*01:01. In one embodiment, the MHC class I molecule is HLA-A*02:01. In one embodiment, the MHC class I molecule is HLA-A*02:03. In one embodiment, the MHC class I molecule is HLA-A*03:01. In one embodiment, the MHC class I molecule is HLA-A*11:01. In one embodiment, the MHC class I molecule is HLA-A*23:01. In one embodiment, the MHC class I molecule is HLA-A*24:02. In one embodiment, the MHC class I molecule is HLA-A*25:01. In one embodiment, the MHC class I molecule is HLA-A*26:01. In one embodiment, the major histocompatibility complex (MHC) class I molecule is HLA-A*29:01. In one embodiment, the MHC class I molecule is HLA-A*32:01. In one embodiment, the MHC class I molecule is HLA-A*68:01. In one embodiment, the MHC class I molecule is HLA-B*07:02. In one embodiment, the MHC class I molecule is HLA-B*08:01. In one embodiment, the MHC class I molecule is HLA-B*13:01. In one embodiment, the MHC class I molecule is HLA-B*13:02. In one embodiment, the MHC class I molecule is HLA-B*14:02. In one embodiment, the MHC class I molecule is HLA-B*15:01. In one embodiment, the major histocompatibility complex (MHC) class I molecule is HLA-B*15:02. In one embodiment, the MHC class I molecule is HLA-B*15:03. In one embodiment, the MHC class I molecule is HLA-B*15:25. In one embodiment, the MHC class I molecule is HLA-B*18:01. In one embodiment, the MHC class I molecule is HLA-B*27:05. In one embodiment, the MHC class I molecule is HLA-B*35:01. In one embodiment, the MHC class I molecule is HLA-B*35:02. In one embodiment, the MHC class I molecule is HLA-B*35:03. In one embodiment, the MHC class I molecule is HLA-B*38:01.In one embodiment, the major histocompatibility complex (MHC) class I molecule is HLA-B*38:02. In one embodiment, the MHC class I molecule is HLA-B*40:01. In one embodiment, the MHC class I molecule is HLA-B*40:02. In one embodiment, the MHC class I molecule is HLA-B*44:03. In one embodiment, the MHC class I molecule is HLA-B*45:01. In one embodiment, the MHC class I molecule is HLA-B*46:01. In one embodiment, the MHC class I molecule is HLA-B*49:01. In one embodiment, the MHC class I molecule is HLA-B*51:01. In one embodiment, the MHC class I molecule is HLA-B*52:01. In one embodiment, the major histocompatibility complex (MHC) class I molecule is HLA-B*54:01. In one embodiment, the MHC class I molecule is HLA-B*56:01. In one embodiment, the MHC class I molecule is HLA-B*57:01. In one embodiment, the MHC class I molecule is HLA-C*01:02. In one embodiment, the MHC class I molecule is HLA-C*03:03. In one embodiment, the MHC class I molecule is HLA-C*03:04. In one embodiment, the MHC class I molecule is HLA-C*04:01. In one embodiment, the MHC class I molecule is HLA-C*05:01. In one embodiment, the MHC class I molecule is HLA-C*06:02. In one embodiment, the major histocompatibility complex (MHC) class I molecule is HLA-C*07:01. In one embodiment, the MHC class I molecule is HLA-C*07:04. In one embodiment, the MHC class I molecule is HLA-C*08:01. In one embodiment, the MHC class I molecule is HLA-C*08:02. In one embodiment, the MHC class I molecule is HLA-C*12:03. In one embodiment, the MHC class I molecule is HLA-C*15:02. In one embodiment, the MHC class I molecule is HLA-C*15:05. In one embodiment, the MHC class I molecule is HLA-C*16:01.

[0199] In one embodiment, a tumor antigen peptide (e.g., comprising or consisting of the sequence shown in SEQ ID NO: 1-269) is non-covalently bound to a major histocompatibility complex (MHC) class I molecule (i.e., the tumor antigen peptide is loaded onto or non-covalently bound to a peptide-binding groove / pocket of the MHC class I molecule). In another embodiment, the tumor antigen peptide is covalently linked / bound to a MHC class I molecule (α chain). In such a construct, the tumor antigen peptide and the MHC class I molecule (α chain) are produced as a synthetic fusion protein, typically with short (e.g., 5 to 20 residues, preferably about 8-12, e.g., 10) flexible linkers or spacer regions (e.g., polyglycine linkers). Alternatively, this disclosure provides a nucleic acid encoding a fusion protein comprising a tumor antigen peptide as defined herein, which is fused to a MHC class I molecule (α chain). In one embodiment, the MHC class I molecule (α chain)-peptide complex is polymerized. Therefore, on the other hand, this disclosure provides major histocompatibility complex (MHC) class I polymers loaded (covalently or non-covalently) with the tumor antigen peptides described herein. These polymers can be tagged, such as with fluorescent tags, thereby allowing for the detection of the polymers. Numerous strategies have been developed for the production of MHC polymers, including MHC dimers, tetramers, pentamers, octamers, etc. (reviewed in Bakker and Schumacher, Current Views in Immunology, 2005, 17:428-433). MHC polymers can be used, for example, for the detection and purification of antigen-specific T cells. Therefore, on the other hand, this disclosure provides a method for detecting or purifying (isolating, enriching) CD8+ T lymphocytes specific to the tumor antigen peptide described herein, the method comprising contacting a cell population with a major histocompatibility complex class I molecule multimer loaded (covalently or non-covalently) with the tumor antigen peptide; and detecting or isolating CD8+ T lymphocytes bound to the major histocompatibility complex class I molecule multimer. CD8+ T lymphocytes bound to the major histocompatibility complex class I molecule multimer can be isolated using known methods, such as fluorescence-activated cell sorting (FACS) or magnetically activated cell sorting (MACS).

[0200] On the other hand, this disclosure provides cells (e.g., host cells), in one embodiment being isolated cells containing nucleic acids, vectors, or plasmids of this disclosure, i.e., nucleic acids or vectors encoding one or more tumor antigen peptides or synthetic long peptides. On the other hand, this disclosure provides cells expressing on their surface a major histocompatibility complex class I molecule (e.g., one of the alleles disclosed above) that binds to or presents the tumor antigen peptides of this disclosure. In one embodiment, the host cell is a eukaryotic cell, such as a mammalian cell, preferably a human cell, cell line, or immortalized cell. In another embodiment, the cell is an antigen-presenting cell (APC), such as a dendritic cell. In one embodiment, the host cell is a primary cell, cell line, or immortalized cell. Nucleic acids and vectors can be introduced into the cells using conventional transformation or transfection techniques. The terms "transformation" and "transfection" refer to techniques for introducing exogenous nucleic acids into host cells, including calcium phosphate or calcium chloride coprecipitation, DEAE-glucan-mediated transfection, lipid transfection, electroporation, microinjection, and virus-mediated transfection. Suitable methods for transforming or transfecting host cells can be found, for example, in Sambrook et al. (ibid.) and other laboratory manuals. Methods for introducing nucleic acids into mammalian cells in vivo are also known and can be used to deliver the vectors or plasmids of this disclosure to subjects for gene therapy.

[0201] A variety of methods known in the art can be used to load one or more tumor antigen peptides onto cells such as antigen-presenting cells. As used herein, “loading cells with tumor antigen peptides” refers to transfecting cells with RNA or DNA encoding tumor antigen peptides, or the tumor antigen peptides themselves, or transforming antigen-presenting cells with nucleic acids encoding tumor antigen peptides. Cells can also be loaded by contacting them with exogenous tumor antigen peptides that can directly bind to major histocompatibility complex class I molecules present on the cell surface (e.g., peptide pulsed cells). Tumor antigen peptides can also be fused to domains or motifs that facilitate their presentation by major histocompatibility complex class I molecules, such as endoplasmic reticulum (ER) recovery signals, C-terminal lysine-aspartate-glutamate-leucine sequences (see Wang et al., *European Journal of Immunology*, December 2004; 34(12):3582-94).

[0202] On the other hand, this disclosure provides compositions or peptide combinations / mixtures comprising any one or any combination of tumor antigen peptides (or nucleic acids encoding said peptides) as defined herein. In one embodiment, the composition comprises any combination of tumor antigen peptides as defined herein (any combination of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more tumor antigen peptides), or a combination of nucleic acids encoding said tumor antigen peptides. Compositions comprising any combination / subcombination of tumor antigen peptides as defined herein are covered in this disclosure. In another embodiment, the combination or mixture may comprise one or more known tumor antigens.

[0203] Therefore, on the other hand, this disclosure provides compositions comprising any one or any combination of tumor antigen peptides as defined herein (e.g., comprising or consisting of the sequence shown in SEQ ID NO: 1-269) and cells expressing major histocompatibility complex class I molecules (e.g., major histocompatibility complex class I molecules described above). Antigen-presenting cells used in this disclosure are not limited to specific cell types and include professional antigen-presenting cells, such as dendritic cells (DCs), Langerhans cells, macrophages, and B cells, which are known to present protein antigens on their cell surface for recognition by CD8+ T lymphocytes. For example, antigen-presenting cells can be obtained by inducing dendritic cells from peripheral blood mononuclear cells and then contacting (stimulating) them with tumor antigen peptides in vitro, ex vivo, or in vivo. Antigen-presenting cells can also be activated in vivo to present tumor antigen peptides, wherein one or more tumor antigen peptides of this disclosure are administered to a subject, and antigen-presenting cells presenting tumor antigen peptides are induced in the subject. The phrase “inducing antigen-presenting cells” or “stimulating antigen-presenting cells” includes contacting or loading cells with one or more tumor antigen peptides, or nucleic acids encoding tumor antigen peptides, such that the tumor antigen peptides are presented on their surface by major histocompatibility complex class I molecules. As described herein, according to this disclosure, tumor antigen peptides can be indirectly loaded, for example using longer peptides / polypeptides (including natural proteins) containing the tumor antigen peptide sequence, which are subsequently processed within the antigen-presenting cells (e.g., by proteases) to generate a major histocompatibility complex class I molecule / tumor antigen peptide complex on the cell surface. After loading antigen-presenting cells with tumor antigen peptides and allowing the antigen-presenting cells to present the tumor antigen peptides, the antigen-presenting cells can be administered as a vaccine to a subject. For example, ex vivo administration may include the steps of: (a) collecting antigen-presenting cells from a first subject; (b) contacting / loading the antigen-presenting cells of step (a) with / loading the tumor antigen peptides to form a major histocompatibility complex class I molecule / tumor antigen peptide complex on the surface of the antigen-presenting cells; and (c) administering the peptide-loaded antigen-presenting cells to a second subject in need.

[0204] The first and second subjects may be the same subject (e.g., autologous vaccines) or different subjects (e.g., allogeneic vaccines). Alternatively, according to this disclosure, the use of the tumor antigen peptides (or combinations thereof) described herein in the preparation of compositions for inducing antigen-presenting cells (e.g., pharmaceutical compositions) is provided. Furthermore, this disclosure provides methods or processes for preparing pharmaceutical compositions for inducing antigen-presenting cells, wherein said methods or processes include the step of mixing or formulating the tumor antigen peptides or combinations thereof with a pharmaceutically acceptable carrier. Cells expressing major histocompatibility complex class I molecules (e.g., any of the above-described HLA molecules) loaded with any or any combination of tumor antigen peptides as defined herein (e.g., antigen-presenting cells) can be used to stimulate / amplify CD8+ T lymphocytes, such as autologous CD8+ T lymphocytes. Therefore, on the other hand, this disclosure provides compositions comprising any or any combination of tumor antigen peptides as defined herein (or nucleic acids or carriers encoding them), cells expressing major histocompatibility complex class I molecules, and T lymphocytes, more specifically CD8+ T lymphocytes (e.g., cell populations containing CD8+ T lymphocytes).

[0205] In one embodiment, the composition further comprises a buffer, excipient, carrier, diluent, and / or culture medium (e.g., a culture medium). In a further embodiment, the buffer, excipient, carrier, diluent, and / or culture medium are pharmaceutically acceptable buffers, excipients, and other components. (The current document content is too long; Doubao has only read the first 85%.)

[0206] Carriers, diluents, and / or culture media. As used herein, “pharmaceutically acceptable buffers, excipients, carriers, diluents, and / or culture media” includes any solvent, buffer, binder, lubricant, filler, thickener, disintegrant, plasticizer, coating, barrier layer formulation, stabilizer, delayed-release agent, dispersion medium, coating agent, antibacterial and antifungal agent, isotonic agent, etc., that is physiologically compatible, does not interfere with the bioavailability of the active ingredient, and is non-toxic to the subject. Such media and reagents are well known in the art for use with pharmaceutically active substances (Rowe et al., Handbook of Pharmaceutical Excipients, 2003, 4th ed., Pharmaceutical Press, London, UK). Unless any conventional media or reagent is incompatible with the active compound (peptide, cell), it is considered for use in the compositions of this disclosure. In one embodiment, the buffer, excipient, carrier, and / or culture media are non-naturally occurring buffers, excipients, carriers, and / or culture media. In one embodiment, one or more tumor antigen peptides described herein, or nucleic acids (such as mRNA) encoding one or more tumor antigen peptides, are contained in or combined with lipid vesicles or liposomes (e.g., cationic liposomes, see, for example, Vitor MT et al., Latest Patent Drug Delivery Formulations, August 2013; 7(2):99-110) or suitable other carriers.

[0207] On the other hand, this disclosure provides compositions comprising any one or any combination of tumor antigen peptides as defined herein (e.g., comprising or consisting of the sequence shown in SEQ ID NO: 1-269) (or nucleic acids such as mRNA encoding said peptides), and buffers, excipients, carriers, diluents, and / or culture media. For compositions comprising cells (e.g., antigen-presenting cells, T lymphocytes), the composition comprises a suitable culture medium that allows for the maintenance of viable cells. Representative examples of such culture media include salt solutions, Elliott Balanced Salt Solutions (Life Technologies...). ) or plasma Lyte (Baxter International, Inc.). In one embodiment, the composition (e.g., a pharmaceutical composition) is an “immunogenic composition,” a “vaccine composition,” or a “vaccine.” As used herein, the terms “immunogenic composition,” “vaccine composition,” or “vaccine” refer to a composition or formulation comprising one or more tumor antigen peptides, nucleic acids, or a vaccine carrier, which, when administered to a subject, can induce an immune response against one or more tumor antigen peptides present therein. Methods of vaccination that induce an immune response in mammals (e.g., humans) include administration using a vaccine or vaccine carrier via any conventional route known in the field of vaccines, such as via the surface of a mucosa (e.g., eye, nose, lung, mouth, stomach, intestine, rectum, vagina, or urethra), via a parenteral route (e.g., subcutaneous, intradermal, intramuscular, intravenous, or intraperitoneal), or via a local route (e.g., via a transdermal delivery system such as a patch). In one embodiment, a tumor antigen peptide (or a combination thereof) is conjugated to a carrier protein (conjugated vaccine) to enhance the immunogenicity of the tumor antigen peptide. Therefore, this disclosure provides compositions (conjugates) comprising a tumor antigen peptide (or a combination thereof) or a nucleic acid encoding a tumor antigen peptide or a combination thereof, and a carrier protein. For example, tumor antigen peptides and / or nucleic acids may be coupled to or complexed with Toll-like receptor (TLR) ligands (see, for example, Zom et al., Progress in Immunology, 2012, 114:177-201) or polymers / dendritic macromolecules (see, for example, Liu et al., Biomacromolecules, 12 August 2013; 14(8):2798-806), such as polymer-linked TLR agonists (see, for example, Lynn et al., Nature Biotechnology 33:1201-1210 (2015); Lynn et al., Nature Biotechnology 38:320-332 (2020)). In one embodiment, the immunogenic composition or vaccine further comprises an adjuvant. An "adjuvant" is a substance that, when added to an immunogen (such as the tumor antigen peptide, nucleic acid, and / or cells of this disclosure), nonspecifically enhances or strengthens the immune response to the agent in the host after exposure to the mixture.Examples of adjuvants currently used in the vaccine field include (1) inorganic salts (aluminum salts such as aluminum phosphate and aluminum hydroxide, calcium phosphate gel), squalene; (2) oil-based adjuvants such as oil emulsions and surfactant formulations, such as MF59 (microfluidic detergent-stabilized oil-in-water emulsion), QS21 (purified saponins), AS02 [SBAS2] (oil-in-water emulsion + monophospholipid A + QS-21); (3) particulate adjuvants, such as virions (monolithic liposome carriers containing influenza hemagglutinin), AS04 ([SBAS4] aluminum salt with monophospholipid A), immunostimulatory complexes (structured complexes of saponins and lipids), polylactic acid-glycolic acid copolymer (PLG); (4) microbial derivatives (natural and synthetic), such as monophospholipid A (MPL), Detox (monophospholipid A + Mycobacterium tumefaciens cell wall skeleton), AGP [RC-529] (synthetic acylated monosaccharide), DC_Chol (lipid immunostimulant capable of self-assembling into liposomes), OM-174 (lipid A derivative), CpG motif (synthetic oligonucleotide containing an immunostimulatory CpG motif), modified cholera toxin (CT) and Escherichia coli enterotoxin (LT) (genetically modified bacterial toxins to provide a non-toxic adjuvant effect); (5) endogenous human immunomodulators, such as human granulocyte-macrophage colony-stimulating factor (hGM-CSF) or human interleukin-12 (hIL-12) (which can be administered as a protein or plasmid-encoded cytokine), immune aptamers (C3d tandem arrays); and / or (6) inert carriers, such as gold particles. In one embodiment, the vaccine is an RNA vaccine.

[0208] In one embodiment, the tumor antigen peptide (e.g., comprising or consisting of the sequence shown in SEQ ID NO: 1-269), the synthetic long peptide (or the nucleic acid encoding said peptide, such as mRNA), or a composition comprising thereof is in lyophilized form. In another embodiment, the tumor antigen peptide, the synthetic long peptide, the nucleic acid, or the composition comprising thereof is in liquid composition form. In a further embodiment, the concentration of the tumor antigen peptide or nucleic acid in the composition is from about 0.01 μg / mL to about 100 μg / mL. In a further embodiment, the concentration of the tumor antigen peptide or nucleic acid is from about 0.2 μg / mL to about 50 μg / mL, from about 0.5 μg / mL to about 10, 20, 30, 40, or 50 μg / mL, from about 1 μg / mL to about 10 μg / mL, or from about 2 μg / mL.

[0209] As described herein, cells expressing major histocompatibility complex class I molecules (such as antigen-presenting cells) loaded with or bound to any one or any combination of tumor antigen peptides as defined herein can be used to stimulate / expand CD8+ T lymphocytes in vivo or in vitro. Therefore, in another aspect, this disclosure provides T-cell receptor (TCR) molecules capable of interacting with or binding to major histocompatibility complex class I molecule / tumor antigen peptide complexes as described herein, nucleic acid molecules encoding such T-cell receptor molecules, and carriers containing such nucleic acid molecules. The T-cell receptors according to this disclosure are capable of specifically binding to or interacting with tumor antigen peptides loaded on major histocompatibility complex class I molecules, preferably on the surface of living cells in vitro or in vivo.

[0210] As used in this article, the term T-cell receptor refers to a member of the immunoglobulin superfamily, possessing a variable binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail; see, for example, Janeway et al., *Immunobiology: The Immune System in Health and Disease*, 3rd ed., *Current Biology Publications*, 4:33, 1997), capable of specifically binding to antigenic peptides bound to the major histocompatibility complex receptor. T-cell receptors can be present on the cell surface and are typically composed of heterodimers with α and β chains (also referred to as TCRα and TCRβ, respectively). Similar to immunoglobulins, the extracellular portion of the T cell receptor chain (e.g., the α chain and β chain) comprises two immunoglobulin regions: a variable region (e.g., the TCR variable α region or Vα and the TCR variable β region or Vβ; typically amino acids 1 to 116 at the N-terminus based on Rabat numbering) and a constant region adjacent to the cell membrane (e.g., the TCR constant domain α or Cα, typically amino acids 117 to 259 based on Rabat, and the TCR constant domain β or Cβ, typically amino acids 117 to 295 based on Rabat). Also similar to immunoglobulins, the variable region contains complementarity-determining regions (CDRs, three per chain), separated by framework regions (FRs). In some embodiments, the T cell receptor is present on the surface of T cells (or T lymphocytes) and binds to the CD3 complex.

[0211] T-cell receptors, particularly nucleic acids encoding the T-cell receptors of this disclosure, can be used, for example, to genetically transform / modify T lymphocytes (e.g., CD8+ T lymphocytes) or other types of lymphocytes to generate novel T-cell clones that specifically recognize major histocompatibility complex class I molecules / tumor antigen peptide complexes. In a particular embodiment, patient-derived T lymphocytes (e.g., CD8+ T lymphocytes) are transformed to express one or more T-cell receptors that recognize tumor antigen peptides, and the transformed cells are administered to the patient (autologous cell infusion). In a particular embodiment, donor-derived T lymphocytes (e.g., CD8+ T lymphocytes) are transformed to express one or more T-cell receptors that recognize tumor antigen peptides, and the transformed cells are administered to the recipient (allogeneic cell infusion). In another embodiment, this disclosure provides T lymphocytes, such as CD8+ T lymphocytes, transformed / transfected with a vector or plasmid encoding a tumor antigen peptide-specific T-cell receptor. In a further embodiment, this disclosure provides a method of treating a patient with autologous or allogeneic cells transformed with a tumor antigen peptide-specific T-cell receptor. In some embodiments, T cell receptors are expressed in primary T cells (e.g., cytotoxic T cells) by replacing endogenous loci (e.g., endogenous TRAC and / or TRBC loci) using, for example, CRISPR, TALEN, zinc finger nucleases, or other targeted disruption systems.

[0212] In another embodiment, this disclosure provides a nucleic acid encoding the aforementioned T-cell receptor. In a further embodiment, the nucleic acid is contained in a vector, such as the vector described above.

[0213] In yet another embodiment, the use of tumor antigen-specific T-cell receptors in the preparation of autologous or allogeneic cells for the treatment of cancer (e.g., colorectal cancer) is provided.

[0214] In some embodiments, patients treated with the compositions of this disclosure (e.g., pharmaceutical compositions) are treated before or after treatment with antitumor agents and / or immunotherapies (e.g., chimeric antigen receptor therapy, immune checkpoint inhibitor therapy). The compositions of this disclosure include: allogeneic T lymphocytes (e.g., CD8+ T lymphocytes) activated in vitro against tumor antigen peptides; allogeneic or autologous antigen-presenting cell vaccines loaded with tumor antigen peptides; vaccines containing tumor antigen peptides or nucleic acids (e.g., mRNA) encoding tumor antigen peptides; and allogeneic or autologous T lymphocytes (e.g., CD8+ T lymphocytes) or lymphocytes transformed by tumor antigen-specific T cell receptors. Methods providing T lymphocyte clones capable of recognizing tumor antigen peptides of this disclosure can specifically target tumor cells expressing tumor antigen peptides in a subject (e.g., a graft recipient), such as allogeneic T lymphocytes and / or donor lymphocyte infusion (DLI) recipients. Therefore, this disclosure provides CD8+ T lymphocytes that encode and express T cell receptors capable of specifically recognizing or binding to tumor antigen peptide / major histocompatibility complex class I molecule complexes. The T lymphocytes (e.g., CD8+ T lymphocytes) may be recombinant (engineered) or naturally selected T lymphocytes. Thus, this specification provides at least two methods for generating the CD8+ T lymphocytes of this disclosure, including the step of contacting undifferentiated lymphocytes with tumor antigen peptide / major histocompatibility complex class I molecule complexes (typically expressed on the surface of cells such as antigen-presenting cells) under conditions favorable to triggering T cell activation and expansion, which may be performed in vitro or in vivo (i.e., in patients administered an antigen-presenting cell vaccine loaded with tumor antigen peptides, or in patients receiving treatment with a tumor antigen peptide vaccine). Using combinations or mixtures of tumor antigen peptides that bind to major histocompatibility complex class I molecules, a population of CD8+ T lymphocytes capable of recognizing multiple tumor antigen peptides can be generated. Alternatively, tumor antigen-specific or targeting T lymphocytes (i.e., engineered or recombinant CD8+ T lymphocytes) can be generated in vitro or ex vivo by cloning one or more nucleic acids (genes) encoding T cell receptors (more specifically, the α and β chains) that specifically bind to major histocompatibility complex class I molecules / tumor antigen peptide complexes. The nucleic acid encoding the tumor antigen peptide-specific T cell receptor of this disclosure can be obtained from in vitro tumor antigen peptide-activated T lymphocytes (e.g., antigen-presenting cells loaded with tumor antigen peptides) using methods known in the art; or from individuals exhibiting an immune response to the peptide / major histocompatibility complex molecule complex. The tumor antigen peptide-specific T cell receptor of this disclosure can be recombinantly expressed in host cells and / or host lymphocytes obtained from graft recipients or graft donors, and optionally differentiated in vitro to provide cytotoxic T lymphocytes (CTLs).Nucleic acids encoding the α and β chains of T cell receptors (transgenic) can be introduced into T cells (e.g., from a patient or another individual) using any suitable method (e.g., transfection (e.g., electroporation) or transduction (e.g., using a viral vector)). Engineered CD8+ T lymphocytes expressing specific T cell receptors against tumor antigen peptides can be expanded in vitro using known culture methods.

[0215] This disclosure provides a method for preparing immune effector cells expressing the T-cell receptors described herein. In one embodiment, the method includes transfecting or transducing immune effector cells, such as immune effector cells isolated from a subject (e.g., a subject with colorectal cancer), such that the immune effector cells express one or more of the T-cell receptors described herein. In some embodiments, the immune effector cells are isolated from an individual and genetically modified without further in vitro manipulation. Such cells can be directly re-administered to the individual. In a further embodiment, the immune effector cells are first activated and stimulated to proliferate in vitro before being genetically modified to express the T-cell receptors. In this regard, the immune effector cells can be cultured before or after genetic modification (i.e., transduction or transfection to express the T-cell receptors described herein).

[0216] Prior to the in vitro manipulation or genetic modification of the immune effector cells described herein, the cell source can be obtained from the subject. Specifically, the immune effector cells used for the T cell receptor described herein include T cells. T cells can be obtained from a variety of sources, including peripheral blood mononuclear cells (PBMCs), bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from sites of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, any number of techniques known to those skilled in the art (e.g., FICOLL) may be used. (Separation) T cells are obtained from a unit of blood collected from a subject. In one embodiment, cells in an individual's circulating blood are obtained via apheresis. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In one embodiment, cells collected via apheresis may be washed to remove the plasma fraction and placed in a suitable buffer or culture medium for subsequent processing. In one embodiment of the invention, cells are washed with phosphate-buffered saline. In alternative embodiments, the wash solution is calcium-free, may be magnesium-free, or may be free of many (if not all) divalent cations. As will be understood by those skilled in the art, the washing step can be performed by methods known in the art, such as using a semi-automatic flow centrifuge. After washing, cells may be resuspended in various biocompatible buffers or other saline solutions, with or without buffer. In some embodiments, undesirable components in the apheresis sample may be removed when the cells are directly resuspended in a culture medium. In some embodiments, this is achieved by lysing red blood cells and consuming monocytes (e.g., via PERCOLL). T cells are isolated from peripheral blood mononuclear cells (PBMCs) using gradient centrifugation. Specific T cell subsets, such as CD28+, CD4+, CD8+, CD45RA+, and CD45RO+ T cells, can be further isolated using positive or negative selection techniques. For example, enrichment of T cell populations by negative selection can be achieved using an antibody combination targeting unique surface markers of the negatively selected cells. One method used herein is cell sorting and / or selection via negative magnetic immunoadhesion or flow cytometry using a mixture of monoclonal antibodies targeting cell surface markers present on the negatively selected cells. For example, to enrich CD8+ cells by negative selection, the monoclonal antibody mixture typically includes antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD4. Flow cytometry and cell sorting can also be used to isolate cell populations of interest for use in this disclosure. Peripheral blood mononuclear cells can be used directly for T cell receptor gene modification using the methods described herein. In some embodiments, T lymphocytes are further isolated after peripheral blood mononuclear cells are isolated, and in some embodiments, cytotoxic and helper T lymphocytes are sorted into naïve, memory, and effector T cell subsets before or after gene modification and / or amplification.

[0217] This disclosure provides isolated immune cells, such as T lymphocytes (e.g., CD8+ T lymphocytes), which are specifically induced, activated, and / or stimulated (expanded) by tumor antigen peptides (i.e., tumor antigen peptides that bind to major histocompatibility complex class I molecules expressed on the cell surface) or combinations of tumor antigen peptides. This disclosure also provides compositions comprising CD8+ T lymphocytes (i.e., one or more tumor antigen peptides that bind to major histocompatibility complex class I molecules) capable of recognizing the tumor antigen peptides of this disclosure or combinations thereof, and said tumor antigen peptides.

[0218] On the other hand, this disclosure provides cell populations or cell cultures (e.g., CD8+ T lymphocyte populations) enriched with T lymphocytes (e.g., CD8+ T lymphocytes) that specifically recognize one or more major histocompatibility complex class I molecules / tumor antigen peptide complexes described herein. Such enriched populations can be obtained by in vitro expansion of specific T lymphocytes (e.g., tumor-infiltrating lymphocytes) using cells expressing (e.g., presenting) one or more tumor antigen peptides disclosed herein as major histocompatibility complex class I molecules (e.g., antigen-presenting cells). As used herein, “enrichment” refers to a population in which the proportion of tumor antigen-specific T lymphocytes (e.g., CD8+ T lymphocytes) is significantly higher than that of the native cell population, i.e., a cell population that has not undergone an in vitro specific T lymphocyte expansion step. In one embodiment, the cell population is a tumor-infiltrating lymphocyte population or is derived from tumor-infiltrating lymphocytes, such as tumor-infiltrating lymphocytes isolated from a patient and expanded in vitro. In a further embodiment, the proportion of tumor antigen peptide-specific T lymphocytes (e.g., CD8+ T lymphocytes) in the cell population is at least about 0.5%, for example, at least about 1%, 1.5%, 2%, or 3%. In some embodiments, the proportion of tumor antigen peptide-specific T lymphocytes (e.g., CD8+ T lymphocytes) in the cell population is about 0.5 to about 10%, about 0.5 to about 8%, about 0.5 to about 5%, about 0.5 to about 4%, about 0.5 to about 3%, about 1% to about 5%, about 1% to about 4%, about 1% to about 3%, about 2% to about 5%, about 2% to about 4%, about 2% to about 3%, about 3% to about 5%, or about 3% to about 4%. Such cell populations or cultures (e.g., CD8+ T lymphocytes) rich in T lymphocytes (e.g., CD8+ T lymphocytes) that specifically recognize one or more target major histocompatibility complex class I molecules / peptides (tumor antigen peptides) complexes can be used for tumor antigen-based cancer immunotherapy, as detailed below. In some embodiments, a population of tumor antigen peptide-specific T lymphocytes is further enriched, for example using an affinity-based system, such as loading (covalent or non-covalent) major histocompatibility complex class I molecular multimers of tumor antigen peptides as defined herein. Therefore, this disclosure provides purified or isolated populations of tumor antigen peptide-specific T lymphocytes (e.g., CD8+ T lymphocytes), wherein the proportion of tumor antigen peptide-specific T lymphocytes (e.g., CD8+ T lymphocytes) is at least about 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0219] On the other hand, this disclosure provides antibodies or antigen-binding fragments thereof (e.g., T-cell receptor mimics or T-cell receptor-like antibodies) or soluble T-cell receptors that specifically bind to complexes comprising the tumor antigen peptides described herein and HLA molecules (e.g., HLA molecules as defined herein). The term “antibody or antigen-binding fragment thereof” as used herein refers to any type of antibody / antibody fragment, including monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, humanized antibodies, CDR transplanted antibodies, chimeric antibodies, and antibody fragments, provided they exhibit the desired antigen-specific / binding activity. Antibody fragments comprise a portion of a full-length antibody, typically an antigen-binding or variable region. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments, biantibodies, linear antibodies, single-chain antibody molecules (e.g., single-chain Fv, scFv), single-domain antibodies (e.g., from camels), shark NAR single-domain antibodies, and multispecific antibodies formed from antibody fragments, single-chain biantibodies (scDb), bispecific T-cell adaptors (BiTE), dual-affinity retargeting molecules (DART), bivalent scFv-Fc, and trivalent scFv-Fc. Antibody fragments may also refer to binding portions containing a CDR or antigen-binding domain, including but not limited to VH regions (VH, VH-VH), anti-calreticulin antibodies, PepBodies, antibody-T-cell epitope fusions (Trojan antibodies), or peptide antibodies. In one embodiment, the antibody or its antigen-binding fragment is a single-chain antibody, preferably a single-chain Fv (scFv). In one embodiment, the antibody or its antigen-binding fragment contains at least one constant domain, such as a constant domain of the light chain and / or heavy chain, or a fragment thereof. In a further embodiment, the antibody or its antigen-binding fragment comprises a crystallizable fragment (Fc) of the antibody constant heavy chain. In one embodiment, the antibody or antigen-binding fragment is an scFv (scFV-Fc) containing an Fc fragment. In one embodiment, the scFv component is attached to the Fc fragment via a linker (e.g., a hinge region). The presence of the Fc region can be used to induce complement-dependent cytotoxicity (CDC), antibody-dependent phagocytosis (ADCP), or antibody-dependent cytotoxicity (ADCC) responses against tumor cells.

[0220] In one embodiment, the antibody or its antigen-binding fragment is a multispecific antibody or its antigen-binding fragment, such as a bispecific antibody or its antigen-binding fragment, wherein at least one antigen-binding domain of the multispecific antibody or antibody fragment recognizes a complex comprising the binding of the tumor antigen peptide described herein to an HLA molecule. In one embodiment, at least one antigen-binding domain of the multispecific antibody or antibody fragment recognizes an immune cell effector molecule. The term "immune cell effector molecule" refers to a molecule expressed by an immune cell whose binding to a multispecific antibody or antibody fragment leads to immune cell activation. Examples of immune cell effector molecules include the CD3 signaling complex in T cells (e.g., CD8 T cells) and various activation receptors (NKG2D, KIR2DS, NKp44, etc.) on NK cells. In a further embodiment, at least one antigen-binding domain of the multispecific antibody or antibody fragment recognizes and binds to the CD3 signaling complex (e.g., anti-CD3) in T cells. In a further embodiment, the multispecific antibody or antibody fragment is a single-chain bispecific antibody (scDb). In a further embodiment, the single-chain biantibody comprises a first antibody fragment (e.g., scFv) and a second antibody fragment (e.g., scFv), the first antibody fragment binding to a complex comprising the tumor antigen peptide described herein bound to an HLA molecule, and the second antibody fragment binding to and conjugating immune cell effector molecules, such as the CD3 signaling complex in T cells (e.g., anti-CD3 scFv). Such constructs can be used, for example, to induce cytotoxic T cell-mediated killing of tumor cells expressing a tumor antigen / major histocompatibility complex recognized by a multispecific antibody or antibody fragment. Antibodies or their antigen-binding fragments can also be used as chimeric antigen receptors (CARs) to generate CAR-T cells, CAR-NK cells, etc. Chimeric antigen receptors provide a ligand-binding domain (e.g., antibody or antibody fragment) specific to a desired antigen (e.g., a major histocompatibility complex / tumor antigen peptide complex) to bind to an activated intracellular domain (or signal transduction domain) portion (e.g., the T cell or NK cell activation domain), providing a primary activation signal. Antigen-binding fragments, more specifically scFv, that can bind to antibodies expressing molecules on tumor cells are often used as ligand-binding domains in chimeric antigen receptors.

[0221] In one embodiment, the soluble T-cell receptor is a soluble therapeutic bispecific T-cell receptor (see, for example, Robinson et al., FEBS Letters, November 2021; 288(21):6159-6173; Dilchert et al., Antibodies (Basel), 10 May 2022; 11(2):34).

[0222] In one embodiment, a soluble T-cell receptor, antibody, or antibody fragment (e.g., a T-cell receptor mimic) is linked to an antitumor agent to form an antibody-drug conjugate (ADC). Such ADCs allow for the targeted delivery of antitumor agents to tumor cells expressing one or more tumor antigen peptides as described above (see, for example, Shen et al., Asian Journal of Pharmaceutical Sciences, November 2020; 15(6):777-785).

[0223] This disclosure also provides nucleic acids, such as mRNA, encoding the soluble T-cell receptors, antibodies, antibody fragments, or chimeric antigen receptors described herein. Such nucleic acids can be formulated in suitable carriers, such as the lipid nanoparticles described above, and can be used to treat cancers, such as colorectal cancer, as described below.

[0224] Therefore, on the other hand, this disclosure provides host cells, preferably immune cells, such as T cells or NK cells, that express the antibodies or antibody fragments (e.g., scFv) described herein.

[0225] This disclosure further relates to pharmaceutical compositions or vaccines comprising the aforementioned immune cells (CD8+ T lymphocytes, CAR-T cells) or tumor antigen peptide-specific CD8+ T lymphocyte populations. Such pharmaceutical compositions or vaccines may comprise one or more pharmaceutically acceptable excipients and / or adjuvants, as described above.

[0226] On the other hand, this disclosure further relates to the use of any tumor antigen peptide, nucleic acid, expression vector, T cell receptor, antibody / antigen binding fragment, cell (e.g., T lymphocytes, antigen-presenting cells, CAR-T cells), and / or composition, or any combination thereof, comprising or consisting of any sequence in SEQ ID NO: 1-269, as a medicament or in the preparation of a medicament for treating cancers expressing said tumor antigen peptides (e.g., colorectal cancer). This disclosure relates to any tumor antigen peptide, nucleic acid, expression vector, T cell receptor, antibody / antigen binding fragment, cell (e.g., T lymphocytes, antigen-presenting cells), and / or composition (e.g., vaccine composition), or any combination thereof, for treating cancers expressing said tumor antigen peptides, such as colorectal cancer, for example, as a colorectal cancer vaccine. The tumor antigen peptide sequences identified herein can be used to produce synthetic peptides for (i) in vitro primer and amplification of tumor antigen-specific T cells for injection into cancer patients, and / or (ii) as vaccines to induce or enhance anti-tumor T cell responses in cancer patients (e.g., colorectal cancer patients).

[0227] On the other hand, this disclosure provides the use of the tumor antigen peptide or synthetic long peptide described herein (e.g., comprising or consisting of any sequence in SEQ ID NO: 1-269), or combinations thereof (e.g., peptide mixtures), or one or more nucleic acids encoding the tumor antigen peptide or synthetic long peptide, for use in vaccine treatment of subjects with cancers (e.g., colorectal cancer) expressing the tumor antigen peptide. This disclosure also provides the use of the tumor antigen peptide or synthetic long peptide described herein, or combinations thereof (e.g., peptide mixtures), or one or more nucleic acids encoding the tumor antigen peptide or synthetic long peptide, for use in vaccine treatment of subjects with cancers (e.g., colorectal cancer) expressing the tumor antigen peptide. In one embodiment, the subject is a receptor for tumor antigen peptide-specific T lymphocytes (e.g., CD8+ T lymphocytes). Therefore, on the other hand, this disclosure provides a method for treating cancers expressing the tumor antigen peptide (e.g., colorectal cancer) (e.g., reducing the number of tumor cells, killing tumor cells), the method comprising administering to a subject in need an effective amount of T lymphocytes (e.g., CD8+ T lymphocytes) that recognize (i.e. express and bind) one or more major histocompatibility complex class I molecules / tumor antigen peptide complexes (expressed on the surface of cells such as antigen-presenting cells). In one embodiment, the method further comprises, after administering / infusing the CD8+ T lymphocytes, administering to the subject an effective amount of the tumor antigen peptide or a synthetic long peptide, or a combination thereof, or one or more nucleic acids encoding the tumor antigen peptide, and / or cells expressing major histocompatibility complex class I molecules loaded with the tumor antigen peptide or synthetic long peptide (e.g., antigen-presenting cells such as dendritic cells). In yet another embodiment, the method comprises administering to a patient in need a therapeutically effective amount of dendritic cells loaded with one or more tumor antigen peptides. In yet another embodiment, the method includes administering a therapeutically effective amount of allogeneic or autologous cells expressing a recombinant T-cell receptor to a patient in need, the T-cell receptor binding to a tumor antigen peptide presented by a major histocompatibility complex class I molecule.

[0228] On the other hand, this disclosure provides the use of T lymphocytes (e.g., CD8+ T lymphocytes), or combinations thereof, that recognize one or more major histocompatibility complex class I molecules loaded with (presenting) tumor antigen peptides for treating cancers (e.g., colorectal cancer) expressing said tumor antigen peptides in a subject (e.g., reducing tumor cell number, killing tumor cells). On the other hand, this disclosure provides the use of T lymphocytes (e.g., CD8+ T lymphocytes), or combinations thereof, that recognize one or more major histocompatibility complex class I molecules loaded with (presenting) tumor antigen peptides for preparing a medicament for treating cancers (e.g., colorectal cancer) expressing said tumor antigen peptides in a subject (e.g., reducing tumor cell number, killing tumor cells). On the other hand, this disclosure provides the use of T lymphocytes (e.g., CD8+ T lymphocytes), or combinations thereof, that recognize one or more major histocompatibility complex class I molecules loaded with (presenting) tumor antigen peptides for treating cancers (e.g., colorectal cancer) expressing said tumor antigen peptides in a subject (e.g., reducing tumor cell number, killing tumor cells). In a further embodiment, the use also includes, after using the tumor antigen peptide-specific T lymphocytes, using an effective amount of the tumor antigen peptide (or a combination thereof), or one or more nucleic acids encoding the tumor antigen peptide, and / or cells expressing one or more major histocompatibility complex class I molecules loaded (presenting) the tumor antigen peptide (e.g., antigen-presenting cells).

[0229] This disclosure also provides a method for generating an immune response in a subject against a human class I major histocompatibility complex molecule expressing any of the tumor antigen peptides disclosed herein (e.g., comprising or consisting of the sequence shown in SEQ ID NO: 1-269) or a combination thereof, the method comprising administering cytotoxic T lymphocytes that specifically recognize a class I major histocompatibility complex molecule loaded with said tumor antigen peptide or a combination of said tumor antigen peptides. This disclosure also provides the use of cytotoxic T lymphocytes for generating an immune response against a tumor cell expressing a human class I major histocompatibility complex molecule loaded with any of the tumor antigen peptides disclosed herein or a combination of said tumor antigen peptides, said cytotoxic T lymphocytes specifically recognizing a class I major histocompatibility complex molecule loaded with said tumor antigen peptide or a combination of said tumor antigen peptides.

[0230] In one embodiment, the cancer is colorectal cancer. In a further embodiment, the cancer is colon cancer. In another embodiment, the cancer is rectal cancer. In one embodiment, the colorectal cancer is characterized by microsatellite instability (MSI). In one embodiment, the colorectal cancer is characterized by microsatellite stability (MSS). In one embodiment, the colorectal cancer is characterized by RAS (e.g., KRAS) and / or RAF mutations. In another embodiment, the colorectal cancer is resistant / refractory to chemotherapy. In another embodiment, the colorectal cancer is resistant / refractory to EGFR inhibitors.

[0231] In one embodiment, the method or use described herein further includes identifying the HLA class I allele expressed by the patient prior to treatment / use, and administering or using a tumor antigen peptide that binds to one or more HLA class I alleles expressed by the patient. For example, if it is determined that the patient expresses HLA-A*02:01 and HLA-B*07:02, then any combination of (i) tumor antigen peptides of SEQ ID NO: 19, 34, 47, 105, 112, 132-134, 138, 142, 184, 204, 206, 224 and / or 240 (binding HLA-A*02:01) and (ii) tumor antigen peptides of SEQ ID NO: 37, 43, 72, 187, 209, 210, 225, 226 and / or 235 (binding HLA-B*07:02) may be administered or used to the patient.

[0232] In one embodiment, the tumor antigen peptides, nucleic acids, expression vectors, T cell receptors, antibody / antigen binding fragments, cells (e.g., T lymphocytes, CAR-T or NK cells, antigen-presenting cells) and / or compositions thereof, or any combination thereof, may be used in combination with one or more additional active agents or therapies to treat cancer (e.g., colorectal cancer), such as chemotherapy (e.g., vinca alkaloids, agents that disrupt microtubule formation (e.g., colchicine and its derivatives), anti-angiogenic agents, therapeutic antibodies, EGFR-targeting agents, tyrosine kinase-targeting agents (e.g., tyrosine kinases). Inhibitors, transition metal complexes, proteasome inhibitors, antimetabolites (such as nucleoside analogs), alkylating agents, platinum-based agents, anthracycline antibiotics, topoisomerase inhibitors, macrolides, retinoids (such as all-trans retinoic acid or its derivatives), gerdemycin or its derivatives (such as 17-AAG), surgery, immune checkpoint inhibitors or immunotherapeutic agents (such as PD-1 / PD-L1 inhibitors such as anti-PD-1 / PD-L1 antibodies, CTLA-4 inhibitors such as anti-CTLA-4 antibodies, B7-1 / B7-2 inhibitors such as anti-B7-1 / B7-2 antibodies). 7-2 antibodies, TIM3 inhibitors such as anti-TIM3 antibodies, BTLA inhibitors such as anti-BTLA antibodies, CD47 inhibitors such as anti-CD47 antibodies, GITR inhibitors such as anti-GITR antibodies, antibodies against tumor antigens (e.g., anti-CD19, anti-CD22 antibodies), cell-based therapies (e.g., CAR-T cells, CAR-NK cells), and cytokines such as IL-2, IL-7, IL-21, and IL-15. In one embodiment, the tumor antigen peptides, nucleic acids, expression vectors, T cell receptors, and cells (e.g., T lymphocytes) disclosed herein... The tumor antigen peptide, nucleic acid, expression vector, T cell receptor, cell (e.g., T lymphocytes, antigen-presenting cells) and / or composition thereof are administered / used in combination with an immune checkpoint inhibitor. In one embodiment, the tumor antigen peptide, nucleic acid, expression vector, T cell receptor, cell (e.g., T lymphocytes, antigen-presenting cells) and / or composition thereof are administered / used in combination with one or more therapies for the treatment of colorectal cancer (e.g., surgery, chemotherapy (e.g., using 5-fluorouracil, capecitabine, oxaliplatin, irinotecan, raltitrexed, trifluralin, tepiramycin), radiotherapy, bevacizumab, cetuximab, panitumumab, regorafenib).

[0233] Additional therapies may be administered before, concurrently with, or after the application of the tumor antigen peptides, synthetic long peptides, nucleic acids, expression vectors, T cell receptors, antibody / antigen binding fragments, cells (e.g., T lymphocytes, CAR-T or NK cells, antigen-presenting cells), and / or compositions disclosed herein.

[0234] Example The following non-limiting embodiments further illustrate this disclosure in detail.

[0235] Example 1: Materials and Methods Human primary tissue Primary tumor samples of human colonic adenocarcinoma were purchased from BioIVT (n=15) and Reprocell (n=11). Tissue samples were obtained from patients who underwent surgery as first-line treatment and were rapidly frozen in liquid nitrogen. More information on primary tissue samples is shown in Tables 1A and 1B.

[0236] Table 1A Sample number gender age Race Clinical diagnosis (specimen) 30774B1 male 65 White or Caucasian rectal adenocarcinoma 43882A1 male 78 White or Caucasian rectal adenocarcinoma 95471A1 female 75 White or Caucasian Sigmoid colon adenocarcinoma 108937A1 female 78 White or Caucasian Tubular adenocarcinoma of the colon 111209A1 female 65 White or Caucasian Cecal mucinous adenocarcinoma 1055698F female 62 White or Caucasian colonic mucinous adenocarcinoma 1120113F male 60 White or Caucasian Muscle mucinous gland carcinoma 1136279F male 53 White or Caucasian Colorectal adenocarcinoma 1146020F female 68 White or Caucasian Invasive adenocarcinoma of the colon 1160100F female 80+ White or Caucasian Invasive adenocarcinoma of the colon 1189347F female 71 White or Caucasian colorectal mucinous adenocarcinoma ILS39235FT1 female 78 White or Caucasian Colorectal adenocarcinoma 1284636F female 80+ White or Caucasian adenocarcinoma 1306257F male 73 White or Caucasian adenocarcinoma 1319540F female 73 White or Caucasian adenocarcinoma EFLFZA9R female 55 White or Caucasian adenocarcinoma UK9MAZ21 male 48 White or Caucasian adenocarcinoma G5TZDA6H female 77 Vietnamese Gastrointestinal stromal tumors 4ZFUNAIU female 30 Vietnamese Mucinous gland carcinoma F93JCAVD male 61 Vietnamese adenocarcinoma CRGG6A53 male 50 White or Caucasian Signet ring cell carcinoma B2CV7Z22 male 34 White or Caucasian adenocarcinoma RFY7HAL3 male 82 White or Caucasian adenocarcinoma YU1YVAJU female 45 Vietnamese adenocarcinoma 2PXQ9AG6 male 56 Vietnamese adenocarcinoma 8AOM8AGA female 73 Vietnamese adenocarcinoma Table 1B Sample number AJCC / UICC Installment Plan Tumor percentage HLA typing 30774B1 Unknown 100 HLA-A*01:01, HLA-A*02:01, HLA-B*35:02, HLA-B*44:02, HLA-C*04:01, HLA-C*05:01 43882A1 Unknown 90 HLA-A*02:01, HLA-A*02:01, HLA-B*18:01, HLA-B*35:03, HLA-C*04:01, HLA-C*07:01 95471A1 Unknown 95 SONG-A*03:01, SONG-A*23:01, SONG-B*35:01, SONG-B*44:03, SONG-C*04:01, SONG-C*04:01 108937A1 IB 100 SONG-A*24:02, SONG-A*68:01, SONG-B*35:03, SONG-B*44:02, SONG-C*04:01, SONG-C*16:04 111209A1 IIIB 85 SONG-A*25:01, SONG-A*29:02, SONG-B*07:02, SONG-B*44:03, SONG-C*07:02, SONG-C*16:01 1055698F Unknown 85 SONG-A*02:01, SONG-A*03:01, SONG-B*07:02, SONG-B*07:02, SONG-C*07:02, SONG-C*07:02 1120113F IV 100 SONG-A*02:01, SONG-A*32:01, SONG-B*15:01, SONG-B*27:05, SONG-C*01:02, SONG-C*03:03 1136279F I 100 SONG-A*03:01, SONG-A*24:02, SONG-B*07:02, SONG-B*18:01, SONG-C*07:01, SONG-C*07:02 1146020F IIIB 85 SONG-A*03:01, SONG-A*24:02, SONG-B*52:01, SONG-B*52:01, SONG-C*12:02, SONG-C*12:02 1160100F IIIB 88 SONG-A*02:01, SONG-A*25:01, SONG-B*18:01, SONG-B*44:02, SONG-C*05:01, SONG-C*12:03 1189347F IIA 90 SONG-A*01:01, SONG-A*02:01, SONG-B*49:01, SONG-B*56:01, SONG-C*07:01, SONG-C*07:02 ILS39235FT1 IIIB 85 SONG-A*01:01, SONG-A*24:02, SONG-B*35:02, SONG-B*40:02, SONG-C*03:04, SONG-C*06:02 1284636F IIA 90 SONG-A*02:01, SONG-A*02:01, SONG-B*45:01, SONG-B*51:01, SONG-C*07:02, SONG-C*15:02 1306257F VAT 95 SONG-A*02:01, SONG-A*68:01, SONG-B*40:02, SONG-B*44:02, SONG-C*02:02, SONG-C*07:04 1319540F IIIB 90 SONG-A*01:01, SONG-A*03:01, SONG-B*07:02, SONG-B*08:01, SONG-C*07:01, SONG-C*07:02 EFLFZA9R IVD 80 SONG-A*02:01, SONG-A*30:01, SONG-B*13:02, SONG-B*40:01, SONG-C*03:04, SONG-C*06:02 UK9MAZ2 IIB1 80 SONG-A*26:01, SONG-A*68:01, SONG-B*38:01, SONG-B*56:01, SONG-C*01:02, SONG-C*12:03 G5TZDA6H III 100 SONG-A*11:01, SONG-A*29:01, SONG-B*07:05, SONG-B*13:01, SONG-C*03:04, SONG-C*15:05 4ZFUNAIU I 95 SONG-A*24:02, SONG-A*29:01, SONG-B*07:05, SONG-B*13:01, SONG-C*03:04, SONG-C*15:05 F93JCAVD II 90 SONG-A*11:01, SONG-A*29:01, SONG-B*07:05, SONG-B*46:01, SONG-C*01:02, SONG-C*15:05 CRGG6A53 Unknown 85 SONG-A*01:01, SONG-A*02:01, SONG-B*08:01, SONG-B*44:03, SONG-C*07:01, SONG-C*16:01 B2CV7Z2 II 80 SONG-A*01:01, SONG-A*02:01, SONG-B*14:02, SONG-B*15:03, SONG-C*08:02, SONG-C*16:01 RFY7HAL3 Unknown 80 SONG-A*01:01, SONG-A*02:01, SONG-B*07:02, SONG-B*40:01, SONG-C*03:04, SONG-C*03:04 YU1YVAJU II 80 SONG-A*02:03, SONG-A*24:02, SONG-B*15:02, SONG-B*15:25, SONG-C*03:04, SONG-C*08:01 2PXQ9AG6 II 80 SONG-A*02:03, SONG-A*29:01, SONG-B*07:05, SONG-B*38:02, SONG-C*07:02, SONG-C*15:05 8AOM8AGA III 80 HLA-A*01:01, HLA-A*24:02, HLA-B*54:01, HLA-B*57:01, HLA-C*06:02, HLA-C*07:02 The proteogenomic workflow for tumor antigen discovery in primary colorectal tumor samples is as follows: Figure 1A-1B As shown.

[0237] RNA extraction and sequencing Total RNA was isolated from primary tissue (29–51 mg) using the All Prep DNA / RNA / miRNA Universal Kit (Qiagen) according to the manufacturer’s recommended protocol.

[0238] RNA quantification was performed using QuBIT (Life Technologies), and RNA quality was assessed using Bioanalyzer Nano (Agilent).

[0239] cDNA libraries were constructed using the KAPA HyperprepRNAseq Chain Specific Kit (KAPA) and via polyA capture.

[0240] The library was quantified using QuBIT and the average length of the library was assessed using BioAnalyzer DNA100.

[0241] All libraries were diluted to 10 nM and normalized by qPCR using the KAPA Library Quantification Kit (KAPA).

[0242] The libraries were mixed at equimolar concentrations.

[0243] PE100 sequencing was performed using Illumina Novaseq S4.

[0244] An average of 200 million peer reads are generated.

[0245] Library construction was completed at the Institute for Immunization and Cancer (IRIC) genome platform, and sequencing was completed at the McGill Genome Center.

[0246] Transcriptomics Bioinformatics Analysis The sequence was pruned using Trimmomatic v0.35 and aligned to the human reference genome GRCh38 using STAR v2.75.1a 1b with default parameters (gene annotation from Gencode v26, based on Ensembl 88). Only the following parameters were modified: `--alignSJoverhangMin`, `--alignMatesGapMax`, `--alignIntronMax`, and `--alignSJstitchMismatchNmax`, set to 10, 200000, 200000, and "5 -1 5 5" respectively, to generate the bam file.

[0247] HLA genotyping HLA genotyping of tissues was performed using OptiType v1.3.5, a tool that uses next-generation sequencing data to predict HLA alleles in samples (https: / / github.com / FRED-2 / OptiType). Information is shown in Tables 1A and 1B.

[0248] Microsatellite instability detection The MSI status of primary tumor samples was assessed using the MSIsensor-pro-1.2.0 program with GRCh38 TCGA baseline (github.com / xjtu-omics / msisensor-pro / ).

[0249] Transcriptome features Transcripts were quantified using Kallisto v0.43.0, and the index was constructed based on Ensembl v88 annotations.

[0250] The transcript expression values ​​of all samples were merged and converted into gene expression levels using tximport v1.28.0 (6).

[0251] The gene expression matrix is ​​then input into an R script to generate immune rejection constant characteristics (ICR) and consensus molecular subtypes (CMS).

[0252] Transcript biotype analysis As previously described, the proportions of various biotypes in the transcriptome of tissue samples were determined (12).

[0253] In short, transcripts and repeat elements are annotated using the Kallisto index, which includes Ensembl-annotated transcripts, and genetic duplication identification information is supplemented by the UCSC Table Browser GRCh38 repeat masker database.

[0254] Transcript expression was quantified using TPM.

[0255] Mutation spectrum Use Freebayes v1.0.2 to call single nucleotide variants from a bam file generated by STAR.

[0256] Obtain a list of high-frequency mutations in colorectal cancer from COSMIC.

[0257] Database construction As described above, a global cancer database is constructed (7).

[0258] In short, each database consists of two parts: a **personalized classical proteome** and a **cancer-specific proteome**.

[0259] Classical proteomics For each sample, single-base mutations with a minimum substitution count of 5 were identified using freeBayes v1.0.2-16-gd466dde75.

[0260] Transcript expression was quantified by TPM using kallisto v0.43.0 in chain-specific mode, with the `-b 100` parameter and other default parameters.

[0261] Then, pyGeno v2.0.0 was used to insert high-quality sample-specific single-base mutations (freeBayes quality > 20) into the reference exome and export the sample-specific sequences of known proteins generated from expressed transcripts (tpm > 0) to generate personalized classic proteomics FASTA files.

[0262] Cancer-specific proteomics Follow the method described above, with only the following modifications: use 8 mTEC samples (GEO accession numbers GSE127825, GSE127825) instead of 6, set the allowed number of k-mer occurrences in mTEC to 1 instead of 0, and ligate peptides with "JJ" adapters before ligating to the personalized classical proteome.

[0263] In short, the R1 and R2 fastq files for each sample are pruned using the fastx_reverse_complement function of FASTX-Toolkit v0.0.14 as described above, and the reverse-mapped reads are inversely complemented.

[0264] Use Jellyfish v2.2.37 to generate a k-mer database (24 or 33 length).

[0265] A single k-mer database was generated for each tumor sample, and the fastq files of the eight mTEC samples were merged into a single database.

[0266] Since the k-mer assembly time increases exponentially after exceeding 30 million k-mers, a database of 33 nucleotide-long k-mers for each cancer is filtered based on a sample-specific threshold (given number of times a k-mer appears in the database), so that the maximum number of k-mers in the assembly step is 30 million.

[0267] After filtering, k-mers that appear more than once in the mTECs k-mer database are removed from each sample database.

[0268] The remaining k-mers were assembled into an overlap group using the internally developed software NEKTAR.

[0269] In short, one of the submitted 33-nucleotide long k-mers is randomly selected as a seed, and continuous k-mers with 32-nucleotide overlap are extended to both ends on the same strand (the `-r` option is disabled because a chain-specific k-mer set is used).

[0270] Assembly stops when there are no k-mers available for assembly or when more than one k-mer meets the condition (the `-a 1` option is used for linear assembly).

[0271] Then a new seed is selected, and the assembly is repeated until all k-mers in the submission list have been used once.

[0272] Finally, an internal Python script was used to perform three-frame translation of the contiguous group and to split the amino acid sequence at the internal stop codon.

[0273] The resulting peptides are linked by "JJ" connectors and spliced ​​with the personalized classical proteome for each sample.

[0274] A second dataset was generated using a unique RNA-seq workflow called k-mer analysis, because existing alignment and variant detection tools struggle to accurately identify structural variations.

[0275] This second dataset can detect peptides encoded by any reading frame from any genomic source (including structural variations), as long as they are cancer-specific (i.e., not present in normal cells).

[0276] MHC II-overexpressing medullary thymic epithelial cells (mTEC^hi) were used as a "normal control".

[0277] To identify cancer-specific RNA sequences, cancer RNA-seq reads were cut into 33-nucleotide long sequences (called k-mers, using Jellyfish 2.2.3 (15)) from which k-mers present in homologous mTEC^hi cells were removed.

[0278] The contiguous groups are translated by computer three-frame translation by assembling overlapping cancer-specific k-mers into longer sequences (called contiguous groups) to eliminate the redundancy inherent in the k-mer space.

[0279] The classical proteome was then spliced ​​with the cancer-specific proteome to create a global cancer database, one for each analyzed sample.

[0280] ### Isolation of MHC-I related peptides (MAPs) The W6 / 32 antibody (BioXcell) was conjugated to CNBR activated agarose 4B beads (Cytivia) as described by Sirois et al. (16). The beads were stored at 4°C in PBS at pH 7.2 and 0.02% NaN3 until use.

[0281] The primary colorectal adenocarcinoma sample (573–1346 mg) was cut into small pieces (approximately 3 mm cubes) and added to 6 ml of ice-cold PBS containing a mixture of protease inhibitors (Sigma).

[0282] First, homogenize the tissue twice using an Ultra Turrax T25 homogenizer (IKA-Labortechnik) at 20,000 rpm for 20 seconds each time.

[0283] Then, 700 μl of ice-cold 10X lysis buffer (5% w / v CHAPS) was added to each sample.

[0284] After incubating at 4°C for 60 minutes by inversion, the sample was centrifuged at 4°C and 16600 g for 20 minutes.

[0285] The supernatant was transferred to a new tube containing 1 mg of W6 / 32 antibody covalently cross-linked to agarose beads and incubated at 4°C for 3 hours by inversion.

[0286] The sample is transferred to a Poly-Prep chromatography column (Biorad), where the liquid mixture is eluted by gravity.

[0287] The agarose beads were washed sequentially with 11 mL PBS, 11 mL 0.1X PBS, and 11 mL water.

[0288] The MHC I complex was eluted from agarose beads using 1% trifluoroacetic acid (TFA) acid treatment.

[0289] The peptide-containing filtrate was separated from the MHC I subunits (HLA molecules and β2 microglobulin) using a homemade StageTip (filled with two 1 mm diameter C18 solid-phase extraction discs, EMPORE).

[0290] StageTip is prewashed sequentially with methanol, 80% acetonitrile (ACN) containing 0.1% TFA, 0.1% TFA, and 1% TFA.

[0291] When the sample is loaded onto the StageTip, the peptides remain on the StageTip, while HLA molecules and β2 microglobulin appear in the flow-through.

[0292] StageTip was washed sequentially with 1% TFA and 0.1% TFA, and then eluted with 30% ACN containing 0.1% TFA to remove the peptides.

[0293] The peptide extract was vacuum centrifuged and dried, and stored at -20°C until mass spectrometry analysis.

[0294] Mass spectrometry analysis The dried peptide extract was resuspended in 4% FA and loaded onto an IonOpticks Aurora 25-cm C18 column.

[0295] Peptides were eluted using a linear gradient at a flow rate of 300 nL / min and 0%–38% ACN (0.2% FA) for 106 minutes on a Neo Vanquish nanofluidic system.

[0296] The sample was analyzed in positive ion mode with a Nanoflex source at 3 kV on an Orbitrap Tribrid Ascend mass spectrometer (Thermo Fisher Scientific).

[0297] For each full MS spectrum (resolution 120,000), 40 MS / MS spectra were acquired. The most abundant multicharged ions were selected for MS / MS sequencing at a resolution of 30,000. The target was controlled by normalized automatic gain control at 100%, the injection time was 59 ms, and the collision energy was 27%.

[0298] The LC-MS instrument was controlled using Xcalibur v4.6 (Thermo Fisher Scientific).

[0299] MAP identification Database searches were performed using PeaksXPro v10.6 (Bioinformatics Solutions) (17).

[0300] The mass error tolerances for the parent ion and fragment ion were set to 10.0 ppm and 0.01 Da, respectively.

[0301] Variable modifications include oxidation (M) and deamidation (NQ).

[0302] The Peaks search results were then imported into MAPDP and filtered as follows: peptides with a length of 8–11 amino acids were selected, the elution ligand threshold rank based on NetMHCpan-4.1b prediction was ≤ 2%, and the false discovery rate (FDR) was 5%.

[0303] FDR is calculated using decoy hits imported from Peaks, which employs a decoy fusion strategy (19).

[0304] Tumor antigen (TA) screening As previously mentioned, each MAP and its coding sequence were compared with the mTEC and corresponding cancer classical proteome, as well as the mTEC and corresponding cancer 24-nucleotide long k-mer database, to identify TA candidates.

[0305] If the MAP does not appear in the mTEC classical proteome, or if all possible MAP coding sequences (MCS) for a given MAP satisfy: i) Expression in mTECs of less than 2 KPHM (minimum number of occurrences per 100 million reads in the 24-nucleotide long k-mer set of MCS), and ii) A fold change of ≥10 in KPHM in cancer, Then it is retained as a TA candidate.

[0306] Since standard mass spectrometry methods cannot distinguish between leucine and isoleucine variants, TA candidates that contain variants already labeled as non-TA candidates are discarded unless their RNA expression in the corresponding tumor sample is higher than that of the variant.

[0307] BamQuery was then used to evaluate the genomic location and biotype of TA candidates in “peptide” mode, as well as the expression of their coding sequences in benign and cancerous tissues.

[0308] Manually verify genomic location and biotype using the UCSC Genome Browser.

[0309] The unmutated TA listed in this article is a peptide that meets the following criteria: The 95th percentile of RNA expression in the TCGA-COAD sample (n=483) was at least twice as high as the 95th percentile in the GTEx (excluding testes and colon) and mTEC samples.

[0310] In addition, use the following filtering criteria to filter TAs: a) For abnormal expression of tumor-specific antigens (aeTSA): In over 90% of mTECs, blood and bone marrow cells, and in every normal GTEx sample except for the testes, the expression of aeTSA-derived RNA was below 8.55 RPHM.

[0311] Furthermore, the average expression in TCGA-COAD is at least twice as high as in normal GTEx colon.

[0312] b) For tumor-associated antigens (TAAs): The TAA-derived RNA can be expressed at more than 8.55 RPHM in >10% of any normal tissue (GTEx, mTECs, and / or blood and bone marrow cells) samples, but the average expression in TCGA-COAD is at least twice as high as in mTECs and every GTEx tissue except the testes.

[0313] Inter-tumor shared assessment To detect the intertumoral distribution of TA and TAA sequences in other colorectal tumors, the log(RPHM+1) expression level of peptide-coding sequences was measured in 483 TCGA colon adenocarcinoma (COAD) samples (see “Quantification of MAP-coding sequences in RNA-seq data”).

[0314] Mass spectrometry verification of tumor antigens 1) Use Comet 2022.01 rev 0 (21) to align LC-MS / MS data to the corresponding database with the same parameters as Peaks.

[0315] The 5% FDR (characteristics: mass, mass error, charge, sequence length, total number of matched ions, Comet e-value / Xcorr / deltaCN / sp fraction) determined by Percolator v3.4 (22) was applied to all peptide-spectrum matches.

[0316] 2) The correlation between each TA predicted spectrum and the experimental spectrum was evaluated using the Prosit tool and the non-trypsin HCD 2020 model.

[0317] TAs with a Prosit spectral angle value > 0.6 are considered good candidates.

[0318] 3) Submit the MS spectra of all TA candidates found in the Comet database search and / or filtered by Prosit for internal manual verification to eliminate any erroneous identifications.

[0319] 4) Find TSAs in the Comet database and / or filter them through Prosit but not manually verified, and further verify them by MS using synthetic analogs.

[0320] Therefore, all TAs listed in this paper were re-identified by the second mass spectrometry search algorithm (Comet) and / or Prosit, and further verified manually (TAA and TSA) or using synthetic analogs (TSA only).

[0321] aetsa presentation in the population With slight modifications as described above, the frequency of TSA presentation by a single CRC in the four population groups is estimated.

[0322] First, generate a list of the most common HLA alleles.

[0323] A total of 187 HLA alleles were added to the simulation, which collectively cover 99% of the alleles of individuals in the TCGA-COAD cohort.

[0324] Accordingly, the binding affinity of a single TSA to its major allele (i.e., the allele that the TSA was originally identified in the source sample) or any of the 187 alleles (hybrid alleles) was assessed using NetMHCpan-4.1b.

[0325] If the predicted rank of elution ligand on the major allele is ≤ 2% (strong binding and weak binding) or the rank on the confounding allele is ≤ 0.5% (strong binding only), then the HLA allele is considered a TSA-binding allele.

[0326] Then, the bioinformatics simulation is based on two parameters.

[0327] 1) The likelihood of TSA expression is based on the proportion of tumors expressing the corresponding RNA in the TCGA-COAD cohort. RNA expression is considered to occur if the rphm value of MCS in TCGA is more than twice the 95th percentile value of all GTEx tissues (except testes).

[0328] 2) HLA allele frequencies were retrieved from the National Marrow Donor Program (NMDP) for European Americans, African Americans, Asian Pacific Islanders, and Hispanics.

[0329] Finally, HLA genotypes of patients with six HLA class I alleles were simulated based on reported frequencies in a given population. Since these six HLA alleles were assumed to be independent events, some HLA loci in the simulated patients were homozygous. TSA presentation was considered to occur in the simulated patients when MCS was expressed and the associated HLA allele was present. Expression of each TSA was considered an independent event. One million simulated patients and their TSA presentation status were generated for each of the four populations and used to plot distributions.

[0330] Example 2: Identification of TSAs and TAAs in CRC Samples The characteristics of the TSAs and TAAs identified in this paper are shown in Tables 2A-2D and 2D. Figure 2A-2C 3A-3C and 4.

[0331] Table 2A: Characteristics of the TSAs identified in this paper Peptide (SEQ ID NO:) Major HLA-allele Sample MCS (SEQ ID NO:) AAAKQSLPK (1) HLA-A03:01 95471A1 GCCGCTGCAAAGCAGAGCCTGCCCAAA(270) AATGHIVAV (2) HLA-C08:01 YU1YVAJU GCCGCCACCGGGCACATCGTGGCGGTC(271) AEVLLQPDF (3) HLA-B44:03 95471A1 GCTGAGGTTCTGCTGCAGCCTGACTTC(272) AGIDFSLSSY (4) HLA-A26:01 UK9MAZ21 GCTGGTATAGACTTCAGTCTAAGCTCTTAC(273) AKKKENITY (5) HLA-B15:03 B2CV7Z22 GCAAAGAAAAAGGAAAATATCACCTAT (274) ALIKHVANA (6) HLA-A02:01 EFLFZA9R GCGCTAATTAAGCACGTTGCGAACGCA (275) APAGAALRAA (7) HLA-B56:01 1189347F GCCCCAGCGGGCGCAGCCCTTCGCGCAGCC (276) APEGLRTAA (8) HLA-B56:01 UK9MAZ21 GCCCCCGAAGGTTTGAGAACTGCCGCT (277) AQLLIKVY (9) HLA-B15:25 YU1YVAJU GCCCAGCTTTTAATAAAGGTTTAC (278) AQLQQNTSL (10) HLA-B15:25 YU1YVAJU GCTCAACTGCAACAAAACACTTCCTTG(279) ATVPSRGFPK (11) HLA-A11:01 F93JCAVD GCAACAGTCCCCAGCCGCGGGTTCCCTAAG(280) DEFRQLKTL (12) HLA-B18:01 1160100F GACGAATTCAGGCAGCTCAAGACCCTC(281) EEINQGGRNY (13) HLA-B44:03 95471A1, CRGG6A53 GAAGAAATAAATCAAGGAGGAAGAAACTAT(282) EEQRVLHQA (14) HLA-B45:01 1284636F GAGGAACAACGGGTGTTGCACCAAGCC(283) EVGEAQLAK (15) HLA-A68:01 108937A1 GAAGTGGGAGAGGCACTTGCCAAG(284) EVLDSLLAQY (16) HLA-A25:0 1160100F GAAGTACTGGACAGCCTGCTGGCTCAGTAT(285) EVQNHSTSSY (17) HLA-A25:0 1160100F GAAGTACAGAATCACTCTACTTCCTCCTAT(286) FEAIRLSL (18) HLA-B40:02 1306257F TTCGAGGCTATCCGCCTAAGCCTA(287) SIGNATURE (19) HLA-B38:02 2PXQ9AG6 TTCCATAACCCAAGCATTGGCAATGCAATT(288) FLGKHTLHY (20) SONGS-A01:0 1189347F TTTTTAGGAAAGCATACATTGCATTAT (289) FVQENYLEY (21) HLA-A29:0 4ZFUNAIU TTCGTGCAGGAAAACTACCTGGAGTAC(290) GKLDNTNEY (22) SONG-B15:0 B2CV7Z2 GGTAAATTAGACAACACTAACGAATAC (291) GLREVSAEL (23) HLA-A02:0 YU1YVAJU GGTCTCAGAGAGGTTAGTGCTGAGTTG (292) GQARGPPAA (24) SONG-B45:01 1284636F GGCCAAGCGAGGGGCCCACCGGCTGCA(293) GSSNPLTLK (25) HLA-A11:0 F93JCAVD GGCTCAAGCAATCCTCTTACCTTGAAG (294) HAWPGLVVF (26) SONG-C12:03 UK9MAZ2 CATGCCTGGCCTGGGCCTCGTCGTTTTC(295) HLSSSNHQL (27) HLA-A02:0 B2CV7Z2 CACCTTTCCAGTTCTAATCACCAATTA (296) HSRGGSSSSSF (28) HLA-B57:01 8AOM8AGA CACAGCCGCGGCGGCAGCAGCAGTGAGAGTTTC(297) KDIPSNPVVL (29) HLA-B40:02 1306257F AAAGACATTCCCTCAAATCCTGTAGTACTT (298) KLVELEHTL (30) HLA-A02:0 1284636F AAGCTGGTTGAACTGGAACATACTCTA (299) KSSKPITI (31) HLA-C16:01 B2CV7Z22 AAATCATCTAAACCCATAACCATA (300) KSVYYFIMK (32) HLA-A11:01 F93JCAVD AAATCAGTCTACTACTTCATAATGAAG (301) KTPTNYYLF (33) HLA-A24:02 ILS39235FT1 AAGACGCCCACCAACTACTACCTCTTC (302) KVIPGVVSK (34) HLA-A11:01 F93JCAVD AAGGTGATTCCAGGGGTGGTCAGCAAG (303) KVLGGNLTK (35) HLA-A03:01 1146020F AAAGTACTAGGAGGAAACCTAACCAAA (304) LAIKQFSI (36) HLA-C03:04 YU1YVAJU TTAGCCATAAAGCAATTCTCAATA (305) LNPRTSPVL (37) HLA-C01:02 UK9MAZ21 CTTAATCCCAGGACTAGCCCAGTCTTA (306) LPDGSRVEL (38) HLA-B35:02, HLA-B07:02 30774B1, 1319540F CTCCCAGACGGCTCCCGCGTGGAGCTG (307) LSDRVTAL (39) HLA-C07:04 1306257F CTTTCTGATAGAGTTACTGCTTTA (308) LSPRLTVIV (40) HLA-C01:02 UK9MAZ21 TTAAGCCCTAGACTAACGGTAATTGTG (309) LSRDISSHL (41) HLA-C15:05 2PXQ9AG6 TTGAGCAGAGACATTTCATCACATCTT (310) LTHTDILSL (42) HLA-C12:03 UK9MAZ21 CTTACACACACAGACATCCTCTCTCTC (311) MEVEEKKSF (43) HLA-B44:03 95471A1 ATGGAGGTAGAAGAGAAGAAAAGCTTT (312) MLAHYIISV (44) HLA-A02:01 1284636F ATGTTAGCGCATTATATAATTAGTGTA (313) NTLDKHLAK (45) HLA-A11:01 F93JCAVD AATACCCTTGACAAACACCTTGCAAAA (314) NYRLKDTLL (46) HLA-B08:01 1319540F AACTACAGACTGAAGGATACCCTGTTG (315) PSRGGTASL (47) HLA-B07:02 RFY7HAL3 CCTTCCCGTGGCGGGACGGCATCCCTC (316) QATVRNQQY (48) HLA-C16:01 B2CV7Z22, CRGG6A53 CAGGCCACAGTGAGGAATCAACAGTAT (317) QTILDKNNR (49) HLA-A68:01 UK9MAZ21 CAAACTATTTTGGACAAAAATAACAGA (318) RAFTEASDGSL (50) HLA-C03:04 YU1YVAJU CGTGCTTTTACTGAAGCCAGTGATGGCAGTCTG (319) RATVLQSEV (51) HLA-B13:02 EFLFZA9R AGGGCTACGGTCCTTCAGTCCGAGGTT (320) REEEAIHHL (52) HLA-B40:02 1306257F CGCGAGGAAGAGGCCATTCACCACCTG (321) RKFASQKSSM (53) HLA-B15:03 B2CV7Z22 AGAAAATTTGCCAGCCAAAAATCTTCTATG (322) RPAVLPLPEL (54) HLA-B07:02 1319540F CGGCCGGCTGTCCTGCCGCTGCCGGAGTTG (323) RQIILGAAM (55) HLA-B15:25 YU1YVAJU AGGCAGATAATTCTAGGGGCTGCCATG (324) SEYFSLLTRA (56) HLA-B40:02 1306257F TCCGAGTACTTCAGCCTGCTCACCCGCGCG (325) SIKLPMTY (57) HLA-C12:03 1160100F TCCATCAAGCTACCAATGACTTAC (326) SLEHDLILI (58) HLA-A02:01 1284636F TCCTTGGAACATGACCTCATTCTTATA (327) SPSLKFSSL (59) HLA-B35:03 108937A1 AGTCCTTCTCTCAAGTTTAGCAGCCTC (328) SSGPSREL (60) HLA-C03:04 EFLFZA9R TCCTCTGGACCTAGCAGAGAACTA (329) STIDGKELLGY (61) HLA-A26:01 UK9MAZ21 AGTACCATTGATGGGGAAAGAGCTACTTGGTTAT (330) STSKPLAF (62) HLA-C15:05 4ZFUNAIU AGCACGTCCAAACCCTTGGCTTTC (331) SVVAHLSTY (63) HLA-B15:02 YU1YVAJU TCCGTGGTGGCTCACCTTTCTACCTAC (332) TEFQQIINL (64) HLA-B40:01 RFY7HAL3 ACAGAGTTTCAGCAAATAATCAATTTA (333) THEGEPTTF (65) HLA-B38:01 UK9MAZ21 ACCCATGAGGGAGAACCTACCACTTC (334) TPSPARPAL(66) HLA-B07:02 1136279F, 1055698F, 1319540F ACCCCCAGCCCCGCCAGGCCCGCACTC (335) TPVHSSPVA (67) HLA-B56:01 UK9MAZ21, 1189347F ACACCAGTCCACAGCAGCCCAGTTGCA (336) TRAHVYLLR (68) HLA-C07:01, HLA-B27:05 1136279F, 1120113F ACACGTGCACACGTATATTTATTGCGG (337) TVFRGGFIWR (69) HLA-A68:01 UK9MAZ21 ACCGTTGTTCAGAGGTGGGTTCATCTGGGCGT (338) VAQARGSAM (70) HLA-C03:04, HLA-C12:02 RFY7HAL3, 4ZFUNAIU, 1146020F GTTGCCCAGGCCAGAGGCAGTGCTATG (339) VQPSSPISSA (71) HLA-B56:01 1189347F GTTCAGCCCTCCAGTCCCATCAGTTCAGCC (340) VTNPNIHLL (72) HLA-C03:03 1120113F GTGACCAATCCTAATATACACCTTTCTG (341) VVADTKMIEY (73) HLA-B15:01 1120113F GTGGTGGCCGACACAAAGATTGATTGAATAC (342) YFHVTLTEF (74) HLA-A23:01 95471A1 TACTTCCACGTGACCTTGACTGAGTTT (343) YHQTEEHKF (75) HLA-B38:01 UK9MAZ21 TATCATCAGACAGAAGAACATAAATTT (344) YPTAAQVQL (76) HLA-B35:03 43882A1 TATCCCACAGCGGCCCAGGTGCAACTG (345) Major HLA alleles: ?? Associated with the bound peptide and corresponding to the HLA of the major sample. Samples: Key samples for detecting tumor antigens MCS: Encoding sequence of MHC class I related peptide Table 2B: Characteristics of the TSAs identified in this paper (continued) peptide MCS_alignment biotype Overlapping ERE % Sample TCGA_COAD >GTEx95th AAAKQSLPK (1) chr21:38931652-38931678 Intergenic 26% AATGHIVAV (2) chr12:56645283-56645309 annotated_ORF 6% AEVLLQPDF (3) chr9:136764405-136764431 annotated_ORF 32% AGIDFSLSSY (4) chrX:9784065-9784094 Intron 6% AKKKENITY (5) chr1:62206674-62206700 annotated_ORF Yes 35% ALIKHVANA (6) chr2:236169233-236169259 Intron 9% APAGAALRAA (7) chrX:131795972-131796001 ncRNA 18% APEGLRTAA (8) chr21:38933440-38933466 Intron 13% AQLLIKVY (9) chr7:100990745-100990771 Frameshift 10% AQLQQNTSL (10) chr20:44355588-44355617 Intergenic 42% ATVPSRGFPK (11) chr16:1980723-1980728|1980939-1980959 annotated_ORF 77% DEFRQLKTL (12) chr1:62207589-62207618 annotated_ORF Yes 51% EEINQGGRNY (13) chr21:38933484-38933510 Intron 10% EEQRVLHQA (14) chr5:33683989-33684015 Frameshift 15% EVGEAQLAK (15) chr17:49025664-49025666|49026466-49026492 annotated_ORF 8% EVLDSLLAQY (16) chr4:52745236-52745265 annotated_ORF Yes 15% EVQNHSTSSY (17) chr2:74442387-74442410 Intergenic 8% FEAIRLSL (18) chr5:33683060-33683089 annotated_ORF 13% FHNPSIGNAI (19) chr8:143872627-143872656 annotated_ORF 6% FLGKHTLHY (20) chr9:94509860-94509886 Intergenic 7% FVQENYLEY (21) chr1:62207058-62207084 annotated_ORF 23% GKLDNTNEY (22) chr11:17000975-17001001 Intron 28% GLREVSAEL (23) chr14:105136837-105136863 Intergenic Yes 8% GQARGPPAA (24) chr2:173327423-173327449 Intergenic 14% GSSNPLTLK (25) chr11:2211969-2211995 Intergenic 62% HAWPGLVVF (26) chr16:78462676-78462702 Intergenic 46% HLSSSNHQL (27) chr19:2269716-2269744|2271385-2271388 annotated_ORF 17% HSRGGSSSESF (28) chr7:20192881-20192910 Intron 12% KDIPSNPVVL (29) chrX:116461789-116461815 annotated_ORF 7% KLVELEHTL (30) chr17:40977868-40977891 3UTR 7% KSSKPITI (31) chr6:57665571-57665597 Intergenic Yes 16% KSVYYFIMK (32) chr5:152404859-152404885 annotated_ORF 19% KTPTNYYLF (33) chr8:123702618-123702644 Junctions 9% KVIPGVVSK (34) chrX:106758199-106758225 Intron Yes 36% KVLGGNLTK (35) chr7:34692297-34692320 Intron Yes 22% LAIKQFSI (36) chr8:120472719-120472745 Intron Yes 7% LNPRTSPVL (37) chr1:17826136-17826162 annotated_ORF 9% LPDGSRVEL (38) chr3:185718374-185718397 Intron 39% LSDRVTAL (39) chr12:130367128-130367154 Junctions 5% LSPRLTVIV (40) chr7:106780427-106780453 ncRNA Yes 17% LSRDISSHL (41) chr12:130119881-130119907 Intergenic 34% LTHTDILSL (42) chr17:48179061-48179087 Intron 23% MEVEEKKSF (43) chr13:22274844-22274870 ncRNA 8% MLAHYIISV (44) chr7:106774997-106775023 Junctions Yes 8% NTLDKHLAK (45) chr9:65773119-65773145 Intergenic Yes 21% NYRLKDTLL (46) chr5:24271660-24271686 Intergenic Yes 11% PSRGGTASL (47) chr11:2527729-2527755 Intron Yes 9% QATVRNQQY (48) chr7:100990787-100990813 Frameshift 46% QTILDKNNR (49) chr3:142635792-142635818 Intron Yes 6% RAFTEASDGSL (50) chr3:45760534-45760560 Intron 21% RATVLQSEV (51) chr5:141413791-141413817 annotated_ORF 6% REEEAIHHL (52) chr1:62207526-62207555 annotated_ORF Yes 9% RKFASQKSSM (53) chr1:150579093-150579122 annotated_ORF 25% RPAVLPLPEL (54) chrX:66162541-66162567 Junctions 17% RQIILGAAM (55) chr7:2520084-2520113 annotated_ORF 85% SEYFSLLTRA (56) chr5:30952576-30952599 Intergenic Yes 23% SIKLPMTY (57) chr9:40662685-40662711;chr9:64786238-64786264;chr9:65270052-65270078 Intergenic Yes 7% SLEHDLILI (58) chr20:44389062-44389088 Intron 8% SPSLKFSSL (59) chr19:41118894-41118917 Intergenic Yes 39% SSGPSREL (60) chr7:126769887-126769919 annotated_ORF 8% STIDGKELLGY (61) chr7:122304345-122304368 annotated_ORF 25% STSKPLAF (62) chr1:17826442-17826468 annotated_ORF 13% SVVAHLSTY (63) chr1:62206926-62206952 annotated_ORF 24% TEFQQIINL (64) chr7:100991371-100991397 annotated_ORF 33% THEGEPTTF (65) chr16:88803916-88803942 annotated_ORF 35% TPSPARPAL (66) chr7:100991554-100991580 annotated_ORF 23% TPVHSSPVA (67) chr7:141980531-141980557 Intergenic Yes 50% TRAHVYLLR (68) chr12:124593159-124593188 Intergenic 17% TVFRGGFIWR (69) chr12:12321089-12321115 Intergenic Yes 18% VAQARGSAM (70) chr15:39252658-39252684 ncRNA 5% VQPSSPISSA (71) chr2:3305122-3305151 Intergenic 12% VTNPNIHLL (72) chrY:3021054-3021080 Intron Yes 7% VVADTKMIEY (73) chr5:33683907-33683936 annotated_ORF 11% YFHVTLTEF (74) chrX:15601963-15601989 5UTR 19% YHQTEEHKF (75) chr12:130349363-130349389 annotated_ORF 35% YPTAAQVQL (76) chr7:100990811-100990837 Frameshift 45% MCS_alignment MCS genome location Biological type: Transcript classification Overlapping EREs: Indicates whether the MCS overlaps with endogenous reverse transcription elements (EREs). % Sample TCGA_COAD>GTEx95th: The proportion of colon adenocarcinomas in TCGA-treated colon adenocarcinomas (n=151) with MCS transcript expression levels twice that of all GTEx samples (excluding testes) at the 95th percentile. Table 2C: Characteristics of TAAs identified in this paper Peptide (SEQ ID NO:) Major HLA-allele Sample MCS (SEQ ID NO:) AATSRIAEL (77) HLA-C03:04 RFY7HAL3 GCTGCAACCTCACGAATTGCTGAACTT(346) AAVFNPRFY (78) HLA-C16:01 B2CV7Z22 GCAGCTGTTTTTTAACCCACGTTTTTAT(347) AAVSTHFAL (79) HLA-C03:04 EFLFZA9R, ILS39235FT1, RFY7HAL3,YU1YVAJU GCAGCTGTCTCTACACACCGTGGCCCTC (348) AEIGYRNSL (80) HLA-B40:01 EFLFZA9R GCAGAAATAGGTTACCGGAATTCATTG(349) AELESKTNTL (81) HLA-B40:01 EFLFZA9R GCTGAACTTGAAAGCAAAAACCAATCACTC(350) AEYNSDLHQF (82) HLA-B44:03 95471A1 GCTGAGTACAACAGTGACCTCCATCAATTT(351) AIIDPNHEIEF (83) HLA-B15:25 YU1YVAJU GCCATAATTGATCCTAATCATGAAATTGAATTT(352) ALNEQIARL (84) HLA-A02:01, HLA-A02:03 YU1YVAJU, RFY7HAL3,EFLFZA9R,CRGG6A53,B2CV7Z22,43882A1,2PXQ9AG6,1306257F,1284636F,1189347F,1160100F,1120113F,1055698F GCATTGAATGAACAGATTGCAAGATTG (353) APGPATREA (85) HLA-B56:01 1189347F GCGCCGGGGCCTGCGACCCGCGAGGCG(354) ASQESTMPK (86) HLA-A11:01 F93JCAVD GCTTCCCAGGAATCAACAATGCCCAAG(355) ATDIVTGLKQK (87) HLA-A11:01 F93JCAVD GCCACTGACATCGTGACAGGTCTGAAACAGAAA(356) ATREAGSAL (88) HLA-B07:02 1319540F GCGACCCGCGAGGCGGGCTCGGGCCTG(357) AVADHLAQL (89) HLA-A02:03 YU1YVAJU GCCGTGGCTGACCACCACCTGGCTCAGTTG(358) DAIKIQAW (90) HLA-A25:01 1160100F,111209A1 GATGCCATAATCAAGATCCAGGCCTGG(359) DALQKQREV (91) HLA-B51:01 1284636F GATGCTCTCCAGAAACAACGGGAGGTT(360) DARDTNMAW (92) HLA-A25:0 1160100F GATGCTCGGGACACGAACATGGGGGCGTGG(361) DEENTGADRLM (93) HLA-B18:01 1160100F GACGAGGAGAACACAGGCGCCGACCGCCTCATG(362) DEKVVITY (94) HLA-B18:01 1160100F GATGAAAAGGTGGTTATTACCTAT(363) DEMQDVMHF (95) HLA-B18:01 1160100F GACGAGATGCAGGATGTGATGCATTTT(364) DEMQHVQH (96) HLA-B18:01 1160100F GATGAAATGCAGCATGTACAGCAT(365) DEQTPIHISW (97) PLANT-B44:02, PLANT-B44:03 1306257F,CRGG6A53 GATGAACAGACTCCAATTCATATATCATGG(366) DIMKIREY (98) HLA-B15:0 YU1YVAJU GATATTATGAAAATAAGAGAGTAT(367) DLKKLVDSL (99) SONGS-B08:0 1319540F GATCTCAAGAAGCTCGTTGATTCCCTG (368) DLLQHSEY (100) HLA-B15:0 YU1YVAJU GATCTTCTCCAACACAGTGAATAT(369) DQIIRLEKL (101) HLA-B14:0 B2CV7Z2 GATCAAATAATACGCTTGGAAAAGCTC(370) DTAMPAHSR (102) HLA-A68:01 UK9MAZ2 GACACTGCTATGCCTGCCCATTCAAGA(371) DVIKEINKA (103) HLA-A26:0 UK9MAZ2 GATGTTATTAAAGAAATCAACAAGGCA(372) DVMHFNYTAW (104) HLA-A25:0 1160100F GATGTGATGCATTTTAACTACACTGCATGG(373) EEFEYQRSY (105) PLANT-B44:03,PLANT-B18:01 1160100F43882A1.95471A1 GAGGAATTTGAATCAAAGATCATAT (374) EEINQGGRKY (106) SONG-B44:03 95471A1,CRGG6A53 GAAGAAATAAATCAAGGAGGAAGAAAATAT(375) EELHAALSEW (107) HLA-B44:03 95471A1 GAGGAGCTCCATGCGGCACTGAGTGAGTGG(376) EEMEWFNNY (108) HLA-B44:03, HLA-B18:01 95471A1,CRGG6A53,43882A1,1160100F,1136279F GAAGAAATGGAGTGGTTTAATAATTAT(377) EEQVNNIKP (109) HLA-B45:01 1284636F GAAGAGCAGTGAACAACATCAAACCT(378) EERFAVDEY (110) HLA-B44:03 95471A1 GAGGAGCGTTTTGCAGTGGACGAGTAC(379) EETLNTLRY (111) HLA-B44:03 95471A1,CRGG6A53 GAGGAAACATTAAATACCCTTCGCTAT (380) ELHAALSEW (112) HLA-A25:01 1160100F GAGCTCCATGCGGCACTGAGTGAGTGG(381) EPEQFVVVM (113) HLA-B35:02, HLA-B35:03 30774B1,ILS39235FT1,43882A1 GAACCTGAGCAGTTTGTGGTTGTGATG(382) EQFWRSVIF (114) HLA-B15:02 YU1YVAJU GAGCAATTTTGGCGTTCAGTTATATTT(383) EQTPIHISW (115) HLA-A25:01 111209A1 GAACAGACTCCAATTCATATATCATGG(384) ESESVQRVTR (116) HLA-A68:01 1306257F GAGAGCGAATCTGTGCAGAGAGTAACGCGG(385) ESKSVQRVTR (117) HLA-A68:01 UK9MAZ21 GAGAGCAAATCTGTGCAGAGAGTAACGCGG(386) ESYSFESSKF (118) HLA-A26:01 UK9MAZ21 GAGTCCTACTCTTTTGAGAGCAGCAAATTT(387) ETIGTGGFAK (119) HLA-A68:01 UK9MAZ21 GAAACTATTGGGACAGGTGGCTTTGCAAAG(388) ETVSEKKTF (120) HLA-A25:01 1160100F GAGACTGTCAGTGAAAAAAAAACTTTT (389) EYLKVGSEGHF (121) HLA-A23:01 95471A1 GAGTACCTGAAGGTGGGCTCCGAGGGACACTTC(390) EYNSDLHQF (122) HLA-A23:01, HLA-A24:02 95471A1,YU1YVAJU,ILS39235FT1,8AOM8AG,4ZFUNAIU,108937A1 GAGTACAACAGTGACCTCCATCAATTT(391) FFNLTLKQV (123) HLA-C04:01 95471A1 TTCTTCAACCTCACGCTCAAGCAGGTC(392) FLFLKEVKV (124) HLA-A02:01 B2CV7Z22 TTCCTATTTCTTAAAGAAGTAAAAGTT(393) FPAGAQVRL (125) HLA-B35:03 43882A1 TTCCCTGCCGGAGCCCAGGTACGCCTG(394) FQYEVAVL (126) HLA-B14:02 B2CV7Z22 TTCCAGTATGAAGTGGCTGTGCTG(395) FWDGKIVLV (127) HLA-C04:01 95471A1 TTTTGGGATGGGAAAATCGTGTTGGTT (396) GAMGYGYEK (128) HLA-A11:01 F93JCAVD GGGGCCATGGGCTATGGCTATGAGAAA(397) GEVGSEVHL (129) HLA-B40:01 EFLFZA9R GGCGAGGTGGGTTCTGAGGTTCACCTA(398) GKFQGLIEKF (130) HLA-B15:03 B2CV7Z22 GGGAAGTTCCAGGGTCTGATTGAGAAGTTT(399) GLFTWTHMK (131) HLA-A11:01 F93JCAVD GGTCTCTTCACATGGACGCACATGAAA(400) GLTGVIMTI (132) HLA-A02:01 B2CV7Z22 GGTCTCACTGGAGTGATCATGACAATA(401) HAINHGTAY (133) HLA-B15:02 YU1YVAJU CATGCCATAAACCATGGTACTGCATAC(402) HHSDWGNIMW (134) HLA-B38:01 UK9MAZ21 CATCACTCAGATTGGGGAAACATCATGTGG(403) HKVDKNEAF (135) HLA-B15:03 B2CV7Z22 CATAAAGTTGATAAAAATGAGGCTTTT (404) HNVDHASVL (136) HLA-C15:02, HLA-C03:04, HLA-C15:05 1284636F,4ZFUNAIU,2PXQ9AG6 CATAACGTGGATCACGCCAGTGTGTTG(405) HPTPVSQA (137) HLA-B56:01 UK9MAZ21 CACCCCACCCCAGTGTCACAGGCC(406) HVADGSATEM (138) HLA-C08:01 YU1YVAJU CATGTTGCTGATGGAAGTGCTACTGAAATG(407) HVIEDIKGRW (139) HLA-A25:01 1160100F CATGTAATTGAAGATATCAAAGGGAGGTGG(408) HVQPGQYVL (140) HLA-B35:03 43882A1 CACGTGCCAGCCTGGCCAGTACGTGCTG(409) IAADGHTDL (141) HLA-C03:04 YU1YVAJU ATCGCTGCAGATGGGCACACGGACCTG(410) IEARNQVFL (142) HLA-B40:01 RFY7HAL3 ATTGAAGCCAGAAATCAAGTTTTTCTT(411) IGNIKKTL (143) HLA-B08:01 1319540F ATTGGCAATATTAAGAAAACCTTA(412) IDENFAEL (144) HLA-C08:02 B2CV7Z22 ATAATTGATGAAAACTTTGCAGAACTA(413) IQRGGGIFF (145) HLA-B15:03 B2CV7Z22 ATCCAGCGAGGTGGAGGCATCCTTCTTC(414) ISVKGRIY (146) HLA-C16:01 B2CV7Z22,CRGG6A53 ATTTCGGTTAAAGGAAGAATTTAT (415) ITKTLKSNSW (147) HLA-B57:01 8AOM8AGA ATCACCAAAACACTGAAAAGCAATAGCTGG(416) IYFKNSENLW (148) HLA-A24:02 YU1YVAJU,ILS39235FT1 ATATTTTAAGAATTCAGAGAATCTATGG(417) KAIEVLLTL (149) HLA-C03:04 YU1YVAJU AAGGCCATTGAAGTTTTGTTAACTCTC(418) KATDIVTGL(150) HLA-C08:01 YU1YVAJU AAGGCCACTGACATCGTGCAGGTCTG(419) KDVNIPTL (151) HLA-B40:02 1306257F,ILS39235FT1 AAAGATGTAAACATTCCAACCTTG(420) KEKETVQV (152) HLA-B49:01 1189347F AAGGAGAAGGAGACAGTACAAGTG(421) KIFFFKDRF (153) HLA-A32:01 1120113F AAGATCTTTTTCTTCAAAGACAGGTTC(422) KIVDFSYSV (154) HLA-A02:01 EFLFZA9R AAGATAGTGGACTTTTCCTACAGTGTT(423) KLDEHIAYL (155) HLA-A02:01 1284636F,B2CV7Z22,CRGG6A53 AAACTAGATGAACATATTGCCTACCTG(424) KLGQVFFL (156) HLA-A02:01 B2CV7Z22,CRGG6A53,43882A1 AAGCTCGGGCAAGTGTTCTTCTTG (425) KLKEEITQL (157) HLA-A02:03 YU1YVAJU AAGCTGAAAGAAGAAATCACACAGTTA(426) KLYQSIIGY (158) HLA-B15:03, HLA-B15:25, HLA-A03:01 B2CV7Z22,YU1YVAJU,1146020F,1136279F AAGTTATACCGAGAGTATAATAGGATAC(427) KMNAKLEEL (159) HLA-A02:03 YU1YVAJU AAAATGAACGCCAAGCTAGAAGAGCTC(428) KMSELQTYV (160) HLA-B13:02, HLA-A02:01 EFLFZA9R,43882A1,1189347F AAAATGTCAGAGCTGCAGACCTATGTT(429) KPTVQPWIA (161) HLA-B56:01 UK9MAZ21 AAGCCTACAGTCCAGCCATGGATAGCA(430) KQMSISTGL (162) HLA-A32:01 1120113F AAGCAGATGTCCATTTCAACAGGCTTA(431) KTLKSNSW (163) HLA-B57:01 8AOM8AGA AAAACACTGAAAAGCAATAGCTGG(432) KVQEQPPAI (164) HLA-A02:01 B2CV7Z22 AAGGTCCAGGAGCAGCCACCGGCGATC(433) LEKAFSEI (165) HLA-B49:01 1189347F CTAGAAAAAGCTTTCTCTGAAATA(434) LERDQLKESL (166) HLA-B40:01 RFY7HAL3 CTGGAGAGAGACCAACTCAAGGAAAGCCTG(435) LEVEDRTSL (167) HLA-B40:01 EFLFZA9R TTGGAAGTTGAAGATCGTACTTCGTTG(436) LFDKSINEF (168) HLA-C04:01 95471A1 CTTTTCGATAAAAGCATAAATGAATTT(437) LLDKDVSMY (169) HLA-A01:01 RFY7HAL3,30774B1,B2CV7Z22,ILS39235FT1,CRGG6A53,8AOM8AGA,1189347F CTCCTGGACAAGGACGTGAGCATGTAC(438) LPAPYQHQL (170) HLA-B35:03 43882A1 CTCCCAGCCCCCTACCAACACCAGCTG(439) LPEEQDRLL (171) HLA-B35:02 ILS39235FT1 CTGCCTGAGGAGCAGGATCGTTTGCTC(440) LQRITKTL (172) HLA-B52:01 1146020F CTCCAACGTATCACCAAAACACTG(441) LSDSFSDLY (173) HLA-A01:01 30774B1,CRGG6A53,1319540F CTGTCTGATTCTTTCAGTGACCTGTAT(442) LSHTGKLAL (174) HLA-C03:04 YU1YVAJU CTGAGCCACACAGGAAAACTTGCCTTA(443) MEELGKVGF (175) HLA-B44:03 95471A1,CRGG6A53 ATGGAGGAATTAGGCAAAGTGGGTTTT(444) MESPSAPPHRW (176) HLA-B44:02 1306257F ATGGAGTCTCCCTCGGCCCCTCCCCACAGATGG(445) MTNEKTTKV (177) HLA-A02:03 YU1YVAJU ATGACTAACGAAAAAACTACCAAAGTA(446) MWDQRLVRL (178) HLA-C04:01 30774B1,95471A1,108937A1 ATGTGGGATCAGAGGCTGGTGAGGTTG(447) NAYEDLSQKY (179) HLA-B35:01 95471A1 AATGCATATGAGGATCTTAGTCAAAAATAC(448) NHENQKVQL (180) HLA-B38:01 K9MAZ21 AAccATXAAXXXXXXXXXXXX(449) NKITTKNAFF (181) HLA-B15:03 B2CV7Z22 AATAATCACTACCAAAGATGCTTTT(450) NLHLKTTSL (182) HLA-B08:01 1319540F ATCTACTC(451) NSTDFTTDR (183) HLA-A68:01 1306257F AACTCTACAGACTTTACCACTGACAGA(452) NYPKSIHSF (184) HLA-A24:02 YU1YVAJU,ILS39235FT1,8AOM8AGA,4ZFUNAIU,1146020F,1136279F AATTATCCCAAGAGCATACATTCTTTT(453) QEGPKQEAL (185) HLA-B40:02 ILS39235FT1 CAAGGGCCTAAGAGAGGCACTG(454) QEMEELGKVGF (186) HLA-B44:03 95471A1 SPRINGGGAGGAATTAGGGAAAGTGGGTTTT(455) (187) HLA-B49:01 1189347F SPRINGSTORMSSTORMS (456) QFYFNKENF (188) HLA-A23:01 95471A1 HELPTACTTCATTCATTEN (457) (189) HLA-B38:01, HLA-B38:02 UK9MAZ21,2PXQ9AG6 STORM STORM (458) QQKVVITKV (190) HLA-A02:03, HLA-B52:01 YU1YVAJU,1146020F,2PXQ9AG6 CAGCAGAAGGTTGTGATTACCAAGGTT(459) QTNSPPPPK (191) HLA-A11:01 G5TZDA6H CAGACGAATTCTCCCCCCCCCCCCAAA(460) QVIETQDPPR (192) HLA-A68:01 1306257F,UK9MAZ21 CAGGTCATCGAGACTCAGGACCCCCCCACGC(461) RAPPLGNPL (193) HLA-C01:02 F93JCAVD CGAGCTCCTCCCCTGGGAAATCCACTA(462) REAGKEAAL (194) HLA-B40:01 RFY7HAL3 AGGGAAGCTGGAAAAGAAGCGGCCCTG(463) REIREENKL (195) HLA-B40:01 EFLFZA9R AGGGAGATTCGAGAAGAAAACAAACTC(464) REIREENKLY (196) HLA-B44:03 95471A1 AGGGAGATTCGAGAAGAAAACAAACTCTAC(465) RELLETTERRY (197) HLA-B44:03 95471A1 CGGGAGCTGCTAGAGACCGAGGCGGCGCTAC(466) RELYANVVL (198) HLA-B40:02, HLA-B40:01 ILS39235FT1,EFLFZA9R CGGGAACTCTACGCCAACGTGGTGCTG(467) REMPGGPVW (199) HLA-B44:02, HLA-B44:03 1306257F,30774B1,95471A1,1160100F AGGGAAATGCCAGGGGGGCCCGTATGG(468) RHQEMFHYF (200) HLA-B38:01, HLA-A24:02 UK9MAZ21,ILS39235FT1 AGGCACCAGGAGATGTTCCACTATTTC(469) RKQTQEVSY (201) HLA-B15:03 B2CV7Z22 AGAAAACAAACCCAAGAGGTCAGCTAT(470) RLSPLSLTGK (202) HLA-A03:01 95471A1,1055698F,1319540F CGTCTGTCACCCCTTTCTTTGACTGGGAAA(471) RLWNETVEL (203) HLA-A02:01 RFY7HAL3,1284636F,1306257F,B2CV7Z22,EFLFZA9R,CRGG6A53,43882A1,1189347F AGGCTGTGGAATGAGACCGTGGAGCTT (472) RMVEMFLEY (204) HLA-B15:03, HLA-B15:25, HLA-A29:02, HLA-A29:01 B2CV7Z22,YU1YVAJU,111209A1,2PXQ9AG6 CGAATGGTTGAGATGTTTCTGGAATAT (473) RPRVSSTEM (205) HLA-B07:02 1319540F CGGCCTCGAGTATCCTCCACAGAAATG (474) RPVNVVNVY (206) HLA-B35:01 95471A1 AGGCCAGTCAATGTCGTCAATGTATAC (475) RQRKLQEY (207) HLA-B15:25 YU1YVAJU CGGCAGAGAAAGCTTCAGGAGTAC (476) RTLPVDSSHGF (208) HLA-B57:01 8AOM8AGA CGTACATTGCCAGTAGATTCTTCTCATGGTTTC (477) RYFDALLKL (209) HLA-A23:01 95471A1 CGTTACTTCGATGCCCTGCTGAAATTG (478) RYQATGLHF (210) HLA-A23:01, HLA-A24:02 95471A1,ILS39235FT1 CGGTACCAGGCAACTGGCTTACATTTC (479) SAGSRAVL (211) HLA-C16:01 B2CV7Z22 TCAGCCGGCTCCCGGGCGGTGCTA (480) SEDRPKQRW (212) HLA-B44:03 95471A1 AGTGAAGACAGACCAAAACAACGCTGG (481) SEEETRVVF (213) HLA-B40:01 EFLFZA9R TCAGAAGAGGAGACCCGGGTTGTCTTC (482) SEELHAALSEW (214) HLA-B44:03 95471A1 TCCGAGGAGCTCCATGCGGCACTGAGTGAGTGG (483) SENLLGKQF (215) HLA-B44:02, HLA-B44:03, HLA-B18:01 1306257F,30774B1,95471A1,CRGG6A53,43882A1,1160100F,1136279F,111209A1,108937A1 TCAGAGAATTTGCTTGGAAAACAGTTT (484) SEVDGNRMTL (216) HLA-B40:02, HLA-B40:01 ILS39235FT1,EFLFZA9R TCAGAAGTTGATGGTAACAGGATGACCTTG (485) SEVSKIVTV (217) HLA-B49:01 1189347F AGTGAAGTCAGCAAAATTGTCACAGTC (486) SEYSVHSSL (218) HLA-B40:01, HLA-B40:02 RFY7HAL3,1306257F,ILS39235FT1 TCAGAATATTCTGTGCACTCATCTTTG (487) SEYVHSSF (219) HLA-B18:01 1136279F TCTGAGTATGTCCACTCCTCTTTC (488) SHVQPGQYVL (220) HLA-B38:01 UK9MAZ21 AGCCACGTGCAGCCTGGCCAGTACGTGCTG (489) SILQFVHMV (221) HLA-A02:01 RFY7HAL3,1284636F,B2CV7Z22,43882A1,1120113F AGTATCCTGCAGTTTGTACACATGGTC (490) SKMSELQTY (222) HLA-B15:03 B2CV7Z22 TCTAAAATGTCAGAGCTGCAGACCTAT (491) SLIEKVTQL (223) HLA-A02:03 YU1YVAJU TCTCTGATAGAAAAAGTTACCCAATTA(492) SLQEKVAKA (224) HLA-A02:01 43882A1 TCATTACAGGAAAAAGTGGCCAAGGCT (493) SLRNGVLLA (225) HLA-A02:03 YU1YVAJU AGCCTTCGGAATGGAGTGCTGCTGGCC (494) SMYLHTEGF (226) HLA-B15:03, HLA-B15:25 B2CV7Z22,YU1YVAJU TCAATGTACCTCCACACAGAGGGCTTC (495) SPDWRRLAL (227) HLA-B07:02 1319540F TCCCCAGATTGGAGGAGGCTGGCTCTG (496) SPRPESGTV (228) HLA-B07:02 1319540F TCTCCCAGACCAGAGTCGGGTACTGTT (497) SQQKVVITK (229) HLA-A11:01 F93JCAVD TCCCAGCAGAAGGTTGTGATTACCAAG (498) SRNAQTFGF (230) HLA-B27:05 1120113F TCCCGGAATGCTCAAACCTTCGGATTT (499) SRSMRLLLL (231) HLA-C06:02 8AOM8AGA TCCAGAAGCATGCGGCTGCTCCTATTG (500) SRVAKTNSL (232) HLA-B14:02, HLA-C06:02 8AOM8AGA,B2CV7Z22 AGTCGGGTGGCCAAGACCAACTCCTTA(501) SSQIPSSVNK (233) HLA-A11:01 F93JCAVD TCATCTCAAATACCCAGTAGTGTAAATAAG (502) STIATSHPK (234) HLA-A11:01 F93JCAVD TCTACAATAGCTACCTCCCACCCCAAG (503) STIYLPLKR (235) HLA-A11:01 F93JCAVD TCCACTATTTACTTACCTCTGAAACGA (504) SVIDEPVRLK (236) HLA-A11:01 F93JCAVD TCTGTTATTGATGAGCCTGTACGGCTAAAA (505) SVPLSDALLNK (237) HLA-A11:01 F93JCAVD AGTGTTCCGCTAAGTGATGCTCTTTTAAATAAA (506) SVQENIQQK (238) HLA-A11:01 G5TZDA6H,F93JCAVD AGTGTCCAGGAAAATATACAGCAGAAA (507) TEEELKVAH (239) HLA-B18:01 1160100F ACTGAAGAGGAACTTAAAGTTGCTCAT (508) TETSNALKV (240) HLA-B49:01 1189347F ACAGAGACTTCAAATGCACTAAAGGTT (509) THVSQIFNMI (241) HLA-B38:01 UK9MAZ21 ACTCATGTTTCTCAGATTTTTAATATGATA (510) TIIDRSFRY (242) HLA-A29:01, HLA-A26:01, HLA-A29:02 G5TZDA6H,F93JCAVD,UK9MAZ21,4ZFUNAIU,111209A1 ACTATTATTGATCGTTCCTTCAGGTAT (511) TLFDYEVRL (243) HLA-A02:01 RFY7HAL3,1284636F,1306257F,30774B1,B2CV7Z22,EFLFZA9R,CRGG6A53,43882A1,1189347F,1160100F,1120113F,1055698F ACCCTCTTCGACTACGAGGTCCGCCTG (512) TLHDTRTHF (244) HLA-B15:02 YU1YVAJU ACTCTTCATGATACAAGAACACATTTT (513) TPAPVEKSPA (245) HLA-B56:01, HLA-B54:01, HLA-B07:02 UK9MAZ21,8AOM8AGA,1189347F,1319540F ACCCCGGCGCCGGTGGAGAAATCCCCGGCT (514) TPMPKDVRQSL (246) HLA-B07:02 1136279F,1319540F ACACCGATGCCAAAAGATGTTCGGCAGAGTCTC (515) TPSPIIQQL (247) HLA-B35:03 43882A1 ACTCCCAGCCCCATCATCCAGCAGTTG (516) TVNQFLTQY (248) HLA-B15:02 YU1YVAJU ACAGTAAATCAGTTTCTTACCCAATAC (517) VADHHLAQL (249) HLA-C08:01 YU1YVAJU GTGGCTGACCACCACCTGGCTCAGTTG (518) VEDRTSLVL (250) HLA-B40:01 EFLFZA9R GTTGAAGATCGTACTTCGTTGGTTTTA (519) VFMKDGFFY (251) HLA-A29:01 F93JCAVD,4ZFUNAIU,2PXQ9AG6 GTTTTCATGAAAGATGGATTTTTCTAT (520) VHQGGVELQQL (252) HLA-B38:01, HLA-B38:02 UK9MAZ21,2PXQ9AG6 GTGCACCAGGGAGGCGTGGAGCTGCAGCAGCTG (521) VIDEPVRL (253) HLA-C05:01, HLA-C04:01, HLA-C08:02 30774B1,95471A1,B2CV7Z22,43882A1,108937A1 GTTATTGATGAGCCAGTACGGCTA (522) VLDSFLQGY (254) HLA-A01:01 B2CV7Z22,1319540F GTCCTGGACAGCTTCCTCCAGGGCTAC (523) VLLHEVFTY (255) HLA-A29:01 4ZFUNAIU,F93JCAVD GTCCTGCTGCACGAGGTTTTCACCTAT (524) VPRKDVGNTL (256) HLA-B07:02 1136279F,1319540F GTACCCAGGAAGGATGTGGGAAACACTTTG (525) VQAIRITSY (257) HLA-B15:03,HLA-B15:25,HLA-C16:01 B2CV7Z22CRGG6A53YU1YVAJU GTACAGGCTATCAGGATAACTTCCTAT (526) VQRLRFEVY (258) HLA-B15:25 YU1YVAJU GTGCAGAGGCTGCGCTTTGAGGTGTAC (527) VYGIRLEHF (259) HLA-A24:02 8AOM8AGAILS39235FT1YU1YVAJU GTATATGGAATTCGACTGGAACATTTT (528) VYKVVGNLL (260) HLA-A24:02 4ZFUNAIUILS39235FT1YU1YVAJU GTCTATAAGGTGGTCGGGAACCTCCTG (529) YEDLSQKY (261) HLA-B18:01 43882A1,1160100F TATGAGGATCTTAGTCAAAAATAC (530) YEIEARNQV (262) HLA-B49:01 1189347F TATGAAATTGAAGCCAGAAATCAAGTT (531) YEIEARNQVF (263) HLA-B18:01 43882A1,1136279F TATGAAATTGAAGCCAGAAATCAAGTTTTT (532) YLLDKDVSM (264) HLA-A02:01 1189347F TACCTCCTGGACAAGGACGTGAGCATG (533) YLLDKDVSMY (265) HLA-A01:01 B2CV7Z22 TACCTCCTGGACAAGGACGTGAGCATGTAC (534) YLLDKDVSMYP (266) HLA-A01:01 B2CV7Z22 TACCTCCTGGACAAGGACGTGAGCATGTACCCT (535) YMLEMDNSMKI (267) HLA-A02:01 43882A1B2CV7Z22 TATATGCTGGAGATGGACAACTCAATGAAAATT (536) YPMRILYDL (268) HLA-B35:03 43882A1 TATCCAATGAGAATTTTATATGACCTT (537) YPWPYGRQT (269) HLA-B54:01 8AOM8AGA TACCCCTGGCCCTACGGCCGACAGACG (538) Table 2D: Characteristics of TAAs identified in this paper (continued) peptide MCS_alignment biotype overlapping ERE sample TCGA_COAD_2GTEx95th AATSRIAEL (77) chr10:93503329-93503355 annotated_ORF 79% AAVFNPRFY (78) chr11:102865811-102865837 annotated_ORF 78% AAVSTHVAL (79) chr2:219055465-219055491 annotated_ORF 62% AEIGYRNSL (80) chr6:80011751-80011777 annotated_ORF 55% AELESKTNTL (81) chr10:93503347-93503376 annotated_ORF 78% AEYNSDLHQF (82) chr2:110672828-110672857 annotated_ORF 50% AIIDPNHEIEF (83) chr6:80039801-80039833 annotated_ORF 46% ALNEQIARL (84) chr18:2589260-2589286 annotated_ORF 38% APGPATREA (85) chr4:121823587-121823613 annotated_ORF 48% ASQESTMPK (86) chr8:37597709-37597735 ncRNA 75% ATDIVTGLKQK (87) chrX:100848692-100848724 annotated_ORF 93% ATREAGSAL (88) chr4:121823575-121823601 annotated_ORF 55% AVADHHLAQL (89) chr2:219055366-219055395 annotated_ORF 68% DAIIKIQAW (90) chr1:156544212-156544223|156544389-156544403 annotated_ORF 43% DALQKQREV (91) chrX:70387211-70387237 annotated_ORF 72% DARDTNMGAW (92) chr19:4930731-4930760 annotated_ORF 57% DEENTGADRLM (93) chr2:219060159-219060191 annotated_ORF 50% DEKVVITY (94) chr1:197122029-197122043|197122159-197122167 annotated_ORF 30% DEMQDVMHF (95) chr12:15586900-15586926 annotated_ORF 24% DEMQHVQH (96) chr8:27788922-27788945 annotated_ORF 53% DEQTPIHISW (97) chr14:54399948-54399976|54401524-54401524 annotated_ORF 68% DIMKIREY (98) chr13:21172382-21172405 annotated_ORF 74% DLKKLVDSL (99) chr6:30110487-30110513 annotated_ORF 78% DLLQHSEY (100) chr15:40213332-40213355 annotated_ORF 55% DQIIRLEKL (101) chr3:44801858-44801884 annotated_ORF 43% DTAMPAHSR (102) chr1:241861491-241861502|241866830-241866844 annotated_ORF 77% DVIKEINKA (103) chr18:50391161-50391187 annotated_ORF 40% DVMHFNYTAW (104) chr12:15586912-15586941 annotated_ORF 30% EEFEYQRSY (105) chr5:60599165-60599191 annotated_ORF 48% EEINQGGRKY (106) chr1:62207589-62207618 annotated_ORF Yes 34% EELHAALSEW (107) chr6:30103581-30103610 annotated_ORF 78% EEMEWFNNY (108) chr20:25418190-25418195|25425211-25425231 annotated_ORF 44% EEQVNNIKP (109) chr13:59879382-59879408 annotated_ORF 47% EERFAVDEY (110) chr1:156534078-156534104 annotated_ORF 71% EETLNTLRY (111) chrX:70330222-70330248 annotated_ORF 68% ELHAALSEW (112) chr6:30103581-30103607 annotated_ORF 79% EPEQFVVVM (113) chr13:59879466-59879468|59911735-59911758 annotated_ORF 61% EQFWRSVIF (114) chr14:54966580-54966606 annotated_ORF 15% EQTPIHISW (115) chr14:54399951-54399976|54401524-54401524 annotated_ORF 68% ESESVQRVTR (116) chr10:128101291-128101320 annotated_ORF 44% ESKSVQRVTR (117) chr10:128101291-128101320 annotated_ORF 50% ESYSFESSKF (118) chr1:241878984-241879013 annotated_ORF 53% ETIGTGGFAK (119) chr9:36581724-36581739|36583627-36583640 annotated_ORF 72% ETVSEKKTF (120) chr8:27777047-27777073 annotated_ORF 45% EYLKVGSEGHF (121) chr9:136763723-136763755 annotated_ORF 26% EYNSDLHQF (122) chr2:110672828-110672854 annotated_ORF 52% FFNLTLKQV (123) chr19:17808351-17808374|17811571-17811573 annotated_ORF 41% FLFLKEVKV (124) chr1:62209843-62209869 annotated_ORF 38% FPAGAQVRL (125) chr2:219055807-219055833 annotated_ORF 73% FQYEVAVL (126) chrX:100849868-100849891 annotated_ORF 97% FWDGKIVLV (127) chr8:27791993-27792019 annotated_ORF 50% GAMGYGYEK (128) chr17:43529936-43529952|43530107-43530116 annotated_ORF 89% GEVGSEVHL (129) chr1:35765318-35765326|35769847-35769864 annotated_ORF 25% GKFQGLIEKF (130) chr5:138287220-138287249 annotated_ORF 52% GLFTWTHMK (131) chrX:4545871-4545897 Intergenic Yes 41% GLTGVIMTI (132) chrX:100862514-100862540 annotated_ORF 94% HAINHGTAY (133) chr12:102178601-102178627 annotated_ORF 47% HHSDWGNIMW (134) chr6:30112660-30112689 Frameshift 85% HKVDKNEAF (135) chr8:27780207-27780233 annotated_ORF 47% HNVDHASVL (136) chr1:47251916-47251922|47260289-47260308 annotated_ORF 33% HPTPVSQA (137) chr20:45792622-45792645 5UTR 64% HVADGSATEM (138) chr2:96343295-96343304|96344105-96344124 annotated_ORF 63% HVIEDIKGRW (139) chr1:68494468-68494497 annotated_ORF 38% HVQPGQYVL (140) chr2:219055528-219055554 annotated_ORF 63% IAADGHTDL (141) chr1:156533072-156533098 annotated_ORF 58% IEARNQVFL (142) chr11:102866322-102866348 annotated_ORF 74% IGNIKKTL (143) chr18:50375879-50375902 annotated_ORF 43% IIDENFAEL (144) chr1:62210944-62210970 annotated_ORF Yes 35% IQRGGGIFF (145) chr7:984559-984574|984950-984960 annotated_ORF 42% ISVKGRIY (146) chr6:80031497-80031520 annotated_ORF 47% ITKTLKSNSW (147) chr11:102863112-102863141 annotated_ORF 83% IYFKNSENLW (148) chrX:101127138-101127167 annotated_ORF 19% KAIEVLLTL (149) chr3:108566634-108566638|108568155-108568176 annotated_ORF 15% KATDIVTGL (150) chrX:100848701-100848727 annotated_ORF 96% KDVNIPTL (151) chr14:55189015-55189038 annotated_ORF 56% KEKETVQV (152) chr6:30111684-30111707 annotated_ORF 83% KIFFFKDRF (153) chr11:102866445-102866448|102867270-102867292 annotated_ORF 79% KIVDFSYSV (154) chr15:40217539-40217565 annotated_ORF 45% KLDEHIAYL (155) chrX:72206778-72206804 annotated_ORF 34% KLGQVFFL (156) chr5:160634541-160634564 annotated_ORF 54% KLKEEITQL (157) chr10:89738511-89738537 annotated_ORF 23% KLYQSIIGY (158) chr13:59833182-59833208 annotated_ORF 33% KMNAKLEEL (159) chrX:70343721-70343747 annotated_ORF 60% KMSELQTYV (160) chr1:214642629-214642655 annotated_ORF 60% KPTVQPWIA (161) chr15:40185278-40185304 annotated_ORF 52% KQMSISTGL (162) chr4:17828329-17828355 annotated_ORF 44% KTLKSNSW (163) chr11:102863112-102863135 annotated_ORF 85% KVQEQPPAI (164) chr19:17807910-17807936 annotated_ORF 83% LEKAFSEI (165) chr3:44802943-44802966 annotated_ORF 46% LERDQLKESL (166) chr4:103140832-103140861 annotated_ORF 29% LEVEDRTSL (167) chr13:21158051-21158077 annotated_ORF 82% LFDKSINEF (168) chr2:168889472-168889498 annotated_ORF 83% LLDKDVSMY (169) chr13:27968965-27968991 annotated_ORF 95% LPAPYQHQL (170) chr17:43532846-43532872 annotated_ORF 91% LPEEQDRLL (171) chr3:44801909-44801935 annotated_ORF 47% LQRITKTL (172) chr11:102863127-102863150 annotated_ORF 87% LSDSFSDLY (173) chr1:53832572-53832591|53835500-53835506 annotated_ORF 22% LSHTGKLAL (174) chr8:127209396-127209422 ncRNA 78% MEELGKVGF (175) chrX:100849322-100849348 annotated_ORF 95% MESPSAPPHRW (176) chr19:41708732-41708764 annotated_ORF 96% MTNEKTTKV (177) chr10:128106635-128106661 annotated_ORF 45% MWDQRLVRL (178) chr15:32616212-32616238 annotated_ORF 49% NAYEDLSQKY (179) chr1:214641438-214641467 annotated_ORF 50% NHENQKVQL (180) chr13:59666827-59666846|59774189-59774195 annotated_ORF 56% NKITTKNAF (181) chr2:96342138-96342140|96342756-96342779 annotated_ORF 37% NLHLKTTSL (182) chr6:80042276-80042302 3UTR 44% NSTDFTTDR (183) chr1:35764404-35764430 annotated_ORF 28% NYPKSIHSF (184) chr11:102865868-102865894 annotated_ORF 77% QEGPKQEAL (185) chrX:72206196-72206222 annotated_ORF 38% QEMEELGKVGF (186) chrX:100849322-100849354 annotated_ORF 95% QEVQLMTKI (187) chr1:214645010-214645036 annotated_ORF 48% QFYFNKENF (188) chrX:100843955-100843981 annotated_ORF 95% QHQETINTL (189) chr4:103158384-103158410 annotated_ORF 34% QQKVVITKV (190) chrX:100850384-100850386|100851233-100851256 annotated_ORF 56% QTNSPPPPK (191) chr11:2138386-2138412 Intron 14% QVIETQDPPR (192) chr2:219055642-219055671 annotated_ORF 68% RAPPLGNPL (193) chr12:13373339-13373365 ncRNA 78% REAGKEAAL (194) chr2:96368981-96369007 annotated_ORF 65% REIREENKL (195) chr1:197090278-197090304 annotated_ORF 38% REIREENKLY (196) chr1:197090275-197090304 annotated_ORF 32% RELLETERRY (197) chr9:35665059-35665088 annotated_ORF 56% RELYANVVL (198) chr19:4932928-4932954 annotated_ORF 73% REMPGGPVW (199) chr11:102872888-102872914 annotated_ORF 85% RHQEMFHYF (200) chr6:30112491-30112517 annotated_ORF 83% RKQTQEVSY (201) chr1:200608920-200608928|200614318-200614335 annotated_ORF 29% RLSPLSLTGK (202) chr8:75324446-75324475 Intron Yes 25% RLWNETVEL (203) chr5:60687207-60687227|60700046-60700051 annotated_ORF 77% RMVEMFLEY (204) chr2:168889233-168889259 annotated_ORF 70% RPRVSSTEM (205) chr10:13180443-13180469 annotated_ORF 60% RPVNVVNVY (206) chr22:19482789-19482815 annotated_ORF 52% RQRKLQEY (207) chr2:112762541-112762564 annotated_ORF 36% RTLPVDSSHGF (208) chr15:32629639-32629671 annotated_ORF 21% RYFDALLKL (209) chr1:156552071-156552095|156554235-156554236 annotated_ORF 59% RYQATGLHF (210) chr1:156566087-156566104|156566390-156566398 annotated_ORF 61% SAGSRAVL (211) chr7:29563986-29564009 5UTR 83% SEDRPKQRW (212) chrX:70402612-70402638 annotated_ORF 68% SEEETRVVF (213) chr9:36594679-36594705 annotated_ORF 54% SEELHAALSEW (214) chr6:30103581-30103613 annotated_ORF 73% SENLLGKQF (215) chr10:128110430-128110456 annotated_ORF 40% SEVDGNRMTL (216) chr17:40300893-40300922 annotated_ORF 58% SEVSKIVTV (217) chr2:200571454-200571480 annotated_ORF 26% SEYSVHSSL (218) chr2:110667651-110667677 annotated_ORF 66% SEYVHSSF (219) chr6:116120100-116120123 annotated_ORF 55% SHVQPGQYVL (220) chr2:219055528-219055557 annotated_ORF 61% SILQFVHMV (221) chr12:15586978-15587004 annotated_ORF 32% SKMSELQTY (222) chr1:214642626-214642652 annotated_ORF 54% SLIEKVTQL (223) chr3:44801765-44801791 annotated_ORF 39% SLQEKVAKA (224) chr5:163482694-163482720 annotated_ORF 32% SLRNGVLLA (225) chr1:156566465-156566491 annotated_ORF 38% SMYLHTEGF (226) chr17:43530138-43530164 annotated_ORF 86% SPDWRRLAL (227) chr4:153204497-153204523 5UTR 46% SPRPESGTV (228) chr1:241866914-241866940 annotated_ORF 68% SQQKVVITK (229) chrX:100851233-100851259 annotated_ORF 58% SRNAQTFGF (230) chr13:59879250-59879276 annotated_ORF 48% SRSMRLLLL (231) chr1:119808737-119808763 annotated_ORF 79% SRVAKTNSL (232) chr1:37692712-37692738 annotated_ORF 46% SSQIPSSVNK (233) chrX:72205512-72205541 annotated_ORF 36% STIATSHPK (234) chrX:100844078-100844078|100848630-100848655 annotated_ORF 95% STIYLPLKR (235) chr12:13376283-13376309 ncRNA Yes 80% SVIDEPVRLK (236) chr10:128122919-128122948 annotated_ORF 58% SVPLSDALLNK (237) chr6:80007895-80007927 annotated_ORF 34% SVQENIQQK (238) chr10:92639878-92639900|92645363-92645366 annotated_ORF 44% TEEELKVAH (239) chr4:103145646-103145672 annotated_ORF 25% TETSNALKV (240) chr8:25469965-25469980|25479913-25479923 annotated_ORF 46% THVSQIFNMI (241) chr10:92633712-92633741 annotated_ORF 41% TIIDRSFRY (242) chr10:128119316-128119319|128122881-128122903 annotated_ORF 46% TLFDYEVRL (243) chr19:4929237-4929263 annotated_ORF 60% TLHDTRTHF (244) chr1:197103638-197103664 annotated_ORF 33% TPAPVEKSPA (245) chr6:27867470-27867499 annotated_ORF 10% TPMPKDVRQSL (246) chr13:59774232-59774248|59774728-59774743 annotated_ORF 32% TPSPIIQQL (247) chr13:21161800-21161826 annotated_ORF 89% TVNQFLTQY (248) chr4:121819420-121819446 annotated_ORF 60% VADHHLAQL (249) chr2:219055366-219055392 annotated_ORF 68% VEDRTSLVL (250) chr13:21158045-21158071 annotated_ORF 82% VFMKDGFFY (251) chr11:102790511-102790521|102790703-102790718 annotated_ORF 59% VHQGGVELQQL (252) chr19:11149150-11149182 annotated_ORF 37% VIDEPVRL (253) chr10:128122922-128122945 annotated_ORF 63% VLDSFLQGY (254) chr17:44936042-44936068 annotated_ORF 36% VLLHEVFTY (255) chr20:63541210-63541236 annotated_ORF 37% VPRKDVGNTL (256) chr13:27432733-27432762 ncRNA 30% VQAIRITSY (257) chr3:170084594-170084620 annotated_ORF 43% VQRLRFEVY (258) chr16:89577620-89577646 annotated_ORF 27% VYGIRLEHF (259) chr1:163327530-163327556 annotated_ORF 39% VYKVVGNLL (260) chr1:156534716-156534733|156535163-156535171 annotated_ORF 42% YEDLSQKY (261) chr1:214641444-214641467 annotated_ORF 48% YEIEARNQV (262) chr11:102866328-102866354 annotated_ORF 79% YEIEARNQVF (263) chr11:102866325-102866354 annotated_ORF 80% YLLDKDVSM (264) chr13:27968968-27968994 annotated_ORF 95% YLLDKDVSMY (265) chr13:27968965-27968994 annotated_ORF 95% YLLDKDVSMYP (266) chr13:27968962-27968994 annotated_ORF 95% YMLEMDNSMKI (267) chr19:41770894-41770926 3UTR yes 42% YPMRILYDL (268) chr13:21172644-21172670 annotated_ORF 57% YPWPYGRQT (269) chr17:8210177-8210203 annotated_ORF 55% Example 3: Confirmation of the immunogenicity of representative TSAs It is generally accepted that there are two important characteristics for predicting the immunogenicity of MHC-related peptides (MAPs): (1) High MHC binding affinity; and (2) Lack of expression of medullary thymic epithelial cells (mTECs) The tumor antigen peptides identified in Example 2 were eluted from MHC class I molecules present on the surface of ovarian tumor cells isolated from CRC patients via immunoprecipitation, thus implicitly indicating that they bind strongly to MHC class I molecules, which would otherwise be impossible to identify using the method used by the inventors. Furthermore, the binding of the identified peptides to MHC class I molecules was evaluated using the NetMHCpan-4.1b tool, and only peptides predicted to have an affinity ≤2% for MHC alleles were selected (see Example 1, “MAP Identification” section).

[0332] Regarding the expression of mTECs, this factor is important because mTECs express MAPs present in all normal cells of the body, and MAP expression in TECs has been reported to be negatively correlated with expression. In the examples, one criterion for selecting tumor antigen peptides is the lack of expression in TECs (see, Example 1, “Selection of Tumor Antigens (TAs)” section).

[0333] The immunogenicity of the representative tumor antigen peptides identified in Example 2 was tested using an in vitro stimulation assay. Monocyte-derived dendritic cells (mDCs) were generated from frozen PBMCs based on the previously described protocol (26). Briefly, StemCell Technologies' EasySep... Human CD14 Positive Sorting Kit II was used to obtain monocytes from CD14+ enriched PBMCs. Monocytes were cultured in CellGenix medium supplemented with human serum (BiolVT), IL-4 (Peprotech), and GM-CSF (Peprotech). DCs were then matured in CellGenix medium supplemented with human serum (BiolVT), IL-4 (Peprotech), LPS (Sigma Aldrich), IFNγ (Peprotech), GM-CSF (Peprotech), and a peptide (10 μM / ml, SB peptide). Matured DCs were then co-cultured with enriched naïve CD8 T cells for 16 days. On day 16, the response of CD8 T cells to aeTSAs was analyzed using the IFNγ ELISpot kit (MabTech) according to the manufacturer's instructions. As a positive control during amplification, a known immunogenic peptide (MelanA binding to HLA-A*02:01) was included for HLA-A2+ donors.

[0334] The results shown in Table 3 demonstrate that all tested TSAs induced the expansion of antigen-specific CD8 T cells after in vitro stimulation, thus confirming their immunogenicity.

[0335] Table 3: Expansion of antigen-specific CD8 T cells TSA Eluted HLA alleles Average IFNγ spot-forming units (SFU) / 1 x 10^6 CD8 T cells (peptide) Average IFNγ spot-forming units (SFU) / 1 x 10^6 CD8 T cells (vector) # Donor SEQ ID NO:19 HLA-A*02:01 2553 273 1 SEQ ID NO:1 HLA-A*03:01 2974 160 4 SEQ ID NO:25 HLA-A*03:01 8077 703 2 SEQ ID NO:17 HLA-A*11:01 3027 317 1 SEQ ID NO:24 HLA-A*11:01 4962 274 4 SEQ ID NO:43 HLA-B*07:02 4623 280 2 SEQ ID NO:9 HLA-B*18:01 4093 273 1 SEQ ID NO:23 HLA-A*11:01 983 30 1 Although the invention has been described above with reference to specific embodiments, modifications may be made without departing from the spirit and essence of the invention as defined in the appended claims. In the claims, the word “comprising” is used as an open-ended term, essentially equivalent to the phrase “including but not limited to.” Unless the context clearly specifies otherwise, the singular forms “a,” “an,” and “the” include plural references.

[0336] References 1. AM Bolger, M. Lohse, B. Usadel, Trimmomatic: A flexible trimming tool for Illumina sequencing data. Bioinformatics® 30, 2114-2120 (2014). 2. A. Dobin et al., STAR: An ultrafast universal RNA-seq aligner. Bioinformatics? 29, 15-21 (2013). 3. A. Szolek et al., OptiType: Precise HLA genotyping from next-generation sequencing data. Bioinformatics® 30, 3310-3316 (2014). 4. P. Jia et al., MSIsensor-pro: A rapid, accurate, and non-matching normal sample-free method for detecting microsatellite instability. Genomics Proteomics Bioinformatics? 18, 65-71 (2020). 5. NL Bray, H. Pimentel, P. Melsted, L. Pachter, A near-optimal probabilistic method for RNA-seq quantification. Nat Biotechnol® 34, 525-527 (2016). 6. C. Soneson, MI Love, MD Robinson, Differential analysis of RNA-seq: Transcript level estimation improves gene level inference. F1000Res?4, 1521 (2015). 7. J. Galon, HK. Angell, D. Bedognetti, FM. Marincola, Continuity of cancer immune surveillance: prognostic, predictive, and mechanistic characteristics. Immunity® 39, 11-26 (2013). 8. J. Roelands et al., A comprehensive oncological, immune, and microbiome atlas of colorectal cancer. Nat Med? 29, 1273-1286 (2023). 9. E. Wang, A. Worschech, FM Marincola, Immunological constants of rejection. TrendsImmunol? 29, 256-262 (2008). 10. J. Guinney et al., Consensus molecular subtypes of colorectal cancer. Nat Med? 21, 1350-1356 (2015). 11. MP Hardy et al., Release of small extracellular vesicles loaded with immunostimulatory virus-like RNA from apoptotic endothelial cells. Sci Rep?9, 7203 (2019). 12. D. Karolchik et al., UCSC Table Browser data retrieval tool. Nucleic AcidsRes?32, D493-496 (2004). 13. Kloor M., Reuschenbach M., Karbach J., Rafiyan M., Al-Batran S.-E., Pauligk C., Jaeger E., Doeberitz M.vK. Frameshift peptide antigen vaccination in MSI-H colorectal cancer patients: a phase I / II clinical trial. J. Clin. Oncol. 2015;33:3020. 14. CM Laumont et al., Non-coding regions are a major source of targetable tumor-specific antigens. SciTransl Med?10, (2018). 15. G. Marcais, C. Kingsford, An efficient, lock-free parallel counting method for k-mer occurrences. Bioinformatics® 27, 764-770 (2011). 16. I. Sirois, M. Isabelle, JD Duquette, F. Saab, E. Caron, Immunopeptidomics: Isolation of mouse and human MHC class I and II related peptides for mass spectrometry analysis. J Vis Exp, (2021). 17. L. Xin et al., A simplified platform for analyzing trillions of DDA and DIA mass spectrometry data, enabling highly sensitive immunopeptidomics. Nat Commun® 13, 3108 (2022). 18. M. Courcelles et al., MAPDP: A cloud-based computational platform for immunopeptidomics analysis. J Proteome Res? 19, 1873-1881 (2020). 19. J. Zhang et al., PEAKS DB: De novo sequencing-assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics® 11, M111 010587 (2012). 20. MVR Cuevas et al., BamQuery: A proteogenomics tool for exploring the immune peptidomome and preferentially processing manipulable tumor antigens. Genome Biol? 24, 188 (2023). 21. JK Eng et al., In-depth exploration of Comet—implementation and characteristics. J Am Soc MassSpectrom? 26, 1865-1874 (2015). 22. L. Kall, JD. Canterbury, J. Weston, WS. Noble, MJ. MacCoss, Semi-supervised learning for peptide identification from shotgun proteomics datasets. Nat Methods® 4, 923-925 (2007). 23. S. Gessulat et al., Prosit: Proteome-wide peptide tandem mass spectrometry prediction using deep learning. Nat Methods® 16, 509-518 (2019). 24. M. Wilhelm et al., Deep learning improves the sensitivity of mass spectrometry-based immunopeptidomics. NatCommun? 12, 3346 (2021). 25. Q. Zhao et al., Proteogenomics reveals a largely shared tumor-specific antigen library in ovarian cancer. Cancer Immunol Res? 8, 544-555 (2020). 26. Wolfl M., Greenberg P. Activation and cytokine-promoted expansion of antigen-specific naïve human CD8+ T cells. Nat Protoc?9, 950-966 (2014). https: / / doi.org / 10.1038 / nprot.2014.064.

Claims

1. A tumor antigen peptide (TAP) comprising or consisting of any of the amino acid sequences described in any one of SEQ ID NOs: 1-269.

2. The TAP of claim 1, wherein the TAP binds to the HLA-A*01:01 molecule and comprises or consists of the sequence of SEQ ID NO:20,169,173,254,265 or266.

3. The TAP of claim 1, wherein the TAP binds to the HLA-A*02:01 molecule and comprises or consists of the sequence of SEQ ID NO: 6, 27, 30, 44, 58, 84, 124, 132, 154-156, 160, 164, 203, 221, 224, 243, 264 or 267.

4. The TAP of claim 1, wherein the TAP binds to the HLA-A*02:03 molecule and comprises or consists of the sequence of SEQ ID NO:23,84,89,157,159,177,190,223 or225.

5. The TAP of claim 1, wherein the TAP binds to the HLA-A*03:01 molecule and comprises or is composed of the sequence of SEQ ID NO: 1, 35, 158 or 202.

6. The TAP of claim 1, wherein the TAP binds to the HLA-A*11:01 molecule and comprises or consists of the sequence of SEQ ID NO: 11, 25, 32, 34, 45, 86, 87, 128, 131, 191, 229 or 233-238.

7. The TAP of claim 1, wherein the TAP binds to the HLA-A*23:01 molecule and comprises or consists of the sequence of SEQ ID NO:74,121,122,188,209 or210.

8. The TAP of claim 1, wherein the TAP binds to the HLA-A*24:02 molecule and comprises or consists of the sequence of SEQ ID NO:33,122,148,184,200,210,259 or260.

9. The TAP of claim 1, wherein the TAP binds to the HLA-A*25:01 molecule and comprises or consists of the sequence of SEQ ID NO:16,17, 90, 92, 104, 112, 115, 120 or 139.

10. The TAP of claim 1, wherein the TAP binds to the HLA-A*26:01 molecule and comprises or is composed of the sequence of SEQ ID NO:4,61,103,118 or242.

11. The TAP of claim 1, wherein the TAP binds to the HLA-A*29:01 molecule and comprises or consists of the sequence of SEQ ID NO:21,204,242,251 or255.

12. The TAP of claim 1, wherein the TAP binds to the HLA-A*32:01 molecule and comprises or is composed of the sequence of SEQ ID NO:153 or 162.

13. The TAP of claim 1, wherein the TAP binds to the HLA-A*68:01 molecule and comprises or consists of the sequence of SEQ ID NO:15,49,69,102,116,117,119,183 or192.

14. The TAP of claim 1, wherein the TAP binds to the HLA-B*07:02 molecule and comprises or consists of the sequence of SEQ ID NO:38,47,54,66,88,205,227,228,245,246 or256.

15. The TAP of claim 1, wherein the TAP binds to the HLA-B*08:01 molecule and comprises or is composed of the sequence of SEQ ID NO:46,99,143 or182.

16. The TAP of claim 1, wherein the TAP binds to the HLA-B*13:02 molecule and comprises or consists of the sequence of SEQ ID NO:51 or 160.

17. The TAP of claim 1, wherein the TAP binds to the HLA-B*14:02 molecule and comprises or consists of the sequence of SEQ ID NO:101, 126 or 232.

18. The TAP of claim 1, wherein the TAP binds to the HLA-B*15:02 molecule and comprises or consists of the sequence of SEQ ID NO:63,98,100,114,133,244 or248.

19. The TAP of claim 1, wherein the TAP binds to the HLA-B*15:03 molecule and comprises or is composed of the sequence of SEQ ID NO: 5, 22, 53, 130, 135, 145, 158, 181, 201, 204, 222, 226 or 257.

20. The TAP of claim 1, wherein the TAP binds to the HLA-B*15:25 molecule and comprises or consists of the sequence of SEQ ID NO: 9, 10, 55, 83, 158, 204, 207, 226, 257 or 258.

21. The TAP of claim 1, wherein the TAP binds to the HLA-B*18:01 molecule and comprises or consists of the sequence of SEQ ID NO: 12,93-96, 105, 108, 215, 219, 239, 261 or 263.

22. The TAP of claim 1, wherein the TAP binds to the HLA-B*27:05 molecule and comprises or consists of the sequence of SEQ ID NO:68 or 230.

23. The TAP of claim 1, wherein the TAP binds to the HLA-B*35:01 molecule and comprises or is composed of the sequence of SEQ ID NO:179 or 206.

24. The TAP of claim 1, wherein the TAP binds to the HLA-B*35:02 molecule and comprises or is composed of the sequence of SEQ ID NO:38,113 or 171.

25. The TAP of claim 1, wherein the TAP binds to the HLA-B*35:03 molecule and comprises or consists of the sequence of SEQ ID NO:59,76,113,125,140,170,247 or268.

26. The TAP of claim 1, wherein the TAP binds to the HLA-B*38:01 molecule and comprises or consists of the sequence of SEQ ID NO:65,75,134,180,189,200,220,241 or252.

27. The TAP of claim 1, wherein the TAP binds to the HLA-B*38:02 molecule and comprises or is composed of the sequence of SEQ ID NO:19,189 or 252.

28. The TAP of claim 1, wherein the TAP binds to the HLA-B*40:01 molecule and comprises or consists of the sequence of SEQ ID NO: 64, 80, 81, 129, 142, 166, 167, 194, 195, 198, 213, 216, 218 or 250.

29. The TAP of claim 1, wherein the TAP binds to the HLA-B*40:02 molecule and comprises or is composed of the sequence of SEQ ID NO:18,29, 52, 56, 151, 185, 198, 216 or 218.

30. The TAP of claim 1, wherein the TAP binds to the HLA-B*44:02 molecule and comprises or is composed of the sequence of SEQ ID NO:97,176,199 or215.

31. The TAP of claim 1, wherein the TAP binds to the HLA-B*44:03 molecule and comprises or consists of the sequence of SEQ ID NO: 3, 13, 43, 82, 97, 105-108, 110, 111, 175, 186, 196, 197, 199, 212, 214 or 215.

32. The TAP of claim 1, wherein the TAP binds to the HLA-B*45:01 molecule and comprises or is composed of the sequence of SEQ ID NO:14,24 or 109.

33. The TAP of claim 1, wherein the TAP binds to the HLA-B*49:01 molecule and comprises or consists of the sequence of SEQ ID NO:152, 165, 187, 217, 240 or 262.

34. The TAP of claim 1, wherein the TAP binds to the HLA-B*51:01 molecule and comprises or is composed of the sequence of SEQ ID NO:

91.

35. The TAP of claim 1, wherein the TAP binds to the HLA-B*52:01 molecule and comprises or is composed of the sequence of SEQ ID NO:172 or 190.

36. The TAP of claim 1, wherein the TAP binds to the HLA-B*54:01 molecule and comprises or is composed of the sequence of SEQ ID NO:245 or 269.

37. The TAP of claim 1, wherein the TAP binds to the HLA-B*56:01 molecule and comprises or consists of the sequence of SEQ ID NO:7,8,67,71,85,137,161 or245.

38. The TAP of claim 1, wherein the TAP binds to the HLA-B*57:01 molecule and comprises or is composed of the sequence of SEQ ID NO:28,147,163 or 208.

39. The TAP of claim 1, wherein the TAP binds to the HLA-C*01:02 molecule and comprises or is composed of the sequence of SEQ ID NO:37,40 or 193.

40. The TAP of claim 1, wherein the TAP binds to the HLA-C*03:03 molecule and comprises or is composed of the sequence of SEQ ID NO:

72.

41. The TAP of claim 1, wherein the TAP binds to the HLA-C*03:04 molecule and comprises or consists of the sequence of SEQ ID NO:36,50,60,70,77,79,136,141,149 or174.

42. The TAP of claim 1, wherein the TAP binds to the HLA-C*04:01 molecule and comprises or consists of the sequence of SEQ ID NO: 123, 127, 168, 178 or 253.

43. The TAP of claim 1, wherein the TAP binds to the HLA-C*05:01 molecule and comprises or is composed of the sequence of SEQ ID NO:

253.

44. The TAP of claim 1, wherein the TAP binds to the HLA-C*06:02 molecule and comprises or is composed of the sequence of SEQ ID NO:231 or 232.

45. The TAP of claim 1, wherein the TAP binds to the HLA-C*07:01 molecule and comprises or is composed of the sequence of SEQ ID NO:

68.

46. ​​The TAP of claim 1, wherein the TAP binds to the HLA-C*07:04 molecule and comprises or is composed of the sequence of SEQ ID NO:

39.

47. The TAP of claim 1, wherein the TAP binds to the HLA-C*08:01 molecule and comprises or consists of the sequence of SEQ ID NO:2,138,150 or249.

48. The TAP of claim 1, wherein the TAP binds to the HLA-C*08:02 molecule and comprises or is composed of the sequence of SEQ ID NO:144 or 253.

49. The TAP of claim 1, wherein the TAP binds to the HLA-C*12:03 molecule and comprises or is composed of the sequence of SEQ ID NO:26,42 or 57.

50. The TAP of claim 1, wherein the TAP binds to the HLA-C*15:02 molecule and comprises or is composed of the sequence of SEQ ID NO:

136.

51. The TAP of claim 1, wherein the TAP binds to the HLA-C*15:05 molecule and comprises or consists of the sequence of SEQ ID NO:41,62 or 136.

52. The TAP of claim 1, wherein the TAP binds to the HLA-C*16:01 molecule and comprises or consists of the sequence of SEQ ID NO:31,48,78,146,211 or257.

53. The TAP as described in any one of claims 1-52, wherein it is encoded by a sequence located in a non-protein coding region of the genome.

54. The TAP of claim 53, wherein the non-protein coding region of the genome is an intergenic region.

55. The TAP of claim 53, wherein the non-protein coding region of the genome is a long non-coding RNA.

56. A composition comprising at least two TAPs as defined in any one of claims 1-55.

57. A synthetic long peptide (SLP) comprising at least one of the amino acid sequences as defined in claim 1, such as at least 5, 10, 15 or 20 amino acids, or a nucleic acid encoding said SLP.

58. A nucleic acid encoding a TAP as defined in any one of claims 1-55, a combination of claims 56, or an SLP as defined in claim 57.

59. The nucleic acid of claim 58, wherein the nucleic acid is mRNA.

60. The nucleic acid of claim 59, wherein the mRNA comprises one or more 5'-end modified, 3'-end modified and / or modified nucleosides to increase mRNA stability, improve translation and / or reduce immunogenicity.

61. The nucleic acid of claim 58, wherein the nucleic acid is DNA.

62. The nucleic acid of claim 61, wherein the nucleic acid is a component of a viral vector.

63. A vesicle or particle comprising any one of claims 1 to 62, a TAP, a combination, an SLP, or a nucleic acid.

64. The vesicles or particles as described in claim 63 are lipid nanoparticles (LNPs).

65. The vesicles or particles of claim 63 or 64, wherein the vesicles or particles comprise cationic lipids.

66. A composition comprising any TAP, combination, SLP or nucleic acid of any one of claims 1 to 62, or any vesicle or particle of any one of claims 63 to 65, and a pharmaceutically acceptable carrier.

67. A vaccine comprising any one of the TAP, combination, SLP or nucleic acid of claims 1 to 62, any one of claims 63 to 65, vesicles or particles, or the composition of claim 66, and an adjuvant.

68. A separated major histocompatibility complex (MHC) class I molecule comprising the TAP of any one of claims 1-55 in its peptide-binding groove.

69. The isolated MHC class I molecule as described in claim 68, wherein it is in polymeric form.

70. The isolated MHC class I molecule as described in claim 69, wherein the polymer is a tetramer.

71. An isolated cell comprising (i) the TAP of any one of claims 1-55; (ii) the combination of claims 56; (iii) the SLP of claim 57; or (iv) a vector comprising a nucleotide sequence encoding the TAP of any one of claims 1-55, the combination of claims 56, or the SLP of claim 57.

72. An isolated cell expressing a major histocompatibility complex (MHC) class I molecule on its surface, said molecule comprising a TAP or combination thereof as described in any one of claims 1-56 in its peptide-binding groove.

73. The cell as described in claim 71 or 72 is an antigen-presenting cell (APC).

74. The cell of claim 73, wherein the APC is a dendritic cell.

75. A T-cell receptor (TCR) that specifically recognizes isolated MHC class I molecules as described in any one of claims 68-70 and / or MHC class I molecules expressed on the cell surface as described in any one of claims 72-74.

76. The TCR as described in claim 75, wherein it is a soluble TCR.

77. An antibody or an antigen-binding fragment thereof, which specifically binds to isolated MHC class I molecules as described in any one of claims 68-70 and / or MHC class I molecules expressed on the cell surface as described in any one of claims 72-74.

78. The TCR as described in claim 75 or 76, or the antibody or antigen-binding fragment thereof as described in claim 77, wherein it is a bispecific TCR or a bispecific antibody or antigen-binding fragment thereof.

79. The TCR, antibody, or antigen-binding fragment thereof as claimed in claim 78, wherein the bispecific antibody or antigen-binding fragment thereof is a single-chain biantibody (scDb).

80. The TCR, antibody, or antigen-binding fragment thereof as described in claim 78 or 79, wherein the bispecific TCR, antibody, or antigen-binding fragment thereof further specifically binds to T cell signaling molecules.

81. The TCR, antibody, or antigen-binding fragment thereof as described in claim 80, wherein the T cell signaling molecule is the CD3 chain.

82. A chimeric antigen receptor (CAR) comprising an antibody or an antigen-binding fragment thereof as described in any one of claims 77-81, or a nucleic acid encoding said CAR.

83. An isolated cell that expresses the TCR of claim 75 or the CAR of claim 82 on its cell surface.

84. The isolated cells as described in claim 82 are CD8+ T lymphocytes.

85. A cell population comprising at least 0.5% or 1% of isolated cells as defined in claim 83 or 84.

86. A method of treating a subject with cancer, comprising administering an effective amount of: (a) A TAP comprising or consisting of any sequence or any combination thereof described in any of SEQ ID NOs: 1-269, or a synthetic long peptide (SLP) comprising at least one sequence described in SEQ ID NOs: 1-269. (b) At least one nucleic acid encoding a TAP, combination thereof, or SLP as defined in (a); (c) Vesicles or particles containing TAP as defined in (a), combinations thereof, or SLP, or at least one nucleic acid as defined in (b); (d) A composition comprising a TAP, a combination thereof or an SLP as defined in (a), at least one nucleic acid as defined in (b), or a vesicle or particle as defined in (c), and a pharmaceutically acceptable carrier; (e) A vaccine comprising TAP, a combination thereof or SLP as defined in (a), at least one nucleic acid as defined in (b), a vesicle or particle as defined in (c), or a composition as defined in (d), and an adjuvant; (f) Cells that express major histocompatibility complex (MHC) class I molecules on their surface, the molecules containing TAPs or combinations thereof as defined in (a) in their peptide-binding grooves; (g) Cells that express T-cell receptors (TCRs) on their cell surface, wherein the TCRs specifically recognize MHC class I molecules expressed on the cell surface as defined in (f); or (h) A soluble TCR, antibody or its antigen-binding fragment, which specifically binds to MHC class I molecules expressed on the cell surface as defined in (f).

87. The method of claim 86, wherein the cancer is colorectal cancer.

88. The method of claim 86 or 87, further comprising administering at least one additional antitumor agent or therapy to the subject.

89. The method of claim 88, wherein the at least one additional antitumor agent or therapy is a chemotherapeutic agent, immunotherapy, immune checkpoint inhibitor, radiotherapy, or surgery.

90. The use of the following substances for treating cancer in a subject, or for preparing a medicament for treating cancer in a subject. (a) A targeted antigen peptide (TAP) comprising any amino acid sequence shown in sequence listing numbers 1 to 269, consisting of any such sequence, or any combination of such sequences; or a synthetic long peptide (SLP) comprising at least one sequence from sequence listing numbers 1 to 269. (b) At least one nucleic acid encoding the target antigen peptide, combination thereof, or synthetic long peptide described in (a); (c) Vesicles or particles containing the target antigen peptides, combinations thereof, synthetic long peptides, or at least one nucleic acid as described in (a); (d) A pharmaceutical composition comprising the targeting antigenic peptide, a combination thereof, or a synthetic long peptide as described in (a), at least one nucleic acid as described in (b), or the vesicles / particles as described in (c), and a pharmaceutically acceptable carrier; (e) a vaccine comprising the targeting antigenic peptide, a combination thereof, or a synthetic long peptide as described in (a), and at least one nucleic acid as described in (b). The vesicles / particles described in (c) or the composition described in (d), and an adjuvant; (f) A cell whose surface expresses a major histocompatibility complex (MHC class I molecule) of class I, wherein the peptide-binding groove of the class I molecule is bound to the target antigen peptide or combination thereof described in (a); (g) Cells that express T cell receptors (TCRs) on their surface, which specifically recognize the class I major histocompatibility complex molecules expressed on the cell surface as described in (f); (h) A soluble TCR, antibody, or antigen-binding fragment thereof, which specifically binds to the class I major histocompatibility complex molecule expressed on the cell surface as described in (f).

91. The use as described in claim 90, wherein the cancer is colorectal cancer.

92. The use as described in claim 90 or 91, wherein the use further comprises administering at least one additional antitumor agent or therapy to the subject.

93. The use as described in claim 92, wherein the at least one additional antitumor agent or therapy is a chemotherapeutic agent, immunotherapy, immune checkpoint inhibitor, radiotherapy, or surgery.

94. A pharmaceutical agent for treating cancer in a subject, said pharmaceutical agent being any one of the following substances: (a) Targeted antigen peptide (TAP): The targeted antigen peptide comprises any sequence from sequence number 1 to 269, is composed of any of the above sequences, or is any combination of the above sequences; or is a synthetic long peptide (SLP) containing at least one sequence from sequence number 1 to 269. (b) At least one nucleic acid encoding the target antigen peptide, combination thereof, or synthetic long peptide described in (a); (c) Vesicles or particles: loaded with the targeting antigen peptide described in (a), a combination thereof, a synthetic long peptide, or at least one nucleic acid described in (b); (d) Composition: The composition comprises the targeted antigen peptide described in (a), a combination thereof, a synthetic long peptide, at least one nucleic acid described in (b) or the vesicles / particles described in (c), and a pharmaceutically acceptable carrier; (e) Vaccine: The vaccine contains the targeting antigen peptide described in (a), a combination thereof, a synthetic long peptide, at least one nucleic acid described in (b), the vesicle / particle described in (c) or the composition described in (d), and an adjuvant; (f) Cells: The cell surface expresses a major histocompatibility complex (MHC class I molecule) of class I, which binds the target antigen peptide described in (a) or a combination thereof in the peptide binding groove of the class I molecule; (g) Cell: The cell surface expresses a T cell receptor (TCR) that is able to specifically recognize the class I major histocompatibility complex molecule expressed on the cell surface as described in (f); (h) Soluble T-cell receptors, antibodies or their antigen-binding fragments: such substances are capable of specifically binding to class I major histocompatibility complex molecules expressed on the cell surface as described in (f).

95. The pharmaceutical preparation of claim 94, wherein the cancer is colorectal cancer.

96. The pharmaceutical agent of claim 94 or 95, wherein the treatment further comprises administering at least one additional antitumor agent or therapy to the subject.

97. The pharmaceutical agent of claim 96, wherein the at least one additional antitumor agent or therapy is a chemotherapeutic agent, immunotherapy, immune checkpoint inhibitor, radiotherapy, or surgery.

Citation Information

Patent Citations

  • Compositions and methods for synthesizing 5′-Capped RNAS

    US10494399B2

  • Compositions and methods for synthesizing 5′-Capped RNAs

    US10519189B2

  • RNA preparations comprising purified modified RNA for reprogramming cells

    US9371511B2

  • O / w type emulsion

    WO2017061150A1

  • Novel cationic lipid exhibiting improved intracellular dynamics

    WO2019188867A1