Chimeric autoantigen receptor for treating autoimmune disease

Abstract

A chimeric protein comprising an extracellular domain of human thyroid-stimulating hormone receptor (TSHR), said domain lacking a C-terminal segment comprising at least the segment from amino acid residue 301 to 413 of TSHR.

Description

[0001] New International Patent Application April 29, 2025 Our ref: PCT-18246 CHIMERIC AUTOANTIGEN RECEPTOR FOR TREATING AUTOIMMUNE DISEASE FIELD OF THE INVENTION The present invention relates to a chimeric protein comprising an extracellular domain of a human thyroid-stimulating hormone receptor (TSHR). The chimeric protein may be a chimeric autoantigen receptor (CAAR). The invention further relates to a nucleic acid molecule encoding the chimeric protein, a vector being or comprising the nucleic acid molecule, and to a lipid nanoparticle (LNP) comprising the nucleic acid molecule or the vector. The invention further relates to a eukaryotic cell comprising the nucleic acid molecule, the vector, the LNP, and or the chimeric protein. The eukaryotic cell contains or is capable of expressing the chimeric protein, notably on its cell surface. The invention further relates to a use of the chimeric protein, the nucleic acid molecule, the vector, the LNP, or the eukaryotic cell for treating an autoimmune thyroid disease, such as Graves’ disease, including Graves’ orbitopathy and other Graves’ disease related manifestation. The invention further relates to a CD19 chimeric antigen receptor (CD19 CAR), nucleic acid molecule, such as vector, encoding it, eukaryotic cell comprising the CD19 CAR or its encoding nucleic acid molecule, LNP comprising one of the latter, and their therapeutic uses as mentioned above. BACKGROUND OF THE INVENTION Graves’ disease (GD, alias Morbus Basedow) is one of the most prevalent autoimmune diseases affecting 20 to 50 out of 10,000 people every year and is characterized by the presence of circulating autoantibodies that bind to and stimulate the thyroid stimulating hormone receptor (TSHR), resulting in hyperthyroidism, thyrotoxicosis and goiter (Menconi et al., 2014). Besides the aberrant activity of the thyroid gland, a large fraction of GD patients develop extrathyroidal manifestations with about 25 to 30 % of patients developing Graves’ ophthalmopathy, which is characterized by persistent inflammation around the eyes, recurrent infections and exophthalmos (Weetman, 2000). In addition, GD patients may suffer from cardiovascular symptoms, such as tachyarrhythmia, and congestive heart failure, as well as Graves' dermopathy and acropachy. Although its exact etiology remains to be completely understood, GD is believed to result from a complex interaction between genetics, epigenetics, the gut microbiome, the imbalance of immune cells and environmental factors (Menconi et al., 2014; Zhou et al., 2022). Currently, antithyroid drugs 2 (ATDs) serve as first-line treatment for GD, directly targeting the thyroid peroxidase enzyme and the production of thyroid hormones. However, half of patients relapse into hyperthyroidism upon ATD discontinuation and require more radical interventions including radioactive iodine therapy, or even, thyroidectomy (Bartalena, 2013). This underlines the unmet medical need for innovative therapeutics to specifically target the underlying cause of GD. GD is characterized by an abnormal number of autoreactive B cells which falsely recognize thyroid epitopes on self-proteins (autoantigens) and produce antibodies that bind to the TSHR (TRAbs), overstimulating the thyroid and causing hyperthyroidism. Autoreactive B cells and secretion of autoantibodies are induced and propelled through helper T cell (Th) stimulation (Crotty, 2015). By binding to the extracellular domain of the TSHR (ecTSHR), agonistic TRAbs mimic the activity of the natural ligand TSH and thereby uncouple the production of thyroid hormones, triiodothyronine (T3) and thyroxine (T4) (Faust et al., 2022). This complex interaction cascade of stimulatory Th cells, autoreactive B cells and dysfunctional regulatory T and B cells (Treg, Breg) leads to a detrimental circle of constant autoimmune stimulation (Hansen et al., 2023). Various biological and immunosuppressing drugs such as corticosteroids are used in the clinic to disrupt this re-stimulation circle and to partly inhibit autoantibody production. However, this may cause serious adverse effects, as pan-suppression causes an increased risk of infection (Lee and Kahaly, 2020). Furthermore, therapeutic antibodies including the anti-IGF-1 receptor antibody teprotumumab have been approved as a novel therapy, but relevant safety risks remain (Lee and Kahaly, 2020). Instead of targeting GD-related cytokine and growth factor signaling, alternative therapeutic approaches focus on immune cell ablation. Although, B cell depletion therapy with anti-CD19 and CD20-specific antibodies, respectively, has been successful in hemato-oncology, only limited efficacy was reported in GD patients (Bartalena et al., 2022). Whilst therapeutic antibodies face functional limitations in vivo such as inadequate pharmacokinetics, tissue inaccessibility and impaired interactions with the immune system, the concept of intercepting the “cellular culprits” remains attractive. Most recently, cellular immunotherapies focus on chimeric antigen receptors (CARs), genetically engineered receptors that allow specific recruitment and activation of effector immune cells towards designated antigens on target cells. For this, CARs consist of an extracellular binding domain, which determines the antigen specificity via a single chain fragment (scFv), 3 followed by a hinge region, transmembrane domain and intracellular signaling domains (June et al., 2018) (see Fig.3B). As several CAR T cell therapies have proven highly effective in the context of B cell malignancies, novel targets, optimized antigen receptors and engineered immune cells have been developed to branch out to other disease areas such as cardiometabolic disorders, fibrosis, and cellular senescence (Aghajanian et al., 2022). Furthermore, first studies applied established CD19-CAR T cell products to treat autoimmune diseases, such as systemic lupus erythematosus, idiopathic inflammatory myositis, and systemic sclerosis with promising preliminary results (Müller et al., 2024). However, instead of eliminating the disease-causing autoreactive B cells exclusively, CD19- CAR T cells may target almost all antibody generating B cells and their unspecific depletion might lead to immune deficits in patients (Hill et al., 2018). Therefore, instead of scFv-based CARs that aim at the vast majority of human B lympho- cytes, the inventors considered novel receptor types termed “Chimeric Auto-Antigen Receptors” (CAARs) which specifically target the disease-causing autoreactive B cells while healthy cells should remain untouched (Nezhad et al., 2020). Duan et al., 2023 described a TSHR-based chimeric antigen receptor T cell that is said to deplete auto-reactive B lymphocytes for treatment of autoimmune thyroid disease. Duan et al. use a TSHR domain comprising aa 21-413. In spite of the progress made in the prior art, there remains a need for better therapeutics, and tools therefor, that can be used for the treatment of autoimmune thyroid disease, such as Graves’ disease. Therefore, it is an object of the present invention to provide improved means, methods, cells, compounds, and compositions that may be used for treating autoimmune thyroid disease. It is another object of the invention to provide means, methods, cells, compounds, uses, and compositions that allow targeting specific disease- causing autoantibodies and B cells producing them, preferably being able to kill such B cells in vitro and in vivo. SUMMARY OF THE INVENTION In order to solve this problem, the invention provides: 1) A chimeric protein comprising the following segments from the N-terminus to the C- terminus: 4 (i) optionally a signal peptide, (ii) an extracellular domain of human thyroid-stimulating hormone receptor (TSHR), said domain lacking a C-terminal segment (of the ECD of human TSHR) comprising at least the segment from amino acid residue 301 to 413 of SEQ ID NO: 1, (iii) optionally a hinge region, (iv) a transmembrane domain, and (v) at least one intracellular domain. 2) The chimeric protein according to 1), wherein said protein and said extracellular domain lack a C-terminal segment comprising at least the segment from amino acid residue 295 to 413 of SEQ ID NO: 1, preferably said protein and said extracellular domain lack the C-terminal segment from amino acid residue 290 to 413 of SEQ ID NO: 1. 3) The chimeric protein according to 1) or 2), wherein said extracellular domain consists of a segment starting with amino acid residue number 30 or lower of SEQ ID NO: 1 and extends at least to amino acid residue 280 and at most up to amino acid residue number 300 of SEQ ID NO: 1. 4) The chimeric protein according to any one of 1) to 3), wherein said extracellular domain consists of the segment from amino acid residue 22 to 289 of SEQ ID NO: 1. 5) A chimeric protein comprising the following segments from the N-terminus to the C- terminus: (i) optionally an N-terminal signal peptide, (ii) an extracellular domain of human TSHR, wherein said extracellular domain consists of a segment starting with amino acid residue number 30 or lower of SEQ ID NO: 1 and extends at least to amino acid residue 280 and at most up to amino acid residue number 300 of SEQ ID NO: 1, (iii) optionally a hinge region, (iv) a transmembrane domain, and (v) at least one intracellular domain. 6) The chimeric protein according to 5), wherein said extracellular domain consists of a segment starting with amino acid residue number 25 or lower of SEQ ID NO: 1 and 5 extends at least to amino acid residue 285 and at most up to amino acid residue number 290 of SEQ ID NO: 1. 7) The chimeric protein according to any one of 1) to 6), wherein said hinge region is or comprises the CD8^-hinge region of SEQ ID NO: 3 or any other hinge region derived from IgG1, IgG4 or CD28. 8) The chimeric protein according to any one of 1) to 7), wherein said transmembrane domain is the CD8^ transmembrane domain of SEQ ID NO: 5 or any other transmembrane domain derived from CD3^(zeta), CD4, ICOS or CD28. 9) The chimeric protein according to any one of 1) to 8), wherein said at least one intracellular domain is selected from intracellular domains of CD3^(zeta), CD28 IC domain, 4-1BB (CD237) IC domain, OX40 (CD134) IC domain, ICOS, CD27, MYD88-CD40, KIRD2DS2 domain, preferably is or comprises the amino acid sequence of SEQ ID NO: 7 and / or SEQ ID NO: 9. 10) The chimeric protein according to any one of 1) to 9), comprising an N-terminal signal peptide, such as the CD8^-leader sequence of SEQ ID NO: 11. 11) The chimeric protein according to any one of 1) to 10), which is a CAAR, preferably said chimeric protein has the amino acid sequence of SEQ ID NO: 13. 12) The chimeric protein according to any one of 1) to 11), for use in treating an autoimmune thyroid diseases, such as Graves’ disease including Graves’ orbitopathy and other Graves’ disease related manifestations. 13) A nucleic acid molecule encoding a chimeric protein according to any one of 1) to 11), such as the nucleic acid molecule of the nucleotide sequence of SEQ ID NO: 14. 14) A nucleic acid molecule comprising at least the following segments: (ii’) a polynucleotide from nucleotide no.34 or lower at least to nucleotide 777 of SEQ ID NO: 16 and lacking a 3’-segment at least from nucleotide 901 to 1239 of SEQ ID NO: 2. 15) The nucleic acid molecule according to 13) or 14), said polynucleotide (ii’) lacking a 3’-segment at least from nucleotide 883 to 1239 of SEQ ID NO: 2, 6 preferably lacking a 3’-segment at least from nucleotide 868 to 1239 of SEQ ID NO: 2, more preferably said polynucleotide (ii’) comprises a polynucleotide of SEQ ID NO: 16. 16) The nucleic acid molecule according to 13), 14) or 15), comprising (i’) a polynucleotide encoding a signal peptide 5’ of said polynucleotide (ii’), (iii’) optionally a polynucleotide encoding a hinge region 3’ to said polynucleotide (ii’), (iv’) a polynucleotide encoding a transmembrane domain 3’ to said polynucleotide (ii’) and, if present, 3’ to said polynucleotide (iii’), and (v’) a polynucleotide encoding at least one intracellular domain. 17) The nucleic acid molecule according to any one of 13) to 16), wherein said nucleic acid molecule is a DNA (single or double-stranded) or is an RNA molecule or comprises ribonucleotides, preferably said nucleic acid molecule is an mRNA molecule. 18) A vector, such as a viral vector, being or comprising a nucleic acid molecule according to any one of 13) to 17) or encoding the chimeric protein according to any one of 1) to 12). 19) Lipid nanoparticle (LNP) comprising the nucleic acid molecule according to any one of 13) to 17) or the vector according to 18), preferably said nucleic acid molecule is an RNA molecule and said LNP contains said RNA molecule embedded therein. 20) The nucleic acid molecule according to any one of 13) to 17) or the vector according to 18) or the lipid nanoparticle according to 19) for use in treating an autoimmune thyroid disease, such as Graves’ disease. 21) A eukaryotic cell comprising the nucleic acid molecule according any one of 13) to 17), or the vector according to 18), or the lipid nanoparticle according to 19), or the chimeric protein according to any one of 1) to 12), wherein said cell is capable of expressing said chimeric protein according to any one of 1) to 12). 22) The eukaryotic cell according to 21), wherein said nucleic acid molecule is a nuclear DNA, such as a chromosome; or wherein said eukaryotic cell comprises the nucleic 7 acid molecule according to any one of 13) to 16) introduced via gene editing into a nuclear DNA, such as a chromosome; or wherein said nucleic acid molecule is RNA, such as mRNA. 23) The eukaryotic cell according to 17) or 18), which is a human immune cell, such as for example a T cell, a natural killer cell, a macrophage, a human induced pluripotent stem (hiPS) cell-derived cell, an autologous immune cell, or an allogenic immune cell. 24) The eukaryotic cell according to 23), wherein said immune cell is modified ex vivo or in vivo for treatment of patients. 25) The eukaryotic cell according to any one of 21) to 24), for use in treating an autoimmune thyroid disease, such as Graves’ disease, such as Graves’ orbitopathy and other Graves’ disease related manifestations. 26) The eukaryotic cell for the use according to 25), comprising administering said cell to a patient. 27) A method of treating an autoimmune thyroid disease, such as Graves’ disease, comprising administering to a patient suffering from an autoimmune thyroid disease the chimeric protein according to any one of 1) to 12), the nucleic acid molecule according to any one of 13) to 17), the vector according to 18), the LNP of 19), or the eukaryotic cell according to any one of 21) or 24). 28) A chimeric protein (CD19-CAR) comprising the following segments from the N- terminus to the C-terminus: (a) optionally a signal peptide; (b) a single-chain antibody segment recognizing the CD19 antigen; (c) optionally a hinge region; (d) a transmembrane domain; and (e) at least one intracellular domain. 29) The chimeric protein according to 28), wherein said (b) single-chain antibody segment is a scFv antibody segment, such as scFv FMC63; and / or said (b) single-chain antibody segment comprises at least the amino acid sequence segment from amino acid residue 22 to 269 of SEQ ID NO: 18 or a segment having 8 at least 95 %, preferably at least 97 %, sequence identity to the segment from residue 22 to 269 of SEQ ID NO: 18. 30) The chimeric protein according to 28) or 29), wherein said chimeric protein comprises a polypeptide comprising the amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 20, preferably said chimeric protein comprises a polypeptide consisting of the amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 20. 31) The chimeric protein according to any one of 28) to 30), for use in treating an autoimmune disease, preferably an autoimmune thyroid disease, such as Graves’ disease, preferably including Graves’ orbitopathy and other Graves’ disease related manifestations. 32) A nucleic acid molecule encoding a chimeric protein according to any one of 28) to 30), or a vector, such as a viral vector, being or comprising said nucleic acid molecule. 33) Lipid nanoparticle (LNP) comprising the nucleic acid molecule or vector according to 32), preferably said nucleic acid molecule is an RNA molecule and said LNP contains said RNA molecule embedded therein. 34) The nucleic acid molecule or vector according to 32) or the lipid nanoparticle according to 33) for use in treating an autoimmune thyroid disease, such as Graves’ disease. 35) A eukaryotic cell comprising the nucleic acid molecule or vector according to 32), or the LNP according to 33), or the chimeric protein according to any one of 28) to 30), wherein said cell may be capable of expressing said chimeric protein according to any one of 28) to 30) or may comprise said chimeric protein according to any one of 28) to 30) anchored in its cell membrane. 36) The eukaryotic cell according to 35), wherein said nucleic acid molecule is a nuclear DNA, such as a chromosome; or wherein said eukaryotic cell comprises the nucleic acid molecule according to 32) introduced via gene editing into a nuclear DNA, such as a chromosome; or wherein said nucleic acid molecule is RNA, such as mRNA; or 9 which is a human immune cell, such as a T cell, a natural killer cell, a macrophage, a human induced pluripotent stem (hiPS) cell-derived cell, an autologous immune cell, or an allogenic immune cell, preferably said immune cell is modified ex vivo or in vivo for treatment of patients, more preferably said cell is a NK cell. 37) The eukaryotic cell according to any one of 35) to 36), for use in treating an autoimmune disease, preferably an autoimmune thyroid disease, such as Graves’ disease, preferably including Graves’ orbitopathy and other Graves’ disease related manifestations. 38) The eukaryotic cell for the use according to 37), comprising administering said cell to a patient. 39) A method of treating an autoimmune disease, preferably an autoimmune thyroid disease, such as Graves’ disease, preferably including Graves’ orbitopathy and other Graves’ disease related manifestations, said method comprising administering to a patient suffering from an autoimmune thyroid disease the chimeric protein according to any one of 28) to 30), the nucleic acid molecule or vector according to 32), the LNP of 33), or the eukaryotic cell according to any one of 35) to 36). The inventors have found a novel chimeric protein having a specific TSHR extracellular domain. The chimeric protein of the invention is a TSHR-CAAR and can be used for autoimmune cell therapy. The chimeric protein and TSHR-CAAR allows specific targeting of TSHR-autoreactive B cells and depleting autoantibodies against TSHR. The TSHR-CAAR of the invention may be used for treating GD patients. The chimeric protein or TSHR-CAAR of the invention has distinct features of the extracellular ligand binding (autoantigen) domain linked to transmembrane and signal transduction modules (see Fig.3B). The TSHR-CAAR of the invention can have an improved expression profile and, notably, superior epitope recognition by antibodies, such as autoreactive model antibodies. Antibody binding to the TSHR-CAAR of the invention was found to be superior compared to a comparative TSHR- CAAR that is similar to a prior art TSHR-CAAR. However, T cells come with disadvantageous traits as they depend on antigen presentation through the major histocompatibility complex (MHC alias HLA in humans) and can elicit severe immune responses, Graft-versus-host disease (GvHD), and cytokine release syndromes (CRS) due to strong activation. In contrast, HLA-independent natural killer (NK) cells are potent innate immune effectors but show a high safety profile with reduced risk of 10 GvHD and lower incidence of CRS or neurotoxicity due to their controlled cytokine release profile. Thus, engineered NK cells are increasingly being considered and studied in clinical trials to treat (autoimmune) patients (Laskowski et al., 2022). For the treatment of lymphoma patients, this also included human induced pluripotent cell (hiPSC)-derived NK cells. (Ghobadi et al., 2025). Therefore, in this invention, the inventors conceived and developed engineered NK cells as possible off-the-shelf cell therapy for B-cell based autoimmune diseases. As a proof of concept, CD19-CAR NK cells were tested for their capacity to kill human B lymphocyte-equivalent cells as correlate of their therapeutic potential in autoimmune patients. BRIEF DESCRIPTION OF THE INVENTION Fig.1: Schematic representation of transcription units encoded by TSHR- CAARV1, TSHR-CAAR289and TSHR-CAAR391. The genetic elements are described in section „Amino acid and nucleotide sequences” and in the Methods section below. WPRE is the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element which stabilizes expression in transgene expression. Fig.2: Schematic representation of cell competitive binding assay with TSHR- CAAR and GD patient sera. In GD patients TSH receptor-directed autoantibodies (TRAb) including M22 activate the TSHR, increase abnormal production of thyroid hormone and lead to Graves’ disease and orbitopathy. For a cell competitive binding assay TSHR-CAAR expressing HEK293 cells or untreated controls were incubated with increasing dilutions of sera from GD patients or healthy donors. After serum-incubation, supernatant was removed and cells were incubated with biotinylated anti-TSHR antibody M22 (M22-bio) at 0,5 µg / mL in 100 µL OptiMEM for 1,0 h at 37 °C. Following the M22 competition step, cells were harvested, washed and stained with SA-APC for 20 minutes at 4 °C. After a final washing step, viability dye (DAPI, 1 µg / mL) was added before competition of M22 and auto- antibodies was determined via flow cytometry. Fig.3 TSHR Structure and CAAR design. (A) Structural features of the TSHR (adapted from Cryo-EM structure of TSHR in complex with the activating autoantibody M22 PDB: 7XW6); Insert: highlighted amino acids in EC domain indicate terminal residues of TSHR-CAAR289and TSHR-CAAR391. (B) Schematic representation of the TSHR CAAR design compared to conventional CAR constructs including autoantigen-domain, CD8^ hinge and transmembrane domain (TM), CD137 (4-1BB) and CD3zeta intracellular signaling domains. Fig.4 Detection of ectopic expression of TSHR and TSHR-CAAR constructs in HEK293T model cells.48h post transfection HEK293T cells were harvested, stained with 11 M22 (AF647-Fab coupled; upper panel) or AF647-labeled anti-THSR antibody (lower panel) and analyzed by flow cytometry. See Methods for details. Fig.5 Determination of TSHR auto-antibody titers in GD patients’ serum. Level of TSHR autoantibodies (TRabs) in sera was determined by commercially available competitive ELISA measuring reduction of bound M22 to recombinant TSHR. Results are shown as percentage inhibition of M22 binding. Samples that show high M22 binding have high levels of anti-TSHR auto-antibodies. The arrows indicate serum samples that were used for testing of binding to the TSHR-CAARs. Fig.6 Detection of stable ectopic expression of TSHR-CAAR289and TSHR- CAAR391in HEK293T model cells. (A) HEK293T cells were transfected with TSHR / TSHR- CAAR expression constructs as indicated above and stained with AF647-labeled anti-THSR antibody and analyzed by flow cytometry. (B) Analog to (A) cells were transfected and subsequently stained with M22-bio (SA-APC; upper panel) or K1-70-bio (SA-APC; lower panel). Mock-transfected cells served as negative control. Fig.7: Flow cytometry data of cell competitive binding assay with TSHR-CAAR and GD patient serum. (A) Flow cytometry analysis of TSHR / TSHR-CAAR transfected HEK293T cells after incubation with GD patient serum or healthy control (HC) serum and subsequent M22-bio competition and streptavidin-APC stain. An example for high titer serum S009 and negative control #874 is shown. (B) Histogram overlay of M22 fluorescence data as in (A) (here sub-gated on APC-positive cells), please note the decrease in mean fluorescence intensity (MFI) on TSHR-CAAR transfected HEK293T with increasing GD patient serum, while MFI in healthy serum samples remained largely unchanged. Fig.8 Cell competitive antibody binding assay with TSHR-CAAR and GD patient sera. M22 binding study with GD patient and healthy donor sera, respectively, on TSHR-CAAR289expressing reporter cells. MFIs of M22-APC at different serum dilutions are shown, normalized to healthy donor controls. Right panel: „NormM22_50“ relates to a dilution of 1:2; NormM22_25=1:4; NormM22_5=1:20; NormM22_1=1:100. Left panel: „GD Serum 50“ relates to a dilution of 1:2; GD Serum 25=1:4; GD Serum 5=1:20; GD Serum 1=1:100, respectively). GD patient serum with high antibody titers (S001; S006; S009; S021) and lower antibody titers (S012; S025) are shown. Mean ± SD, Statistical test: Kruskal-wallis: * p < 0.05; **p<0.01. Fig.9 Extended cell competitive binding assay with stratified GD patient sera. Extended CAAR - M22 binding study with 31 donors including GD patients with high TRab titers (n=18), low TRab titers (n=7) and healthy donors (n=6), respectively, on TSHR- CAAR289expressing reporter cells and subsequent M22-bio competition and streptavidin- 12 APC detection. (A) Representation of all serum samples analyzed for competitive M22- binding at different serum concentrations as indicated, with healthy donor serum serving as normalization reference. (B) Stratification of GD sera correlates with M22 competition to TSHR-CAAR289reporter cells. Serum from GD patients with high TRab titers mediated profound M22-binding competition to TSHR-CAAR289cells, while sera with low TRab show less M22 inhibition. Healthy donor sera did not affect M22 binding at any serum concentration. Mean ± SD, Statistical test: Kruskal-wallis: ** p < 0.01; ****p<0.0001. Fig.10 TSHR-CAAR specific cell activation by phosphorylation of ERK1 / 2. Jurkat T cell lines stably expressing TSHR-CAAR289or GFP control were incubated with THSR-specific antibodies (M22 and K1-70), control IgG and phorbol myristate acetate / ionomycin (PMA / Iono), respectively, to be subsequently analyzed for cell activation marker by flow cytometry. (A) Intracellular flow cytometry analysis shows TSHR-CAAR289dependent activation of T cells upon stimulation with TSHR-specific antibodies M22 and K1-70 by detection of phosphorylated ERK1 and ERK2 (pERK1 / 2) after 15 minutes of stimulation. Protein kinase C activator PMA and calcium ionophore Ionomycin served as positive controls while control IgG and Mock-transfected Jurkat cells did not show responses. (B) Quantification of TSHR-CAAR289dependent ERK1 / 2 phosphorylation. Percentage and MFI of CD3+GFP+pERK1 / 2+Jurkat T cells shows significant activation upon various CAAR-specific stimuli. pERK1 / 2 was detectable in M22 and K1-70 treated TSHR-CAAR289samples after 15 minutes of stimulation as well as upon PMA / Iono treatment. Mean ± SD, Statistical test: 2Way ANOVA with Sidak correction, n = 2 / 3; ** p < 0.01 Fig.11 CD19-CAR specific cell activation by phosphorylation of ERK1 / 2 in Jurkat cells. Analogous to Fig.10, Jurkat T cell lines stably expressing CD19-CARVB1, CD19-CARVB2, or GFP control were incubated with K562 wt, K562-CD19, or PMA / Iono, respectively, to be subsequently analyzed for cell activation marker by flow cytometry. (A) Phenotypic analysis by flow cytometry verifies CAR expression specifically in CD19- CARVB1, CD19-CARVB2lines in comparison to Jurkat-GFP control cell line. (B) Left: Intracellular flow cytometry analysis shows CD19-CAR dependent activation of Jurkat T cells upon stimulation with CD19-expressing target cells by detection of phosphorylated ERK1 and ERK2 (pERK1 / 2) after 15 minutes of stimulation. PMA / Iono served as positive control while Mock-transfected Jurkat cells did not show responses. Right: Quantification of CD19-CAR dependent ERK1 / 2 phosphorylation. Percentage of CD3+GFP+pERK1 / 2+Jurkat T cells shows significant activation in CD19-CAR samples upon stimulation with K562- CD19 as well as upon PMA / Iono treatment but not with K562 wt. Mean ± SD, Statistical test: 2Way ANOVA with Sidak correction, n = 4; * p < 0.05, *** p < 0.005, **** p < 0.0001. 13 Fig.12 CD19-CAR specific cell activation by phosphorylation of ERK1 / 2 in primary T lymphocytes. Primary T lymphocytes were transiently transfected with CD19- CARVB1, CD19-CARVB2, or GreenLantern mRNA and subsequently incubated with K562 wt, K562-CD19 target cells, or PMA / Iono, respectively. Afterwards, cells were analyzed for cell activation marker by flow cytometry. (A) Phenotypic analysis by flow cytometry shows strong expression of CD19-CARVB1and CD19-CARVB2in primary T lymphocytes 20 hours post mRNA transfection. (B) Left: Intracellular flow cytometry analysis depicts CD19-CAR dependent activation of primary T lymphocytes upon stimulation with CD19-expressing target cells by strong phosphorylation of ER1 and ERK2 (ERK1 / 2) after 15 minutes of stimulation. Mock-transfected primary T lymphocytes did not show responses. PMA / Iono served as positive control. Right: Quantification of CD19-CAR dependent ERK1 / 2 phosphorylation. Percentage of CD3+pERK1 / 2+ T lymphocytes shows strong activation upon stimulation of CD19-CAR with K562-CD19 and pERK1 / 2 was significantly increased while K562 wt did not elicit a responses. Mean ± SD, Statistical test: 2Way ANOVA with Sidak correction, n = 2. Fig.13 CD19-CAR specific NK-mediated cell killing of CD19+target cells. Pre- activated human NK cells expressing CD19-CARVB1, CD19-CARVB2, or GreenLantern were incubated with CD19+Nalm-6 B-cell line or transgenic K562-CD19 cell line to analyze CAR- specific lysis of target cells by NK cells. (A) Pre-activated and expanded primary NK cells were transfected with mRNA encoding CD19-CARVB1, CD19-CARVB2, or GreenLantern control. Viability of cells and expression of respective proteins was analyzed 20 hours post transfection using flow cytometry. (B) Nalm-6 and K562-CD19 target cell lines express CD19 as shown in flow cytometry analysis compared to CD19 negative K562 control cells. (C) Specific lysis of luciferase-expressing target cells Nalm-6 and K562-CD19 by CD19- CAR-expressing NK cells in different effector-to-target (E:T) ratios was measured by determining luciferase activity after 4 hours of co-culture. Results are shown as relative Luciferase signals in percent normalized to luciferase signal of untreated target cells and lowest overall luciferase signal. CD19-CAR receptors expressing NK cells killed Nalm-6 cells more effectively (as shown by the weaker relative Luciferase signals) compared to untreated and GreenLantern control NK cells, whereas the universal NK-target cell K562- CD19 was killed effectively by all tested NK cells showing that the overall killing capacity was not impaired. Shown are means of n = 5 independent experiments with standard deviations. Fig.14 Plasmid map of TSHR-CAAR289. The nucleotide sequence is given in SEQ ID NO: 17. The relevant genetic elements are described in section „Amino acid and nucleotide sequences” and in the Methods section below. Additional features shown 14 comprise WPRE is the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element which stabilizes expression in transgene expression, EF1A: Promoter sequence of elongation factor 1α, and structural elements of lentiviral vector backbone. Fig.15 Plasmid map of TSHR-CAAR391. Similar genetic elements as shown in Fig. 14 and are explained in the context of Fig.14. Fig.16 Plasmid map of CD19-CARVB1. The amino acid sequence of the CD19- CARVB1and the nucleotide sequence of the encoding plasmid are given in SEQ ID NO: 18 and SEQ ID NO: 19, respectively. Fig.17 Plasmid map of CD19-CARVB2. The amino acid sequence of the CD19- CARVB2and the nucleotide sequence of the encoding plasmid are given in SEQ ID NO: 20 and SEQ ID NO: 21, respectively. DETAILED DESCRIPTION OF THE INVENTIONS A) TSHR-CAAR of the Invention The inventors have found that a TSHR-CAAR that does not contain the entire extracellular domain (ECD) of TSHR, but lacks the loop region downstream of the LRRD domain or a major part of the loop region (Fig.3), not only expressed better in eukaryotic cells, but showed improved antibody binding to its ligand-binding (autoimmune) domain. The TSHR-CAAR of the invention is a chimeric protein comprising or consisting of the following segments from the N-terminus to the C-terminus: (i) optionally a signal peptide, (ii) an extracellular (ligand binding) domain of human TSHR, said domain lacking a (C- terminal) segment comprising (or consisting of) at least the segment from amino acid residue 301 to 413 of SEQ ID NO: 1, (iii) optionally a hinge region, (iv) a transmembrane domain, and (v) at least one intracellular domain. Human TSHR is synthesized as a 764 amino acid (aa) residue precursor that contains a 21 aa signal peptide, a 392 aa extracellular domain (ECD), a 269 aa membrane spanning domain consisting of seven transmembrane segments, and a 82 aa cytoplasmic domain. Herein, the amino acid numbering used starts with aa 1 of the signal peptide of human TSHR, whereby the ECD of human TSHR starts with aa 22 which is a Met residue. The amino acid sequence of the N-terminal signal peptide and ECD of human TSHR is shown in 15 SEQ ID NO: 1. The ECD of human TSHR may be considered to consist of two (sub)domains, the large leucine-rich repeat domain (LRRD) and the small helical loop, both shown in the insert of Fig.3. The small helical loop is located between about aa 289 and aa 391 of SEQ ID NO: 1; these residues are identified in the insert of Fig.3. In the chimeric protein of the invention, not the entire ECD of human TSHR is present, but a shorter (smaller) ECD that lacks a C-terminal segment (of the ECD of human TSHR). The (shorter) ECD used in the chimeric protein of the invention (also referred to as “the ECD of the invention”) comprises the ligand binding domain of TSHR and is therefore also referred to as “extracellular ligand binding domain of human TSHR”. The ECD of the invention lacks fully or partly the small helical loop shown in the insert of Fig.3 that is located between aa 289 and aa 391 of SEQ ID NO: 1. The ECD of the invention preferably lacks at least the segment from amino acid residue 301 to 413 of SEQ ID NO: 1. More preferably, the ECD of the invention lacks at least the segment from amino acid residue 295 to 413 of SEQ ID NO: 1, even more preferably it lacks at least the segment from amino acid residue 290 to 413 of SEQ ID NO: 1. In one embodiment of the chimeric protein, the ECD is that from aa 22 to 289 of SEQ ID NO: 1. It is understood that not only the ECD of the invention, but the entire chimeric protein lacks these lacking segments identified above. The ECD of the invention preferably consists of a segment starting with amino acid residue number 30 or lower of SEQ ID NO: 1 and extends at least to amino acid residue 280 and at most to amino acid residue number 300 of SEQ ID NO: 1. Preferably, the ECD consists of a segment starting with amino acid residue number 25 or lower of SEQ ID NO: 1 and extends at least to amino acid residue 285 and at most up to amino acid residue number 290 of SEQ ID NO: 1. The ECD may consist of the segment from amino acid residue 22 to 289 of SEQ ID NO: 1. Accordingly, the chimeric protein of the invention may be defined as comprising or consisting of the following segments from the N-terminus to the C-terminus: (i) optionally an N-terminal signal peptide, (ii) an extracellular ligand binding domain of human TSHR, wherein said extracellular domain consists of a segment starting with amino acid residue number 30 or lower of SEQ ID NO: 1 and extends at least to amino acid residue 280 and at most up to amino acid residue number 300 of SEQ ID NO: 1, (iii) optionally a hinge region, (iv) a transmembrane domain, and (v) at least one intracellular domain. 16 The optional N-terminal signal peptide (i) is not particularly limited in the invention. Generally, it ensures, upon expressing the chimeric protein in a eukaryotic cell, signaling the chimeric protein for export and insertion into the cell membrane. An example of the signal peptide is the intrinsic signal peptide of human TSHR that may be the peptide from aa 1 to 20 of SEQ ID NO: 1. A preferred signal peptide is the CD8 ^-leader sequence of SEQ ID NO: 11 that is used in the Examples. Preferably, the chimeric protein of the invention contains a signal peptide. The chimeric protein may contain a hinge region (iii). The hinge region is not particularly limited. As the hinge region, a segment that is or comprises the CD8^-hinge region of SEQ ID NO: 3 or any other hinge region derived from IgG1, IgG4 or CD28 may be used. Preferably, the chimeric protein contains a hinge region, more preferably it contains a signal peptide (i) and a hinge region (iii). The chimeric protein of the invention comprises a transmembrane (TM) domain. The TM domain allows anchoring of the chimeric protein in the cell membrane, after expressing the chimeric protein in a eukaryotic cell. TM domains for such purpose are known. An example is the TM domain of human TSHR. Another example is the CD8^ transmembrane domain of SEQ ID NO: 5 that is used in the Examples. Other examples are the TM domains derived from CD3^(zeta), CD4, ICOS or CD28. The chimeric protein of the invention typically comprises at least one intracellular domain (v). The function of the at least one intracellular domain is signal transduction to the interior of a cell that contains the chimeric protein in its cell membrane. The at least one intracellular domain may be selected from the intracellular domains of CD3^(zeta), CD28 IC domain, 4-1BB (CD237) IC domain, OX40 (CD134) IC, ICOS, CD27, MYD88-CD40, KIRD2DS2 domain, preferably is or comprises the amino acid sequence of SEQ ID NO: 7 and / or SEQ ID NO: 9. In one embodiment of the chimeric protein, the TSHR-CAAR is that of the amino acid sequence of SEQ ID NO: 13. Herein, an amino acid sequence segment (or, briefly, “segment”) refers to a plurality of contiguous amino acid residues of a protein or polypeptide having a larger number of amino acid residues than the segment. A protein may comprise multiple segments. Herein, 17 different segments are non-overlapping. Protein domains may also be referred to as “segments”. The invention also provides a nucleic acid molecule encoding the chimeric protein of the invention. An example of such nucleic acid molecule is that of the nucleotide sequence of SEQ ID NO: 14. The invention also provides a nucleic acid molecule comprising at least the following segments: (ii’) a polynucleotide from nucleotide no.34 or lower at least to nucleotide 777 of SEQ ID NO: 16 and lacking a 3’-segment at least from nucleotide 901 to 1239 of SEQ ID NO: 2; or a polynucleotide encoding the same protein segment by the degeneracy of the genetic code. Preferably, the polynucleotide (ii’) lacks a 3’-segment at least from nucleotide 883 to 1239 of SEQ ID NO: 2, preferably it lacks a 3’-segment at least from nucleotide 868 to 1239 of SEQ ID NO: 2, more preferably said polynucleotide (ii’) is or comprises a polynucleotide of SEQ ID NO: 16. In each of said embodiments, the invention also provides a nucleic acid molecule that encodes the same protein by the degeneracy of the genetic code. The nucleic acid molecule generally further comprises the following segments: (i’) a polynucleotide encoding a signal peptide 5’ of said polynucleotide (ii’), (iii’) optionally a polynucleotide encoding a hinge region 3’ to said polynucleotide (ii’), (iv’) a polynucleotide encoding a transmembrane domain 3’ to said polynucleotide (ii’) and, if present, 3’ to said polynucleotide (iii’), and (v’) a polynucleotide encoding at least one intracellular domain. In the context of nucleic acids, a segment of a nucleic acid molecule refers to a plurality of contiguous nucleoside groups of a nucleic acid (molecule), the latter having a larger number of nucleoside groups than the segment. A nucleic acid molecule may comprise multiple segments. Herein, different segments are generally non-overlapping. The nucleic acid molecule may be a coding sequence, a construct comprising the coding sequence, a gene encoding the chimeric protein, a vector or plasmid comprising the gene, or an mRNA. An example of such nucleic acid molecule is the plasmids shown in Fig.14, the nucleotide sequence of which is given in SEQ ID NO: 17. The invention also provides a polynucleotide that is the reverse complement of the nucleic acid molecule, notably where the nucleic acid molecule is DNA. 18 The nucleic acid molecule of the invention may be DNA, i.e. it may be a DNA molecule. Alternatively, the nucleic acid molecule may be RNA, i.e. it may be an RNA molecule. The RNA may be a single-stranded RNA, especially an mRNA. In some embodiments, the RNA comprises one or more modified nucleosides in place of uridine (modRNA), wherein the modified nucleoside is preferably selected from pseudouridine (ψ), N-methyl- pseudouridine (m1ψ), and 5-methyl-uridine (m5U). In some embodiments, the RNA comprises at least one of the following, preferably all of the following: a 5’ cap; a 5’ UTR; a 3’ UTR; and a poly-A sequence. In some embodiments, the poly-A sequence comprises at least 100 A nucleotides. The 5’ cap may be a cap1 or cap2 structure. The invention further provides a vector being or comprising a nucleic acid molecule as defined above. The vector generally encodes the chimeric protein of the invention and preferably lacks a nucleic acid segment that encodes the lacking segments of the chimeric protein defined above. Apart from a polynucleotide that encodes the chimeric protein of the invention or the nucleic acid molecule defined above, the vector may further contain regulatory elements for expressing the nucleic acid in the expression system of interest and / or a selectable marker for selecting the vector in bacterial or eukaryotic cells. The vector may be a viral vector for making use of a viral expression system. An example of a viral vector is a lentiviral vector. A lentiviral vector generally contains regulatory elements derived from a lentivirus for expressing the nucleic acid of the invention or for expressing the chimeric protein of the invention. The invention further provides a lipid nanoparticle (LNP) comprising the nucleic acid molecule or the vector of the invention. The nucleic acid molecule is preferably an RNA molecule and said RNA molecule is embedded in the LNP. LNPs for delivering nucleic acids to human subjects have become widely known in recent years. Suitable LNPs may be those used for delivering mRNA vaccines to human subjects. Some references to documents describing such LNPs are as follows: WO2023166099 A1, Schoenmaker et al., International Journal of Pharmaceutics 601 (2021) 120586. The invention further provides a eukaryotic cell comprising the nucleic acid molecule or the vector of the invention. Alternatively, the eukaryotic cell may comprise the chimeric protein of the invention and / or the LNP of the invention. The eukaryotic cell is preferably capable of expressing said chimeric protein. The eukaryotic cell may be a human immune cell, such as 19 for example a T cell, a natural killer cell, a macrophage, a human induced pluripotent stem (hiPS) cell-derived cell, an autologous immune cell, or an allogenic immune cell. The eukaryotic cell may comprise the nucleic acid molecule of the invention integrated into a nuclear DNA. In such case, this DNA may be the nucleic acid molecule of the invention. Alternatively, the eukaryotic cell may contain the nucleic acid molecule separate from a nuclear chromosome. If the nucleic acid molecule is RNA or contains ribonucleosides, the nucleic acid molecule may be contained in the cytoplasm of the cell, notably for expressing the chimeric protein from the nucleic acid molecule. There are different ways of introducing the nucleic acid molecule into eukaryotic cells. The nucleic acid molecule may be introduced into a cell by any means that are known for this purpose, such as microinjection or lipofection. Further, cells may be transfected using LNPs containing the nucleic acid molecule, notably if the nucleic acid molecule is or contains RNA. For inserting the nucleic acid molecule into a resident DNA molecule of the cell, such as a chromosome, the gene editing technology or recombinase-mediated integration may be used. The ultimate goal of the invention is to provide methods, means and tools (compounds) for treating an autoimmune thyroid disease, such as Graves’ disease, Graves’ orbitopathy and / or other Graves’ disease related manifestations in a patient. There are different possibilities how the invention can be used for this purpose. A first possibility is cell therapy using the eukaryotic cell of the invention and administering said cell to a patient, e.g. intravenously. The cell used for this purpose may be an autologous cell or an allogenic cell. For autologous cell therapy, a cell sample such as a blood sample may be obtained from the patient and the desired cells are isolated from the sample. The isolated cells may then be provided with the chimeric protein of the invention, or with the nucleic acid molecule for expressing the chimeric protein in said cell. The modified cells may then be reinserted into the patient. Such blood cell-derived immune cells may comprise, but are not limited to, various leukocytes such as T lymphocytes, natural killer (NK) cells, monocytes and invariant natural killer T cells (iNKT). In the Examples and Results sections below, we disclose methods and results which illustrate that it is possible to provide engineered NK cells by transfecting them with mRNAs which encode chimeric antigen receptors of the invention. Using the example of a CD19- 20 CAR mRNA, we show functionality of such CAR effector cells to specifically induce ERK signaling in human immune cells and hence, to selectively kill target cells, e. g. equivalents of human B cells. In allogenic cells therapy, a suitable allogenic cell may be provided with the chimeric protein or the nucleic acid molecule similarly as described above. The modified allogenic cells may then be inserted into the patient. For the treatment of Graves’ disease, Graves’ orbitopathy and / or other Graves’ disease related manifestations, a preferred eukaryotic cell among those mentioned above is an immune cell, preferably a T cell or a natural killer cell. A way of introducing the nucleic acid molecule of the invention into a T cell is introducing it using gene editing into the T cell locus. After (re-)introducing the immune cell into the patient, the obtained genetically- modified immune cell may express the chimeric protein of the invention on its surface and bind autoantigenic antibodies or B cells producing such autoantigenic antibodies for treating the disease. Accordingly, the invention provides a eukaryotic cell as described above for use in treating an autoimmune thyroid disease, such as Graves’ disease, comprising administering said cell to a patient. The invention further provides a method of treating an autoimmune thyroid disease, such as Graves’ disease, comprising administering to a patient suffering from an autoimmune thyroid disease the chimeric protein of the invention, the nucleic acid molecule according to the invention, the vector according to the invention, the LNP of the invention, or the eukaryotic cell, such as a NK cell, according to the invention. B) CD19-CAR of the Invention The inventors have further found that a chimeric CD19-CAR allows targeting CD19 cells, such as B-cells, and even to kill CD19 cells, for treating an autoimmune disease, such as B- cell dependent autoimmune diseases, preferably an autoimmune thyroid disease, e.g. Graves’ disease. The chimeric CD19-CAR comprises a single-chain variable antibody fragment (scFv), such as FMC63, which was engineered to recognize the CD19 antigen (found on most human B cells) and is fused with transmembrane and intracellular signaling domains (like CD3ζ, CD28, or 4-1BB). The chimeric CD19-CAR of the invention allows redirecting immune cells 21 to target CD19-expressing cells, e.g. in the context of cell therapy against B cell derived malignancies and autoimmune diseases. Thus, the invention provides, as a CD19-CAR, a chimeric protein comprising the following segments from the N-terminus to the C-terminus: (a) optionally a signal peptide; (b) an (extracellular) single-chain antibody segment recognizing the CD19 antigen; (c) optionally a hinge region; (d) a transmembrane domain; and (e) at least one intracellular domain. The single-chain antibody segment of item (b) may be a scFv antibody domain, such as scFv FMC63. Alternatively or additionally, the single-chain antibody segment may comprise at least the amino acid sequence segment from amino acid residue 22 to 269 of SEQ ID NO: 18 or a segment having at least 95 %, preferably 97%, sequence identity to the segment from residue 22 to 269 of SEQ ID NO: 18. In preferred embodiments, the chimeric protein comprises a polypeptide comprising the amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 20, preferably said chimeric protein comprises a polypeptide consisting of the amino acid sequence of SEQ ID NO: 18 or SEQ ID NO: 20. The scFv is also referred to herein as extracellular, since this domain of the chimeric protein is extracellular when incorporated in the cell membrane of a eukaryotic cell. The N-terminal signal peptide, hinge domain, transmembrane domain, and intracellular domains may, alternatively, be any of those mentioned in section A) above and be adjusted to the specific requirements of their application. The optional N-terminal signal peptide is not particularly limited. Generally, it allows, upon expressing the chimeric protein in a eukaryotic cell, signaling the chimeric protein for export and insertion into the cell membrane. A preferred signal peptide is the CD8 ^-leader sequence of SEQ ID NO: 11 that is used in the Examples. Preferably, the chimeric protein of the invention contains a signal peptide. The chimeric protein may contain a hinge region. The hinge region is also not particularly limited. As the hinge region, a segment that is or comprises the CD8^-hinge region of SEQ ID NO: 3 or any other hinge region derived from IgG1, IgG4 or CD28 may be used. 22 Preferably, the chimeric protein contains a hinge region, more preferably it contains a signal peptide (a) and a hinge region (c). The chimeric protein of the invention comprises a transmembrane (TM) domain. The TM domain allows anchoring of the chimeric protein in the cell membrane, e.g. after expressing the chimeric protein, in a eukaryotic cell. TM domains for such purpose are known. An example is the CD8^ transmembrane domain of SEQ ID NO: 5 that is used in the Examples. Other examples are the TM domains derived from CD3^(zeta), CD4, ICOS or CD28. The chimeric protein of the invention typically comprises at least one intracellular domain. The function of the at least one intracellular domain is signal transduction to the interior of a cell that contains the chimeric protein in its cell membrane. The at least one intracellular domain may be selected from the intracellular domains of CD3^(zeta), CD28 IC domain, 4- 1BB (CD237) IC domain, OX40 (CD134) IC, ICOS, CD27, MYD88-CD40, KIRD2DS2 domain, preferably is or comprises the amino acid sequence of SEQ ID NO: 7 and / or SEQ ID NO: 9. In preferred embodiments, the chimeric protein that is a CD19-CAR comprises a polypeptide of SEQ ID NO: 18 or the polypeptide of SEQ ID NO: 20. More preferably, it comprises a polypeptide consisting of polypeptide of SEQ ID NO: 18 or the polypeptide of SEQ ID NO: 20. A chimeric protein that comprises a polypeptide consisting of polypeptide of SEQ ID NO: 18 or the polypeptide of SEQ ID NO: 20 may comprise further chemical moieties, such as post-translational modifications of amino acid residues thereof or cap structure. Two specific chimeric proteins disclosed herein and used in the Examples are CD19- CARVB1and CD19-CARVB2. The polypeptides of CD19-CARVB1and CD19-CARVB2consist of the amino acid sequences given in SEQ ID NO: 18 and SEQ ID NO: 20, respectively. Although the modular structure of these two chimeric proteins is similar, certain segments vary in order to allow tailored expression and signaling characteristics in respective cell types. While CD19CARVB1comprises the scFv FMC63, followed by the CD8 hinge region, CD8 transmembrane domain, stimulatory domains CD28 with CD3^(zeta). CD19-CARVB2comprises scFv FMC63, the CD28 hinge region, CD28 transmembrane domain, stimulatory domains 4-1BB (alias CD137) with CD3^. The various segments of CD19-CARVB1and 23 CD19-CARVB2are identified below in the section on the amino acid and nucleotide sequences, cf. see SEQ ID NO: 18 and SEQ ID NO: 20, respectively. Herein, an amino acid sequence segment (or, briefly, “segment”) refers to a plurality of contiguous amino acid residues of a protein or polypeptide having a larger number of amino acid residues than the segment. A protein may comprise multiple segments. Herein, different segments are non-overlapping. Protein domains may also be referred to as “segments”. The invention also provides a nucleic acid molecule encoding a chimeric protein (CD19- CAR) of the invention. The nucleic acid molecule may be a coding sequence, a construct comprising the coding sequence, a gene encoding the chimeric protein, a vector or plasmid comprising the gene, or an mRNA. Examples of such nucleic acid molecules are the plasmids shown in Figs.16 and 17, the nucleotide sequences of which are given in SEQ ID NO: 19 and SEQ ID NO: 21. The invention also provides a polynucleotide that is the reverse complement of the nucleic acid molecule, notably where the nucleic acid molecule is DNA. The nucleic acid molecule of the invention may be DNA, i.e. it may be a DNA molecule. Alternatively, the nucleic acid molecule may be RNA, i.e. it may be an RNA molecule. The RNA may be a single-stranded RNA, especially an mRNA. In some embodiments, the RNA comprises one or more modified nucleosides in place of uridine (modRNA), wherein the modified nucleoside is preferably selected from pseudouridine (ψ), N-methyl- pseudouridine (m1ψ), and 5-methyl-uridine (m5U). In some embodiments, the RNA comprises at least one of the following, preferably all of the following: a 5’ cap; a 5’ UTR; a 3’ UTR; and a poly-A sequence. In some embodiments, the poly-A sequence comprises at least 100 A nucleotides. The 5’ cap may be a cap1 or cap2 structure. The invention further provides a vector being or comprising a nucleic acid molecule as defined above. The vector generally encodes the chimeric CD19-CAR protein of the invention. Apart from a polynucleotide that encodes the chimeric protein of the invention or the nucleic acid molecule defined above, the vector may further contain regulatory elements for expressing the nucleic acid in the expression system of interest and / or a selectable marker for selecting the vector in bacterial or eukaryotic cells. The nucleic acid molecule of the invention may be a vector, and the plasmids of Figs.16 and 17 are examples of vectors 24 as well as of the nucleic acid molecule. The vector may be a viral vector for making use of a viral expression system, as further described above in section A). The invention further provides a lipid nanoparticle (LNP) comprising the nucleic acid molecule or the vector of the invention. The disclosure above in section A) applies analogously to LNPs comprising a nucleic acid molecule encoding a CD19-CAR of the invention. The invention further provides a eukaryotic cell comprising the nucleic acid molecule or the vector of the invention. Alternatively, the eukaryotic cell may comprise the chimeric protein of the invention and / or the LNP of the invention. The eukaryotic cell is preferably capable of expressing said chimeric CD19-CAR protein. The eukaryotic cell may be a human immune cell, such as for example a T cell, a natural killer cell, a macrophage, a human induced pluripotent stem (hiPS) cell-derived cell, an autologous immune cell, or an allogenic immune cell. The eukaryotic cell may comprise the nucleic acid molecule of the invention integrated into a nuclear DNA. In such case, this DNA may be the nucleic acid molecule of the invention. Alternatively, the eukaryotic cell may contain the nucleic acid molecule separate from a nuclear chromosome. If the nucleic acid molecule is RNA or contains ribonucleosides, the nucleic acid molecule may be contained in the cytoplasm of the cell, notably for expressing the chimeric protein from the nucleic acid molecule. There are different ways of introducing the nucleic acid molecule into eukaryotic cells. The nucleic acid molecule may be introduced into a cell by any means that are known for this purpose, such as microinjection or lipofection. Further, cells may be transfected using LNPs containing the nucleic acid molecule, notably if the nucleic acid molecule is or contains RNA. For inserting the nucleic acid molecule into a resident DNA molecule of the cell, such as a chromosome, the gene editing technology or recombinase-mediated integration may be used. The goal of the invention is to provide methods, means and tools (such as compounds) for treating an autoimmune disease, notably an autoimmune thyroid disease, such as Graves’ disease, which may include Graves’ orbitopathy and / or other Graves’ disease related manifestations in a patient. There are different possibilities how the invention can be used for this purpose. 25 A first possibility is cell therapy using the eukaryotic cell of the invention and administering said cell to a patient, e.g. intravenously. The cell used for this purpose may be an autologous cell or an allogenic cell. Autologous cell therapy and allogenic cells therapy are disclosed in further detail above in section A), which applies analogously to the present CD19-CAR aspect of the invention. In the Examples and Results sections below, we disclose methods and results which illustrate that it is possible to provide engineered NK cells by transfecting them with mRNAs which encode chimeric antigen receptors of the invention. Using the example of a CD19- CAR mRNA, we show functionality of such CAR effector cells to specifically induce ERK signaling in human immune cells and hence, to selectively kill target cells, e. g. equivalents of human B cells. For the treatment of Graves’ disease, Graves’ orbitopathy and / or other Graves’ disease related manifestations, a preferred eukaryotic cell among those mentioned above is an immune cell, preferably a T cell or a natural killer (NK) cell. NK cells are most preferred. A way of introducing the nucleic acid molecule of the invention into a T cell is introducing it using gene editing into the T cell locus. After (re-)introducing the immune cell into the patient, the obtained genetically-modified immune cell may express the chimeric protein of the invention on its surface and bind autoantigenic antibodies or B cells producing such autoantigenic antibodies for treating the disease. Accordingly, the invention provides a eukaryotic cell as described above for use in treating an autoimmune disease, preferably autoimmune thyroid disease, such as Graves’ disease, comprising administering said cell to a patient. The invention further provides a method of treating an autoimmune disease, preferably autoimmune thyroid disease, such as Graves’ disease, comprising administering to a patient suffering from an autoimmune thyroid disease the chimeric protein of the invention, the nucleic acid molecule according to the invention, the vector according to the invention, the LNP of the invention, or the eukaryotic cell, such as a NK cell, according to the invention. EXAMPLES 26 1. Methods 1.1 Primary Cells and Cell lines 1.1.1 Cell lines The HEK293T cell line (#ACC 635; DSMZ) was used for lentiviral production. The cell lines HEK293 (#ACC 305; DSMZ) and Jurkat (#ACC305, DSMZ) were used for expression of Chimeric AutoAntigen Receptor (CAAR) and Chimeric Antigen Receptor (CAR) constructs. HEK293T and HEK293 were cultured in Dulbecco’s modified Eagle’s medium (DMEM) + Glutamax supplemented with 10 % heat-inactivated fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin (all Thermo Fisher). Jurkat T cell lines, Nalm-6- luciferase cells and K562 wt and K562-CD19, which ectopically express human CD19 with a Luciferase and GFP reporter cassette, were cultivated in RPMI-1640 + Glutamax medium supplemented with 10 % FBS, 100 U / mL penicillin, 100 μg / mL streptomycin, 1 % non- essential amino acids, 1 % sodium-pyruvate and 55 µmol / L beta-mercaptoethanol (all media reagents Thermo Fisher). All cells were maintained in humidified incubators at 37 °C and 5 % CO2. 1.1.2 Primary human immune cells For peripheral blood mononuclear cell (PBMC) isolation, blood from buffy coats was diluted 1:5 to 1:8 with PBS (Corning) containing 2 % fetal bovine serum (FBS; Gibco; heat- inactivated; from Brazil). PBMCs were obtained by density gradient centrifugation using SepMate™-50 tubes (Stemcell Technologies) filled with Lymphoprep density gradient medium (Stemcell Technologies) according to the manufacturer’s instructions. After isolation, cell numbers were determined using automated cell counters (NucleoCounter NC- 250, Chemometec) according to the manufacturer´s instructions, before freezing PBMCs for cryopreservation in FBS with 10 % DMSO, and transfer to liquid nitrogen for at least one week before further experiments. Human primary NK cells or pan T lymphocytes were isolated from PBMCs using magnetic negative separation (Miltenyi Biotec) according to the manufacturer’s protocol. PBMC cells were resuspended in 40 µL separation buffer (PBS, 0.5% BSA, 2mM EDTA) per 1x107cells. 10 µL of NK cell Biotin antibody cocktail of pan T cell Biotin antibody cocktail was added per 1x107cells and incubated for 5 minutes at 4 °C. After addition of 30 µL of buffer 27 per 1x107cells, 20 µL of NK cell microbead cocktail or pan T cell microbead cocktail per 107cells were added and incubated for 10 minutes at 4 °C followed by magnetic separation using LS Columns (Miltenyi Biotec). After equilibration of the column with 3 mL separation buffer, labelled cell suspension was applied and column was washed 3 times with 1 mL separation buffer. Untouched NK cells or pan T lymphocytes eluted with the flow through. Yield of NK cells or pan T lymphocytes was determined by cell counting (Nucleocounter). NK cells were subsequently pre-activated for up to four days using the ImmunoCult NK expansion kit (Stemcell) according to manufacturer’s instructions. After pre-activation, cells were either used for transfection of mRNA or were further expanded by culturing them with K562-CD19 feeder cells in a ratio of 1:1.25 for up to 14 days in NK MACS medium (Miltenyi) with 5 % human AB serum, 100 U / mL IL-2 and 5 ng / ml IL-15. After 7 days, fresh feeder cells were added in the same ratio. On day 3, 6, 7, 10, and 13 fresh expansion medium was added to the culture. Pan T cells were subsequently pre-activated for three days on a culture plate coated with CD3 / CD28 antibodies (2.5 µg / mL, Miltenyi Biotech) in ImmunoCult T cell medium (Stemcell) with 100 ng / mL IL-2 (Milteny Biotech). Activated pan T cells were used for transfection of mRNA. 1.2 Expression of TSHR-CAAR and CD19-CAR in human cells 1.2.1 TSHR-CAAR and CD19-CAR expression constructs The extracellular domain of the human thyroid stimulating hormone receptor (THSR; Gene ID: 7253) was analysed and TSHR-CAAR constructs were designed and synthesized as lentiviral expression constructs (GeneArt (Thermo Fisher Scientific); Vectorbuilder). The CAAR designs are based on TSHR-derived fragments, namely AA M1-Q289 (in TSHR- CAARV1), AA M22-Q289 (in TSHR-CAAR289), and AA M22-G391 (in TSHR-CAAR391) fused to the N-terminal CD8 leader as a recombinant signal peptide. While TSHR-CAARV1includes features of a typical 2ndgeneration CAR backbone harboring CD28 and CD3zeta domains, TSHR-CAAR289and TSHR-CAAR391contain additional co-stimulatory features of 3rdgeneration receptors (Tomasik et al., 2022): the antigen-domain is linked to a CD8^^hinge and CD8 transmembrane domain to the signaling modules consisting of CD137 (4-1BB) and CD3zeta intracellular domains (see Fig.1). Analogously, for CD19- CARs, the FMC63-derived anti-CD19 scFv was synthesized and linearly fused to CD8 28 leader, hinge, transmembrane and signaling domains to generate CARVB1and CD19- CARVB2expression constructs (Vectorbuilder) (see Fig.16 and 17). Downstream of the TSHR CAAR expression units in TSHR-CAAR289and TSHR-CAAR391, reporters are driven by a separate cytomegaly virus (CMV) promotor with eGFP and hygromycin resistance cassettes allowing to monitor and enrich transfected / transduced target cells, while the construct TSHR-CAARV1contains a T2A peptide to link those reporter cassettes to TSHR CAAR expression. 1.2.2 Transfection and expression of TSHR-CAAR289and TSHR-CAAR391Plasmid transfection was conducted using Lipofectamin 3000 (Thermo Fisher Scientific) and Mirus LT1 (Mirus Bio), respectively, according to the manufacturer’s instructions. In brief, 2 µg of plasmid DNA were diluted in 125 µL OptiMEM (Thermo Fisher Scientific) and P300 reagent was added (2 µL / µg DNA). In parallel, 7.5 µL LF3000 was diluted in 125 µL OptiMEM before combining both volumes. After 15 minutes incubation at room temperature the lipofection solution was added drop-wise to HEK293(T) cells with about 80 % confluence in 6 well dishes. Selection of transfected HEK293(T) cells was achieved by culturing under hygromycin B (500 µg / mL; hygromycin B Cellpure, Roth) for at least 10 days. 1.2.3 Production of lentiviral particles and lentiviral transduction For the generation of VSV-G pseudotyped lentiviral particles cargo constructs expressing TSHR-CAAR289and TSHR-CAAR391as well as CARVB1and CD19-CARVB2were co- transfected with the packaging vectors psPAX and pMD2.G into 90 % confluent HEK293T cells by lipofection using Lipofectamin 3000 (Thermo Fisher Scientific). CD19-specific chimeric antigen receptor (CD19-CAR) constructs and GFP expressing vector pLV- GFPSpark served as positive controls. After 48 hours of production virus-containing culture supernatants were harvested and cell debris was removed by centrifugation and subsequent filtration through 0.8 µm cellulose acetate filters (Sartorius). Virus particles were concentrated using the Lenti-X Concentrator (Clontech Laboratories), aliquoted and frozen at -80 °C for long-term storage. For determination of lentiviral titers, HEK293 and Jurkat cells were incubated with increasing amounts of concentrated viral particles together with 5 to 8 µg / mL Polybrene (Merck). Transduction efficacy was tested two days post transduction via flow cytometry for GFP, CAR and TSHR-CAAR expression and the multiplicity of infection (MOI) was 29 calculated. Subsequently, target cells (Jurkat, HEK293T) were transduced with TSHR- CAAR, CD19-CAR and GFP lentiviruses at a MOI of 5 to 10. In order enhance transduction efficacy, spin-infection was performed with target cells being centrifuged at 1000 x g for 1.5 h at 30 °C. 1.2.4 CD19-CAR mRNA synthesis The linearized or PCR amplified plasmid templates which were used for mRNA transcription harbored a T7 promoter for initiation of transcription, followed by an open reading frame (ORF) which encoded for CD19-CARVB1, CD19-CARVB2, or GreenLantern proteins. The encoding CAR expression constructs were purchased from Vectorbuilder. The plasmids were transformed into chemically competent E. coli for amplification and purified by ion exchange chromatography. Afterwards, the plasmids were analyzed by sequencing and photometric methods and stored at -20 °C. To enable usage with the CleanCap IVT kit for mRNA production, a mutation within the T7 promoter had to be introduced. Therefore, specific primers containing the mutation and binding to the T7 promoter were used to exchange a guanine with an adenine directly behind the TATA box by polymerase chain reaction (PCR). Prior to in vitro transcription (IVT), the template DNA was linearized using the restriction enzyme BamHI from NEB or amplified by PCR. The IVT of the template DNA into mRNA was done according to the protocol of the HiScribe T7 mRNA Kit with CleanCap Reagent AG (E2080, NEB) and additional poly A-tailing. For each reaction 1 µg of template DNA, 2 µl of Reaction Buffer (10x), CleanCap Reagent AG (40 mM), NTPs (50 mM) and 2 µl of T7 RNA Polymerase were mixed in a PCR tube. Here, UTP was substituted with 1N-Methylpseudouridine (CrystalChem). Subsequently, the reaction was incubated at 37°C for 2 hours in a thermocycler (846-x-070-311, AnalytikJena). Afterwards, 2 µl (4 U) DNAse I was added to the reaction and incubated for 15 minutes at 37°C. The primary mRNA product was purified using the Monarch® RNA Cleanup Kit (T2050L, NEB). For Poly A-tailing, 10 µl 10x PolyA Reaction Buffer (B0276S, NEB), ATP and 5 µl PolyA Polymerase (ML0276L, NEB) was added to 50 µg of mRNA and topped to 100 µL with nuclease free water. The reaction was incubated for 30 minutes at 37°C. Subsequently, the polyadenylated mRNA was purified again using the Monarch® RNA Cleanup Kit (T2050L, NEB). RNA concentration was determined by UV spectroscopy.1.5 µL mRNA was analyzed on a NanoDrop UV / Vis spectrophotometer (Thermo Fisher). The measured concentration was 30 used to assess reaction efficiency, while the A260 nm / A280 nm ratio indicates purity of the mRNA. A value between 1.8 and 2.0 was considered optimal. Integrity and purity of mRNA was tested by agarose gel electrophoresis using the Agilent TapeStation System.1 µL mRNA sample or RNA size marker (Agilent 5067-5578) was mixed with 5 µL of sample buffer (Agilent 5067-5577), vortexed at 2000 rpm for 1 minute, heated to 72 °C for 3 min and subsequently placed on ice for 2 min. Samples were spun down and inserted into the TapeStation System together with a screen tape (Agilent 5067- 5576). All measurements were done before and after polyadenylation to validate mRNA size and polyA tail length, showing that the poly(A) tail length was ca.20 to 300 nt. 1.2.5 Transfection of human NK cells and human T lymphocytes with CD19-CAR mRNA On day 0, 7, and 14 of expansion, NK cells were harvested and used for transfection of mRNA. T cells were transfected on day 3 of activation. Per transfection reaction, 5x105human NK cells or 1x106T lymphocytes were resuspended in nucleofection solution containing 16.4 µL P3 solution and 3.6 µL supplement (Lonza, P3 primary Cell nucleofector kit).18 µL of cell suspension was mixed with 1 µg of mRNA dilution and transferred into a nucleofection cuvette. The cuvette was placed in the 4D nucleofector (Lonza) and nucleofection was conducted using the program CM-137 for NK cells and EO-115 for T lymphocytes. Directly afterwards, 80 µL of warm NK cell expansion medium or T cell medium was added to the cuvette and incubated for 7 minutes at room temperature. Afterwards, the cell suspension was carefully mixed and added to prewarmed medium in a cell culture well plate. The cells were incubated at 37 °C for about 20 hours. 1.2.6 Analysis of CD19-CAR expression post mRNA transfection by flow cytometry In order to validate transfection efficiency and mRNA translation 20 hours after nucleofection, pNK cells or pan T lymphocytes were analyzed by flow cytometry for CD19- CAR and GFP expression, respectively. Therefore, cells were counted and about 1x105cells per condition were taken for FACS analysis, while remaining cells were used for subsequent functional assays. For immune cell FACS staining, cells were harvested, centrifuged at 400 x g for 5 minutes at 4 °C, and washed once with 200 µL PBS per sample. Cells were incubated with Fc Block (Miltenyi) for 15 minutes at 4 °C to avoid unspecific binding of detection antibodies. 31 Following a PBS washing step, cells were incubated with pre-labeled antibody staining mixes for 20 minutes at 4 °C. After a final washing step, viability dye (4′,6-Diamidin-2- phenylindol (DAPI), 1 µg / mL) was added and cells subjected to analysis on a MacsQuant10 flow cytometer. Besides GFP expression, CD19-CARVB1and CD19-CARVB2expression was detected by FMC62-AF647 (Acro biosystems) antibody. 1.3 TSHR Detection: Flow cytometry staining & analysis TSHR-CAAR expression and binding of patient-derived autoantibodies was validated by flow cytometry. Therefore, cells were harvested and stained with anti-human TSHR mAbs (clone: M22 or clone: K1-70, AntibodySystem and Biorbyt). For detection, unlabeled anti- human TSHR IgGs (clone M22 or clone K1-70, AntibodySystem) were covalently linked to biotin via the EZ-Link Sulfo-NHS-LC-Biotin coupling kit (Thermo Fisher Scientific) which allows subsequent labeling via streptavidin-coupled fluorophores (Streptavidin-APC, Miltenyi Biotech). In brief, 100 µg IgG were incubated with 2.5 µL EZ-Link Sulfo-NHS-LC- Biotin (10 mM) in phosphate-buffered saline (PBS). Alternatively, M22 TSHR mAb (Biorbyt) was coupled to fluorescently labeled Fab fragments which bind to the constant Fc region (Zenon Human IgG Labeling kit; Invitrogen). For this, 5 µg M22 were incubated with 25 µL Zenon human IgG labeling reagent (here: AF647; 200 µg Fab / mL) for 5 minutes at room temperature followed by blocking free binding site with 25 µL Zenon blocking reagent (5 mg / mL) for additional 5 minutes. Fluorescent labeling of mouse anti-human K1-70 TSHR (Biorbyt) was performed using Fc-binding probes (m-IgG Fc BP-CFL 555, Santa Cruz) and 5 µg K1-70 incubated with 25 µL m-IgG Fc BP (100 µg / mL) for 15 minutes at room temperature. In addition, anti-human TSHR AF647-conjugated antibody (FAB65342R, R&D Systems) served as a positive staining control. Cell-activation of Jurkat cells or human T lymphocytes was analyzed by staining cells with antibodies specific for phospho ERK1 / 2 (clone: MILAN8R, ebioscience), CD69 (clone: FN-50, Biolegend), and CD3 (clone: SK7, Biolegend). For flow-cytometric analysis cells were harvested and washed with PBS before incubating with human Fc block reagent (Miltenyi Biotech) in 96 wells for 10 minutes at 4 °C. After washing, cells were incubated with pre-labeled antibody staining mixes for 20 minutes at 4 °C. Biotinylated antibodies were detected by adding a second washing and incubation step with fluorophore-labeled streptavidin (SA-APC or SA-PE, Miltenyi Biotech). After a final washing step, viability dye (4′,6-Diamidin-2-phenylindol (DAPI), 1 µg / mL) was added. 32 For intracellular flow cytometry cells were fixed using IC Fixation Buffer (Thermo Fischer Scientific) for 20 minutes at room temperature in the dark. After washing, cells were permeabilzed with ice-cold 90-100 % methanol for 30 minutes on ice before cells are incubated with Fc block reagent (Milteny Biotec) to minimize nonspecific Fc-mediated binding. Intracellular phosphoproteins and other marker proteins were detected by incubation with fluorophore-conjugated antibodies over night at 4 °C. After several washing steps samples were measured on a MACSQuant10 flow cytometer (Miltenyi Biotech) or a Northern Lights 3000 flow cytometer (Cytek Biosciences, USA). Data analysis was conducted with FCS Express 7 (V.7.20, De Novo Software). 1.4 Determination of anti-TSHR antibody (TRAb) levels in patient sera Sera were sampled from Graves´ disease (GD) patients after informed consent and processed anonymously, as approved by the Bavarian Medical Chamber (Bayrische Ärztekammer) on September 30, 2020. The level of anti-TSHR autoantibodies in patients’ sera was determined by using the Anti- TSH Receptor (TRab) Fast ELISA (IgG) (EA 1015-9601-1 G, EUROIMMUN) according to manufacturer’s instruction. The ELISA uses porcine TSH receptor and has a lower detection limit of 0.16 IU / l. In short, 75 µL serum was added per well of the antigen-coated 96-well plate, which was then incubated for 1 hour at room temperature. After a washing step, M22-peroxidase antibody was added to the wells and incubated for 25 minutes. The plate was washed three times before addition of peroxidase substrate and incubating for another 25 minutes. To terminate the reaction, stop solution was added to the wells and the color intensity was measured at 450 nm and a reference wavelength of 620 nm. The amount of TRAb was determined by calculating the percentage of inhibition of M22 binding by anti-TSHR auto-antibodies in patient sera compared to the negative control. 1.5 Cell competitive binding assay with TSHR-CAAR and GD patient sera For determining the ability of the designed TSHR-CAARs to bind patient derived auto- antibodies against the TSH receptor, a competitive binding assay was performed. Therefore, TSHR-CAAR289expressing HEK293 cells (or untreated controls, respectively) were seeded in 96 well plates (4x104cc / well) before incubation with increasing dilutions of sera from GD patients with high or low amount of TRAb or sera from healthy donors as negative control. Sera were diluted (1:2, 1:4, 1:20 and 1:100 in OptiMEM (Thermo Fisher 33 Scientific)) and added for 1.5 hours at 37 °C on HEK293 cells. After serum-incubation, supernatant was removed and cells were incubated with biotinylated anti-TSHR antibody M22 (M22-bio) at 0.5 µg / mL in 100 µL OptiMEM for 1 hour at 37 °C. Following the M22 competition step, cells were harvested, washed and stained with SA-APC for 20 minutes at 4 °C. After a final washing step, viability dye (DAPI, 1 µg / mL) was added before measuring. Competition of M22 and auto-antibodies was determined via flow cytometry on a MACSQuant10 flow cytometer (Miltenyi Biotech). 1.6 Cell activation assay In order to test the ability of the designed TSHR-CAAR to induce signal transduction cascades in effector immune cells, cell activation assays were established. Therefore, anti- TSHR antibodies M22 and K1-70, or an unspecific IgG control antibody (Ultra Leaf human IgG1 Isotype Control, Biolegend) were coated on a cell culture treated flat-bottom 96 well plate.100 µl of diluted antibody at a final concentration of 50 µg / mL were incubated at room temperature for 2 hours or at 4 °C over night. Afterwards, the wells were washed two times with PBS and blocked with 100 µL 10% FBS in PBS for another 2 hours at room temperature or overnight at 4 °C. Before adding the cells, the wells were washed 2 times with PBS. Jurkat-TSHR-CAAR289and Jurkat-GFP control cells were washed once with PBS and resuspended at 1x105cells per 100 µL in Jurkat culture medium before seeding on the coated 96 well plate. As positive control cells were incubated in 100 µL media containing PMA / Iono (Phorbol-12-Myristat-13-Acetat 1 µg / mL / Ionomycin, 1 nM (both Sigma). The cells were incubated for 15 minutes at 37 °C and 5 % CO2. Afterwards, phosphorylated ERK1 and ERK2 (phosphoERK1 / 2) was measured by flow cytometry. As state-of-the-art control, 1x105CD19-CAR expressing Jurkat cells and T-lymphocytes (CD19-CARVB1and CD19-CARVB2) were co-cultured with K562 wt or K562-CD19 target cells in an effector target ratio (E:T ratio) of 1:2 and treated in the same manner as described above. 1.7 NK-mediated target cell killing assay Assays on Natural Killer (NK)-mediated cytotoxicity are used to evaluate the ability of NK cells to recognize and destroy target cells, typically tumor or virus-infected cells. The most common approach involves co-culturing NK cells with labeled target cells, such as K562 34 leukemia cells, in a controlled environment. Mixed cells are then incubated for several hours at different effector-to-target (E:T) cell ratios to monitor how effectively NK cells induce cell death in defined co-cultures with luciferase-expressing target cells. Decrease of luciferase signal monitors targeted cell killing and serves as a surrogate marker for cytotoxic activity of NK cells. For this, NK cells were harvested and washed at 400 x g for 5 minutes at 20 °C before being seeded in 100 µL at defined cell concentrations in 96 well cell culture plates. Afterwards, luciferase-expressing target cells were harvested, washed at 400 x g for 5 minutes at 20 °C and adjusted to defined cell concentrations before being added to the pre- seeded NK cells and further incubated for 4 hours at 37 °C. Various effector-to-target cell ratios were tested in duplicates to measure efficacy of NK cell-mediated cytotoxicity. In addition, target cells were treated with staurosporine (STS) (final conc.1 µM) serving as positive controls. After incubation, luciferase activity was measured using a bioluminescent reporter assay (Bright-Glo, Promega). After equilibration to room-temperature an equal volume of Bright- Glo reagent was added directly to the co-culture medium and incubated for at least 2 minutes to allow cell lysis. Afterwards, lysates were transferred to suitable white 96-well plate and luminescence was measured on a SpectraMax plate reader. 2. Results 2.1 Design of the TSHR-CAAR constructs Thyroid stimulating autoantibodies cause hyperthyroidism in Graves’ disease and autoantibodies exert their stimulating effect by binding to the thyroid stimulating hormone receptor (TSHR). Its extracellular domain has been identified as the dominant antigen recognized by autoantibodies in GD patients (Smith et al., 1988; Sanders et al., 2003). The structure of the TSHR, as well as the other Glycoprotein Hormone Receptors (GPHRs), contains a large amino-terminal extracellular domain (ECD) and a transmembrane domain (TMD). The TSHR ECD contains an N-terminal region, a leucine-rich repeat domain (LRRD) and a hinge region or cleavage domain. The TMD contains the typical seven transmembrane helices of GPCRs, an eighth helix parallel to the membrane and a C- terminal tail (Faust et al., 2022). 35 In order to specifically target TSHR-autoreactive antibody-generating B cells and their secreted immunoglobulins, parts of the extracellular domain were selected as building blocks for the design of the TSHR-CAARs. TSHR-derived LRRD-containing fragments of the ecTSHR, namely AA M1-Q289 (for TSHR-CAARV1) and the fragment AA M22-Q289 (for TSHR-CAAR289) lacking the intrinsic signal peptide sequence, were designed and fused to the N-terminal CD8^ leader sequence. In addition to the two LRRD TSHR-CAARs mentioned above, another larger TSHR-CAAR (AA M22-G391; referred to as TSHR- CAAR391) with an elongated ecTSHR domain was designed that is similar to a recently published construct (Duan et al., 2023) and serves as “state of the art” reference construct. In construct TSHR-CAAR391, the intrinsic signal peptide sequence is also replaced with the N-terminal CD8^ leader sequence and all TSHR-autoantigen domains were combined with hinge, transmembrane and signaling domains derived from validated and published CD19- CAR constructs. Both elongated ecTSHR constructs, TSHR-CAAR391and Duan CAAR (AA M22-G413), include the helical hinge loop downstream of the LRD. Structural analysis revealed that upon TSHR activation, the helical hinge contributes to the rotation of the ECD and promotes an inward movement of the extracellular tip, converting the TSHR into an inactive confirmation (Faust et al., 2022). 2.2 Detection of TSHR-CAAR expression on model cells In order to validate proper expression and folding of TSHR-CAAR proteins, HEK293T cells were either transfected with TSHR-CAAR289, TSHR-CAAR391, TSHR-CAARV1or full-length TSHR (TSHR-FL) and control expression constructs. After 48 hours cells were harvested and stained with the commercially available anti-TSHR antibody (FAB65342R, R&D) coupled to AF647 (Fig.4 lower panel). All four TSHR constructs TSHR-FL, TSHR-CAARV1, TSHR-CAAR289, TSHR-CAAR391were expressed and successfully detected by the anti- TSHR AF647 antibody with the highest signal for the full-length TSHR protein. TSHR- CAAR289signal intensity was comparable to the TSHR-FL and higher than the TSHR- CAARV1. Surprisingly, the longer ECD in TSHR-CAAR391did show a significant weaker signal than all other constructs. Mock-transfected cells did not show any signal after staining and served as a good negative control. 36 In addition to protein expression, protein folding of the extracellular domains is crucial for CAAR functionality. To address this point, we made use of anti-TSH receptor antibody clones that were originally isolated from GD patients and resemble well described auto- antibodies in thyroid diseases. The M22 is a fully characterized stimulatory antibody that binds agonistically to the extracellular domain of the TSH receptor and competes with its naturally ligand thyroid stimulating hormone (TSH; Fig.3A) (Furmaniak et al., 2011), whereas the K1-70 is described as an inhibitory antibody for the TSH receptor. M22 binding was tested analogously to the anti-TSHR-AF647 in flow cytometry, and AF647-Fab coupled M22 robustly detected full length TSHR receptor protein as well all three TSHR-CAAR proteins (Fig.4 upper panel). The structural data available for the M22–ecTSHR complex highlight the non-linear antibody binding epitope buried in the six leucine-rich repeats ligand binding pocket of the TSHR. Thus, M22 binding to all three TSHR-CAAR proteins serves as a strong indicator for proper folding of the designed chimeric autoantigen domains, but also highlights high binding affinities of M22 for TSHR-CAAR289, while no background signal was detected in control samples. Surprisingly, binding of M22 to the cell surface-expressed TSHR-CAAR289was much stronger than to TSHR-CAAR391(compare the respective graphs in Fig.4, upper panel). Thus, the engineered TSHR-CAAR289molecule devoid of the helical hinge loop is much superior for antibody binding. The inventors assume that the ligand binding domain of TSHR-CAAR289provides higher flexibility and accessibility of the LRRD, which could explain the superior antibody binding. Accordingly, TSHR-CAAR289allows to specifically target TSHR-autoreactive antibody-generating B cells and their secreted immunoglobulins. Based on its superior binding M22 capacities and its improved signal transduction domains compared to TSHR-CAARV1, the TSHR-CAAR289construct was selected for further testing. 2.3 TSHR antibody level in patients’ sera Sera of GD patients were tested for anti-TSHR autoantibodies by competitive ELISA, also known as an inhibition assay. In contrast to conventional ELISAs, the assay measures the concentration of an antigen by detection of signal interference, since the sample antigen competes with a reference antigen for binding to a specific amount of labeled antibody. For this TSHR-TRAb assay, low antibody signal represents a strong inhibition of M22 binding and therefore a high amount of TRAb in the tested serum. Samples showing an 37 inhibition of M22 binding of over 90 % were considered having a high TRAb titer, samples with an inhibition of under 40 % were considered as having low TRAb titers. In total 90 sera were tested (Fig.5) with 20 sera exhibiting high TRAb titers (22 %), 8 sera showed low autoantibody titers (9 %). From the samples showing high or low autoantibody titers, six sera (4 high, 2 low; see arrows Fig.5) were selected for patient-derived autoantibody testing on TSHR-CAARs in a competitive FACS staining. 2.4 Patient-derived anti-TSHR autoantibodies (TRAb) bind to TSHR CAARs 2.4.1 Validation of biotinylated M22 and K1-70 in TSHR-CAAR binding assay Measuring autoantibody binding to TSHR-CAAR proteins in a cell competitive binding assay required labeled probing antibodies, e.g. biotinylated M22 for the detection of epitope binding competition. Thus, unlabeled anti-human TSHR IgGs (clone: M22 and clone: K1- 70) were covalently linked to biotin via the EZ-Link Sulfo-NHS-LC-Biotin coupling which allows subsequent labeling via streptavidin-coupled fluorophores (Streptavidin-APC, Miltenyi Biotech). These coupled antibodies were tested for TSHR and TSHR-CAAR detection by flow cytometry. HEK293T cells were either transfected with TSHR-CAAR289, TSHR-CAAR391 or full-length TSHR and control expression constructs. In addition, antibiotic selection of transfectants over 10 days allowed enrichment of hygromycin B- resistant HEK293T. Cells were harvested and stained with the biotinylated M22 (M22-bio) and K1-70 (K1-70-bio) with subsequent streptavidin-APC labeling. In parallel, staining cells with the commercially available anti-TSHR-AF647 antibody (FAB65342R, R&D) served as control. All three TSHR constructs TSHR-FL, TSHR-CAAR289, TSHR-CAAR391 were expressed and detected by the anti-TSHR-AF647 antibody (Fig.6A). Here, the biotinylated M22 and K1-70 were tested and the modified variants were functional and efficient in staining TSHR-FL as well as TSHR-CAAR cells as determined by flow cytometry. Furthermore, both antibodies detected a pronounced fraction of TSHR-CAAR positive cells with an increased mean fluorescence intensity in hygromycin-B selected HEK293T cells (Fig.6B). Again, the TSHR-CAAR289showed higher expression and signal intensity compared to the TSHR-FL and the TSHR-CAAR391. Mock-transfected cells did not show any signal after staining and served as a good negative control. 2.4.2 Cell competitive binding assay with TSHR-CAAR and GD patient sera For determining the ability of the designed TSHR-CAAR289to bind patient derived auto- antibodies against the TSH receptor, a cell competitive binding assay was performed. 38 Therefore, TSHR-CAAR289expressing HEK293 cells, or untreated controls, respectively, were incubated with increasing dilutions of sera from GD patients with high or low amount of TRAb or sera from healthy donors as negative control. Upon addition of M22-bio serum- derived GD patient autoantibodies are competing for binding to their cognate epitopes namely the TSHR-CAAR protein. In line with our hypothesis, GD patient serum with high antibody titers (S001; S006; S009; S021) led to a pronounced inhibition of M22 binding to TSHR-CAAR289and thus to a reduced APC signal on reporter cells (Fig.7). Analogous treatment with serum of healthy donors did not affect M22 binding to TSHR-CAARs which is reflected by unaltered high antibody signals at all serum dilutions (Fig.7). Furthermore, GD patient serum with lower antibody titers (S012; S025) was less potent in inhibiting M22 binding to TSHR-CAAR289which resulted in a marginal reduction of M22- APC signal on reporter cells (Fig.8). Analogous treatment with serum of healthy donors did not affect M22 binding to TSHR-CAAR289which is reflected by unaltered high antibody signals at all serum dilutions (Fig.8). Initial data was further consolidated when the GD patient cohort was extended and the M22 - TSHR-CAAR289binding assay was tested with additional 25 GD patient sera (Fig.9). In line with our previous data, patient sera with high TRab titers led to a profound inhibition of M22 binding to TSHR-CAAR289while sera with lower antibody titers affected M22 binding significantly less. The data reconfirm that treatment with serum of healthy donors did not hinder M22 binding to TSHR-CAAR289at all serum dilutions (Fig.9). Combining our initial M22 CAAR staining studies with the cell competitive binding assay, data indicated a robust binding of M22 and patient derived TRAb to the new designed TSHR-CAAR289. 2.4.3 Cell Activation assay TSHR-CAAR289specific signal transduction mediated through ligand binding is critical for proper CAAR function. In order to test specificity and cell activation capacity transgenic Jurkat T cell lines were generated expressing the TSHR-CAAR289or GFP as control. Incubation with THSR-specific antibodies (M22 and K1-70) resulted in robust CAAR stimulation and subsequent cell activation as detected by phosphorylation of ERK1 / 2 (pERK1 / 2). CD3+GFP+pERK1 / 2+ TSHR-CAAR289Jurkat T cells highlight significant stimulation responses upon M22 and K1-70 CAAR-binding as well as upon PMA / Iono treatment while neither control IgG nor control cells showed respective cell responses 39 (Fig.10). Extracellular signal-regulated kinase 1 / 2 (ERK1 / 2) as a serine / threonine protein kinase belonging to the mitogen-activated protein kinase (MAPK) family plays a key role in signal transduction in immune cells including cell proliferation, cell growth, and cell differentiation. Hence, the anti-THSR antibody-mediated cell activation and ERK1 / 2 phosphorylation data further validates the functionality and specificity of the TSHR-CAAR289in the immune cell context. In summary, TSHR-CAAR289does not only bind GD patient autoantibodies with its extracellular domain, but serves as a fully functional receptor molecule which robustly triggers specific intracellular signaling pathways and, hence, activates human immune cells specifically. As CD19-CARs represent current state-of-the-art in the field of CAR cell therapy, we generated two different CD19-CAR constructs (CD19-CARVB1and CD19-CARVB2) to express them in Jurkat T cells and to juxtapose their activation profile to the TSHR-CAAR289receptor. Incubation of CD19-CAR expressing Jurkat cells with CD19-expressing target cells resulted in robust cell activation measured by phosphorylation of ERK1 / 2 similar to TSHR-CAAR289activation (Fig.11). Taken together, cell expression, competitive binding and immune cell activation assays confirm key functional features of the TSHR-CAAR289molecule. Robust protein expression in reporter cells, which was validated by antigen-specific binding of M22, K1-70 and anti- TSHR (FAB65342R) antibodies, was unexpectedly clearly stronger than TSHR-CAAR391expression. Furthermore, cell surface staining proved proper folding and transport of the TSHR-CAAR289protein to the cell surface as well as improved antibody binding than to TSHR-CAAR391. Using GD patient-derived serum antibodies, inhibiting M22 binding to TSHR-CAAR showed the capacity of TSHR-CAAR289to not only be recognized by primary disease-specific autoantibodies but also serve as a surrogate indicator for targeting autoreactive B cells in respective GD patients. In functional assays, TSHR-CAAR289demonstrated its proficiency to specifically induce intracellular signaling cascades in T cells upon target ligand binding and is thereby able to activate effector immune cells. Therefore, the TSHR-CAARs of the invention may be used for treating autoimmune thyroid disease, such as Graves’ disease. 40 2.5 Expression and function of CD19-CAR in primary human immune cells We also sought to investigate whether human T lymphocytes and NK cells can be engineered to express CA(A)R for cell targeting. Using CD19-CAR, we established robust CAR expression by efficiently transfecting mRNA in human immune cells. CD19-CAR stimulation reliably induced ERK phosphorylation in human T lymphocytes and subsequent killing of CD19-expressing target cells, e. g. equivalents of human B cells. 2.5.1 Cell activation of primary T lymphocytes Human primary T lymphocytes were transfected with CD19-CAR mRNAs or GreenLantern mRNA using nucleofection.20 hours after transfection, mRNA translation and expression was measured by flow cytometry. T lymphocytes transfected with CD19-CARVB1or CD19- CARVB2mRNA showed strong CD19-CAR expression and transfection efficacy (Fig.12A). CD19-CAR expressing T lymphocytes were subsequently co-cultured with CD19- expressing target cells and their activation was analyzed by measuring the percentage of CD3+pERK1 / 2+T cells. Incubation with CD19-target cells resulted in strong increase in phosphorylated ERK1 / 2, whereas T lymphocytes without CD19-CARs (wild type or mock- transfected) and co-culture with mock-transfected target cells did not lead to an increase of pERK1 / 2 (Fig.12B). 2.5.2 CD19-CAR specific lysis of CD19+target cells by human NK cells Human primary NK cells were transfected with CD19-CAR mRNAs or GreenLantern mRNA using nucleofection.20 hours after transfection, mRNA translation and receptor expression was measured by flow cytometry. NK cells transfected with CD19-CARVB1or CD19-CARVB2mRNA showed strong CD19-CAR expression and transfection efficacy (Fig.13A). CD19- CAR expressing NK cells were subsequently co-cultured with different luciferase-transgenic target cells in increasing effector:target ratios. The universal NK-target cell line K562-CD19 and the B cell line Nalm-6 both expressed the CD19 antigen and reporter luciferase, whereas wild type K562 did not express CD19 (Fig.13B). NK-mediated lysis of target cells was analyzed by measuring the amount of luciferase activity after 4 hours of co-culture. Nalm-6, as B cell equivalents, were efficiently killed in a CD19-CAR specific manner, whereas lysis of Nalm-6 by mock transfected of wild type NK cells was less pronounced (Fig.13C, left). K562-CD19 were killed comparably by all tested NK cells, showing that the natural killing capacity of the used cells is not impaired by their treatment (Fig.13C, right). 41 In conclusion, the medical utility of human immune cells which expressed either CD19- CARVB1or CD19-CARVB2, or more preferably TSHR-CAAR289could be demonstrated by these experiments because all CA(A)Rs were provided in human immune cells and shown to be functionally active: 1) Expression of all CA(A)Rs was shown on the surface of immune cells 2) Specific binding of TSHR-CAAR289to GD patient autoantibodies was shown, depending on the antibody titers of the respective patients 3) Specific activation of the immune cell second messenger ERK was shown for CD19- CARVB1, CD19-CARVB2, and TSHR-CAAR2894) Concomitantly, CD19-CARVB1or CD19-CARVB2–expressing human NK cells exerted specific killing of human B lymphocyte-equivalent cells. In analogy, it is also expected of TSHR-CAAR289-expressing NK cells to exert such specific killing on GD-specific anti-TSHR antibody-generating B lymphocytes in humans. These CA(A)R-expressing NK cells or other CA(A)R-expressing immune cells provide novel medical uses in the treatments of human autoimmune disease, such as Graves’ disease, or other diseases.

[0002] 42 Amino acid and nucleotide sequences SEQ ID NO: 1 Amino acid sequence of N-terminal signal peptide (“TSHR leader” in Fig.1) and extracellular (ec) domain of human TSHR (aa 1-413); in italics: ECD fragment of aa 22 to 289 used in human TSHR-CAAR289; underlined: aa residue 301 MRPADLLQLV LLLDLPRDLG GMGCSSPPCE CHQEEDFRVT CKDIQRIPSL PPSTQTLKLI ETHLRTIPSH AFSNLPNISR IYVSIDVTLQ QLESHSFYNL SKVTHIEIRN TRNLTYIDPD ALKELPLLKF LGIFNTGLKM FPDLTKVYST DIFFILEITD NPYMTSIPVN AFQGLCNETL TLKLYNNGFT SVQGYAFNGT KLDAVYLNKN KYLTVIDKDA FGGVYSGPSL LDVSQTSVTA LPSKGLEHLK ELIARNTWTL KKLPLSLSFL HLTRADLSYP SHCCAFKNQK KIRGILESLM CNESSMQSLR QRKSVNALNS PLHQEYEENL GDSIVGYKEK SKFQDTHNNA HYYVFFEEQE DEIIGFGQEL KNPQEETLQA FDSHYDYTIC GDSEDMVCTP KSDEFNPCED IMG* SEQ ID NO: 2 Coding sequence of the amino acid sequence of SEQ ID NO: 1 atg agg ccg gcg gac ttg ctg cag ctg gtg ctg ctg ctc gac ctg ccc agg gac ctg ggc gga atg ggg tgt tcg tct cca ccc tgc gag tgc cat cag gag gag gac ttc aga gtc acc tgc aag gat att caa cgc atc ccc agc tta ccg ccc agt acg cag act ctg aag ctt att gag act cac ctg aga act att cca agt cat gca ttt tct aat ctg ccc aat att tcc aga atc tac gta tct ata gat gtg act ctg cag cag ctg gaa tca cac tcc ttc tac aat ttg agt aaa gtg act cac ata gaa att cgg aat acc agg aac tta act tac ata gac cct gat gcc ctc aaa gag ctc ccc ctc cta aag ttc ctt ggc att ttc aac act gga ctt aaa atg ttc cct gac ctg acc aaa gtt tat tcc act gat ata ttc ttt ata ctt gaa att aca gac aac cct tac atg acg tca atc cct gtg aat gct ttt cag gga cta tgc aat gaa acc ttg aca ctg aag ctg tac aac aat ggc ttt act tca gtc caa gga tat gct ttc aat ggg aca aag ctg gat gct gtt tac cta aac aag aat aaa tac ctg aca gtt att gac aaa gat gca ttt gga gga gta tac agt gga cca agc ttg ctg gac gtg tct caa acc agt gtc act gcc ctt cca tcc aaa ggc ctg gag cac ctg aag gaa ctg ata gca aga aac acc tgg act ctt aag aaa ctt cca ctt tcc ttg agt ttc ctt cac ctc aca cgg gct gac ctt tct tac cca agc cac tgc tgt gct ttt aag aat cag aag aaa atc aga gga atc ctt gag tcc ttg atg tgt aat gag agc agt atg cag agc ttg cgc cag aga aaa tct gtg aat gcc ttg aat agc ccc ctc cac cag gaa tat gaa gag aat ctg ggt gac agc att gtt ggg tac aag gaa aag tcc aag ttc cag gat act cat aac aac gct cat tat tac gtc ttc ttt gaa gaa caa gag gat gag atc att ggt ttt ggc cag gag ctc aaa aac ccc cag gaa gag act cta caa gct ttt gac agc cat tat gac tac acc ata tgt ggg gac agt gaa gac atg gtg tgt acc ccc aag tcc gat gag ttc aac ccg tgt gaa gac ata atg ggc SEQ ID NO: 3 Amino acid sequence of the hinge region (“CD8^-hinge” in Fig.1): CD8 AA A290-D337 A KPTTTPAPRP PTPAPTIASQ PLSLRPEACR PAAGGAVHTR GLDFACD SEQ ID NO: 4 Coding sequence of the amino acid sequence of SEQ ID NO: 3 gcg aag ccc acc acg acg cca gcg ccg cga cca cca aca ccg gcg ccc acc atc gcg tcg cag ccc ctg tcc ctg cgc cca gag gcg tgc cgg cca gcg gcg ggg ggc gca gtg cac acg agg ggg ctg gac ttc gcc tgt gat SEQ ID NO: 5 Amino acid sequence of the transmembrane region (“CD8-TM” in Fig. 1): CD8 AA I338-C361 43 IYI WAPLAGTCGV LLLSLVITLY C SEQ ID NO: 6 Coding sequence of the amino acid sequence of SEQ ID NO: 5 atc tac atc tgg gcg ccc ttg gcc ggg act tgt ggg gtc ctt ctc ctg tca ctg gtt atc acc ctt tac tgc SEQ ID NO: 7 Amino acid sequence of the co-stimulatory domain ("4-1BB” in Fig. 1): 4- 1BB AAK362-L403 KRGRKKLLY IFKQPFMRPV QTTQEEDGCS CRFPEEEEGG CEL SEQ ID NO: 8 Coding sequence of the amino acid sequence of SEQ ID NO: 7 aaa cgg ggc aga aag aaa ctc ctg tat ata ttc aaa caa cca ttt atg aga cca gta caa act act caa gag gaa gat ggc tgt agc tgc cga ttt cca gaa gaa gaa gaa gga gga tgt gaa ctg SEQ ID NO: 9 Amino acid sequence of the signaling domain ("CD3zeta” in Fig. 1): CD3 zeta AA R404-R515* RVKFSRS ADAPAYQQGQ NQLYNELNLG RREEYDVLDK RRGRDPEMGG KPRRKNPQEG LYNELQKDKM AEAYSEIGMK GERRRGKGHD GLYQGLSTAT KDTYDALHMQ ALPPR SEQ ID NO: 10 Coding sequence of the amino acid sequence of SEQ ID NO: 9 aga gtg aag ttc agc agg agc gca gac gcc ccc gcg tac cag cag ggc cag aac cag ctc tat aac gag ctc aat cta gga cga aga gag gag tac gat gtt ttg gac aag aga cgt ggc cgg gac cct gag atg ggg gga aag ccg aga agg aag aac cct cag gaa ggc ctg tac aat gaa ctg cag aaa gat aag atg gcg gag gcc tac agt gag att ggg atg aaa ggc gag cgc cgg agg ggc aag ggg cac gat ggc ctt tac cag ggt ctc agt aca gcc acc aag gac acc tac gac gcc ctt cac atg cag gcc ctg ccc cct cgc SEQ ID NO: 11 Amino acid sequence of the signal peptide ("CD8-leader” or "CD8Leader” in Fig.1): CD8 leader AA M1-P21 MALPVTALLLPLALLLHAARP SEQ ID NO: 12 Coding sequence of the amino acid sequence of SEQ ID NO: 11 atg gcc tta cca gtg acc gcc ttg ctc ctg ccg ctg gcc ttg ctg ctc cac gcc gcc agg ccg SEQ ID NO: 13 Amino acid sequence of TSHR CAAR289(see Fig.1) of the following segments in the order shown from N- to C-terminus: - first 21 residues: signal peptide: CD8^-leader aa M1-P21; - aa 22 to 289 of human TSHR in regular script; - underlined: CD8^-hinge; - italics: transmembrane region; - bold: co-stimulatory domain 4-1BB AAK362-L403; - regular script: signaling domain: CD3zeta AA R404-R515* MALPVTALLL PLALLLHAAR PMGCSSPPCE CHQEEDFRVT CKDIQRIPSL PPSTQTLKLI ETHLRTIPSH AFSNLPNISR IYVSIDVTLQ QLESHSFYNL SKVTHIEIRN TRNLTYIDPD ALKELPLLKF LGIFNTGLKM FPDLTKVYST DIFFILEITD NPYMTSIPVN AFQGLCNETL TLKLYNNGFT SVQGYAFNGT KLDAVYLNKN KYLTVIDKDA FGGVYSGPSL 44 LDVSQTSVTA LPSKGLEHLK ELIARNTWTL KKLPLSLSFL HLTRADLSYP SHCCAFKNQA KPTTTPAPRP PTPAPTIASQ PLSLRPEACR PAAGGAVHTR GLDFACDIYI WAPLAGTCGV LLLSLVITLY CKRGRKKLLY IFKQPFMRPV QTTQEEDGCS CRFPEEEEGG CELRVKFSRS ADAPAYQQGQ NQLYNELNLG RREEYDVLDK RRGRDPEMGG KPRRKNPQEG LYNELQKDKM AEAYSEIGMK GERRRGKGHD GLYQGLSTAT KDTYDALHMQ ALPPR* SEQ ID NO: 14 Coding sequence of the amino acid sequence of SEQ ID NO: 13 atg gcc tta cca gtg acc gcc ttg ctc ctg ccg ctg gcc ttg ctg ctc cac gcc gcc agg ccg atg gga tgt agc tct cca cct tgc gag tgc cac caa gaa gag gac ttc cgg gtc aca tgc aag gac atc cag aga atc ccc agc ctg cct cct agc aca cag acc ctg aag ctg atc gag aca cac ctg aga aca atc cct agc cac gcc ttc tcc aac ctg cct aac atc tcc cgg atc tac gtg tcc atc gac gtg acc ctg cag cag ctg gaa tcc cac agc ttc tac aac ctg tcc aaa gtg acc cac atc gag atc cgg aac acc cgg aac ctg acc tac atc gac ccc gac gct ctg aaa gag ctg ccc ctg ctg aag ttc ctg ggc atc ttc aac acc ggc ctg aag atg ttc ccc gac ctg acc aag gtg tac tct acc gac atc ttc ttc atc ctg gaa atc aca gac aac ccc tac atg acc agc att ccc gtg aac gcc ttc cag ggc ctg tgc aac gaa acc ctg aca ctg aag ctg tac aac aac ggc ttc acc tcc gtg cag ggc tac gcc ttc aat ggc acc aag ctg gat gcc gtg tac ctg aac aag aac aag tac ctg acc gtg atc gac aag gac gcc ttc ggc gga gtg tac tct gga cct tct ctg ctg gat gtg tcc cag acc tct gtg acc gct ctg ccc tct aaa ggc ctg gaa cac ctg aaa gaa ctg atc gcc cgg aac aca tgg act ctg aag aag ctg cct ctg agc ctg tcc ttc ctg cac ctg acc aga gcc gac ctg agc tac cct tct cac tgc tgc gcc ttc aag aac cag gcg aag ccc acc acg acg cca gcg ccg cga cca cca aca ccg gcg ccc acc atc gcg tcg cag ccc ctg tcc ctg cgc cca gag gcg tgc cgg cca gcg gcg ggg ggc gca gtg cac acg agg ggg ctg gac ttc gcc tgt gat atc tac atc tgg gcg ccc ttg gcc ggg act tgt ggg gtc ctt ctc ctg tca ctg gtt atc acc ctt tac tgc aaa cgg ggc aga aag aaa ctc ctg tat ata ttc aaa caa cca ttt atg aga cca gta caa act act caa gag gaa gat ggc tgt agc tgc cga ttt cca gaa gaa gaa gaa gga gga tgt gaa ctg aga gtg aag ttc agc agg agc gca gac gcc ccc gcg tac cag cag ggc cag aac cag ctc tat aac gag ctc aat cta gga cga aga gag gag tac gat gtt ttg gac aag aga cgt ggc cgg gac cct gag atg ggg gga aag ccg aga agg aag aac cct cag gaa ggc ctg tac aat gaa ctg cag aaa gat aag atg gcg gag gcc tac agt gag att ggg atg aaa ggc gag cgc cgg agg ggc aag ggg cac gat ggc ctt tac cag ggt ctc agt aca gcc acc aag gac acc tac gac gcc ctt cac atg cag gcc ctg ccc cct cgc taa SEQ ID NO: 15 Amino acid sequence of CAAR antigen domain: EcTSHR AA M22-Q289 MGCSSPPCE CHQEEDFRVT CKDIQRIPSL PPSTQTLKLI ETHLRTIPSH AFSNLPNISR IYVSIDVTLQ QLESHSFYNL SKVTHIEIRN TRNLTYIDPD ALKELPLLKF LGIFNTGLKM FPDLTKVYST DIFFILEITD NPYMTSIPVN AFQGLCNETL TLKLYNNGFT SVQGYAFNGT KLDAVYLNKN KYLTVIDKDA FGGVYSGPSL LDVSQTSVTA LPSKGLEHLK ELIARNTWTL KKLPLSLSFL HLTRADLSYP SHCCAFKNQ SEQ ID NO: 16 Coding sequence of the amino acid sequence of SEQ ID NO: 15 atg gga tgt agc tct cca cct tgc gag tgc cac caa gaa gag gac ttc cgg gtc aca tgc aag gac atc cag aga atc ccc agc ctg cct cct agc aca cag acc ctg aag ctg atc gag aca cac ctg aga aca atc cct agc cac gcc ttc tcc aac ctg cct aac atc tcc cgg atc tac gtg tcc atc gac gtg acc ctg cag cag ctg gaa tcc cac agc ttc tac aac ctg tcc aaa gtg acc cac atc gag atc cgg aac acc cgg aac ctg acc tac atc gac ccc gac gct ctg aaa gag ctg ccc ctg ctg aag ttc ctg ggc atc ttc aac acc ggc ctg aag atg ttc ccc gac ctg acc aag gtg tac tct acc gac atc ttc ttc atc ctg gaa atc aca gac aac ccc tac atg acc agc att ccc gtg aac gcc ttc cag ggc ctg tgc aac gaa acc ctg aca ctg aag ctg 45 tac aac aac ggc ttc acc tcc gtg cag ggc tac gcc ttc aat ggc acc aag ctg gat gcc gtg tac ctg aac aag aac aag tac ctg acc gtg atc gac aag gac gcc ttc ggc gga gtg tac tct gga cct tct ctg ctg gat gtg tcc cag acc tct gtg acc gct ctg ccc tct aaa ggc ctg gaa cac ctg aaa gaa ctg atc gcc cgg aac aca tgg act ctg aag aag ctg cct ctg agc ctg tcc ttc ctg cac ctg acc aga gcc gac ctg agc tac cct tct cac tgc tgc gcc ttc aag aac cag SEQ ID NO: 17 Nucleic acid sequence of the TSHR-CAAR289plasmid (Fig.14) aatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgcctta caaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattag gaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgt atttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctc tctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgt gtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaat ctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgca ggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaat tttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaatt agatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatag tatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctg tagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatat aatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttag acaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgctgatcttcagac ctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattga accattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtggga ataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgc tgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctat tgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctg gctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcattt gcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacac gacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaa tcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtgga attggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggt aggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccatta tcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtg gagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcgctagcttttaaa agaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatac aaactaaagaattacaaaaacaaattacaaaaattcaaaattttactagtgattatcggatcaactt tgtatagaaaagttgggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgaga agttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaag tgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtc gccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttccc gcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagta cgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaagga gccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggt ggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgc tgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcg gtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcc tgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctgg tctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtga ĴĶ gcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggag agcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtga ctccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtct ttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagtta ggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcat tctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgacaagtttgtaca aaaaagcaggctgccaccatggccttaccagtgaccgccttgctcctgccgctggccttgctgctcc acgccgccaggccgatgggatgtagctctccaccttgcgagtgccaccaagaagaggacttccgggt cacatgcaaggacatccagagaatccccagcctgcctcctagcacacagaccctgaagctgatcgag acacacctgagaacaatccctagccacgccttctccaacctgcctaacatctcccggatctacgtgt ccatcgacgtgaccctgcagcagctggaatcccacagcttctacaacctgtccaaagtgacccacat cgagatccggaacacccggaacctgacctacatcgaccccgacgctctgaaagagctgcccctgctg aagttcctgggcatcttcaacaccggcctgaagatgttccccgacctgaccaaggtgtactctaccg acatcttcttcatcctggaaatcacagacaacccctacatgaccagcattcccgtgaacgccttcca gggcctgtgcaacgaaaccctgacactgaagctgtacaacaacggcttcacctccgtgcagggctac gccttcaatggcaccaagctggatgccgtgtacctgaacaagaacaagtacctgaccgtgatcgaca aggacgccttcggcggagtgtactctggaccttctctgctggatgtgtcccagacctctgtgaccgc tctgccctctaaaggcctggaacacctgaaagaactgatcgcccggaacacatggactctgaagaag ctgcctctgagcctgtccttcctgcacctgaccagagccgacctgagctacccttctcactgctgcg ccttcaagaaccaggcgaagcccaccacgacgccagcgccgcgaccaccaacaccggcgcccaccat cgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggggcgcagtgcacacg agggggctggacttcgcctgtgatatctacatctgggcgcccttggccgggacttgtggggtccttc tcctgtcactggttatcaccctttactgcaaacggggcagaaagaaactcctgtatatattcaaaca accatttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttccagaagaa gaagaaggaggatgtgaactgagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagg gccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagag acgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaat gaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggg gcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttca catgcaggccctgccccctcgctaaacccagctttcttgtacaaagtggtgataatcgaattccgat aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctcctttta cgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcatttt ctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgt ggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagc tcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgc ccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacg tcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcc cttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcg tcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgggaattcccg cggttcgaacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagt tcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgccc aacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcc attgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatat gccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatg accttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgc ggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccc cattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaac tccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctct Ĵķ ggctaactagagaacccactgcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtg cccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagg gcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctg gcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaag cagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaagg acgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcga gctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaac agccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgcc acaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacgg ccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgag aagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagc tgtacaagggctccggagagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccgg ccccatgaaaaagcctgaactcaccgcgacgtctgtcgagaagtttctgatcgaaaagttcgacagc gtctccgacctgatgcagctctcggagggcgaagaatctcgtgctttcagcttcgatgtaggagggc gtggatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgtttatcggca ctttgcatcggccgcgctcccgattccggaagtgcttgacattggggaatttagcgagagcctgacc tattgcatctcccgccgtgcacagggtgtcacgttgcaagacctgcctgaaaccgaactgcccgctg ttctgcagccggtcgcggaggccatggatgcgatcgctgcggccgatcttagccagacgagcgggtt cggcccattcggaccgcaaggaatcggtcaatacactacatggcgtgatttcatatgcgcgattgct gatccccatgtgtatcactggcaaactgtgatggacgacaccgtcagtgcgtccgtcgcgcaggctc tcgatgagctgatgctttgggccgaggactgccccgaagtccggcacctcgtgcacgcggatttcgg ctccaacaatgtcctgacggacaatggccgcataacagcggtcattgactggagcgaggcgatgttc ggggattcccaatacgaggtcgccaacatcttcttctggaggccgtggttggcttgtatggagcagc agacgcgctacttcgagcggaggcatccggagcttgcaggatcgccgcggctccgggcgtatatgct ccgcattggtcttgaccaactctatcagagcttggttgacggcaatttcgatgatgcagcttgggcg cagggtcgatgcgacgcaatcgtccgatccggagccgggactgtcgggcgtacacaaatcgcccgca gaagcgcggccgtctggaccgatggctgtgtagaagtactcgccgatagtggaaaccgacgccccag cactcgtccgagggcaaaggaatagggtacctttaagaccaatgacttacaaggcagctgtagatct tagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatctg ctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactag ggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgtt gtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtagt agttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagagga acttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagc atttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctc tagctatcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgcc ccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccag aagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtatta cgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaat cgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgccctt cccaacagttgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcggg tgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttc ttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttag ggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtag tgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtgga ctcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattt tgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaa aatattaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttat 48 ttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataata ttgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattt tgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtg cacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaaga acgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgcc gggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtca cagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtga taacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcac aacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacg acgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaact acttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccactt ctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctc gcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggg gagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcat tggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaattta aaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgtt ccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgta atctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctac caactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgta gccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctg ttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttac cggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgac ctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagagagaaag gcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaa acgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatg ctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttt tgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccg cctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgagga agcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctgg cacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactc attaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggata acaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcactaaagg gaacaaaagctggagctgcaagctt SEQ ID NO: 18 Amino acid sequence of CD19-CARVB1: segments in the order shown from N- to C-terminus: - first 21 residues: signal peptide: CD8^-leader aa M1-P21; - aa 22 to 269: scFV in regular script; - underlined: CD8^-hinge aa A270-D317; - italics: transmembrane region aa I318-C341; - bold: co-stimulatory domain 4-1BB aa R342-S382; - regular script: signaling domain: CD3zeta aa R383-R494* MALPVTALLL PLALLLHAAR PDIQMTQTTS SLSASLGDRV TISCRASQDI SKYLNWYQQK PDGTVKLLIY HTSRLHSGVP SRFSGSGSGT DYSLTISNLE QEDIATYFCQ QGNTLPYTFG GGTKLEITGS TSGSGKPGSG EGSTKGEVKL QESGPGLVAP SQSLSVTCTV SGVSLPDYGV SWIRQPPRKG LEWLGVIWGS ETTYYNSALK SRLTIIKDNS KSQVFLKMNS LQTDDTAIYY CAKHYYYGGS YAMDYWGQGT 49 SVTVSSAAAA KPTTTPAPRPP TPAPTIASQP LSLRPEACRP AAGGAVHTRG LDFACDIYIW APLAGTCGVL LLSLVITLYC RSKRSRLLHS DYMNMTPRRP GPTRKHYQPY APPRDFAAYR SRVKFSRSAD APAYQQGQNQ LYNELNLGRR EEYDVLDKRR GRDPEMGGKP RRKNPQEGLY NELQKDKMAE AYSEIGMKGE RRRGKGHDGL YQGLSTATKD TYDALHMQAL PPR* SEQ ID NO: 19 Nucleic acid sequence of the CD19-CARVB1plasmid (Fig.16) aatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgcctta caaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattag gaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgt atttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctc tctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgt gtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaat ctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgca ggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaat tttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaatt agatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatag tatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctg tagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatat aatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttag acaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgctgatcttcagac ctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattga accattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtggga ataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgc tgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctat tgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctg gctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcattt gcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacac gacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaa tcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtgga attggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggt aggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccatta tcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtg gagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcgctagcttttaaa agaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatac aaactaaagaattacaaaaacaaattacaaaaattcaaaattttactagtgattatcggatcaactt tgtatagaaaagttgggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgaga agttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaag tgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtc gccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttccc gcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagta cgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaagga gccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggt ggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgc tgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcg gtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcc tgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctgg tctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtga 50 gcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggag agcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtga ctccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtct ttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagtta ggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcat tctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgacaagtttgtaca aaaaagcaggctgccaccatggccttaccagtgaccgccttgctcctgccgctggccttgctgctcc acgccgccaggccggacatccagatgacacagactacatcctccctgtctgcctctctgggagacag agtcaccatcagttgcagggcaagtcaggacattagtaaatatttaaattggtatcagcagaaacca gatggaactgttaaactcctgatctaccatacatcaagattacactcaggagtcccatcaaggttca gtggcagtgggtctggaacagattattctctcaccattagcaacctggagcaagaagatattgccac ttacttttgccaacagggtaatacgcttccgtacacgttcggaggggggactaagttggaaataaca ggctccacctctggatccggcaagcccggatctggcgagggatccaccaagggcgaggtgaaactgc aggagtcaggacctggcctggtggcgccctcacagagcctgtccgtcacatgcactgtctcaggggt ctcattacccgactatggtgtaagctggattcgccagcctccacgaaagggtctggagtggctggga gtaatatggggtagtgaaaccacatactataattcagctctcaaatccagactgaccatcatcaagg acaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagccatttacta ctgtgccaaacattattactacggtggtagctatgctatggactactggggtcaaggaacctcagtc accgtctcctcagcggccgcagcgaagcccaccacgacgccagcgccgcgaccaccaacaccggcgc ccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggggcgcagt gcacacgagggggctggacttcgcctgtgatatctacatctgggcgcccttggccgggacttgtggg gtccttctcctgtcactggttatcaccctttactgcaggagtaagaggagcaggctcctgcacagtg actacatgaacatgactccccgccgccccgggcccacccgcaagcattaccagccctatgccccacc acgcgacttcgcagcctatcgctccagagtgaagttcagcaggagcgcagacgcccccgcgtaccag cagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggaca agagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgta caatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccgg aggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgccc ttcacatgcaggccctgccccctcgctaaacccagctttcttgtacaaagtggtgataatcgaattc cgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctcct tttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttca ttttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggca acgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgt cagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgcc ttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagct gacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctac gtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttc cgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgggaatt cccgcggttcgaacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcat tagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgacc gcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggact ttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatc atatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagta catgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtg atgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctcc accccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaa caactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct ctctggctaactagagaacccactgcgccaccatggtgagcaagggcgaggagctgttcaccggggt 51 ggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggc gagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgc cctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacat gaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttc aaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgca tcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaacta caacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatc cgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcg acggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaa cgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggac gagctgtacaagtaaggtacctttaagaccaatgacttacaaggcagctgtagatcttagccacttt ttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatctgctttttgctt gtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccact gcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactct ggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtc atcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttat tgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttca ctgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatccc gcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctga ctaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgag gaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtattacgcgcgctca ctggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcag cacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagtt gcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggtt acgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcct ttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatt tagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcg ccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttcc aaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttc ggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacg cttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaat acattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaagg aagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctg tttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtggg ttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttcca atgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagc aactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagca tcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcg gccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatggggg atcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtga caccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactcta gcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcgg cccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcat tgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggca actatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgt cagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatcta ggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcg tcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgct 52 tgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttt tccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagtta ggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtgg ctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggc gcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaa ctgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagagagaaaggcggacaggt atccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggta tctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggg gggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcctt ttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagag cgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggt ttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcacc ccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcac acaggaaacagctatgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagc tggagctgcaagctt SEQ ID NO: 20 Amino acid sequence of CD19-CARVB2: segments in the order shown from N- to C-terminus: - first 21 residues: signal peptide: CD8^-leader aa M1-P21; - aa 22 to 269: scFV in regular script; - underlined: CD8^-hinge aa I270-P308; - italics: transmembrane region aa F309-V335; - bold: co-stimulatory domain 4-1BB aa K336-L377; - regular script: signaling domain: CD3zeta aa R378-R398* MALPVTALLL PLALLLHAAR PDIQMTQTTS SLSASLGDRV TISCRASQDI SKYLNWYQQK PDGTVKLLIY HTSRLHSGVP SRFSGSGSGT DYSLTISNLE QEDIATYFCQ QGNTLPYTFG GGTKLEITGS TSGSGKPGSG EGSTKGEVKL QESGPGLVAP SQSLSVTCTV SGVSLPDYGV SWIRQPPRKG LEWLGVIWGS ETTYYNSALK SRLTIIKDNS KSQVFLKMNS LQTDDTAIYY CAKHYYYGGS YAMDYWGQGT SVTVSSAAAI EVMYPPPYLD NEKSNGTIIH VKGKHLCPSP LFPGPSKPFW VLVVVGGVLA CYSLLVTVAF IIFWVKRGRK KLLYIFKQPF MRPVQTTQEE DGCSCRFPEE EEGGCELRVK FSRSADAPAY QQGQNQLYNE LNLGRREEYD VLDKRRGRDP EMGGKPRRKN PQEGLYNELQK DKMAEAYSEIG MKGERRRGKG HDGLYQGLSTA TKDTYDALHM QALPPR* SEQ ID NO: 21 Nucleic acid sequence of the CD19-CARVB2plasmid (Fig.17) gtatcgctagcttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagaca taatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttactag tgattatcggatcaactttgtatagaaaagttgctgcagccccgataaaataaaagattttatttag tctccagaaaaaggggggaatgaaagaccccacctgtaggtttggcaagctagctgcagtaacgcca ttttgcaaggcatggaaaaataccaaaccaagaatagagaagttcagatcaagggcgggtacatgaa aatagctaacgttgggccaaacaggatatctgcggtgagcagtttcggccccggcccggggccaaga acagatggtcaccgcagtttcggccccggcccgaggccaagaacagatggtccccagatatggccca accctcagcagtttcttaagacccatcagatgtttccaggctcccccaaggacctgaaatgaccctg cgccttatttgaattaaccaatcagcctgcttctcgcttctgttcgcgcgcttctgcttcccgagct ctataaaagagctcacaacccctcactcggcgcgccagtcctccgacagactgagtcgcccgggcaa 53 gtttgtacaaaaaagcaggctgccaccatggccttaccagtgaccgccttgctcctgccgctggcct tgctgctccacgccgccaggccggacatccagatgacacagactacatcctccctgtctgcctctct gggagacagagtcaccatcagttgcagggcaagtcaggacattagtaaatatttaaattggtatcag cagaaaccagatggaactgttaaactcctgatctaccatacatcaagattacactcaggagtcccat caaggttcagtggcagtgggtctggaacagattattctctcaccattagcaacctggagcaagaaga tattgccacttacttttgccaacagggtaatacgcttccgtacacgttcggaggggggactaagttg gaaataacaggctccacctctggatccggcaagcccggatctggcgagggatccaccaagggcgagg tgaaactgcaggagtcaggacctggcctggtggcgccctcacagagcctgtccgtcacatgcactgt ctcaggggtctcattacccgactatggtgtaagctggattcgccagcctccacgaaagggtctggag tggctgggagtaatatggggtagtgaaaccacatactataattcagctctcaaatccagactgacca tcatcaaggacaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagc catttactactgtgccaaacattattactacggtggtagctatgctatggactactggggtcaagga acctcagtcaccgtctcctcagcggccgcaattgaagttatgtatcctcctccttacctagacaatg agaagagcaatggaaccattatccatgtgaaagggaaacacctttgtccaagtcccctatttcccgg accttctaagcccttttgggtgctggtggtggttggtggagtcctggcttgctatagcttgctagta acagtggcctttattattttctgggtgaaacggggcagaaagaaactcctgtatatattcaaacaac catttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttccagaagaaga agaaggaggatgtgaactgagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggc cagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagac gtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatga actgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggc aaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcaca tgcaggccctgccccctcgctaaacccagctttcttgtacaaagtggtgataatcgaattccgataa tcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacg ctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttct cctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtgg cgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctc ctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgccc gctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtc ctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtccct tcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtc ttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgggaattcccgcg gttcgaacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttc atagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaa cgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccat tgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgc caagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgac cttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcgg ttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccacccca ttgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactc cgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctgg ctaactagagaacccactgcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcc catcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggc gatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggc ccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagca gcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggac gacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagc tgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacag 54 ccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccac aacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggcc ccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaa gcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctg tacaagggctccggagagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccggcc ccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcac cctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgag cgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcg cggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgc cgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggc ctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgacc accagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggt gcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtc accgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgag gtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggg gactggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctg gttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataa agcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccc tcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagta tttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatggt tacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtg gtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgccc atcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttattt atgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggagg cctagggacgtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttac aacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgc cagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggc gaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccg ctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgc cggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcac ctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggttt ttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacact caaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaa aatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttaggtgg cacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtat ccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattc aacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccaga aacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggat ctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcactttta aagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcat acactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatg acagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctga caacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgcct tgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgta gcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaat taatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctg gtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggcca gatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaa 55 atagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactc atatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatccttttt gataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaa agatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacc accgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggc ttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaaga actctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcga taagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctga acggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagc gtgagctatgagaaagcgccacgcttcccgaagagagaaaggcggacaggtatccggtaagcggcag ggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtc gggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatgga aaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctt tcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgc cgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaac cgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacacttt atgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatg accatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctgcaagctta atgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttac aaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattagg aaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgta tttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctgggagctct ctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtg tgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatc tctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcag gactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaatt ttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaatta gatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagt atgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgt agacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatata atacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttaga caagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgctgatcttcagacc tggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaa ccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaa taggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgct gacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctatt gaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctgg ctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttg caccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacg acctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaat cgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaa ttggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggta ggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattat cgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtgg agagagagacagagacagatccattcgattagtgaacggatctcgacg 56 REFERENCES Aghajanian, H., Rurik, J.G. and Epstein, J.A. (2022), “CAR-based therapies: opportunities for immuno-medicine beyond cancer”, Nature Metabolism, Vol.4 No.2, pp.163–169, doi: 10.1038 / s42255-022-00537-5. Bartalena, L. (2013), “Diagnosis and management of Graves disease: a global overview”, Nature Reviews Endocrinology, Vol.9 No.12, pp.724–734, doi: 10.1038 / nrendo.2013.193. Bartalena, L., Piantanida, E., Gallo, D., Ippolito, S. and Tanda, M.L. (2022), “Management of Graves’ hyperthyroidism: present and future”, Expert Review of Endocrinology & Metabolism, Vol.17 No.2, pp.153–166, doi: 10.1080 / 17446651.2022.2052044. Crotty, S. (2015), “A brief history of T cell help to B cells”, Nature Publishing Group, Vol.15 No. 3, pp.185–189, doi: 10.1038 / nri3803. Duan, H., Jiang, Z., Chen, L., Bai, X., Cai, H., Yang, X. and Huang, H. (2023), “TSHR-based chimeric antigen receptor T cell specifically deplete auto-reactive B lymphocytes for treatment of autoimmune thyroid disease.”, International Immunopharmacology, Vol.124 No. Pt A, p.110873, doi: 10.1016 / j.intimp.2023.110873. Faust, B., Billesbølle, C.B., Suomivuori, C.-M., Singh, I., Zhang, K., Hoppe, N., Pinto, A.F.M., et al. (2022), “Autoantibody mimicry of hormone action at the thyrotropin receptor”, Nature, Vol. 609 No.7928, pp.846–853, doi: 10.1038 / s41586-022-05159-1. Furmaniak, J., Sanders, J., Young, S., Kabelis, K., Sanders, P., Evans, M., Clark, J., et al. (2011), “In vivo effects of a human thyroid-stimulating monoclonal autoantibody (M22) and a human thyroid-blocking autoantibody (K1-70)”, Auto-Immunity Highlights, Vol.3 No.1, pp. 19–25, doi: 10.1007 / s13317-011-0025-9. Ghobadi A, Bachanova V, Patel K, Park JH, Flinn I, Riedell PA, Bachier C, et al. (2025) Induced pluripotent stem-cell-derived CD19-directed chimeric antigen receptor natural killer cells in B- cell lymphoma: a phase 1, first-in-human trial. Lancet 405(10473):127-136. doi: 10.1016 / S0140-6736(24)02462-0 Hansen, M., Johnson, A., Weber, K.S. and O’Neill, K.L. (2023), “Characterizing the Interplay of Lymphocytes in Graves’ Disease”, International Journal of Molecular Sciences, Vol.24 No. 7, p.6835, doi: 10.3390 / ijms24076835. Hill, J.A., Li, D., Hay, K.A., Green, M.L., Cherian, S., Chen, X., Riddell, S.R., et al. (2018), “Infectious complications of CD19-targeted chimeric antigen receptor–modified T-cell immunotherapy”, Blood, Vol.131 No.1, pp.121–130, doi: 10.1182 / blood-2017-07-793760. 57 June, C.H., O’Connor, R.S., Kawalekar, O.U., Ghassemi, S. and Milone, M.C. (2018), “CAR T cell immunotherapy for human cancer”, Science, Vol.359 No.6382, pp.1361–1365, doi: 10.1126 / science.aar6711. Laskowski TJ, Biederstädt A, Rezvani K (2022). Natural killer cells in antitumour adoptive cell immunotherapy. Nat Rev Cancer 22(10):557-575 Lee, A.C.H. and Kahaly, G.J. (2020), “Novel Approaches for Immunosuppression in Graves’ Hyperthyroidism and Associated Orbitopathy”, European Thyroid Journal, Vol.9 No. Suppl 1, pp.17–30, doi: 10.1159 / 000508789. Menconi, F., Marcocci, C. and Marinò, M. (2014), “Diagnosis and classification of Graves’ disease”, Autoimmunity Reviews, Vol.13 No.4–5, pp.398–402, doi: 10.1016 / j.autrev.2014.01.013. Menconi, F., Marcocci, C. and Marinò, M. (2014), “Diagnosis and classification of Graves’ disease”, Autoimmunity Reviews, Vol.13 No.4–5, pp.398–402, doi: 10.1016 / j.autrev.2014.01.013. Müller, F., Taubmann, J., Bucci, L., Wilhelm, A., Bergmann, C., Völkl, S., Aigner, M., et al. (2024), “CD19 CAR T-Cell Therapy in Autoimmune Disease — A Case Series with Follow- up”, New England Journal of Medicine, Vol.390 No.8, pp.687–700, doi: 10.1056 / nejmoa2308917. Nezhad, M.S., Seifalian, A., Bagheri, N., Yaghoubi, S., Karimi, M.H. and Adbollahpour- Alitappeh, M. (2020), “Chimeric Antigen Receptor Based Therapy as a Potential Approach in Autoimmune Diseases: How Close Are We to the Treatment?”, Frontiers in Immunology, Vol. 11, p.603237, doi: 10.3389 / fimmu.2020.603237. Tomasik, J., Jasiński, M. and Basak, G.W. (2022), “Next generations of CAR-T cells - new therapeutic opportunities in hematology?”, Frontiers in Immunology, Vol.13, p.1034707, doi: 10.3389 / fimmu.2022.1034707. Weetman, A.P. (2000), “Graves’ Disease”, The New England Journal of Medicine, Vol.343 No. 17, pp.1236–1248, doi: 10.1056 / nejm200010263431707. Zhou, F., Wang, X., Wang, L., Sun, X., Tan, G., Wei, W., Zheng, G., et al. (2022), “Genetics, Epigenetics, Cellular Immunology, and Gut Microbiota: Emerging Links With Graves’ Disease”, Frontiers in Cell and Developmental Biology, Vol.9, p.794912, doi: 10.3389 / fcell.2021.794912.

Claims

58 Claims 1. A chimeric protein comprising the following segments from the N-terminus to the C- terminus: (i) optionally a signal peptide, (ii) an extracellular domain of human thyroid-stimulating hormone receptor (TSHR), said domain lacking a C-terminal segment comprising at least the segment from amino acid residue 301 to 413 of SEQ ID NO: 1, (iii) optionally a hinge region, (iv) a transmembrane domain, and (v) at least one intracellular domain.

2. The chimeric protein according to claim 1, wherein said protein and said extracellular domain lack a C-terminal segment comprising at least the segment from amino acid residue 295 to 413 of SEQ ID NO: 1, preferably said protein and said extracellular domain lack the C-terminal segment from amino acid residue 290 to 413 of SEQ ID NO:

1.

3. A chimeric protein comprising the following segments from the N-terminus to the C- terminus: (i) optionally an N-terminal signal peptide, (ii) an extracellular domain of human TSHR, wherein said extracellular domain consists of a segment starting with amino acid residue number 30 or lower of SEQ ID NO: 1 and extends at least to amino acid residue 280 and at most up to amino acid residue number 300 of SEQ ID NO: 1, (iii) optionally a hinge region, (iv) a transmembrane domain, and (v) at least one intracellular domain.

4. The chimeric protein according to any one of claims 1 to 3, wherein said hinge region is or comprises the CD8^-hinge region of SEQ ID NO: 3 or any other hinge region derived from IgG1, IgG4 or CD28; and / or wherein said transmembrane domain is the CD8^ transmembrane domain of SEQ ID NO: 5 or any other transmembrane domain derived from CD3^(zeta), CD4, ICOS or CD28, and / or59 wherein said at least one intracellular domain is selected from intracellular domains of CD3^(zeta), CD28 IC domain, 4-1BB (CD237) IC domain, OX40 (CD134) IC, ICOS, CD27, MYD88-CD40, KIRD2DS2 domain, preferably is or comprises the amino acid sequence of SEQ ID NO: 7 and / or SEQ ID NO:

9.

5. The chimeric protein according to any one of claims 1 to 4, comprising an N-terminal signal peptide, such as the CD8^-leader sequence of SEQ ID NO:

11.

6. The chimeric protein according to any one of claims 1 to 5, for use in treating an autoimmune thyroid diseases, such as Graves’ disease including Graves’ orbitopathy and other Graves’ disease related manifestations.

7. A nucleic acid molecule encoding a chimeric protein according to any one of claims 1 to 6, such as the nucleic acid molecule of the nucleotide sequence of SEQ ID NO: 14, wherein said nucleic acid molecule may be a DNA molecule or an RNA molecule or comprises ribonucleotides, preferably said nucleic acid molecule is an mRNA molecule.

8. A vector, such as a viral vector, being or comprising a nucleic acid molecule according to claim 7 or encoding the chimeric protein according to any one of claims 1 to 6.

9. Lipid nanoparticle (LNP) comprising the nucleic acid molecule according to claim 7 or the vector according to claim 8, preferably said nucleic acid molecule is an RNA molecule and said LNP contains said RNA molecule embedded therein.

10. The nucleic acid molecule according to claim 7 or the vector according to claim 8 or the lipid nanoparticle according to claim 9 for use in treating an autoimmune thyroid disease, such as Graves’ disease.

11. A eukaryotic cell comprising the nucleic acid molecule according to claim 7, or the vector according to claim 8, or the lipid nanoparticle according to claim 9, or the chimeric protein according to any one of claims 1 to 6, wherein said cell contains or is capable of expressing said chimeric protein according to any one of claims 1 to 6.

12. The eukaryotic cell according to claim 11, wherein said nucleic acid molecule is a nuclear DNA, such as a chromosome; or wherein said eukaryotic cell comprises the nucleic acid molecule according to claim 7 introduced via gene editing into a nuclear60 DNA, such as a chromosome; or wherein said nucleic acid molecule is RNA, such as mRNA.

13. The eukaryotic cell according to claim 11 or 12, which is a human immune cell, such as a T cell, a natural killer cell, a macrophage, a human induced pluripotent stem (hiPS) cell-derived cell, an autologous immune cell, or an allogenic immune cell.

14. The eukaryotic cell according to claim 13, which is a NK cell.

15. The eukaryotic cell according to any one of claims 11 to 14, for use in treating an autoimmune thyroid disease, such as Graves’ disease, such as Graves’ orbitopathy and other Graves’ disease related manifestations.

Images