Synthetic nucleic acid and therapeutic uses thereof
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-02
- Publication Date
- 2026-03-11
AI Technical Summary
Current mRNA-based therapeutic approaches face challenges in optimizing the stability and cellular internalization of mRNA molecules, which affects their translation efficiency and longevity within cells, particularly in therapeutic applications such as vaccine development and gene therapy.
The use of specific combinations of untranslated regions (UTRs) from genes like beta-globin, alpha-globin, rotavirus VP6, and manganese superoxide dismutase, along with modified poly(A) or poly(AG) tails, to enhance the stability and translation efficiency of synthetic mRNA molecules by incorporating these sequences into the 5' and 3' UTRs of the mRNA, thereby improving protein expression.
These combinations significantly increase protein expression levels and stability of mRNA molecules in various cell types, including human cancer cells and dendritic cells, leading to enhanced therapeutic efficacy and prolonged translation of proteins of interest.
Smart Images

Figure FR2024050571_14112024_PF_FP_ABST
Abstract
Description
[0001]SYNTHETIC NUCLEIC ACID AND ITS THERAPEUTIC USES DESCRIPTION TECHNICAL FIELD OF THE INVENTION The present invention relates to the field of nucleic acids and in particular messenger RNA for therapeutic purposes. STATE OF THE ART The concept of gene therapy emerged in the 1960s with the development of molecular biology. Gene therapy is a strategy that consists of introducing nucleic acids into the cells of an organism to treat a disease linked to a defective, mutant allele. This approach has evolved: in addition to the strategy of restoring defective genetic activity, it now also concerns any in situ production of additional activity, from an exogenous nucleic acid, likely to have a therapeutic impact.Among the nucleic acids used in the therapeutic field, we can cite deoxyribonucleic acid "DNA" (double and single-stranded) and ribonucleic acid "RNA" (single-stranded, comprising uracil instead of thymine in DNA). Due to its physicochemical and physiological properties, RNA is a particularly powerful molecular biology tool for targeting genes of interest and / or for the expression of exogenous proteins. The technical obstacles linked to its instability and its sensitivity to RNAses degradation proteins have been overcome, and today, many therapeutic formulations targeting RNA and / or based on RNA are approved. The review (Zhu et al., 2022) presents the different types of RNAs used in research and human therapy: antisense oligonucleotides that specifically inhibit the translation of an RNA into protein; interfering RNAs that cause the degradation of RNA molecules; guide RNAs that direct the endonucleases known as "molecular scissors" of the CRISPR - Cas system to the genes that need to be modified; aptamers capable of interacting with proteins; and messenger RNAs (mRNAs) allowing the in situ translation into proteins of the genetic information they encode. For the use of mRNA in therapy, it is important to optimize the stability of the mRNA molecule used, to promote its proper cellular internalization and translation. The adjustment parameters are the chemical formulation of the molecule (modified nucleotides, addition of untranslated sequences), possible complexation with chemical agents, and the excipients used in the administration formulation.In 2020, the emergence of COVID-19 disease linked to infection by the SARS-CoV-2 coronavirus led to the accelerated development of mRNA-based vaccines. In particular, the BNT162b2 vaccine developed by Pfizer-BioNTech (Lamb, 2021), as well as the mRNA-1273 vaccine from Moderna (Baden et al., 2021), have proven their clinical efficacy. Both vaccines use an ionized lipid-based formulation encompassing synthetic mRNA molecules comprising modified nucleosides, encoding a pre-fusion form of the coronavirus Spike protein. mRNA vaccines are also being developed for cancer treatment: more than 20 vaccine candidates are currently in clinical trials for the treatment of various solid tumors. In most cases, these mRNA vaccines are administered concomitantly with immune checkpoint modulators, or cytokine cocktails.Therapeutic messenger RNA (mRNA) is a highly advanced technology that requires the production of sequence-optimized mRNA and its complexation with a chemical agent for proper cellular internalization. The conventional process of mRNA translation in eukaryotic cells relies on a ribosome scanning mechanism, starting with a cap located at the 5' end, which scans the mRNA until the first start codon. Another process, used by viruses, involves sequences called IRES (Internal Ribosome Entry Site) that allow recruitment of the ribosome at the start codon, independently of the presence of the cap and the scanning mechanism. Synthetic mRNAs used in therapy generally have a poly(A) tail, a sequence located downstream (3') of the coding sequence, which protects the RNA molecule from degradation by RNAse enzymes.In addition to these elements, therapeutic mRNAs generally include untranslated nucleotide sequences called UTRs for Untranslated Regions located upstream (5'UTR) and / or downstream (3'UTR) of the coding sequence. The use of such untranslated sequences, in 5' and / or 3', to prolong and / or increase the translation into protein of an mRNA in transformed cells, has been proposed in particular in the European patent application EP3494982. The review by (Uchida et al., 2020) presents this strategy to increase the translation efficiency and half-life of synthetic mRNAs, which consists of including UTR sequences from genes whose mRNA is highly translated and exhibits stability, such as the alpha-globin, beta-globin, albumin, complement factor 3 or cytochrome CYP2E1 gene.These untranslated sequences include: - The 5'UTR and 3'UTR sequences of human beta-globin as described in the article (Babendure et al., 2006), international application WO2014186334 and patent EP0737750; - The 5' UTR sequence of one of the HBA1 or HBA2 genes of human alpha-globin (the 5'UTR sequence is identical in both genes); - The 5'NeoUTR3 element, a synthetic element described in the article by (Cao et al., 2021) and in patent application US 2020 / 0066375. This is an element selected from a library of 12,000 synthetic UTRs after their functional evaluation; - The 5'UTR4 element, a synthetic element described in the article (Linares-Fernandez et al., 2021); - The 3'mtRNR1 AES sequence, composed of two segments: one from human mitochondrial 12S rRNA (mtRNR1) and the other derived from the human AES / TLE5 gene (AES)(Von Niessen A et al., 2019); - The 3'UTR sequence of the rotavirus viral VP6 gene, isolated and characterized by Yang and colleagues (Yang et al., 2004); and - The 3'UTR sequence of the gene coding for manganese superoxide dismutase (MnSOD), whose effects on mRNA translation were described in the article by (Chung et al., 1998). These untranslated elements are used in particular for mRNAs used in vaccine compositions. This is particularly the case for vaccines developed against the SARS-CoV-2 coronavirus, inducing the disease known as COVID-19. In particular, the BNT162b2 vaccine developed by Pfizer and BioNTech (Xia, 2021) comprises an mRNA comprising an open reading frame (ORF) encoding a pre-fusion version of the SARS-CoV-2 Spike protein, said ORF being flanked by the following elements: - 5'UTR from the human alpha-globin gene, with a minor modification in the consensus Kozak sequence; and - 3'UTR mtRNR1 AES.This particular combination of 5'UTR and 3'UTR elements used in this vaccine is considered to be a reference combination, allowing to obtain a maximum translation of the mRNA thus constructed. Another reference construction is the association of the 5'UTR element of human beta-globin with the 3'UTR element mtRNR1 AES. The inventors tested other untranslated elements, in particular including other 3'UTR elements, which allow to obtain a level of translation much higher than that observed for the combination 5'UTR of the human beta-globin gene, and 3'UTR mtRNR1 AES. In addition, the inventors tested several types of heterologous poly(A) tail type sequences, in particular poly(AG) or poly(G), which allow to increase the stability of the synthetic nucleic acid of the invention.DISCLOSURE OF THE INVENTION The present invention relates to a synthetic nucleic acid comprising, in the 5'-3' direction, the following elements: a) at least one 5'UTR untranslated element, selected from the 5'UTR of the human beta-globin gene (SEQ ID NO. 4), the synthetic element 5'NeoUTR3 (SEQ ID NO. 5), the 5'UTR of the human alpha-globin gene (SEQ ID NO. 6), and the synthetic element 5'UTR4 (SEQ ID NO. 7), b) an open reading frame (ORF), and c) at least one 3'UTR untranslated element, selected from the 3'UTR element of the rotavirus VP6 gene (SEQ ID NO. 1) and the 3'UTR element of a manganese superoxide dismutase (MnSOD) gene. The present invention also relates to an expression vector comprising the synthetic nucleic acid as described above.The present invention also relates to a host cell comprising the synthetic nucleic acid or the expression vector as described above, with the exception of a human embryonic stem cell. Also a subject of the invention is a pharmaceutical or vaccine composition comprising a synthetic nucleic acid as described above in a suitable pharmaceutical vehicle, and optionally one or more excipients, and / or one or more adjuvants. The present invention also relates to a synthetic nucleic acid as described above, for its use as a medicament. The present invention also relates to a synthetic nucleic acid as described above for its use in various applications, for example in the treatment or prevention of bone disorders.Finally, the present invention also relates to the in vitro use of the synthetic nucleic acid as described above to increase and / or prolong the translation of a protein of interest from this nucleic acid, within a host cell having integrated said nucleic acid as defined above. DESCRIPTION OF THE FIGURES Figure 1 represents the expression kinetics of mRNA coding for nanoluciferase with different combinations of UTRs, introduced into three different cell types.The tested combinations are as follows: - 5'β-3'MT = 5'UTR of human beta-globin and 3'UTR of mtRNR1 AES - 5'β-3'Rota = 5'UTR of human beta-globin and 3'UTR of rotavirus VP6 gene - 5'β-3'MnSOD = 5'UTR of human beta-globin and 3'UTR of rat MnSOD gene - 5'NeoUTR3-3'MT = synthetic element 5'NeoUTR3 and 3'UTR of mtRNR1 AES - 5'NeoUTR3-3'Rota = synthetic element 5'NeoUTR3 and 3'UTR of rotavirus VP6 gene - 5'NeoUTR3-3'MnSOD = synthetic element 5'NeoUTR3 and 3'UTR of rat MnSOD [Fig. 1A] Expression kinetics in human HeLa cancer cells [Fig. 1B] Expression kinetics in murine DC2.4 dendritic cells [Fig. 1C] Expression kinetics in murine C2C12 myoblasts.Figure 2 represents the relative expression of mRNAs encoding nanoluciferase surrounded by specific UTR sequences, compared to the “standard” mRNA comprising the untranslated elements 5’UTRβglo and the 3’UTR MT, over time in three cell types. Expression levels are normalized to the expression level measured for the standard mRNA. [Fig. 2A] Expression over time in HeLa human cancer cells [Fig. 2B] Expression over time in DC2.4 murine dendritic cells [Fig. 2C] Expression over time in C2C12 murine myoblasts Figure 3 represents the stability of the polyadenylated tail on the different plasmids. Figure 4 represents the expression kinetics of the different mRNAs in C2C12 cells. Figure 5 represents the total production of nanoluciferase by the different mRNAs in C2C12 cells. Figure 6 represents the expression kinetics of different mRNAs in HeLa cells.Figure 7 represents the nanoluciferase production by the different mRNAs in HeLa cells. Figure 8 represents the total nanoluciferase production by the different mRNAs in HeLa cells, with mRNAs capped with ARCA or Cleancap AG analogues. Figure 9 represents the expression kinetics of the different mRNAs in DC2.4 cells. Figure 10 represents the total nanoluciferase production by the different mRNAs in DC 2.4 cells. Figure 11 represents the total nanoluciferase production by the different mRNAs in DC 2.4 cells, with mRNAs capped with ARCA or Cleancap AG analogues. Figure 12 represents the expression of the different mRNAs in MoDCs 24h after transfection. Figure 13 represents the comparison of the expression of the different mRNAs in MoDCs 24h after transfection, with ARCA or Cleancap AG cap. Figure 14 represents the intracellular stability of mRNAs with different 3'UTR sequences.A) Intracellular stability in HeLA cells, B) Intracellular stability in DC2.4 cells. Figure 15 represents the immunogenicity of the 3'UTR sequences in DC2.4 cells measured by RT-qPCR. Figure 16 represents the expression kinetics (A) and total protein production (B) after transfection with mRNA with 5'UTR α-globin and 3'UTR AES-mtRNR1 in combination with either the A110 tail or the Tail X tail in DC2.4 cells. Figure 17 represents the expression kinetics (A) and total protein production (B) after transfection with mRNA with 5'UTR α-globin and 3'UTR AES-mtRNR1 in combination with either the A110 tail or the Tail X tail in HeLa cells. Figure 18 shows the kinetics (A) and total protein production (B) after transfection with mRNA without 5'UTR and with 3'UTR, VP6 or MnSOD in HeLa cells. The control is the mRNA construct with 3'UTR AES-MT.Figure 19 shows the kinetics (A) and total protein production (B) after transfection with mRNA without 5'UTR and with 3'UTR, VP6 or MnSOD in DC2.4 cells. The control is the mRNA construct with 3'UTR AES-MT. DETAILED DESCRIPTION OF THE INVENTION A combination of 5'UTR and 3'UTR sequences allowing higher protein expression than "classical" non-coding sequences has been identified. Such combinations of untranslated elements make it possible to increase the expression of proteins for therapeutic purposes, and therefore can improve the efficacy of treatments. According to a first aspect, the present invention relates to a synthetic nucleic acid comprising, in the 5'-3' direction, the following elements: a) at least one 5'UTR untranslated element selected from the 5'UTR of the human beta-globin gene (SEQ ID NO. 4), the synthetic element 5'NeoUTR3 (SEQ ID NO. 5), the 5'UTR of the human alpha-globin gene (SEQ ID NO.6), and the synthetic element 5'UTR4 (SEQ ID NO. 7), b) an open reading frame (ORF), and c) at least one untranslated 3'UTR element, selected from the 3'UTR element of the rotavirus VP6 gene (SEQ ID NO. 1) and the 3'UTR element of the manganese superoxide dismutase (MnSOD) gene. The terms below are defined to better explain the subject of the invention. To designate the 5'UTR and 3'UTR elements, the terms "elements" and "sequences" are used interchangeably. It is indeed clear to the person skilled in the art that these elements are made up of nucleotides and therefore constitute nucleotide sequences. The expression "synthetic nucleic acid" designates, within the meaning of the invention, an isolated double-stranded or single-stranded nucleic acid, obtained by linking different polynucleotides, synthetic or natural. It will preferably be a single-stranded nucleic acid, preferably messenger RNA (mRNA).The term "5'UTR untranslated element" refers to a portion of synthetic nucleic acid that is located 5' (i.e., "upstream") of an open reading frame and that is not translated into protein. This element acts as a translation activator. A 5'UTR element may include elements for controlling gene expression, also called regulatory elements. These regulatory elements may be, for example, ribosome binding sites. The term "open reading frame" or "open reading frame" (ORF) refers to a sequence of several nucleotide triplets that can be translated into a peptide or protein. An open reading frame preferably contains a start codon, i.e., a combination of three consecutive nucleotides generally coding for the amino acid methionine (ATG), at its 5' end and a subsequent region that is generally a multiple of 3 nucleotides in length.An ORF is preferably terminated by a stop codon (e.g., TAA, TAG, TGA). Typically, this is the only stop codon in the open reading frame. The term "3'UTR" refers to a portion of the synthetic nucleic acid molecule that is located 3' (i.e., "downstream") of an open reading frame and is not translated into protein. Typically, a 3'UTR is the portion of an mRNA located between the protein coding region (ORF) and the poly(A) or poly(AG) tail of the nucleic acid. The 3'UTR of the MnSOD gene can be derived from any organism. Indeed, as shown in (Chung et al., 1998), there is a strong sequence identity between the 3'UTR MnSOD elements of the cow, mouse, rat and human genes (see in particular Figure 3 and Table 2 of this article). Thus, depending on the implementation desired by the person skilled in the art, he or she will be able to choose the origin of the 3'UTR MnSOD element.In the present application, the examples presented were carried out with the 3'UTR element derived from the rat gene, having the sequence as shown in SEQ ID NO. 2. According to one implementation of the invention, the 3'UTR element of the MnSOD gene is derived from the rat gene (SEQ ID NO. 2) or from the human gene. According to another implementation of the invention, the synthetic nucleic acid according to the invention is characterized in that it comprises at least one of the following 3'UTR sequences: - the 3'UTR of the VP6 gene of the rotavirus, having the sequence as shown in SEQ ID NO. 1, and - the 3'UTR of the MnSOD gene, And that these 3'UTR elements are combined with 5'UTR elements derived from different organisms. Thus, the 3'UTR element of the rotavirus VP6 gene is not combined with a 5'UTR element from a rotavirus gene; and the 3'UTR element of the rat gene encoding MnSOD is not combined with a 5'UTR element from a rat gene.The synthetic nucleic acid according to the invention comprises at least one 5'UTR element, and at least one 3'UTR element. It is therefore understood that several non-coding elements may be present, upstream and downstream of the ORF. In particular, it is usual to place two identical or different 5'UTR elements "head to tail" upstream of the ORF. According to a particular aspect, the invention corresponds to specific combinations of 5'UTR and 3'UTR sequences. As presented in the examples, these combinations make it possible to obtain a strong expression of the synthetic mRNAs comprising these elements in 3 different cell types, as well as in vivo in mice. One hypothesis is that this strong expression is obtained by an increase in the stability of the mRNA, thanks to the specific combination of these 5'UTR and 3'UTR elements.In particular, the synthetic nucleic acid according to the invention is characterized in that the 5'UTR element is selected from: - the 5'UTR of the human beta-globin gene, having the sequence as presented in SEQ ID NO. 4, - the synthetic element 5'NeoUTR3, having the sequence as presented in SEQ ID NO. 5, - the 5'UTR of the human alpha globin gene, having the sequence as presented in SEQ ID NO. 6, and - the synthetic element 5'UTR4 having the sequence as presented in SEQ ID NO. 7.Thus, the following eight combinations are covered by the invention: - 3' Rota (3'UTR from the VP6 gene of rotavirus) and 5' ^ (5'UTR of the human ^-globin gene), - 3' Rota (3'UTR from the VP6 gene of rotavirus) and 5'NeoUTR3 (synthetic element) - 3' MnSOD (3'UTR from the MnSOD gene) and 5' ^ (5'UTR of the human ^-globin gene), - 3' MnSOD (3'UTR from the MnSOD gene) and 5'NeoUTR3 (synthetic element), - 3' Rota (3'UTR from the VP6 gene of rotavirus) and 5' ^ (5'UTR of the human ^-globin gene), - 3' MnSOD (3'UTR from the MnSOD gene) and 5'NeoUTR3 (synthetic element), - 3' Rota (3'UTR from the VP6 gene of rotavirus) and 5' ^ (5'UTR of the human ^-globin gene), - 3' MnSOD (3'UTR from the MnSOD) and 5' ^ (5'UTR of the human ^-globin gene), - 3' Rota (3'UTR from the rotavirus VP6 gene) and 5'UTR4, - 3'MnSOD (3'UTR of the MnSOD gene) and 5'UTR4.Among these combinations of untranslated elements, the preferred combinations are those comprising the 5' ^ element, i.e. the following combinations: - 3' Rota (3'UTR from the rotavirus VP6 gene) and 5' ^ (5'UTR of the human ^-globin gene), and - 3'MnSOD (3'UTR of the MnSOD gene) and 5' ^ (5'UTR of the human ^-globin gene). In particular, the 3'UTR of the MnSOD gene is from a rat gene or the human gene. A highly preferred combination is that comprising the rat 5' ^ and 3'MnSOD elements, respectively having the sequences SEQ ID NO. 4 and SEQ ID NO. 2 around the ORF. The untranslated elements used in the synthetic nucleic acid of the invention are defined by their origin as well as by their nucleotide sequence. It is however understood that said sequence may vary slightly, in particular be optimized by the replacement of a small percentage of nucleotides, while remaining included in the invention.Thus, for the purposes of the invention, the untranslated elements are defined as follows: - the 5'UTR of the human beta-globin gene has at least 90% sequence identity with the sequence SEQ ID NO. 4, - the synthetic element 5'NeoUTR3 has at least 90% sequence identity with the sequence SEQ ID NO. 5, - the 5'UTR of the human alpha-globin gene has at least 90% sequence identity with the sequence SEQ ID NO. 6, - the synthetic element 5'UTR4 has at least 90% sequence identity with the sequence SEQ ID NO. 7, - the 3'UTR element of the rotavirus VP6 gene has at least 90% sequence identity with the sequence SEQ ID NO. 1, and - the 3'UTR element of the manganese superoxide dismutase (MnSOD) gene from the rat gene has at least 90% sequence identity with the sequence SEQ ID NO. 2.The synthetic nucleic acid according to the invention is preferably a single-stranded nucleic acid, preferably a ribonucleic acid (RNA), and most preferably a messenger RNA (mRNA). According to a preferred embodiment, the synthetic nucleic acid according to the invention is also characterized in that it further comprises, at the 5' end, a cap. A cap is an entity, generally a modified nucleotide, which "caps" the 5' end of a mature mRNA. Many examples of cap structures are known to those skilled in the art, for example caps of the ARCA, Cap0, Cap1 or Cap2 type. According to a preferred implementation, the synthetic nucleic acid according to the invention is characterized in that it further comprises, at the 3' end, a poly(A) tail or a poly(AG) tail. According to this implementation, the nucleic acid is an mRNA.A poly(A) tail or 3'-poly(A) tail is a sequence of adenosine nucleotides, comprising up to about 400 adenosine nucleotides, located at the 3' end of an mRNA. A poly(AG) tail or 3'-poly(AG) tail is a sequence of adenosine and guanine nucleotides, comprising up to about 400 nucleotides, composed of a mixture of adenosines and guanines, in all ratios conceivable by the person skilled in the art. In particular, the poly(AG) tail comprises at least one guanine. In particular, the poly(A) or poly(AG) tail comprises between 100 and 150 nucleotides, in particular comprises 120 nucleotides. The synthetic nucleic acid according to the invention comprises an open reading frame (ORF) coding for a protein of interest. In the examples presented in the experimental section, this protein of interest is nanoluciferase. The person skilled in the art will know how to choose the protein of interest which is most suitable, depending on the intended uses.According to a preferred implementation, the protein of interest is a protein of the Bone Morphogenetic Protein (BMP) family, also called bone morphogenetic protein. These proteins are growth factors involved during embryogenesis. Among them, BMP-2 is involved in the development of bones and cartilage. Thus, according to a particular implementation of the invention, the ORF codes for a BMP protein, preferably BMP2. Among other non-limiting examples of therapeutic applications, we can cite tissue regeneration with mRNAs encoding bone morphogenesis or angiogenesis factors, anticancer vaccination with mRNAs encoding tumor antigens, or coagulation factors or treatment in the context of fibrosis. We can also cite the use of the defined sequences to deliver a healthy copy of a protein to treat orphan diseases such as phenylketonuria.Another subject of the present invention is an expression vector comprising the synthetic nucleic acid as described above. By "expression vector" is meant a vector comprising a nucleic acid molecule encoding a protein of interest and the elements necessary to enable its expression. In particular, the nucleic acid molecule encoding the protein of interest is operably linked to appropriate regulatory sequences, such as a promoter with constitutive or inducible activity. Another subject of the present invention is a host cell comprising the synthetic nucleic acid as described above or the expression vector as described above, with the exception of a human embryonic stem cell. The person skilled in the art knows numerous means for introducing a nucleic acid or a vector into cells, and in particular transfection.The host cells will be chosen according to the intended applications; they will preferably be eukaryotic cells, and preferably mammalian cells, with the exception of a human embryonic stem cell. In the examples presented in the in vitro experimental part, the host cells chosen are the following: - Hela cells, which are human cancer cells, - DC2.4 cells which are murine dendritic cells, and - C2C12 cells, which are murine myoblasts. These cells of various origins and functions illustrate the fact that the synthetic nucleic acid according to the invention can be translated efficiently regardless of the cell type. The host cells will be isolated cells, in in vitro culture, or cells isolated from a living multicellular organism, with the exception of human embryonic stem cells.The host cells may in particular be human primary cells, such as monocytes from blood; human mesenchymal stem cells, or primary cells from surgical waste, with the exception of human embryonic stem cells. According to one implementation of the invention, the host cells may be human primary cells from patients, with the exception of human embryonic stem cells. The present invention also relates to a pharmaceutical or vaccine composition comprising a synthetic nucleic acid according to the invention in a suitable pharmaceutical vehicle, and optionally one or more excipients and / or one or more adjuvants. A "suitable pharmaceutical vehicle" means any vehicle that is acceptable for use in subjects, preferably human beings. The pharmaceutical or vaccine composition is formulated to be administered orally, topically or parenterally to a subject.A vaccine composition is intended for use as a vaccine, i.e., to induce an immune response against a specific antigen in a subject. Vaccination may be prophylactic or therapeutic. The term "excipients" refers to substances other than the active pharmaceutical ingredient (here, the synthetic nucleic acid or the expression vector), which have been evaluated for their absence of toxicity. Many excipients and / or vehicles may be used, for example, water, buffered water, saline solution, glycine solution and their derivatives as well as agents necessary to reproduce physiological conditions, such as, for example, buffering and pH adjusting agents, surfactants such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, this list not being exhaustive.In addition, the pharmaceutical composition may be sterilized by sterilization techniques well known to those skilled in the art. By "adjuvants" is meant substances that can induce and / or enhance the immune response against an antigen when administered to a subject (in this case, in the form of a synthetic nucleic acid or an expression vector). The present invention also relates to a synthetic nucleic acid for use as a medicament. In this embodiment, the synthetic nucleic acid will be administered to a subject, in particular a human being, to treat a symptom or disease. More specifically, when the protein of interest encoded by the synthetic nucleic acid is a BMP protein, the present invention relates to such a synthetic nucleic acid for use in the treatment or prevention of bone or cartilage pathologies.These conditions include osteoarthritis, rheumatoid arthritis, osteoporosis, osteomalacia, bone dystrophies, and bone cancer such as osteosarcoma. Other pathologies may be treated using such synthetic nucleic acids, such as, for example, hemophilia, lysosomal storage diseases, and cystic fibrosis. The protein of interest may also be an antigen. In this case, the invention consists of a synthetic nucleic acid comprising an open reading frame coding for said antigen. A vaccine composition comprising said nucleic acid will be used for the vaccination of subjects (human beings or animals) at risk.The present invention also relates to the in vitro use of the synthetic nucleic acid as described above to increase and / or prolong the translation of a protein of interest from this nucleic acid, within a host cell having integrated said nucleic acid as defined above. EXAMPLES Material and methods 1) Nucleotide sequences of the UTRs and polyA elements used The sequences used are presented in Table 1.Table 1 Sequence Name Nucleotide Sequence SEQ ID NO : 3'UTR Rota tg6 GGACCAAGCTAACAACTTGGTATCCAACTTTGGTGAGTA 1 TGTAGCTATATCAAGCTGTT 3'UTR MnSOD CATATGTGTAAGCATACAGTTATGTTTAATTAAT2 AATGTATTGTTAGGCAACTGTTTGAGAACAGTACATACT TGGTGTGAGCTGCTCTTGATTGAACATTTTCATTAGAG GCTTGAATTGCTTGGACGCTGTCACTGTCATCATAAGGC CATCAAAGATATTCCATCTGTGTTGGGGCCTGTGGG GAGGCTGTAATTCCTGTTCTACTTACTGGGGGGGGCTGTAATCCTGTTGGGCCTGTGGGGGGCTGTAATTCCT CAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGC 3 CACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCA ATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGT TGGTCAATTTCGTGCCAGCCACACC- CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTCTTTT GTCCTGGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCC AGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTC TGCTAGTTCCAGACACCTCC 5'UTR beta-globin ATCCAAAGTTGAGCGTTTATTCTGAGCTTCTGCAAAAAG 4 AACAAGCCG 5'NeoUTR3 ATCTTGTCTCGCTCCGGGGAACGCTCGGAAACTCCCGG 5 CCGCCGCCACCCGCGTCTGTTCTGTTACACAAGGGAAG AAAAGCCGCTGCCGCACTCCGAGTGTCCG 5'UTR alpha-globin GAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAG 6 AGAACCCGACCGCCGAG. ’UTR4CTGAAACACGGTGGAGAGTTTATTGCAAAATAACGCGTC7 CATTCGACA PolyA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 8 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA PolyA / G AAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAGAAAAAA 9 AAAAGAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAGA AAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAGAAAAAAA AAAGAAAAAAAAAAG A110 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACT 10 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A120 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 11 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 2) Cloning of UTR sequences and polyadenylated sequences The UTR sequences were ordered from GENSCRIPT with the addition of 5' and 3' restriction sites. These sequences were inserted by conventional cloning into a plasmid containing a T7 promoter for the production of mRNA by in vitro transcription.The poly(A) (SEQ ID NO: 8, 10, 11) and poly(AG) (SEQ ID NO: 9) sequences were obtained from GENSCRIPT. They contain 5' and 3' restriction sites. These sequences were inserted by conventional cloning after the 3'UTR sequence. These techniques are described in (Sambrook, Joseph. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001). The UTR and polyadenylated sequences were ordered from Genscript. 3) Stability of polyadenylated sequences in bacterial transformants We performed 10 successive subcultures of isolated colonies of E. coli Top10 bacteria (Thermo Fisher) transformed with plasmids with poly(A) tails (SEQ ID NO: 8), A120 (SEQ ID NO: 11), A110 (SEQ ID NO: 10) or AG (SEQ ID NO: 9). Plasmid DNA from colonies of the 10th passage was isolated with the Nucleospin® plasmid kit (Macherey Nagel). The DNA was sequenced by Eurofins.4) In vitro transcription (IVT) For in vitro transcription, plasmids are linearized with a restriction enzyme that cuts after polyadenylated sequences. We used the HighYield T7 RNA Synthesis Kit (Jena Bioscience) for IVT. The reaction conditions are shown in Table 3. IVT was performed with two cap analogs: the ARCA (Anti Reverse Cap Analog) analog or the Cleancap analog. ® (Trilink Biotechnologies). IVT reactions were incubated for 2 hours at 37°C. Table 3: IVT reaction conditions Final concentration or volume Analog ARCA or CleanCap 6 mM ATP / CTP / UTP / GTP 7.5 mM Dithiotrehitol 10 mM Linear template DNA 1 µg Mix with T7 polymerase 2 µL 2X buffer 10 µL PCR grade water X µL Final volume 20 µL After the IVTG reaction, we removed the template DNA using the Turbo ™DNAse (ThermoFisher) following the supplier's protocol. The linear plasmid is then purified using a kit (e.g., Gel & PCR cleanup, Macherey Nagel; Monarch kit ®RNA Cleanup kit, New England Biolabs). The linear fragment is then used for in vitro transcription with kits distributed either by NEW ENGLAND BIOLABS (hiScribe) or by THERMOFISHER (mMessage mMachine). These kits also indicate the purification and quality control procedures for the mRNAs obtained. 5) Cell culture The evaluation of mRNA expression was carried out on the following cell models: - HeLa human cancer cells which are available from ATCC (https: / / www.atcc.org / products / ccl-2), - DC2.4 murine dendritic cells which are available from Merck (https: / / www.merckmillipore.com / FR / fr / product / DC2.4-Mouse-Dendritic-Cell- Line,MM_NF-SCC142), - C2C12 cells which are murine myoblasts available from ATCC (https: / / www.atcc.org / products / crl-1772 ), and - human monocyte-derived dendritic cells (MoDC) were obtained from blood samples from the French Blood Establishment, according to the method described in (Linares-Fernández S et al., Combining an optimized mRNA template with a double purification process allows strong expression of in vitro transcribed mRNA, Mol Ther Nucleic Acids. 2021 Dec 3 :26 :945-956). After monocyte isolation, they were differentiated into MoDC with interleukin 4 (62.5 ng / mL) and granulocyte macrophage colony stimulating factor (75 ng / mL) for 6 days. We confirmed the obtention of CD45+ / CD14- / CD209+ moDC by flow cytometry. 6) Cell culture The cells were cultured in the media recommended by their suppliers; these media and their additives were obtained from MERCK and LONZA.HeLa cells were cultured in Minimum Eagle's Medium (MEM) supplemented with 10% decomplemented fetal bovine serum and containing 100 U / mL penicillin and 100 µg / mL streptomycin (Fischer Bioblock, Illkirch, France). DC2.4 cells were cultured in RPMI 1640 medium (Roswell Park Memory Institute) supplemented with 10% decomplemented fetal bovine serum and containing 100 U / mL penicillin and 100 µg / mL streptomycin (Fischer Bioblock, Illkirch, France). C2C12 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% decomplemented fetal bovine serum and containing 100 U / mL penicillin and 100 µg / mL streptomycin (Fischer Bioblock, Illkirch, France).7) Transfection for introduction of mRNA into cells 24 hours before transfection, cells were cultured in 96-well or 24-well plates at cell densities to achieve 70-80% confluence at the time of transfection. Transfection was performed with 200 ng of mRNA for one well of a 96-well plate and 1 µg of mRNA for one well of a 24-well plate. The mRNAs were complexed with the commercial vector Lipofectamine messengerMAX® distributed by ThermoFisher following the supplier's protocol (https: / / www.thermofisher.com / fr / fr / home / life-science / cell-culture / transfection / transfection-reagents / lipofectamine-messengermax-reagent.html). 8) Nanoluciferase reporter gene expression measurement Nanoluciferase reporter gene expression was measured using a Nano-Glo® Luciferase Assay System kit provided by PROMEGA (https: / / france.promega.com / products / luciferase-assays / reporter-assays / nano_glo-luciferase-assay-system / ?catNum=N1110). Bioluminescence was measured using an IVIS Lumina LT bioimager (Perkin Elmer). 9) Reverse transcription and quantitative PCR Total RNA was extracted with Trizol. ™ (ThermoFisher) and converted to cDNA with the LunaScript™ RT SuperMix Kit (New England Biolabs). For qPCR, we used the Luna qPCR Master mix (New England Biolabs) and a Light Cycler instrument ©480 PCR system (Roche). 10) Cytotoxicity tests We evaluated cell viability after transfection of cells with the different mRNAs formulated with Lipofectamine messengerMAX™ using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay according to the procedure described in (Perche F et al., Enhancement of dendritic cells transfection in vivo and of vaccination against B16F10 melanoma with mannosylated histidylated lipopolyplexes loaded with tumor antigen messenger RNA, Nanomedicine. 2011 Aug;7(4):445-53.). Cell viability was normalized to that of untransfected cells. Example 1. Kinetics of mRNA translation introduced into cells Different cell types were transfected with mRNA constructs encoding the nanoluciferase reporter gene, surrounded by different combinations of untranslated UTR elements. The cell models that were used are: - DC2 cells.4, murine dendritic cells, - Hela cells, human cancer cells, - C2C12 cells, murine myoblasts. The untranslated UTR elements are as follows: - three 3'UTR elements: the 3'UTR mtRNR1-AES abbreviated MT (SEQ ID NO. 3), the 3'UTR MnSOD abbreviated MnSOD (SEQ ID NO. 2) and the 3'UTR derived from Rotavirus abbreviated Rota (SEQ ID NO. 1), and - two 5'UTR elements: the 5'UTR of beta-globin, abbreviated 5'β (SEQ ID NO. 4); and the 5' NeoUTR3 (SEQ ID NO. 5). All six combinations were tested and the results obtained are presented in Figures 1A, 1B and 1C. On Hela cells (Fig 1A), both the 3'UTR Rota and MnSOD sequences allow better expression than the standard 3'UTR MT. We can see in Figure 1B that the 5'β-3'MnSOD combination allows better expression than the 5'β-3'MT and 5'β-3'Rota combinations on DC2.4 cells. No gain in expression was observed on C2C12 cells at 96h.The results obtained at 6h are nevertheless in favor of the 5'β-3'MnSOD combination. (Fig. 1C) The 5'UTRNeo3 element appears to be less effective than the 5'β, on the three types of cells. Example 2. Translation of mRNA into protein The relative expression of mRNAs with different combinations of 3'UTR and 5'UTR elements was compared to that measured with the "standard" mRNA comprising the 5' ^ and 3'MT elements. The results obtained on HeLa cells are summarized in Table 2 below. Table 2 5'UTR 3'UTR Expression Level Expression Level Expression Level at 6h 24h 96h 5' ^ 3'-MT 1 1 1 5' ^ 3' Rota >1.5 >1.5 >1.5 5' ^ 3'MnSOD 5 >4 >1 5'NeoUTR3 3'-MT <1 <1 1 5'NeoUTR3 3' Rota <1 <1 <1 5'NeoUTR3 3'MnSOD <1 <1 <1 The 3'UTR MnSOD allows a 5-fold gain in expression at 6h and more than 4-fold at 24h on HeLa cells. The 3'UTR Rota allows an almost 2-fold increase in mRNA expression, compared to the standard combination (Fig. 2A). On DC2 cells.4, the 3'UTR MnSOD increases nanoluciferase expression by a factor of 56 hours after transfection on HeLa cells; and by a factor greater than 2 at 24 hours. The 3'UTR Rota element only allowed an increase of approximately 1.5 times on these DC2 cells 46 hours after transfection, and a little less 96 hours after transfection (Fig. 2B). 96 hours after transfection, no significant difference was measured on C2C12 cells (Fig. 2C). It would nevertheless appear that a transient effect of increased translation, at 6 hours, is observed with the 3'Rota and 3'MnSOD elements. The inventors are testing several hypotheses to explain this phenomenon. The 5'UTRNeo3 element appears to be less effective than the 5'^, on the three types of cells. Example 3: Stability and Expression Stability of a polyadenylated tail We first showed that polyA / G tails are stable on template plasmids (Figure 3).Indeed, 100% of the bacterial clones had an intact A / G tail after 10 successive subcultures. This rate was 95% for clones with the A110 construct described in US 2020 / 0392518. We confirmed the instability of tails containing only adenosines, only 48% of the A120 clones had an intact tail. Expression kinetics of different mRNAs according to the invention In combination with the 5'UTR α-globin (α), the 3'UTR sequences MnSOD (MnSOD) and VP6 (Rota) allowed better mRNA expression than the reference sequence AES-mtRNR1 (AES) in C2C12 cells (Figures 4 and 5). In C2C12 cells, the 3'UTR sequences MnSOD (MnSOD) and VP6 (Rota) allowed equivalent or superior expression to the AES sequence, in combination with UTR4 (4) or UTR3 (3).In HeLa cells, the 3'UTR MnSOD (MnSOD) and VP6 (Rota) sequences allowed higher expression than the AES sequence, in combination with the 5'UTR α-globin (α) or UTR4 (4) or UTR3 (3) (Figures 6 and 7). We showed that this discrepancy is valid with ARCA or Cleancap AG caps (Figure 8). In DC2.4 cells, the 3'UTR MnSOD (MnSOD) and VP6 (Rota) sequences allowed equivalent expression to the AES sequence (AES), in combination with the 5'UTR α-globin (α) or UTR3 (3) (Figures 9 and 10). The 5'UTR4 / 3'UTR MnSOD combination (4-NL-MnSOD) is not efficient in DC2.4 cells. We have shown that this equivalence is valid with ARCA or Cleancap AG caps (Figure 11). In primary human monocyte-derived dendritic cells (MoDCs), the 3'UTR sequences MnSOD (MnSOD) and VP6 (Rota) allowed equivalent expression to the AES sequence (AES), in combination with the 5'UTRs α-globin (α) or UTR4 (4) or UTR3 (3) (Figure 12).We have shown that in MoDCs, the 5'UTR α-globin-3'UTR AES (α-NL-AES) combination is equivalent to the 5'UTR α-globin-3'UTR MnSOD (α-NL-MnSOD) or 5'UTR α-globin-3'UTR VP6 (α-NL-Rota) combinations with either ARCA or Cleancap AG caps (Figure 13). The ARCA cap analog is described in (Stepinski J, Waddell C, Stolarski R, Darzynkiewicz E, Rhoads RE (2001) Synthesis and properties of mRNAs containing the novel "anti-reverse" cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG. RNA 7: 1486–1495). The Clean cap analog is an invention of Trilink technologies (https: / / www.trilinkbiotech.com / legal-notices ). Intracellular stability of mRNAs The VP6 3'UTR sequences increased the intracellular stability of mRNAs with a 5'UTR3 compared to the reference 3'UTR, both in HeLa cells (Figure 14A) and DC2.4 cells (Figure 14B).Immunogenicity of 3'UTR sequences The 3'UTR sequences MnSOD or VP6 did not result in higher immunogenicity than the reference 3'UTR sequence in DC2.4 cells (Figure 15). Other expression kinetics The mRNA with 5'UTR α-globin and 3'UTR AES-mtRNR1 in combination with the AG tail allowed a better expression than this same combination with A110 tail in DC2.4 cells (Figure 16). The mRNA with 5'UTR α-globin and 3'UTR AES-mtRNR1 in combination with the AG tail allowed a better expression than this same combination with A110 tail in HeLa cells (Figure 17). We also evaluated the expression of mRNAs with the different 3'UTR sequences without combination with a 5'UTR sequence. The 3'UTR MnSOD and VP6 sequences allowed expression at least equivalent to that obtained with mRNA possessing the 3'UTR AES sequence, both in HeLa (Figure 18) and DC2.4 (Figure 19) cells.REFERENCES BIBLIOGRAPHIQUES EP3494982 US20200066375 WO2014186334 EP0737750 US20200392518 Zhu Y, Zhu L, Wang X, Jin H. RNA-based therapeutics: an overview and prospectus. Cell Death Dis. 2022 Jul 23;13(7):644. Lamb YN. BNT162b2 mRNA COVID-19 Vaccine: First Approval. Drugs. 2021 Mar;81(4):495- 501. Baden LR, El Sahly HM, Essink B, Kotloff K, Frey S, Novak R, Diemert D, Spector SA, Rouphael N, Creech CB, McGettigan J, Khetan S, Segall N, Solis J, Brosz A, Fierro C, Schwartz H, Neuzil K, Corey L, Gilbert P, Janes H, Follmann D, Marovich M, Mascola J, Polakowski L, Ledgerwood J, Graham BS, Bennett H, Pajon R, Knightly C, Leav B, Deng W, Zhou H, Han S, Ivarsson M, Miller J, Zaks T; COVE Study Group. Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N Engl J Med. 2021 Feb 4;384(5):403-416. Uchida S, Perche F, Pichon C, Cabral H. Nanomedicine-Based Approaches for mRNA Delivery. Mol Pharm. 2020 Oct 5;17(10):3654-3684. Babendure JR, Babendure JL, Ding JH, Tsien RY.Control of mammalian translation by mRNA structure near caps. RNA. 2006 May;12(5):851-61. Cao J, Novoa EM, Zhang Z, Chen WCW, Liu D, Choi GCG, Wong ASL, Wehrspaun C, Kellis M, Lu TK. High-throughput 5' UTR engineering for enhanced protein production in non-viral gene therapies. Nat Commun. 2021 Jul 6;12(1):4138. Linares-Fernández S, Moreno J, Lambert E, Mercier-Gouy P, Vachez L, Verrier B, Exposito JY. Combining an optimized mRNA template with a double purification process allows strong expression of in vitro transcribed mRNA. Mol Ther Nucleic Acids. 2021 Dec 3;26:945- 956. Orlandini von Niessen AG, Poleganov MA, Rechner C, Plaschke A, Kranz LM, Fesser S, Diken M, Löwer M, Vallazza B, Beissert T, Bukur V, Kuhn AN, Türeci Ö, Sahin U. Improving mRNA- Based Therapeutic Gene Delivery by Expression-Augmenting 3' UTRs Identified by Cellular Library Screening. Mol Ther. 2019 Apr 10;27(4):824-836. Yang AD, Barro M, Gorziglia MI, Patton JT.Translation enhancer in the 3'-untranslated region of rotavirus gene 6 mRNA promotes expression of the major capsid protein VP6. Arch Virol. 2004 Feb;149(2):303-21. Chung DJ, Wright AE, Clerch LB. The 3' untranslated region of manganese superoxide dismutase RNA contains a translational enhancer element. Biochemistry. 1998 Nov 17;37(46):16298-306. Xia X. Detailed Dissection and Critical Evaluation of the Pfizer / BioNTech and Moderna mRNA Vaccines. Vaccines (Basel). 2021 Jul 3;9(7):734. Sambrook, Joseph. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 2001. Linares-Fernández S et al., Combining an optimized mRNA template with a double purification process allows strong expression of in vitro transcribed mRNA, Mol Ther Nucleic Acids. 2021 Dec 3 :26 :945-956. Perche F et al., Enhancement of dendritic cells transfection in vivo and of vaccination against B16F10 melanoma with mannosylated histidylated lipopolyplexes loaded with tumor antigen messenger RNA, Nanomedicine. 2011 Aug ;7(4) :445-53. Stepinski J, Waddell C, Stolarski R, Darzynkiewicz E, Rhoads RE (2001) Synthesis and properties of mRNAs containing the novel "anti-reverse" cap analogs 7-methyl(3'-O- methyl)GpppG and 7-methyl(3'deoxy)GpppG. RNA 7: 1486–1495.
Claims
CLAIMS 1. Synthetic nucleic acid comprising, in the 5'-3' direction, the following elements: a) at least one 5'UTR untranslated element, selected from the 5'UTR of the human beta-globin gene (SEQ ID NO. 4), the synthetic element 5'NeoUTR3 (SEQ ID NO. 5), the 5'UTR of the human alpha-globin gene (SEQ ID NO. 6), and the synthetic element 5'UTR4 (SEQ ID NO. 7), b) an open reading frame (ORF), and c) at least one 3'UTR untranslated element, selected from the 3'UTR element of the rotavirus VP6 gene (SEQ ID NO. 1) and the 3'UTR element of a manganese superoxide dismutase (MnSOD) gene.
2. Synthetic nucleic acid according to claim 1, characterized in that the 3'UTR element of the MnSOD gene is derived from the rat gene (SEQ ID NO. 2) or from the human gene.
3. Synthetic nucleic acid according to one of claims 1 or 2, characterized in that this nucleic acid is an RNA, in particular a messenger RNA. 4.Synthetic nucleic acid according to one of claims 1 to 3, characterized in that it further comprises, in 5', a cap of the ARCA, Cap0, Cap1 or Cap2 type.
5. Synthetic nucleic acid according to one of claims 1 to 4, characterized in that it further comprises, in 3', a poly(A) or poly(AG) tail, preferably a poly(AG) tail comprising at least one nucleotide base G.
6. Synthetic nucleic acid according to one of claims 1 to 5, characterized in that the ORF codes for a protein of interest: BMP protein, preferably BMP2.
7. Expression vector comprising the synthetic nucleic acid according to one of claims 1 to 6.
8. Host cell, with the exception of a human embryonic stem cell, comprising the synthetic nucleic acid according to one of claims 1 to 6 or the expression vector according to claim 7. 9.Pharmaceutical or vaccine composition comprising a synthetic nucleic acid according to one of claims 1 to 6 in a suitable pharmaceutical vehicle, and optionally one or more excipients, and / or one or more adjuvants.
10. Synthetic nucleic acid according to one of claims 1 to 6 for its use as a medicament.
11. Synthetic nucleic acid according to claim 6 for use in the treatment or prevention of bone pathologies.
12. In vitro use of the synthetic nucleic acid according to one of claims 1 to 6 to increase and / or prolong the translation of a protein of interest from this nucleic acid, within a host cell having integrated said nucleic acid as defined in claim 8.