Methods of treatment of metabolic disorders

EP4735019A1Pending Publication Date: 2026-05-06INST NAT DE LA SANTE & DE LA RECHERCHE MEDICALE (INSERM) +3
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
INST NAT DE LA SANTE & DE LA RECHERCHE MEDICALE (INSERM)
Filing Date
2024-06-28
Publication Date
2026-05-06

AI Technical Summary

Technical Problem

Current methods fail to effectively address the global epidemic of obesity and related metabolic disorders such as Type 2 Diabetes and cardiovascular diseases, as they primarily focus on glucose metabolism without considering the impact of fructose and other sugars, leading to disrupted sugar metabolism and hormone secretion.

Method used

Inhibiting the Sodium-Glucose-Co-Transporter-4 (SGTL4) to reduce the absorption and reabsorption of sugars like mannose, glucose, and fructose, which are elevated in obese individuals, thereby improving insulin sensitivity and potentially preventing the progression to metabolic disorders and associated cancers.

Benefits of technology

SGTL4 inhibition shows promise in reducing serum sugar concentrations, improving insulin sensitivity, and slowing the onset of obesity and hyperglycemia, offering a therapeutic approach to treat or prevent metabolic disorders and related conditions like Type 2 Diabetes and cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000043_0001
    Figure IMGF000043_0001
  • Figure IMGF000043_0002
    Figure IMGF000043_0002
  • Figure IMGF000044_0001
    Figure IMGF000044_0001
Patent Text Reader

Abstract

METHODS OF TREATMENT OF METABOLIC DISORDERS In the present invention SLC5A9 gene (encoding SGLT4 protein) regulation was analyzed in the intestine of patients before and after weight-loss surgery. RNA scope analysis was used to determine the precise location of SLC5A9 in the human intestine and pancreas. Sglt4 knock- out (KO) mice were created using CRISPR / Cas techniques, allowing to study changes in their metabolic phenotype for months while they were fed the WD (Western Diet). So, these data demonstrate that SLC5A9 mRNA levels are induced in the apical membrane of the intestine and exocrine pancreas in persons with obesity and Type 2 Diabetes. Furthermore, Sglt4 deficiency slows the onset of obesity and hyperglycemia in mice fed the WD, improving insulin sensitivity by improving beta cell function. Accordingly the present invention relates to a method for preventing or treating metabolic disorders by targeting the Sodium-Glucose-Co- Transporter-4 (SGTL4).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS OF TREATMENT OF METABOLIC DISORDERS

[0002] FIELD OF THE INVENTION:

[0003] The present invention relates to a method for preventing or treating metabolic disorders such as Type 2 Diabetes and obesity by targeting the Sodium-Glucose-Co-Transporter-4 (SGTL4).

[0004] BACKGROUND OF THE INVENTION:

[0005] A perennial challenge facing all of the world's countries, regardless of their level of economic development, is addressing the epidemic of obesity which has become a pandemic. According to the World Health Organization, more than 1.9 billion adults, 18 years and older, were overweight. Of these 650 million were obese h Worldwide obesity has almost tripled and the key ingredients contributing to this are a sedentary lifestyle, a high-fat, and high-sugar diet, known as the Western diet (WD), ubiquitous access to convenience foods, or spending less time preparing meals at home2. Childhood obesity has doubled in children and quadrupled in adolescents since the 1980s3. Collectively, these transitions have radically affected human metabolic health status worldwide. Obesity is characterized by excessive accumulation and storage of fat which is a leading risk factor for the development of non-alcoholic fatty liver disease (NAFLD), T2D, cardiovascular disease (CDV), and certain cancers, thus causing premature mortality and disability worldwide4’5. Despite these facts, control of carbohydrate consumption, including that of dietary sugars, and their relevance in the global rise of obesity in adults, adolescents, and children remains controversial6. This is not surprising since it was just in the recent past, that the ruminant consumption of trans-saturated fats was considered a major public health concern for their detrimental effects on metabolic disease7. The majority of studies in the last three decades have focused on glucose transporters, such as SGLT1, SGLT2, and GLUT2, which seemed relevant at the time, since sucrose was universally referred to as 'table sugar’ and was a stable commodity in the diet. However, the composition of the WD is not only of sucrose, and fat, but also high-fructose-corn-syrup (HFCS), which is actively transported by SGLT4 and GLUT58. The Western-style dietary pattern is largely linked to the rise in obesity, which is characterized by the chronic overconsumption of foods enriched in refined sugars such as sucrose, HFCS, salt, proteins derived from fatty domesticated and processed meats, and trans-saturated fats, with time, exacerbate all chronic diseases of civilization. It potentiates 1) glycemic load, 2) fatty acid composition, 3) macronutrient composition, 4) micronutrient density, 5) acid-base balance, 6) sodium-potassium ratio, 7) fiber content, and 8) aging9-11. Although the majority of metabolic studies of sugar metabolism have focused mostly on glucose because of its fundamental role in energy generation and metabolic diseases the blame has now been shifted to fructose-containing sugars12. Nevertheless, all metabolic diseases share a common origin - a disruption in the balance of sugar metabolism and hormone secretion, commonly referred to as glucose homeostasis. Central to this balance are glucose transporters, some of which are subject to adaptation and inhibition. Some adaptations of glucose transporters may promote or worsen metabolic diseases and certain cancers13, while their inhibition can favorably alter the pathophysiology of these diseases14,15. Beyond these noticeable observations, our knowledge of the inter-organ crosstalk of sugar transporter adaptation and / or inhibition in metabolic disease is severely limited. For the first time in history, public health authorities are predicting that the younger generation will have a shorter life span than their parents16. As can be imagined, this debilitating and chronic disease carries a substantial economic burden on individuals and society. Worldwide health authorities must now invest in research to develop sustainable therapeutic strategies to prevent obesity, and its correlates, Non Alcoholic Fatty Liver Disease (NAFLD), Type 2 Diabetes (T2D), and Cardiovascular diseases (CVD). Unlike some of its better-known family members, SGLT4 also exhibits a Na+-dependent alpha-methyl-D-glucopyranoside (AMG) transport system with a Km of 2.6 mM, suggesting that it is a low affinity-type transporter17, similar to that of SGLT218. Early studies by Alton and colleagues suggested that approximately 95-98% of mannose entering the cell is transported by an ‘unknown sodium-dependent-mannose-transport-system where it is catabolized, while only 2% of mannose is used for N-glycosylation19. Later studies using radiolabeled mannose suggested that an ‘SGLT4-like transport system ’ might be physiologically relevant for intestinal absorption and renal reabsorption17’20,21. But, unlike SGLT1 and SGLT2, which transports only glucose22, SGLT4 transports naturally occurring sugars with a rank order of mannose, followed by glucose, fructose, 1,5-anhydro-D-glucitol (1,5AG), and galactose20, the majority of which are enriched in the WD, and dangerously elevated in the blood of obese individuals with and without T2D23-25. Therefore, inhibition of the serum concentrations of such SGLT4 substrates via absorption / reabsorption would be a “game-changer” for the modification of such pathological conditions. Compared to glucose and fructose, mannose has received little attention in metabolic studies. Found in Chinese jujube, coffee grounds, baker's yeast, and in high amounts of various fruits26, the serum concentration of mannose in mammals is low, ranging from 28-161 pM19, thus suggesting that the most likely sources are from the diet or the conversion from glucose during the endogenous glucose production27. However, since circulating levels of mannose and 1,5AG are elevated in T2D individuals, it was speculated that mutations in the SLC5A9 gene (encoding SGLT4) may account for such changes17Beyond these noticeable observations, the biological mechanisms supporting these associations remain largely unknown. Granting SLC5A9 mRNA levels have been reported to be expressed in the human small intestine, kidney, skeletal muscle, lung, caecum, colon, pancreas, and testis17,28, there is so far no scientific evidence for the physiological importance of the SGLT4 transporter in these organs. Inventors therefore examined SGLT4 transporter regulation in pathologic conditions and determines that SLC5A9 mRNA levels are induced in the apical membrane of the intestine and exocrine pancreas in persons with obesity and T2D. Furthermore, Sglt4 deficiency slows the onset of obesity and hyperglycemia in mice fed the Western diet (WD), improving insulin sensitivity, lending credence that SGLT4 inhibition improves beta cell function. Accordingly inventors describe the identification of SGLT4 as new therapeutic target of metabolic disease which inhibition contribute to lower the serum concentrations of various sugars, and accordingly "gamechanger" for the treatment of such pathological conditions such as metabolic diseases.

[0006] SUMMARY OF THE INVENTION:

[0007] A first object of the invention relates to a Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use in the treatment or prevention of a patient affected with a metabolic disorder.

[0008] A second object of the invention relates to a combination of a Sodium-Glucose-Co- Transporter-4 (SGTL4) inhibitor and a Sodium-Glucose-Co-Transporter-2 (SGTL2) inhibitor for simultaneous or sequential use in preventing or treating metabolic disorder.

[0009] A third object of the invention relates to a method for screening a Sodium-Glucose-Co- Transporter-4 (SGTL4) inhibitor (or antagonist) for use in the treatment or prevention of metabolic disorder.

[0010] In a particular embodiment, the metabolic disorder is selected from the list consisting of overweight, obesity, hepatic steatosis or fatty liver, dyslipidemia and in particular, hypercholesterolemia and / or hypertriglyceridemia; hyperglycemia, insulin resistance and diabetes, preferably Type 2 diabetes and gestational diabetes; metabolic syndrome, chronic renal failure, hypertension and cardiovascular disease.

[0011] In a particular embodiment, the metabolic disorder (overweight, obesity insulin resistance and Type 2 diabetes) is associated with pancreatic, liver, colorectal, kidney, uterine or breast cancer. In a more particular embodiment, the metabolic disorder (overweight, obesity insulin resistance and Type 2 diabetes) is associated with pancreatic cancer or liver cancer. Accordingly the use and the therapeutic method of the present invention may be used to prevent the progression of the metabolic disease to pancreatic, liver, colorectal, kidney, uterine or breast cancer. In a more particular embodiment, the use and the therapeutic method of the present invention may be used to prevent the progression of the metabolic disease to pancreatic cancer or liver cancer.

[0012] DETAILED DESCRIPTION OF THE INVENTION:

[0013] In the present invention, SLC5A9 gene (encoding SGLT4 protein) regulation was analyzed in the intestine of patients before and after weight-loss surgery. RNA scope analysis was used to determine the precise location of SLC5A9 in the human intestine and pancreas. Sglt4 knock-out (KO) mice were created using CRISPR / Cas techniques, allowing to study changes in their metabolic phenotype for months while they were fed the WD (Western Diet). Pancreatic Islets were isolated from both groups of mice, and a glucose-stimulated insulin secretion (GSIS) assay was performed by perfusion techniques.

[0014] From obese patients with and without Type 2 diabetes (T2D) (n =50), a significant reduction in BMI (p<0.0001) post-surgery was observed. This was accompanied by a marked reduction in glycemia after a glucose challenge (OGTT). It was also found that SLC5A1 (SGLT1) mRNA was significantly reduced in both cohorts. However, inventors found a more profound decrease of SLC5A9 (SGLT4) mRNA expression (70%) levels post-surgery, compared to SLC5A1 (40%), while SLC5A2 (SGLT2), SLC2A2 (GLUT2), and SLC2A5 (GLUT5) mRNA expression levels remained unchanged. Intriguingly, inventors also discovered that Sglt4 KO mice were protected against obesity and T2D up to 5 months of feeding the WD when compared to WT mice fed the same diet. Using RNAScope, it was revealed that both SLC5A1 and SLC5A9 mRNA levels were highly expressed in the apical membrane of the intestine of a person with obesity. Moreover, inventors also observed that SLC5A9 is mainly expressed in the exocrine pancreas and induced by obesity and T2D. Approximately 80% of pancreatic cancer patients experience glucose intolerance or diabetes. Based on this observation, two hypotheses have emerged: i. Epidemiological studies have shown that T2D is a risk factor for overall cancer incidence and several specific types of cancer, including colorectal, liver, kidney, uterine, and breast cancer (PMID: 25555821). Notably, there is evidence suggesting a bidirectional relationship between T2D and pancreatic cancer (PMID: 24609291), and ii. the conditions linked to diabetes contribute to the formation of pancreatic cancer (see the reviews Eible G et al J Acad Nutr Diet. 2018 Apr;118(4):555-567. and Zhong L et al. Front Endocrinol . 2023 Apr 11; 14:1116582.). Consequently, the inventors propose that inhibiting SGLT4 may potentially decelerate or even prevent the progression from obesity and T2D to pancreatic cancer. Finally, islets isolated from WT mice fed the WD showed impaired GSIS (glucose-stimulated insulin secretion), compared to those of Sglt4 KO mice. Collectively, these data demonstrate that SLC5A9 mRNA levels are induced in the apical membrane of the intestine and exocrine pancreas in persons with obesity and T2D. Furthermore, Sglt4 deficiency slows the onset of obesity and hyperglycemia in mice fed the WD, improving insulin sensitivity, lending credence to the idea that SGLT4 inhibition improves both beta cell function and exocrine function.

[0015] Lastly, in example 2, the inventors conducted experiments to evaluate the efficacy of targeted antisense oligonucleotides against human SGLT4. These oligonucleotides were successfully validated in HK-2 cells (renal cells). Thus, this antisense nucleotide have the potential to prevent the upregulation of SGLT4 and consequently improve insulin sensitivity in human islets or exocrine tissue that has been chronically exposed (up to 96 hours) to Western diet media compared to normal media.

[0016] Thus, the present invention provides methods and compositions (such as pharmaceutical compositions) for preventing or treating a metabolic disorder.

[0017] In the context of the invention, the term "treatment or prevention" means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition. In particular, the treatment of the disorder may consist in improving insulin sensitivity in conditions such as overweight (or excess weight), obesity, and diabetes, preferably Type 2 diabetes mellitus and gestational diabetes. Most preferably, such treatment leads to the complete depletion of the pathological features as observed in metabolic disorder.

[0018] As used herein, the terms “treatment,” “treat,” and “treating” refer to reversing, alleviating, inhibiting the progress of a disease or disorder as described herein (i.e. metabolic disorders), or delaying, eliminating or reducing the incidence or onset of a disorder or disease as described herein, as compared to that which would occur in the absence of the measure taken. The terms “prophylaxis” or “prophylactic use” and “prophylactic treatment” as used herein, refer to any medical or public health procedure whose purpose is to prevent the disease herein disclosed (i.e. metabolic disorder). As used herein, the terms “prevent”, “prevention” and “preventing” refer to the reduction in the risk of acquiring or developing a given condition (i.e. metabolic disorder), or the reduction or inhibition of the recurrence or said condition (i.e. metabolic disorder) in a subject who is not ill, but who has been or may be near a subject with the condition (i.e. metabolic disorder) / Preferably, the individual to be treated is a human or non-human mammal (such as a rodent, a feline, a canine, or a primate) affected or likely to be affected with metabolic disorder. Preferably, the individual is a human.

[0019] Sodium-Glucose-Co-TransDorter-4 (SGTL4) inhibitors

[0020] According to a first aspect, the present invention relates to a Sodium-Glucose-Co- Transporter-4 (SGTL4) inhibitor for use in the treatment or prevention of a patient affected with a metabolic disorder.

[0021] In the present invention, inventors demonstrated that Sodium-Glucose-Co-Transporter- 4 (SGTL4) is highly expressed in apical membrane of the intestine and (for the first time) exocrine pancreas in persons with obesity and Type 2 diabetes (T2D) and that Sglt4 deficiency slows the onset of obesity and hyperglycemia in mice fed with Western Diet (WD).

[0022] In a particular embodiment, the metabolic disorder is selected from the list consisting of overweight, obesity, hepatic steatosis or fatty liver, dyslipidemia and in particular, hypercholesterolemia and / or hypertriglyceridemia; hyperglycemia, insulin resistance and diabetes, preferably Type 2 diabetes and gestational diabetes; metabolic syndrome, chronic renal failure, hypertension and cardiovascular disease.

[0023] In a more particular embodiment, the metabolic disorder overweight, obesity, insulin resistance and diabetes, preferably Type 2 diabetes.

[0024] In a particular embodiment, the metabolic disorder (overweight, obesity insulin resistance and Type 2 diabetes) is associated with pancreatic cancer, liver cancer, colorectal cancer, kidney cancer, uterine cancer or breast cancer. In a more particular embodiment, the metabolic disorder (overweight, obesity insulin resistance and Type 2 diabetes) is associated with pancreatic cancer and liver cancer.

[0025] Accordingly the use and the therapeutic method of the present invention may be used to prevent the progression of the metabolic disease to pancreatic cancer, liver cancer, colorectal cancer, kidney cancer, uterine cancer or breast cancer. In a more particular embodiment, the use and the therapeutic method of the present invention may be used to prevent the progression of the metabolic disease to pancreatic cancer or liver cancer.

[0026] As used herein the term “Sodium-Glucose-Co-Transporter-4 (abbreviated as SGLT4 (synonyms SLC5A9 or “solute carrier family 5 member 9”) refers to a protein member of the Sodium-glucose transport family of proteins, that, in humans, is encoded by the SLC5A9 gene (Gene ID: 200010). Sodium-dependent glucose cotransporters (or sodium-glucose linked transporter, SGLT) are a family of glucose transporter found in the intestinal mucosa (enterocytes) of the small intestine (SGLT1) and the proximal tubule of the nephron (SGLT2 in PCT and SGLT1 in PST). They contribute to renal glucose reabsorption. In the kidneys, 100% of the filtered glucose in the glomerulus has to be reabsorbed along the nephron (98% in PCT, via SGLT2). If the plasma glucose concentration is too high (hyperglycemia), glucose passes into the urine (glucosuria) because SGLT are saturated with the filtered glucose.

[0027] Unlike some of its better-known family members, SGLT4 also exhibits a Na+- dependent alpha-methyl-D-glucopyranoside (AMG) transport system with a Km of 2.6 mM, suggesting that it is a low affinity-type transporter17, similar to that of SGLT218. Early studies by Alton and colleagues suggested that approximately 95-98% of mannose entering the cell is transported by an ‘unknown sodium-dependent-mannose-transport-system where it is catabolized, while only 2% of mannose is used for N-glycosylation19. Later studies using radiolabeled mannose suggested that an ‘SGLT4-like transport system ’ might be physiologically relevant for intestinal absorption and renal reabsorption17’20,21. But, unlike SGLT1 and SGLT2, which transports only glucose22, SGLT4 transports naturally occurring sugars with a rank order of mannose, followed by glucose, fructose, 1,5-anhydro-D-glucitol (1,5AG), and galactose20, the majority of which are enriched in the WD, and dangerously elevated in the blood of obese individuals with and without T2D23'25.

[0028] A "Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor" or "Sodium-Glucose-Co- Transporter-4 (SGTL4) antagonist" refers to a molecule (natural or synthetic) capable of neutralizing, blocking, inhibiting, abrogating, reducing or interfering with the biological activities of Sodium-Glucose-Co-Transporter-4 (SGTL4) including, for example, reduction or blocking the sugars transports mainly mannose, glucose and fructose . Sodium-Glucose-Co- Transporter-4 (SGTL4) inhibitors or antagonists include antibodies and antigen-binding fragments thereof, proteins, peptides, glycoproteins, glycopeptides, glycolipids, polysaccharides, oligosaccharides, nucleic acids, bioorganic molecules, peptidomimetics, pharmacological agents and their metabolites, transcriptional and translation control sequences, and the like. Inhibitors or antagonists also include, antagonist variants of the protein, siRNA molecules directed to a protein, antisense molecules directed to a protein, aptamers, and ribozymes against a protein. The Sodium-Glucose-Co-Transporter-4 (SGLT4) inhibitor or antagonist is a molecule that binds to SGLT4 and disrupts its biological activity, which involves decreasing serum concentrations of SGLT4 substrates such as mannose, glucose, fructose, and 1,5-anhydro-D-glucitol (1,5AG). This disruption can be achieved through neutralization, blocking, inhibition, abrogation, reduction, or interference with SGLT4. Accordingly, a “Direct Sodium-Glucose-Co-Transporter-4 (SGTL4) Inhibitor" is a Sodium-Glucose-Co-Transporter-4 (SGLT4) inhibitor / antagonist which directly binds to Sodium-Glucose-Co-Transporter-4 (SGLT4) (protein or nucleic sequence (DNA or mRNA)) and neutralizes, blocks, inhibits, abrogates, reduces or interferes with the biological activity of Sodium-Glucose-Co-Transporter-4 (SGLT4).

[0029] In the context of the present invention, the direct Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor (i) directly binds to Sodium-Glucose-Co-Transporter-4 (SGLT4) (protein or nucleic sequence (DNA or mRNA)) and (ii) inhibits serum concentrations of SGLT4 substrates (through blocking Sodium-Glucose-Co-Transporter-4 (SGLT4) transport sugar process) and / or iii) elevating glucose sensitivity / tolerance and / or insulin sensitivity.

[0030] More particularly, the direct Sodium-Glucose-Co-Transporter-4 (SGLT4) inhibitor according to the invention is:

[0031] 1) an inhibitor of Sodium-Glucose-Co-Transporter-4 (SGLT4) activity (such as small organic molecule, antibody, aptamer, polypeptide) and / or

[0032] 2) an inhibitor of Sodium-Glucose-Co-Transporter-4 (SGLT4) gene expression (such as antisense oligonucleotide, nuclease, siRNA, ...)

[0033] By "biological activity" of Sodium-Glucose-Co-Transporter-4 (SGLT4) is meant in the context of the present invention, by i) elevating the serum concentrations of SGLT4 substrates through active transport of mannose, glucose, fructose, 1,5-anhydro-D-glucitol (1,5AG), and galactose (in intestine and pancreatic cells) and / or ii) decreasing glucose sensitivity / tolerance and / or insulin sensitivity .

[0034] By "biological activity" of Sodium-Glucose-Co-Transporter-4 (SGLT4), as meant in the context of the present invention, refers to: i) the active transport of SGLT4 substrates such as mannose, glucose, fructose, 1,5-anhydro-D-glucitol (1,5AG), artificial sweeteners, and galactose (in intestine and pancreatic cells), leading to elevated serum concentrations, and ii) the potential effects of SGLT4 on reducing glucose sensitivity / tolerance and / or insulin sensitivity.

[0035] The person skilled in the art is familiar with well-known tests used to determine the potential of a compound to function as a Sodium-Glucose-Co-Transporter-4 (SGLT4) inhibitor. In a preferred embodiment, the antagonist / inhibitor specifically binds to Sodium-Glucose-Co- Transporter-4 (SGLT4) (protein or nucleic sequence (DNA or mRNA)) in a sufficient manner to inhibit the biological activity of Sodium-Glucose-Co-Transporter-4 (SGLT4). Binding to Sodium-Glucose-Co-Transporter-4 (SGLT4) and inhibition of the biological activity of Sodium-Glucose-Co-Transporter-4 (SGTL4) may be determined by any competing assays well known in the art. For example, the assay may consist in determining the ability of the agent to be tested as a Sodium-Glucose-Co-Transporter-4 (SGLT4) inhibitor to bind to Sodium- Glucose-Co-Transporter-4 (SGLT4). The binding ability is reflected by the Kd measurement. The term "Kd", as used herein, is intended to refer to the dissociation constant, which is obtained from the ratio of Kd to Ka (i.e. Kd / Ka) and is expressed as a molar concentration (M). Kd values for binding biomolecules can be determined using methods well established in the art. In specific embodiments, an antagonist / inhibitor that "specifically binds to Sodium-Glucose-Co- Transporter-4 (SGLT4)" is intended to refer to an inhibitor that binds to human Sodium- Glucose-Co-Transporter-4 (SGLT4) polypeptide with a Kd of IpM or less, lOOnM or less, lOnM or less, or 3nM or less. Then a competitive assay may be settled to determine the ability of the agent to inhibit biological activity of Sodium-Glucose-Co-Transporter-4 (SGLT4) : inhibition of serum concentrations of SGLT4 substrates through blocking Sodium-Glucose-Co- Transporter-4 (SGLT4)-sugar transport process.

[0036] By “inhibitor of the Sodium-Glucose-Co-Transporter-4 (SGLT4) activity”, it is herein referred to a compound which is capable of reducing or inhibiting serum concentrations of SGLT4 substrates. In view of the teaching of the present disclosure, particularly of the examples, it falls within the ability of the skilled person to assess whether a compound is an inhibitor of the SGTL4 activity..

[0037] Thus typically, inhibitor of the Sodium-Glucose-Co-Transporter-4 (SGLT4) activity according to the invention has the capacity (i) to improve glucose tolerance / sensitivity and / or and / or insulin sensitivity ii) to inhibits serum concentrations of SGLT4 substrates through blocking Sodium-Glucose-Co-Transporter-4 (SGLT4)-sugar transport process.

[0038] The skilled in the art can easily determine whether inhibitor of the Sodium-Glucose-Co- Transporter-4 (SGLT4) activity , according to the invention is biologically active. For example, the capacity to improve glucose tolerance can be determined by any routine test well known by the man skills in the art: oral glucose tolerance tests (OGTT). The glucose tolerance test measures the clearance of oral glucose and is widely used to evaluate glucose tolerance, insulin sensitivity, and insulin secretion. It helps detect disturbances in glucose metabolism related to conditions like diabetes or metabolic syndrome.

[0039] Animals are fasted several hours (around 16 hours) before the test and blood glucose levels are determined before a solution of glucose is administered orally by gavage. Subsequently, the blood glucose level is measured at different time points during the following 2 hours (see www.mmpc.org / shared / document.aspx?id=238&docType=Protocol). The capacity to improve insulin sensitivity and to test pancreatic islet function can also be determined for example with a common glucose-stimulated insulin secretion (GSIS) assay as described in experimental section, and other routine test well known by the man skills in the art.

[0040] The skilled in the art can easily determine whether a Sodium-Glucose-Co-Transporter- 4 (SGLT4) antagonist neutralizes, blocks, inhibits, abrogates, reduces or interferes with a biological activity of Sodium-Glucose-Co-Transporter-4 (SGLT4). to check whether the Sodium-Glucose-Co-Transporter-4 (SGLT4) antagonist / inhibitor binds to Sodium-Glucose- Co-Transporter-4 (SGLT4) and / or is able to inhibit processes associated with elevation of serum concentrations of SGLT4 substrates through active transport of mannose, glucose, fructose, 1,5-anhydro-D-glucitol (1,5AG), and galactose (in intestine and pancreatic cells) and / or decreasing glucose sensitivity / tolerance, , in the same way than the initially characterized inhibitor of Sodium-Glucose-Co-Transporter-4 (SGLT4), binding assay and / or a glucose sensitivity assay may be performed with each antagonist.

[0041] Accordingly, the direct Sodium-Glucose-Co-Transporter-4 (SGLT4) inhibitor may be a molecule that binds to Sodium-Glucose-Co-Transporter-4 (SGLT4) selected from the group consisting, antibodies, aptamers.

[0042] The skilled in the art can easily determine whether a Sodium-Glucose-Co-Transporter- 4 (SGLT4) inhibitor or antagonist neutralizes, blocks, inhibits, abrogates, reduces or interferes with a biological activity of Sodium-Glucose-Co-Transporter-4 (SGLT4): (i) binding to Sodium-Glucose-Co-Transporter-4 (SGLT4) (protein or nucleic sequence (DNA or mRNA)) and / or (ii) inhibiting serum concentrations of SGLT4 substrates through blocking Sodium- Glucose-Co-Transporter-4 (SGLT4)-sugar transport process or restoring glucose sensitivity / tolerance.

[0043] The term “metabolic disorders” means a disorder that negatively alters the body's processing and distribution of macronutrients, such as proteins, fats, and carbohydrates. Metabolic disorders can happen when abnormal chemical reactions in the body alter the normal metabolic process. It can also be defined as inherited single gene anomaly, most of which are autosomal recessive. A “metabolic disorder” according to the present invention means metabolic alterations such as glucose or lipid metabolic disorder and directly associated with overweight, obesity, hepatic steatosis or fatty liver, dyslipidemia and, in particular, hypercholesterolemia and / or hypertriglyceridemia; hyperglycemia, insulin resistance and diabetes, preferably type 2 diabetes mellitus and gestational diabetes; metabolic syndrome, chronic renal failure, hypertension and cardiovascular diseases. In a particular embodiment, the metabolic disorder is selected from the list selected from the list consisting of overweight, obesity, insulin resistance and diabetes, preferably Type 2 diabetes mellitus.

[0044] In a specific embodiment inhibitor of the Sodium-Glucose-Co-Transporter-4 (SGLT4) activity may be used to treat or prevent metabolic disorder such as obesity, hepatic steatosis or fatty liver, dyslipidemia and, in particular, hypercholesterolemia and / or hypertriglyceridemia; hyperglycemia, insulin resistance and diabetes, preferably type 2 diabetes mellitus and gestational diabetes; metabolic syndrome, chronic renal failure, hypertension and cardiovascular diseases.

[0045] In a more specific embodiment a direct inhibitor of the Sodium-Glucose-Co- Transporter-4 (SGLT4) of the invention, may be used to treat metabolic disorder such as insulin resistance and type 2 diabetes.

[0046] As used herein, the term “type 2 diabetes ” is a disease known as adult-onset diabetes, is a form of diabetes that is characterized by high blood sugar, insulin resistance, and relative lack of insulin. Long-term complications from high blood sugar include heart disease, strokes, diabetic retinopathy which can result in blindness, kidney failure, and poor blood flow in the limbs which may lead to amputations29. The sudden onset of hyperosmolar hyperglycemic state may occur; however, ketoacidosis is uncommon30. Type 2 diabetes makes up about 90% of cases of diabetes, with the other 10% due primarily to type 1 diabetes and gestational diabetes29. In type 1 diabetes there is a lower total level of insulin to control blood glucose, due to an autoimmune induced loss of insulin-producing beta cells in the pancreas31. Diagnosis of diabetes is by blood tests such as fasting plasma glucose, oral glucose tolerance test, or glycated hemoglobin (A1C)32.

[0047] Type 2 diabetes is preventable by staying a normal weight, exercising regularly, and eating a healthy diet29. If blood sugar levels are not adequately lowered, the medication metformin is typically recommended33. Many people may eventually also require insulin injections34Bariatric surgery often improves diabetes in those who are obese35.

[0048] Incidence of type 2 diabetes has increased dramatically since 1960 in parallel with obesity. As of 2015 there were approximately 392 million people diagnosed with the disease compared to around 30 million in 198536. Typically, it begins in middle or older age, although rates of type 2 diabetes are increasing in young people37As used herein, the term “insulin resistance” is a term related to pathological conditions in which cells fail to respond normally to the hormone insulin (pancreatic hormone associated with glucose homeostasis). There are many causes of insulin resistance and the underlying process is still not completely understood, but high levels of ceramides in tissues is considered as a major determinant of insulin resistance through inhibition of cellular insulin signaling cascades38. Risk factors for insulin resistance include obesity, sedentary lifestyle, family history of diabetes, various health conditions, and certain medications. Insulin resistance is considered a component of the metabolic syndrome. Various genetic factors can increase risk, such as a family history of diabetes, and there are some specific medical conditions associated with insulin resistance, such as polycystic ovary syndrome39and non-alcoholic fatty liver disease (NAFLD). Hepatitis C also makes people three to four times more likely to develop type 2 diabetes and insulin resistance40. There are multiple ways to measure insulin resistance such as fasting insulin levels or glucose tolerance tests.

[0049] In some embodiments, the prophylactic methods of the invention are particularly suitable for subjects who are identified as at high risk for metabolic disorders. Typically subject that are risk for metabolic disorders include patient with obesity, sedentary lifestyle, family history of diabetes, various health conditions, and certain medications.

[0050] Typically, a direct Sodium-Glucose-Co-Transporter-4 (SGLT4) inhibitors according to the invention includes but is not limited to:

[0051] A) Inhibitor of Sodium-Glucose-Co-Transporter-4 (SGLT4) activity such as, anti- SGLT4 antibody and Anti- SGLT4 aptamers

[0052] B) Inhibitor of Sodium-Glucose-Co-Transporter-4 (SGLT4) gene expression selected from the list consisting of antisense oligonucleotide, nuclease, siRNA, shRNA or ribozyme nucleic acid sequence.

[0053] A) Inhibitor of Sodium-Glucose-Co-Transporter-4 (SGLT4) activity

[0054] • Antibody

[0055] In one embodiment, the Sodium-Glucose-Co-Transporter-4 (SGLT4) inhibitor of activity is an antibody (the term including antibody fragment or portion) that can block directly or indirectly the Sodium-Glucose-Co-Transporter-4 (SGLT4) biological activity.

[0056] In preferred embodiment, the Sodium-Glucose-Co-Transporter-4 (SGLT4) antagonist may consist in an antibody directed against the Sodium-Glucose-Co-Transporter-4 (SGLT4), in such a way that said antibody binds to a Sodium-Glucose-Co-Transporter-4 (SGLT4) and able of neutralizing, blocking, inhibiting, abrogating, reducing or interfering with the biological activities of Sodium-Glucose-Co-Transporter-4 (SGLT4) ("neutralizing antibody").

[0057] Then, for this invention, neutralizing antibody of Sodium-Glucose-Co-Transporter-4 (SGLT4) are selected as above described for their capacity to (i) bind to Sodium-Glucose-Co- Transporter-4 (SGLT4) (protein) and / or (ii) inhibiting serum concentrations of SGLT4 substrates through blocking Sodium-Glucose-Co-Transporter-4 (SGLT4)-sugar transport process or restoring glucose sensitivity / tolerance and / or insulin sensitivity.

[0058] In one embodiment of the antibodies or portions thereof described herein, the antibody is a monoclonal antibody. In one embodiment of the antibodies or portions thereof described herein, the antibody is a polyclonal antibody. In one embodiment of the antibodies or portions thereof described herein, the antibody is a humanized antibody. In one embodiment of the antibodies or portions thereof described herein, the antibody is a chimeric antibody. In one embodiment of the antibodies or portions thereof described herein, the portion of the antibody comprises a light chain of the antibody. In one embodiment of the antibodies or portions thereof described herein, the portion of the antibody comprises a heavy chain of the antibody. In one embodiment of the antibodies or portions thereof described herein, the portion of the antibody comprises a Fab portion of the antibody. In one embodiment of the antibodies or portions thereof described herein, the portion of the antibody comprises a F(ab')2 portion of the antibody. In one embodiment of the antibodies or portions thereof described herein, the portion of the antibody comprises a Fc portion of the antibody. In one embodiment of the antibodies or portions thereof described herein, the portion of the antibody comprises a Fv portion of the antibody. In one embodiment of the antibodies or portions thereof described herein, the portion of the antibody comprises a variable domain of the antibody. In one embodiment of the antibodies or portions thereof described herein, the portion of the antibody comprises one or more CDR domains of the antibody.

[0059] As used herein, "antibody" includes both naturally occurring and non-naturally occurring antibodies. Specifically, "antibody" includes polyclonal and monoclonal antibodies, and monovalent and divalent fragments thereof. Furthermore, "antibody" includes chimeric antibodies, wholly synthetic antibodies, single chain antibodies, and fragments thereof. The antibody may be a human or nonhuman antibody. A nonhuman antibody may be humanized by recombinant methods to reduce its immunogenicity in man.

[0060] Antibodies are prepared according to conventional methodology. Monoclonal antibodies may be generated using the method of Kohler and Milstein41. To prepare monoclonal antibodies useful in the invention, a mouse or other appropriate host animal is immunized at suitable intervals (e.g., twice-weekly, weekly, twice-monthly or monthly) with antigenic forms of Sodium-Glucose-Co-Transporter-4 (SGTL4). The animal may be administered a final "boost" of antigen within one week of sacrifice. It is often desirable to use an immunologic adjuvant during immunization. Suitable immunologic adjuvants include Freund's complete adjuvant, Freund's incomplete adjuvant, alum, Ribi adjuvant, Hunter's Titermax, saponin adjuvants such as QS21 or Quil A, or CpG-containing immunostimulatory oligonucleotides. Other suitable adjuvants are well-known in the field. The animals may be immunized by subcutaneous, intraperitoneal, intramuscular, intravenous, intranasal or other routes. A given animal may be immunized with multiple forms of the antigen by multiple routes.

[0061] Briefly, the recombinant Sodium-Glucose-Co-Transporter-4 (SGTL4) may be provided by expression with recombinant cell lines or bacteria. Recombinant form of Sodium-Glucose- Co-Transporter-4 (SGTL4) may be provided using any previously described method. Following the immunization regimen, lymphocytes are isolated from the spleen, lymph node or other organ of the animal and fused with a suitable myeloma cell line using an agent such as polyethylene glycol to form a hydridoma. Following fusion, cells are placed in media permissive for growth of hybridomas but not the fusion partners using standard methods, as described42. Following culture of the hybridomas, cell supernatants are analyzed for the presence of antibodies of the desired specificity, i.e., that selectively bind the antigen. Suitable analytical techniques include ELISA, flow cytometry, immunoprecipitation, and western blotting. Other screening techniques are well-known in the field. Preferred techniques are those that confirm binding of antibodies to conformationally intact, natively folded antigen, such as non-denaturing ELISA, flow cytometry, and immunoprecipitation.

[0062] Significantly, as it is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W. R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). The Fc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab')2 fragment, retains both antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitopebinding ability in isolation. Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity determining regions (CDR1 through CDRS). The CDRs, and in particular the CDRS regions, and more particularly the heavy chain CDRS, are largely responsible for antibody specificity.

[0063] It is now well-established in the art that the non CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and / or Fc / pFc' regions to produce a functional antibody.

[0064] This invention provides in certain embodiments compositions and methods that include humanized forms of antibodies. As used herein, "humanized" describes antibodies wherein some, most or all of the amino acids outside the CDR regions are replaced with corresponding amino acids derived from human immunoglobulin molecules. Methods of humanization include, but are not limited to, those described in U.S. Pat. Nos. 4,816,567,5,225,539,5,585,089, 5,693,761, 5,693,762 and 5,859,205, which are hereby incorporated by reference. The above U.S. Pat. Nos. 5,585,089 and 5,693,761, and WO 90 / 07861 also propose four possible criteria which may be used in designing the humanized antibodies. The first proposal was that for an acceptor, use a framework from a particular human immunoglobulin that is unusually homologous to the donor immunoglobulin to be humanized, or use a consensus framework from many human antibodies. The second proposal was that if an amino acid in the framework of the human immunoglobulin is unusual and the donor amino acid at that position is typical for human sequences, then the donor amino acid rather than the acceptor may be selected. The third proposal was that in the positions immediately adjacent to the 3 CDRs in the humanized immunoglobulin chain, the donor amino acid rather than the acceptor amino acid may be selected. The fourth proposal was to use the donor amino acid reside at the framework positions at which the amino acid is predicted to have a side chain atom within 3 A of the CDRs in a three dimensional model of the antibody and is predicted to be capable of interacting with the CDRs. The above methods are merely illustrative of some of the methods that one skilled in the art could employ to make humanized antibodies. One of ordinary skill in the art will be familiar with other methods for antibody humanization. In one embodiment of the humanized forms of the antibodies, some, most or all of the amino acids outside the CDR regions have been replaced with amino acids from human immunoglobulin molecules but where some, most or all amino acids within one or more CDR regions are unchanged. Small additions, deletions, insertions, substitutions or modifications of amino acids are permissible as long as they would not abrogate the ability of the antibody to bind a given antigen. Suitable human immunoglobulin molecules would include IgGl, IgG2, IgG3, IgG4, IgA and IgM molecules. A "humanized" antibody retains a similar antigenic specificity as the original antibody. However, using certain methods of humanization, the affinity and / or specificity of binding of the antibody may be increased using methods of "directed evolution", as described by Wu et al., I. Mol. Biol. 294: 151, 1999, the contents of which are incorporated herein by reference.

[0065] Fully human monoclonal antibodies also can be prepared by immunizing mice transgenic for large portions of human immunoglobulin heavy and light chain loci. See, e.g., U.S. Pat. Nos. 5,591,669, 5,598,369, 5,545,806, 5,545,807, 6,150,584, and references cited therein, the contents of which are incorporated herein by reference. These animals have been genetically modified such that there is a functional deletion in the production of endogenous (e.g., murine) antibodies. The animals are further modified to contain all or a portion of the human germ-line immunoglobulin gene locus such that immunization of these animals will result in the production of fully human antibodies to the antigen of interest. Following immunization of these mice (e.g., XenoMouse (Abgenix), HuMAb mice (Medarex / GenPharm)), monoclonal antibodies can be prepared according to standard hybridoma technology. These monoclonal antibodies will have human immunoglobulin amino acid sequences and therefore will not provoke human anti-mouse antibody (KAMA) responses when administered to humans.

[0066] In vitro methods also exist for producing human antibodies. These include phage display technology (U.S. Pat. Nos. 5,565,332 and 5,573,905) and in vitro stimulation of human B cells (U.S. Pat. Nos. 5,229,275 and 5,567,610). The contents of these patents are incorporated herein by reference.

[0067] Thus, as will be apparent to one of ordinary skill in the art, the present invention also provides for F(ab') 2 Fab, Fv and Fd fragments; chimeric antibodies in which the Fc and / or FR and / or CDR1 and / or CDR2 and / or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric F(ab')2 fragment antibodies in which the FR and / or CDR1 and / or CDR2 and / or light chain CDR3 regions have been replaced by homologous human or non-human sequences; chimeric Fab fragment antibodies in which the FR and / or CDR1 and / or CDR2 and / or light chain CDR3 regions have been replaced by homologous human or non-human sequences; and chimeric Fd fragment antibodies in which the FR and / or CDR1 and / or CDR2 regions have been replaced by homologous human or non- human sequences. The present invention also includes so-called single chain antibodies.

[0068] The various antibody molecules and fragments may derive from any of the commonly known immunoglobulin classes, including but not limited to IgA, secretory IgA, IgE, IgG and IgM. IgG subclasses are also well known to those in the art and include but are not limited to human IgGl, IgG2, IgG3 and IgG4.

[0069] In another embodiment, the antibody according to the invention is a single domain antibody. The term “single domain antibody” (sdAb) or "VHH" refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals which are naturally devoid of light chains. Such VHH are also called “nanobody®”. According to the invention, sdAb can particularly be llama sdAb.

[0070] The skilled artisan can use routine technologies to use the antigen-binding sequences of these antibodies (e.g., the CDRs) and generate humanized antibodies for treatment of metabolic disorder (such as type 2 diabetes as disclosed herein).

[0071] The skilled artisan can use routine technologies to use the antigen-binding sequences of these antibodies (e.g., the CDRs) and generate humanized antibodies for treatment of metabolic disorder such as type 2 diabetes as disclosed herein.

[0072] • Aptamer

[0073] In another embodiment, the Sodium-Glucose-Co-Transporter-4 (SGLT4) antagonist / inhibitor is an aptamer directed against Sodium-Glucose-Co-Transporter-4 (SGLT4). aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed by Jayasena43. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods44. Then, for this invention, neutralizing aptamers of Sodium-Glucose-Co-Transporter-4 (SGLT4) are selected as above described for their capacity to (i) bind to Sodium-Glucose-Co- Transporter-4 (SGLT4) and / or (ii) inhibiting serum concentrations of SGLT4 substrates through blocking Sodium-Glucose-Co-Transporter-4 (SGLT4)-sugar transport process or restoring glucose sensitivity / tolerance and / or insulin sensitivity.

[0074] B) Inhibitor of Sodium-Glucose-Co-Transporter-4 (SGLT4) gene expression

[0075] In still another embodiment, the Sodium-Glucose-Co-Transporter-4 (SGLT4) antagonist is an inhibitor of Sodium-Glucose-Co-Transporter-4 (SGLT4) gene expression. An "inhibitor of expression" refers to a natural or synthetic compound that has a biological effect to inhibit the expression of a gene. Therefore, an "inhibitor of Sodium-Glucose-Co-Transporter- 4 (SGLT4) gene expression" denotes a natural or synthetic compound that has a biological effect to inhibit the expression of Sodium-Glucose-Co-Transporter-4 (SGLT4) gene (or the gene transcript : RNA).

[0076] In a preferred embodiment of the invention, said inhibitor of Sodium-Glucose-Co- Transporter-4 (SGLT4) gene expression is antisense oligonucleotide, nuclease, siRNA, shRNA or ribozyme nucleic acid sequence.

[0077] Inhibitors of Sodium-Glucose-Co-Transporter-4 (SGLT4) gene expression for use in the present invention may be based on antisense oligonucleotide constructs. Antisense oligonucleotides, including antisense RNA molecules and antisense DNA molecules, would act to directly block the translation of Sodium-Glucose-Co-Transporter-4 (SGLT4) mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of Sodium-Glucose-Co-Transporter-4 (SGLT4), and thus activity, in a cell. For example, antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding Sodium-Glucose-Co-Transporter-4 (SGLT4) can be synthesized, e.g., by conventional phosphodiester techniques and administered by e.g., intravenous injection or infusion. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732).

[0078] Small inhibitory RNAs (siRNAs) can also function as inhibitors of Sodium-Glucose- Co-Transporter-4 (SGLT4) gene expression for use in the present invention. Sodium-Glucose- Co-Transporter-4 (SGLT4) gene expression can be reduced by using small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that Sodium-Glucose-Co-Transporter-4 (SGTL4) gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA- encoding vector are well known in the art for genes whose sequence is known45'49, U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01 / 36646, WO 99 / 32619, and WO 01 / 68836).

[0079] Example of commercial siRNAs, against Sodium-Glucose-Co-Transporter-4 (SGLT4) include, but are not limited to: SLC5A9 siRNA (Santa Cruz, Cat No. sc-88339, USA) with the following sequences : sc- 88339A

[0080] Sense: CCAACAUUGCCUACCCUAAtt (SEQ ID N°l)

[0081] Antisense: UUAGGGUAGGCAAUGUUGGtt (SEQ ID N°2)

[0082] SC-88339B:

[0083] • Sense: CUCUUACUUUGCUGUCUAAtt (SEQ ID N°3)

[0084] • Antisense: UUAGACAGCAAAGUAAGAGtt (SEQ ID N°4) sc-88339C:

[0085] • Sense: CUUGACAAGUGGAGAAACAtt (SEQ ID N°5)

[0086] • Antisense: UGUUUCUCCACUUGUCAAGtt (SEQ ID N°6)

[0087] Inhibitors of Sodium-Glucose-Co-Transporter-4 (SGLT4) gene expression for use in the present invention may be based nuclease therapy (like Talen or Crispr).

[0088] The term “nuclease” or “endonuclease” means synthetic nucleases consisting of a DNA binding site, a linker, and a cleavage module derived from a restriction endonuclease which are used for gene targeting efforts. The synthetic nucleases according to the invention exhibit increased preference and specificity to bipartite or tripartite DNA target sites comprising DNA binding (i.e. TALEN or CRISPR recognition site(s)) and restriction endonuclease target site while cleaving at off-target sites comprising only the restriction endonuclease target site is prevented.

[0089] The guide RNA (gRNA) sequences direct the nuclease (i.e. Cas9 protein) to induce a site-specific double strand break (DSB) in the genomic DNA in the target sequence.

[0090] Restriction endonucleases (also called restriction enzymes) as referred to herein in accordance with the present invention are capable of recognizing and cleaving a DNA molecule at a specific DNA cleavage site between predefined nucleotides. In contrast, some endonucleases such as for example Fokl comprise a cleavage domain that cleaves the DNA unspecifically at a certain position regardless of the nucleotides present at this position. Therefore, preferably the specific DNA cleavage site and the DNA recognition site of the restriction endonuclease are identical. Moreover, also preferably the cleavage domain of the chimeric nuclease is derived from a restriction endonuclease with reduced DNA binding and / or reduced catalytic activity when compared to the wildtype restriction endonuclease.

[0091] According to the knowledge that restriction endonucleases, particularly type II restriction endonucleases, bind as a homodimer to DNA regularly, the chimeric nucleases as referred to herein may be related to homodimerization of two restriction endonuclease subunits. Preferably, in accordance with the present invention the cleavage modules referred to herein have a reduced capability of forming homodimers in the absence of the DNA recognition site, thereby preventing unspecific DNA binding. Therefore, a functional homodimer is only formed upon recruitment of chimeric nucleases monomers to the specific DNA recognition sites. Preferably, the restriction endonuclease from which the cleavage module of the chimeric nuclease is derived is a type IIP restriction endonuclease. The preferably palindromic DNA recognition sites of these restriction endonucleases consist of at least four or up to eight contiguous nucleotides. Preferably, the type IIP restriction endonucleases cleave the DNA within the recognition site which occurs rather frequently in the genome, or immediately adjacent thereto, and have no or a reduced star activity. The type IIP restriction endonucleases as referred to herein are preferably selected from the group consisting of: Pvull, EcoRV, BamHl, Bcnl, BfaSORF1835P, Bfil, Bgll, Bglll, BpuJl, Bse6341, BsoBl, BspD6I, BstYl, CfrlOl, Ecll8kl, EcoO1091, EcoRl, EcoRll, EcoRV, EcoR1241, EcoR12411, HinPl l, Hindi, Hindlll, Hpy991, Hpyl881, Mspl, Muni, Mval, Nael, NgoMIV, Notl, OkrAl, Pabl, Pad, PspGl, Sau3 Al, Sdal, Sfil, SgrAl, Thai, VvuYORF266P, Ddel, Eco571, Haelll, Hhall, Hindll, and Ndel.

[0092] Example of commercial gRNAs against Sodium-Glucose-Co-Transporter-4 (SGLT4) include, but are not limited to: SLC59gRNA Target sequence (from Cyagen) with the following sequence

[0093] Pair 1 : gRNAl (matches reverse strand of the gene): ATTTGGGCCATTCCTTGATATGG (SEQ ID N°7) gRNA2 (matches reverse (forward?) strand of the gene): GCTTGGTCAATACCTCCTTAAGG (SEQ ID N°8)

[0094] Pair 2: gRNA3 (matches reverse strand of the gene): GACTGGCCAAACTGTCATCGTGG (SEQ ID N°9) gRNA4 (matches forward strand of the gene) GTGATATTTCGTCAAGGAACTGG ((SEQ ID N°10) The gRNA were used by Cyagen to develop the Sglt4 Knock-out mouse model .

[0095] Other nuclease for use in the present invention are disclosed in WO 2010 / 079430, WO201 1072246, W02013045480,50’51.

[0096] Ribozymes can also function as inhibitors of Sodium-Glucose-Co-Transporter-4 (SGLT4) gene expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of Sodium-Glucose-Co-Transporter-4 (SGLT4) mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays.

[0097] Antisense oligonucleotides, siRNAs and ribozymes useful as inhibitors of Sodium- Glucose-Co-Transporter-4 (SGTL4) gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, antisense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and / or 3' ends of the molecule, or the use of phosphorothioate or 2'-O-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

[0098] Antisense oligonucleotides, siRNAs and ribozymes of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide, siRNA or ribozyme nucleic acid to the cells and preferably cells expressing Sodium-Glucose-Co-Transporter-4 (SGTL4). Preferably, the vector transports the nucleic acid within cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide, siRNA, gRNA or ribozyme nucleic acid sequences. Viral vectors are a preferred type of vectors and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art.

[0099] Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non- essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell line with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles)52,53

[0100] Preferred viruses for certain applications are the adenoviruses and adeno-associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno-associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hematopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion.

[0101] Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g., SANBROOK et al.54. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigenencoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC / CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and mi croencap sul ati on .

[0102] In a preferred embodiment, the antisense oligonucleotide, nuclease (i.e. CrispR with gRNA), siRNA, shRNA or ribozyme nucleic acid sequences are under the control of a heterologous regulatory region, e.g., a heterologous promoter. The promoter may be specific for the pancreatic or intestine cells.

[0103] Method of preventing or treating pathological conditions

[0104] The present invention further contemplates a method of preventing or treating metabolic disorder in a subject comprising administering to the subject a therapeutically effective amount of a Sodium-Glucose-Co-Transporter-4 (SGTL4) Inhibitor.

[0105] In a particular embodiment, the metabolic disorder is selected from the list consisting of overweight, obesity, hepatic steatosis or fatty liver, dyslipidemia and in particular, hypercholesterolemia and / or hypertriglyceridemia; hyperglycemia, insulin resistance and diabetes, preferably Type 2 diabetes, and gestational diabetes; metabolic syndrome, chronic renal failure, hypertension and cardiovascular diseases In a more particular embodiment, the metabolic disorder is selected from the list consisting of overweight, obesity, and diabetes, preferably Type 2 diabetes

[0106] Preferably, the metabolic disorder is Type 2 diabetes.

[0107] In one aspect, the present invention provides a method of inhibiting metabolic disorder in a subject comprising administering a therapeutically effective amount of a Direct Sodium- Glucose-Co-Transporter-4 (SGTL4) Inhibitor.

[0108] By a "therapeutically effective amount" of a Direct Sodium-Glucose-Co-Transporter-4 (SGTL4) Inhibitor as described above is meant a sufficient amount of the antagonist to prevent or treat a metabolic disorder. It will be understood, however, that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific polypeptide employed; and like factors well known in the medical arts. For example, it is well known within the skill of the art to start with doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicine typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg / kg to about 20 mg / kg of body weight per day, especially from about 0.001 mg / kg to 7 mg / kg of body weight per day.

[0109] The invention also relates to a method for treating a metabolic disorder in a subject having a high level of SGTL4 in a biological sample (such as in intestinal or pancreatic sample) with a Direct Sodium-Glucose-Co-Transporter-4 (SGTL4) Inhibitor.

[0110] The invention also relates to a method for treating a metabolic disorder in a subject having a higher level of SGTL4 in a biological sample (such as in intestinal or pancreatic sample) as compared to a predetermined refence value, with a Direct Sodium-Glucose-Co- Transporter-4 (SGTL4) Inhibitor. The invention also relates to Direct Sodium-Glucose-Co-Transporter-4 (SGTL4) Inhibitor for use in the treatment of a metabolic disorder in a subject having a high level of SGTL4 in a biological sample.

[0111] The invention also relates to Direct Sodium-Glucose-Co-Transporter-4 (SGTL4) Inhibitor for use in the treatment of a metabolic disorder in a subject having a higher level of SGTL4 in a biological sample as compared to a predetermined reference value.

[0112] As used herein, the term “predetermined reference value” refers to a threshold value or a cut-off value. A "threshold value", “reference value” or "cut-off value" can be determined experimentally, empirically, or theoretically. A threshold value can also be arbitrarily selected based upon the existing experimental and / or clinical conditions, as would be recognized by a person of ordinary skilled in the art. For example, retrospective measurement of the level of the marker of the invention (e.g. the at least one metabolite) in properly banked historical patient samples may be used in establishing the predetermined corresponding reference value. In some embodiments, the predetermined corresponding reference value is the median measured in the population of the patients for the marker of in the invention. In some embodiments, the threshold value has to be determined in order to obtain the optimal sensitivity and specificity according to the function of the test and the benefit / risk balance (clinical consequences of false positive and false negative). Typically, the optimal sensitivity and specificity (and so the threshold value) can be determined using a Receiver Operating Characteristic (ROC) curve based on experimental data. For example, after determining the level of the marker of the invention in a group of reference, one can use algorithmic analysis for the statistic treatment of the levels determined in samples to be tested, and thus obtain a classification standard having significance for sample classification. The full name of ROC curve is receiver operator characteristic curve, which is also known as receiver operation characteristic curve. It is mainly used for clinical biochemical diagnostic tests. ROC curve is a comprehensive indicator that reflects the continuous variables of true positive rate (sensitivity) and false positive rate (1- specificity). It reveals the relationship between sensitivity and specificity with the image composition method. A series of different cut-off values (thresholds or critical values, boundary values between normal and abnormal results of diagnostic test) are set as continuous variables to calculate a series of sensitivity and specificity values. Then sensitivity is used as the vertical coordinate and specificity is used as the horizontal coordinate to draw a curve. The higher the area under the curve (AUC), the higher the accuracy of diagnosis. On the ROC curve, the point closest to the far upper left of the coordinate diagram is a critical point having both high sensitivity and high specificity values. The AUC value of the ROC curve is between 1.0 and 0.5. When AUOO.5, the diagnostic result gets better and better as AUC approaches 1. When AUC is between 0.5 and 0.7, the accuracy is low. When AUC is between 0.7 and 0.9, the accuracy is moderate. When AUC is higher than 0.9, the accuracy is quite high. This algorithmic method is preferably done with a computer. Existing software or systems in the art may be used for the drawing of the ROC curve, such as: MedCalc 9.2.0.1 medical statistical software, SPSS 9.0, ROCPOWER.SAS, DESIGNROC.FOR, MULTIREADER POWER. SAS, CREATE-ROC.SAS, GB STAT VIO.O (Dynamic Microsystems, Inc. Silver Spring, Md., USA), etc.

[0113] The above method and use comprise the step of measuring the level of SGTL4 protein expression (protein or nucleic sequence (DNA or mRNA) in a biological sample obtained from said subject wherein and compared to a reference control value.

[0114] A high level of SGTL4 is predictive of a high risk of having or developing a metabolic disorder (such type 2 diabetes or insulin resistance) and means that Direct Sodium-Glucose- Co-Transporter-4 (SGTL4) Inhibitor could be used.

[0115] Typically, a biological sample is obtained from the subject and the level of SGTL4 is measured in this tissue sample (intestine and / or pancreas). Indeed, decreasing Sodium-Glucose- Co-Transporter-4 (SGTL4) level s / activity would be particularly beneficial in those patients displaying low levels of SGTL4.

[0116] Pharmaceutical compositions of the invention:

[0117] The Sodium-Glucose-Co-Transporter-4 (SGTL4) Inhibitor activity / inhibitor of Sodium-Glucose-Co-Transporter-4 (SGTL4) gene expression as described above may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions.

[0118] Accordingly, the present invention relates to a pharmaceutical composition comprising a Direct Sodium-Glucose-Co-Transporter-4 (SGTL4) Inhibitor according to the invention and a pharmaceutically acceptable carrier.

[0119] The present invention also relates to a pharmaceutical composition for use in the prevention or treatment of metabolic disorder (such as overweight, obesity, insulin resistance and diabetes, preferably Type 2 diabetes) comprising a Direct Sodium-Glucose-Co- Transporter-4 (SGTL4) Inhibitor according to the invention and a pharmaceutically acceptable carrier.

[0120] "Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.

[0121] In therapeutic applications, compositions are administered to a patient already suffering from a disease, as described, in an amount sufficient to cure or at least partially stop the symptoms of the disease and its complications. An appropriate dosage of the pharmaceutical composition is readily determined according to any one of several well-established protocols. For example, animal studies (for example on mice or rats) are commonly used to determine the maximal tolerable dose of the bioactive agent per kilogram of weight. In general, at least one of the animal species tested is mammalian. The results from the animal studies can be extrapolated to determine doses for use in other species, such as humans for example. What constitutes an effective dose also depends on the nature and severity of the disease or condition, and on the general state of the patient's health.

[0122] In therapeutic treatments, the antagonist / inhibitor contained in the pharmaceutical composition can be administered in several dosages or as a single dose until a desired response has been achieved. The treatment is typically monitored and repeated dosages can be administered as necessary. Compounds of the invention may be administered according to dosage regimens established whenever inactivation of Sodium-Glucose-Co-Transporter-4 (SGTL4) is required.

[0123] The daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg / kg to about 20 mg / kg of body weight per day, especially from about 0.001 mg / kg to 10 mg / kg of body weight per day. It will be understood, however, that the specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability, and length of action of that compound, the age, the body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the host undergoing therapy.

[0124] In the pharmaceutical compositions of the present invention for oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, local or rectal administration, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings. Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.

[0125] The appropriate unit forms of administration include forms for oral administration, such as tablets, gelatine capsules, powders, granules and solutions or suspensions to be taken orally, forms for sublingual and buccal administration, aerosols, implants, forms for subcutaneous, intramuscular, intravenous, intranasal or intraocular administration and forms for rectal administration.

[0126] In the pharmaceutical compositions of the present invention, the active principle is generally formulated as dosage units containing from 0.5 to 1000 mg, preferably from 1 to 500 mg, more preferably from 2 to 200 mg of said active principle per dosage unit for daily administrations.

[0127] When preparing a solid composition in the form of tablets, a wetting agent such as sodium laurylsulfate can be added to the active principle optionally micronized, which is then mixed with a pharmaceutical vehicle such as silica, gelatine, starch, lactose, magnesium stearate, talc, gum arabic or the like. The tablets can be coated with sucrose, with various polymers or other appropriate substances or else they can be treated so as to have a prolonged or delayed activity and so as to release a predetermined amount of active principle continuously.

[0128] A preparation in the form of gelatin capsules is obtained by mixing the active principle with a diluent such as a glycol or a glycerol ester and pouring the mixture obtained into soft or hard gelatine capsules.

[0129] A preparation in the form of a syrup or elixir can contain the active principle together with a sweetener, which is preferably calorie-free, methyl-paraben and propylparaben as an antiseptic, a flavoring and an appropriate color.

[0130] The water-dispersible powders or granules can contain the active principle mixed with dispersants or wetting agents, or suspending agents such as polyvinyl-pyrrolidone, and also with sweeteners or taste correctors.

[0131] The active principle can also be formulated as microcapsules or microspheres, optionally with one or more carriers or additives. Among the prolonged-release forms which are useful in the case of chronic treatments, implants can be used. These can be prepared in the form of an oily suspension or in the form of a suspension of microspheres in an isotonic medium.

[0132] The direct Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitors according to the invention can be administered by any suitable route of administration. For example, direct Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor according to the invention can be administered by oral (including buccal and sublingual), rectal, nasal, topical (intracolic), pulmonary, vaginal, or parenteral (including intramuscular, intra-arterial, intrathecal, subcutaneous and intravenous) administration.

[0133] For the direct Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitors according to the invention and in the preferred embodiment the SGLT4 inhibitor can be administered by oral (including buccal and sublingual), rectal or parenteral (including intramuscular, intra-arterial, intrathecal, subcutaneous and intravenous) administration.

[0134] The direct Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor of the present invention, may be formulated in a wide variety of oral administration dosage forms.

[0135] The term “preparation” is intended to include the formulation of the active compound with an encapsulating material as carrier, providing a capsule in which the active component, with or without carriers, is surrounded by a carrier, which is in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pulls, cachets, and lozenges may be as solid forms suitable for oral administration. Other forms suitable for oral administration include liquid form preparations including emulsions, syrups, elixirs, aqueous solutions, aqueous suspensions, or solid form preparations which are intended to be converted shortly before use to liquid form preparations. Emulsions may be prepared in solutions, for example, in aqueous propylene glycol solutions or may contain emulsifying agents, for example, such as lecithin, sorbitan monooleate, or acacia. Aqueous solutions can be prepared by dissolving the active component in water and adding suitable colorants, flavors, stabilizers, and thickening agents. Aqueous suspensions can be prepared by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well-known suspending agents. Solid form preparations include solutions, suspensions, and emulsions, and may contain, in addition to the active component, colorants, flavors, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilizing agents, and the like. Combination of SGLT4 inhibitor and SGLT2 inhibitor

[0136] Sodium-Glucose-Co-Transporter-2 (SGTL2) inhibitors, also called gliflozins, are actually used in the treatment of type 2 diabetes. SGLT2 is predominantly found in kidney tubules and in conjunction with SGLT1 resorbs glucose into the blood from the forming urine. By inhibiting SGLT2, and not targeting SGLT1, glucose is excreted, which in turn lowers blood glucose levels. Examples include dapagliflozin (Farxiga in US, Forxiga in EU), canagliflozin (Invokana) and empagliflozin (Jardiance). Specific SGLT2 inhibitors reduce cardiovascular death and hospitalizations with heart failure in patients with T2D55. The safety and efficacy of SGLT2 inhibitors have not been established in patients with type 1 diabetes, and FDA has not approved them for use in these patients (Research, Center for Drug Evaluation and (2018-12- 28). "Sodium -glucose Cotransporter-2 (SGLT2) Inhibitors". FDA) . The present invention relates to the identification of a new therapeutical target for metabolic diseases that contributes to the serum concentrations of various sugars during pathological conditions (obesity and T2D) : sodium-glucose-co-transporter 4 (SGLT4). Similar to SGLT2, SGLT4 functions as a glucose transporter involved in glucose reabsorption. However, SGLT4 also transports naturally occurring sugars, with a preference ranking of mannose, glucose, fructose, 1.5 AG, and galactose.

[0137] Accordingly, in order to treat metabolic disorders (such as overweight, obesity, and diabetes, preferably Type 2 diabetes and insulin resistance ) means that Direct Sodium-Glucose- Co-Transporter-4 (SGTL4) Inhibitor could be used in combination with an Sodium-Glucose- Co-Transporter-2 (SGTL2)inhibitor

[0138] In a particular embodiment, the metabolic disorder is selected from the list consisting of overweight, obesity, hepatic steatosis or fatty liver, dyslipidemia and in particular, hypercholesterolemia and / or hypertriglyceridemia; hyperglycemia, insulin resistance and diabetes, preferably Type 2 diabetes, and gestational diabetes; metabolic syndrome, chronic renal failure, hypertension and cardiovascular diseases.

[0139] In a more particular embodiment, the metabolic disorder is selected from the list consisting of overweight, obesity, insulin resistance and diabetes, preferably Type 2 diabetes Preferably, the metabolic disorder is Type 2 diabetes.

[0140] In some embodiments, the methods and use of the present invention further comprises the step of applying an Sodium-Glucose-Co-Transporter-2 (SGTL2) inhibitor.

[0141] Accordingly, the present invention also relates to a method of preventing or treating metabolic disorder in a subject comprising administering to the subject a therapeutically effective amount of a Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor and an an Sodium- Glucose-Co-Transporter-2 (SGTL2) inhibitor.

[0142] The present invention also relates to pharmaceutical composition comprising a Sodium- Glucose-Co-Transporter-4 (SGTL4) Inhibitor and a Sodium-Glucose-Co-Transporter-2 (SGTL2) inhibitor for simultaneous or sequential use in preventing or treating metabolic disorder.

[0143] The present invention also relates to a combination of a Sodium-Glucose-Co- Transporter-4 (SGTL4) inhibitor and a Sodium-Glucose-Co-Transporter-2 (SGTL2) inhibitor for simultaneous or sequential use in preventing or treating metabolic disorder..

[0144] The term “SGTL2 inhibitor” has its general meaning in the art and refers to a molecule (natural or synthetic) capable of neutralizing, blocking, inhibiting, abrogating, reducing or interfering with the biological activities of Sodium-Glucose-Co-Transporter-2 (SGTL2) (partially the same biological activity as Sodium-Glucose-Co-Transporter-4 (SGTL4) that is elevating serum glucose levels). Sodium-Glucose-Co-Transporter-2 (SGTL2) inhibitors include antibodies and antigen-binding fragments thereof, proteins, peptides, glycoproteins, glycopeptides, glycolipids, polysaccharides, oligosaccharides, nucleic acids, bioorganic molecules, peptidomimetics, pharmacological agents and their metabolites, transcriptional and translation control sequences, and the like. Inhibitors or antagonists also include, antagonist variants of the protein, siRNA molecules directed to a protein, antisense molecules directed to a protein, aptamers, and ribozymes against a protein. For instance, the Sodium-Glucose-Co- Transporter-2 (SGTL2) inhibitor or antagonist may be a molecule that binds to Sodium- Glucose-Co-Transporter-2 (SGTL2) and neutralizes, blocks, inhibits, abrogates, reduces or interferes with the biological activity of Sodium-Glucose-Co-Transporter-2 (SGTL2) (such biological activity being inhibiting serum glucose concentrations through blocking Sodium- Glucose-Co-Transporter-2 (SGLT2)-sugar transport process).

[0145] In some embodiments, the SGTL2 inhibitor of the present invention includes but is not limited to:

[0146] A) Inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) activity such as, small organic molecule or anti- SGTL2 antibody (neutralizing antibody)

[0147] B) Inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) gene expression selected from the list consisting of antisense oligonucleotide, nuclease, siRNA, shRNA or ribozyme nucleic acid sequence..

[0148] In a preferred embodiment, the therapeutic combination concern the same type of inhibitors : an inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) activity with an inhibitor Sodium-Glucose-Co-Transporter-4 (SGTL4) activity or an inhibitor of Sodium- Glucose-Co-Transporter-2 (SGTL2) gene expression with an inhibitor Sodium-Glucose-Co- Transporter-4 (SGTL4) gene expression.

[0149] In a particular embodiment the inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) activity is a small organic molecule (the term including chemical entities see above definition) that can block directly the biological activity of Sodium-Glucose-Co-Transporter-2 (SGTL2) which is selected from the list consisting of (include, but are not limited to) Dapagliflozin, Sotagliflozin, Canagliflozin, Licogliflozin, Empagliflozin , Ipragliflozin, Luseogliflozin, Tofogliflozin, Ertugliflozin, . . .

[0150] As used herein, the term "small organic molecule" refers to a molecule of size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g.; proteins, nucleic acids, etc.); preferred small organic molecules range in size up to 2000 Da, and most preferably up to about 1000 Da.

[0151] Examples of such inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) activity as a small organic molecule that can be used according to the present invention are disclosed in : 56,57

[0152] In still another embodiment, the Sodium-Glucose-Co-Transporter-2 (SGTL2) antagonist is an inhibitor of SGTL2 gene expression. An "inhibitor of expression" refers to a natural or synthetic compound that has a biological effect to inhibit the expression of a gene. Therefore, an "inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) gene expression" denotes a natural or synthetic compound that has a biological effect to inhibit the expression of Sodium-Glucose-Co-Transporter-2 (SGLT2) gene (or the gene transcript : RNA).

[0153] In a preferred embodiment of the invention, said inhibitor of Sodium-Glucose-Co- Transporter-2 (SGTL2)gene expression is antisense oligonucleotide, nuclease, siRNA, shRNA or ribozyme nucleic acid sequence.

[0154] Example of siRNAs against Sodium-Glucose-Co-Transporter-2 (SGTL2) that can be used according to the invention are disclosed in Scisciola L. et al.. Cardiovasc Diabetol. 2023; 22: 24..; Jiang M. et al PLoS One. 2014; 9(9): el08941.

[0155] In other words, the inventions relates to an inhibitor Sodium-Glucose-Co-Transporter- 4 (SGTL4) with an inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) for the simultaneous or sequential use for preventing or treating metabolic disorder in a subject in need thereof.

[0156] By a "therapeutically effective amount" is meant a sufficient amount of compound to treat and / or to prevent metabolic disorder. It will be understood that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific inhibitor employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.

[0157] The inhibitor Sodium-Glucose-Co-Transporter-4 (SGTL4) with the inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) according to the invention can be administered by any suitable route of administration. For example, thrombin according to the invention can be administered by oral (including buccal and sublingual), rectal, nasal, topical (intravesical), pulmonary, vaginal, or parenteral (including intramuscular, intra-arterial, intrathecal, subcutaneous and intravenous) administration or in a form suitable for administration by inhalation or insufflation.

[0158] Method of screening for treating metabolic disorder

[0159] A further object of the invention relates a method for screening a Sodium-Glucose-Co- Transporter-4 (SGTL4) inhibitor (or antagonist) for use in the treatment or prevention of metabolic disorder.

[0160] For example, the screening method may measure the binding of a candidate compound to Sodium-Glucose-Co-Transporter-4 (SGTL4), or to cells tissue sample or organism expressing SGLT4, or a fusion protein thereof by means of a label directly or indirectly associated with the candidate compound. Furthermore, the screening method may involve measuring or, qualitatively or quantitatively, detecting ability of said candidate compound to inactivate SGLT4 biological activity (see above definition).

[0161] In a particular embodiment, the screening method of the invention comprises the step consisting of:

[0162] (i) providing purified SGLT4 protein, providing a cell, tissue sample or organism expressing the SGLT4, (ii) providing a candidate compound such as small organic molecule, nucleic acids, antibodies, peptide or polypeptide,

[0163] (iii) measuring the activity of the SGLT4,

[0164] (iv) and selecting positively candidate compounds that, blocks the biological activity of SGLT4 or inhibits SGLT4 expression. .

[0165] In a particular embodiment, the screening method of the invention may further comprise a step consisting in administering the candidate compound selected at step d) to an animal model of metabolic disorder (i.e. Type 2 diabetes) to validate the protective effects of said candidate compound.

[0166] In general, such screening methods involve providing appropriate cells which express SGLT4. In particular, a nucleic acid encoding SGLT4 may be employed to transfect cells to thereby express the hormone of the invention. Such a transfection may be accomplished by methods well known in the art. In a particular embodiment, said cells may be selected from the group consisting of the mammal cells reported yet to express SGLT4 (e.g. pancreatic or renal cells).

[0167] The screening method of the invention may be employed for determining a SGLT4 inhibitor by contacting such cells with compounds to be screened and determining whether such compound inactivates SGLT4.

[0168] According to a one embodiment of the invention, the candidate compounds may be selected from a library of compounds previously synthesized, or a library of compounds for which the structure is determined in a database, or from a library of compounds that have been synthesized de novo or natural compounds. The candidate compound may be selected from the group of (a) proteins or peptides, (b) nucleic acids and (c) organic or chemical compounds (natural or not). Illustratively, libraries of pre-selected candidate nucleic acids may be obtained by performing the SELEX method as described in documents US 5,475,096 and US 5,270,163. Further illustratively, the candidate compound may be selected from the group of antibodies directed against SGLT4 and small organic molecule.

[0169] SGLT4 inhibition with the candidate compound can be tested by various known methods. For example glucose challenge (OGTT / iGTT) or glucose stimulated insulin secretion (GSIS) assay (see above) may be used for performing the screening method of the invention, (see example 1, figure 2). FIGURES:

[0170] Figure 1:. Metabolic phenotype, and selected SGLT and GLUT family of gene expression levels from obese non-diabetic and T2D individuals before and after weightloss surgery, (a) BMI, (b) post-load glucose measurements in obese non-diabetic individuals before and after weight-loss surgery, (c) post-load glucose measurements in obese T2D individuals before and after weight-loss surgery, (d-i) Scattered dot-plot analysis of SLC5A1, SLC5A9, SLC2A1, SL52A2, SIX'2A2.jand SLC2A5 gene expression levels in the intestine of obese individuals before and after bypass surgery. Specific p-values: **p < 0.01 ****p < 0.0001. Paired t-test

[0171] Figure 2: Phenotypic analysis of WT vs. Sglt4 KO mice fed the WD for 3 months. (A) Schematic representation of the strategy used to generate the Sglt4 KO mouse model, (B) weight change, (C) fasting glycemia, (D) OGTT, (E) plasma insulin levels following a glucose challenge, and (F) GSIS from isolated islets from WT vs. Sglt4 KO. Specific p values: *p < 0.05, t-test analysis, n = 4 - 5 mice per group

[0172] Figure 3: siRNA silencing of SCL5A9 gene in HK-2 cell line. qPCR analysis of SCL5A9 gene expression in HK-2 cells transfected with non-targeting pool siRNA (SCTRL-scramble) and siSCL5A9 siRNA for 48 hrs. n = 3 experiments and in triplicate. *p < 0.05

[0173] Figure 4: Metabolic Parameters in Sglt4 Knock-out (KO) vs. Sglt4 WT Mice on a Western Diet. Sglt4 KO mice consume the same amount of food and water but exhibit lower oxygen consumption compared to Sglt4 WT controls. Male mice were fed a Western diet for 20 weeks and then housed in metabolic cages for three days prior to the study. Over the next four days, the following metabolic parameters were measured: food intake (kcal / h) (A), water intake (ml / h) (B), oxygen consumption (ml / h) (C), carbon dioxide production (ml / h) (D), respiratory exchange ratio (E), and locomotor activity (F) (n = 7-8 mice per group). Data are presented as means ± s.e.m. Statistical analysis was performed using a two-way ANOVA test and Fisher’s LSD multiple comparison test, with * indicating p < 0.05 and ** indicating p < 0.005.

[0174] EXAMPLE 1:

[0175] Results

[0176] Using an existing collection of human tissues, referred to as the Biological Atlas of Severe Obesity (ABOS) from a cohort of 1600 patients, offered us a unique opportunity to explore the association of SLC5A9 (SGLT4) expression in patients before and after weight-loss surgery. From a selected number of obese patients with and without T2D (n = 50), we observed a significant reduction in BMI (p<0.0001) post-surgery (Figure 1A). This was accompanied by a marked reduction in glycemia after a glucose challenge (OGTT) (Figure 1B-C). From the same patients, we found that SLC5A1 (SGLT1) mRNA was also significantly reduced in both cohorts (Figure ID), as expected. However, we found a more profound decrease of SLC5A9 (SGLT4) mRNA expression (70%) levels post-surgery (Figure IE), compared to SLC5A1 (40%), suggesting that SLC5A1 is not the only active sugar transporter modulated by obesity, which was also significantly decreased post-surgery (Figure IF). However, SLC5A2 (SGLT2), SLC2A2 (GLUT2), and SLC2A5 (GLUT5) mRNA expression levels remained unchanged (Figure 1G-I). Collectively, these data demonstrate that reduced SLC5A9 mRNA levels are associated with significant weight loss in humans.

[0177] To investigate the role of SGLT4 in the progression of obesity to T2D, we created the first Sglt4 global KO mouse model, bred on C57BL / 6N background using CRISPR / Cas- mediated genome engineering, targeting exons 4 to 10 (Cyagen Bioscience’s) (Figure 2A). Both Sglt4 KO and control WT mice were fed the WD (Table 1) for 3 months. Intriguingly, the Sglt4 mutant mice displayed 16% less weight gain (Figure 2B), and reduced fasting glycemia (Figure 2C) with an improved glycaemic profile after an OGTT, compared to the WT mice fed the same diet (Figure 2D-E). To explore the chronic effect of the WD on islet function, islets were isolated from both groups, and a glucose-stimulated insulin secretion (GSIS) assay was performed by perifusion techniques. We observed that islets isolated from WT mice fed the WD showed impaired GSIS, compared to those of Sglt4 KO mice (Figure 2F). Collectively, these data demonstrate that Sglt4 KO mice maintained normal glucose tolerance and insulin sensitivity, thus supporting the notion that SGLT4 inhibition improves beta cell function. These mice are presently being maintained at our animal facility, and experiments are being reproduced in larger numbers. All animal experiments were approved by the University of Lille Animal Care and Use Ethical Committee (Number: 21875-2019081315329274)..

[0178] The expression level of SLC5A9 mRNA was previously studied in 12 human tissues by qPCR in a comparison with those of SLC5A1 and SLC5A2. Among the tissues tested, the small intestine and kidney expressed SLC5A9 mRNA at a relatively high level17Using RNAScope, we revealed that both SLC5A1 and SLC5A9 mRNA levels were highly expressed in the apical membrane of the intestine of a person with obesity. Slc5a9 mRNA was also detected, but lower, in the intestine of lean mice. No detectable expression was observed in the intestine of Sglt4 KO mice (Data not shown).

[0179] We also observed that Slc5a9 mRNA remained intact in the apical membrane of the Sgltl KO mouse (data not shown), thus confirming the specificity of the Slc5a9 probes. We have previously shown that both SLC5A1 and SLC5A2 were specifically expressed in human alpha cells58,59. Here, we show that SLC5A9 is mainly expressed in the exocrine pancreas and induced in the exocrine component of the pancreas of a person with obesity and T2D (Data not shown).

[0180] EXAMPLE 2: Oligonucleotides specific for mouse and human SGTL4

[0181] Method:

[0182] Cell culture

[0183] Human kidney 2 (HK-2) cells were cultured in DMEM (Invitrogen, Cat No. 41965, Netherlands, UK) 11 mM glucose supplemented with 10% FBS (Eurobio Scientific, Cat No. CVFSVG06-01, LES ULIS, France), 100 U / ml penicillin-streptomycin (P / S) (Gibco, Cat No. 15140-122, Grand Island, NY, USA), 0,01% insulin-Transferrin-Selenium (ITS) (Gibco, Cat No. 41400-045, Grand Island, NY, USA), 0,5ug / ml hydrocortisone (Sigma, Cat No. H0135, Steinheim, Germany), 10 ng / ml epidermal growth factor (EGF) (Sigma, Cat No. 9644, Steinheim, Germany) and 6,5 ng / ml triiodothyronine 3 (T3) (Sigma, Cat No. T5516, Steinheim, Germany). siRNA transfections

[0184] HK-2 cells (8 x 105cells) were seeded in a 25 cm2flask with DMEM complete media. After 24h, cells were washed once with PBS and transfected with 50 nmol / L non-targeting scrambled control (Dharmacon, Cat No. D-001810-10-20, USA), and 50 nmol / L human SGLT4 siRNA ON-TARGETplus (Santa Cruz, Cat No. sc-88339, USA) with Lipofectamine 3000 Transfection reagent (Therrmofisher Scientific, Cat. No. L3000001, France), according to the manufacturer’s instructions. Lipofectamine 3000 (7,5 ul) was diluted in Opti-MEM Medium (Gibco, Cat No. 31985-062, USA) (125 ul). siRNA was diluted in Opti-MEM Medium (125 ul). Lipofectamine 300 and siRNA were mixed and incubated at room temperature for 15 min. The siRNA-lipid complex was added to 2,5 ml of media without 10% FBS and 100 U / ml P / S. After 16 h, cells were changed to complete media. The cells were collected 48 h after transfection for RNA and protein extraction. All experiments were performed three times and in triplicated.

[0185] Results

[0186] To study the role of SGLT4 mainly in the intestine but also in other metabolic tissues such as pancreas or kidney, we optimized the siRNA-mediated gene silencing technique. For that we used an immortalized human kidney proximal tubule epithelial cell line (HK-2) that express SLC5A9 gene (encoding SGLT4 protein). After 48 h, SGLT4 siRNA effectively reduced (around 57%) the gene expression of SLC5A9 compared with non-targeting siRNA control (Scramble).

[0187] EXAMPLE 3 :

[0188] Methods

[0189] Metabolic cages

[0190] Sglt4 WT and Sglt4 KO mice fed a Western diet were used to conduct a high-resolution metabolic and behavioral phenotypic study utilizing Promethion Core^ / E cages (n = 7-8 mice per group). Mice were housed individually for seven days in the cages: three days for adaptation and four days for recording. This setup allowed simultaneous measurement of energy expenditure, physical activity, indirect calorimetry, and food and water consumption. Continuous measurements of 02 consumption and CO2 production enabled the calculation of the respiratory quotient to reflect energy expenditure. Horizontal and vertical movements (XYZ-axis) within the metabolic cage were monitored to quantify physical activity. The system also recorded food and water consumption and the mass of the mice. The analysis software synchronized data on body mass, food intake, water intake, mouse movement, and wheel revolutions, providing a comprehensive platform for behavior analysis. The experiment kept the same conditions of temperature, humidity, and air composition as in the housing. Data was analyzed using CalR Version 1.3.

[0191] In Situ Hybridization Techniques - RNAscope for Paraffin-Embedded (FFPE) Tissues Tissue Preparation

[0192] Mouse and human metabolic tissues were fixed in 4% PFA for 3 hours and 32 hours, respectively. The samples were then transferred to 70% ethanol and embedded in paraffin blocks. Human islets (1000 IEQ) were washed twice with IX PBS before being fixed with 4% PFA-PBS for 1 hour. Following fixation, the islets were washed twice with IX PBS and preserved in 80-100 pL of pre-heated histogel (Thermo Scientific, Cat No. HG-4000-012, UK). The histogel containing human islets was then transferred to 70% ethanol and embedded in paraffin blocks. RNA In Situ Hybridization

[0193] RNA in situ hybridization was performed using the RNAscope® Multiplex Fluorescent Reagent Kit v2 (Advanced Cell Diagnostics, Cat. No. 323100-USM, USA), following the manufacturer’s guidelines. Probes were used to target mRNA coding for the Sglt4 protein in mice (Advanced Cell Diagnostics, Cat. No. 895321-C2, USA) and the Sgltl protein in mice (Advanced Cell Diagnostics, Cat. No. 475981, USA).

[0194] Slide Preparation

[0195] Tissue sections of 5 pm were baked for 1 hour in a HybEZ hybridization oven (Advanced Cell Diagnostics, Cat. No. 321720). The slides were deparaffinized in xylene twice (5 min each), then dehydrated in 100% ethanol (2 times, 5 min each). Tissue sections were treated with hydrogen peroxide for 10 min before being washed with distilled water. For antigen retrieval, slides were immersed in the kit solution IX for 8 min for human / mouse islets in histogel, 15 min for human and mouse intestine / kidney and pancreas, or 30 min for human and mouse liver at boiling temperature (99 °C) using a steamer (Braun, Cat. No. F S3000). The samples were then rinsed in deionized water for 15 s and immediately incubated with 100% ethanol for 3 min at room temperature. A hydrophobic barrier was drawn with a Dako pen (Agilent Dako, Cat. No. S2002, Denmark), and tissue sections were treated for 8 min with protease plus and washed with distilled water. The slides were incubated at 40°C in a HybZ hybridization oven in the following order: target probes for 2 hours, amplifier 1 for 30 min, amplifier 2 for 30 min, amplifier 3 for 15 min, and HRP-C 1 / 2 / 3 for 15 min. After each hybridization step, slides were washed with IX wash buffer twice for 2 min each at room temperature. Finally, tissues were incubated with the TSA Plus Cyanine 3 fhiorophore (Akoya, Cat. No. NEL744001KT, USA) diluted 1 : 1500 in TSA buffer (Advanced Cell Diagnostics, Cat. No. 322809, USA) for 30 min at 40°C. Before proceeding to immunofluorescence, the slides were incubated with the blocker for 15 min.

[0196] Controls and Imaging

[0197] Assays using archival FFPE specimens included parallel processing with positive and negative controls to ensure interpretable results. Controls used were:

[0198] Positive control for mouse: Advanced Cell Diagnostics, Cat. No. 320871, USA Positive control for human: Advanced Cell Diagnostics, Cat. No. 320861, USA Negative control for both species: Advanced Cell Diagnostics, Cat. No. 320881, USA Images were acquired using the Zeiss LSM 710 confocal microscope with the Airyscan superresolution module (Zeiss, Germany) and the Zeiss Spinning Disk confocal microscope. Images were captured using a 40 / objective (Jena, Germany) with immersion oil and processed and adjusted using ImageJ, version 1.8.0 172 / 1 ,53q99 (https: / / imagej.nih.gov / ij).

[0199] Results

[0200] Metabolic Cage Analysis in Sglt4 WT vs. Sglt4 KO Mice Fed a Western Diet

[0201] Metabolic parameters such as whole-body oxygen consumption, energy expenditure, substrate utilization, and behaviors like food intake and physical activity are crucial for understanding an organism’s metabolic profile. To investigate these aspects, Sglt4 WT and Sglt4 KO mice fed a Western diet (WD) for 18 weeks were analyzed using a metabolic cages system. A key aspect of obesity is energy balance. An increase in food intake or a decrease in energy expenditure can predispose mice to weight gain. Observing changes in these parameters can provide insights into the mechanisms of action in specific obesity models. While fat accumulation involves more complex interactions than simply energy in (food intake) versus energy out (energy expenditure), these factors are essential to measure. Energy expenditure consists of four components: basal energy expenditure or resting metabolic rate, energy expenditure due to the thermic effect of food, energy required for thermoregulation, and energy spent on physical activity62. In this study, we measured food and water intake, oxygen consumption, carbon dioxide production, and physical activity (distance traveled within the cage) daily in all mice. These measurements allowed us to evaluate the metabolic phenotype of Sglt4 WT and Sglt4 KO mice under the influence of a Western diet, providing valuable data on energy balance and metabolic health.

[0202] Metabolic Findings in Sglt4 WT and Sglt4 KO Mice Fed a Western Diet

[0203] The Sglt4 WT and Sglt4 KO mice exhibited similar food consumption patterns, with higher intake during the dark phase compared to the light phase, indicating that the reduced weight observed in the Sglt4 KO mice is not due to lower food intake (Figure 4A). Water intake was also similar among the groups, suggesting that Sglt4 WT mice do not exhibit glycosuria, unlike Sglt2 KO mice (Figure 4B) (PMID: 21330458). We measured whole-body 02 consumption and CO2 production through indirect calorimetry, which involved assessing the concentrations of inspired and expired 02 and CO2 to indirectly measure heat production. As nocturnal animals, mice showed decreased activity during light phases. Notably, Sglt4 KO mice exhibited lower oxygen consumption and CO2 production (Figure 4C-D). A key metabolic parameter of interest is the respiratory exchange ratio (RER), which is the ratio of CO2 produced to 02 consumed and serves as an indicator of the proportion of substrate (carbohydrate or fat) being utilized for energy production. The significantly lower RER in Sglt4 KO mice, alongside their reduced oxygen consumption, suggests a higher utilization of fat over carbohydrates (Figure 4E). Physical activity levels, another contributor to energy expenditure, were similar between the groups, indicating that increased movement did not drive the less obese phenotype observed in the Sglt4 KO mice (Figure 4F).

[0204] Weight Gain and Metabolic Insights in Sglt4 KO vs. Sglt4 WT Mice on a Western Diet

[0205] As previously noted, Sglt4 KO mice exhibited less weight gain compared to Sglt4 WT mice despite both groups consuming a Western diet (WD). Our metabolic cages study confirmed that this difference in weight gain is not due to reduced food intake in Sglt4 KO mice. Previous studies have shown that Sgltl is prominently expressed in brain regions associated with learning, regulation of feeding behavior, energy expenditure, and glucose homeostasis, similar to Sglt260>61.63.64.65.66.67wehypothesized that Sglt4 might also play a role in such regulatory processes within the brain. However, our investigation did not detect any evidence of Slc5a9 mRNA expression in the four sensory circumventricular organs of the brain (median eminence, vascular organ of the lamina terminalis, subfornical organ, and area postrema) in mice fed either a standard chow diet or a high-fat diet (HFD).

[0206] DISCUSSION

[0207] SGLT4 inhibition shows promise across several potential indications. Firstly, targeting obesity through SGLT4 inhibition could reduce the absorption of sugars from Western diets, potentially aiding weight loss and preventing associated complications such as obesity, prediabetes, T2D, chronic renal failure, and liver and pancreatic cancers. Moreover, targeting SGLT4 may benefit cardiovascular health by lowering elevated blood sugar levels, like mannose, which are linked to increased cardiovascular risk (PMID: 38055929; PMID: 27345421). Additionally, SGLT4 inhibition could have therapeutic implications for metabolic- associated fatty liver disease (MAFLD) by reducing liver metabolic stress through decreased sugar (fructose) absorption, potentially slowing disease progression and improving liver health. GLUT5, a fructose-transporting member of the facilitative glucose transporter (GLUT, SLC2) family, is a therapeutic target for diabetes and cancer but has no potent inhibitors (PMID: 27074918). Deleting GLUT5 in mice leads to severe nutrient absorption defects and volume depletion when subjected to a high fructose diet, making GLUT5 inhibitors impractical for therapeutic use (PMID: 19091748). Additionally, GLUT5 is not expressed in the pancreas, limiting its potential impact on metabolic regulation. In contrast, SGLT4 is expressed in the pancreas, and its inhibition can effectively reduce the uptake of sugars prevalent in the Western diet, offering a more viable and targeted therapeutic strategy. In the context of pancreatic cancer, where increased SGLT4 gene expression is observed in conditions such as obesity and T2D (data not shown), inhibiting this transporter could mitigate excessive sugar uptake by pancreatic cells (endocrine and exocrine), potentially reducing cancer risk. Lastly, SGLT4 inhibition could support metabolic health post-weight loss surgery by moderating intestinal sugar absorption, complementing surgical effects and sustaining long-term metabolic improvements. Among these indications, a particular attention is needed on obesity, which is closely linked to prediabetes and affects over 1 billion people worldwide (PMID: 37196350; PMID: 38432237). Given the urgent need for effective interventions, targeting obesity with SGLT4 inhibition holds great promise. The success of SGLT2 inhibitors in managing T2D provides a compelling rationale for exploring SGLT4 inhibition earlier, potentially offering broader metabolic benefits and a significant impact on public health.

[0208] In summary, while SGLT4 inhibition holds promise across various health conditions, prioritizing obesity and prediabetes aligns with clinical needs, established therapeutic mechanisms, and the potential for significant metabolic improvements worldwide.

[0209] Table section

[0210] Table 1: Composition of the Western diet media used for in vitro experiments Table 2: Useful nucleotide for practicing the invention REFERENCES:

[0211] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. 1. Organization, W.H. Obesity and overweight. (2020).

[0212] 2. Hall, K.D. Did the Food Environment Cause the Obesity Epidemic? Obesity 26, 11-13 (2018).

[0213] 3. Ogden, C.L., Carroll, M.D., Kit, B.K. & Flegal, K.M. Prevalence of obesity in the United States, 2009-2010. NCHS data brief, 1-8 (2012).

[0214] 4. Lauby-Secretan, B., et al. Body Fatness and Cancer— Viewpoint of the IARC Working Group. The New England journal of medicine 375, 794-798 (2016).

[0215] 5. Mortality, G.B.D. & Causes of Death, C. Global, regional, and national life expectancy, all-cause mortality, and cause-specific mortality for 249 causes of death, 1980- 2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet 388, 1459- 1544 (2016).

[0216] 6. Khan, T.A. & Sievenpiper, J.L. Controversies about sugars: results from systematic reviews and meta-analyses on obesity, cardiometabolic disease and diabetes. Eur JNutr 55, 25-43 (2016).

[0217] 7. Sacks, F.M., et al. Dietary Fats and Cardiovascular Disease: A Presidential Advisory From the American Heart Association. Circulation 136, el-e23 (2017).

[0218] 8. Wood, I.S. & Trayhurn, P. Glucose transporters (GLUT and SGLT): expanded families of sugar transport proteins. The British journal of nutrition 89, 3-9 (2003).

[0219] 9. Vuilleumier, S. Worldwide production of high-fructose syrup and crystalline fructose. The American journal of clinical nutrition 58, 733S-736S (1993).

[0220] 10. Cordain, L., et al. Origins and evolution of the Western diet: health implications for the 21st century. The American journal of clinical nutrition 81, 341-354 (2005).

[0221] 11. Naja, F., et al. A Western dietary pattern is associated with overweight and obesity in a national sample of Lebanese adolescents (13-19 years): a cross-sectional study. The British journal of nutrition 114, 1909-1919 (2015).

[0222] 12. Willett, W.C. Dietary fat and obesity: an unconvincing relation. The American journal of clinical nutrition 68, 1149-1150 (1998).

[0223] 13. Duan, W ., et al. Hyperglycemia, a neglected factor during cancer progression. Biomed Res lnt 2014, 461917 (2014).

[0224] 14. Saponaro, C., et al. The GLP1R Agonist Liraglutide Reduces Hyperglucagonemia Induced by the SGLT2 Inhibitor Dapagliflozin via Somatostatin Release. Cell reports 28, 1447-1454 el444 (2019). 15. Jabbour, S.A. & Goldstein, B.J. Sodium glucose co-transporter 2 inhibitors: blocking renal tubular reabsorption of glucose to improve glycaemic control in patients with diabetes. International journal of clinical practice 62. 1279-1284 (2008).

[0225] 16. Olshansky, S.J., et al. A potential decline in life expectancy in the United States in the 21st century. The New England journal of medicine 352, 1138-1145 (2005).

[0226] 17. Tazawa, S., et al. SLC5A9 / SGLT4, a new Na+-dependent glucose transporter, is an essential transporter for mannose, 1,5-anhydro-D-glucitol, and fructose. Life sciences 76, 1039-1050 (2005).

[0227] 18. Wright, E.M., Hirayama, B.A. & Loo, D.F. Active sugar transport in health and disease. Journal of internal medicine 261, 32-43 (2007).

[0228] 19. Alton, G., et al. Direct utilization of mannose for mammalian glycoprotein biosynthesis. Glycobiology 8, 285-295 (1998).

[0229] 20. De la Horra, M.C., et al. Na+-dependent d-mannose transport at the apical membrane of rat small intestine and kidney cortex. Biochimica et Biophysica Acta (BBA) - Biomembranes 1512, 225-230 (2001).

[0230] 21. Pitkanen, E. & Pitkanen, O.M. Renal tubular reabsorption of 1,5-anhydro-D-glucitol and D-mannose in vivo in the rat. P fingers Ar chiv : European journal of physiology 420, 367- 375 (1992).

[0231] 22. Wright, E.M. Renal Na(+)-glucose cotransporters. American journal of physiology. Renal physiology 280, Fl 0-18 (2001).

[0232] 23. Lee, S., et al. Integrated Network Analysis Reveals an Association between Plasma Mannose Levels and Insulin Resistance. Cell metabolism 24, 172-184 (2016).

[0233] 24. Yoshimura, K., et al. Plasma mannose level, a putative indicator of glycogenolysis, and glucose tolerance in Japanese individuals. Journal of diabetes investigation 8, 489-495 (2017).

[0234] 25. Kawasaki, T., et al. Postprandial plasma fructose level is associated with retinopathy in patients with type 2 diabetes. Metabolism: clinical and experimental 53, 583-588 (2004).

[0235] 26. Sharma, V., Ichikawa, M. & Freeze, H.H. Mannose metabolism: more than meets the eye. Biochemical and biophysical research communications 453, 220-228 (2014).

[0236] 27. Sone, H., et al. Physiological changes in circulating mannose levels in normal, glucose-intolerant, and diabetic subjects. Metabolism: clinical and experimental 52, 1019- 1027 (2003). 28. Chen, J., et al. Quantitative PCR tissue expression profiling of the human SGLT2 gene and related family members. Diabetes therapy : research, treatment and education of diabetes and related disorders 1, 57-92 (2010).

[0237] 29. Organization, W.H. Diabetes Fact sheet N°312. (2011).

[0238] 30. Pasquel, F.J. & Umpierrez, G.E. Hyperosmolar hyperglycemic state: a historic review of the clinical presentation, diagnosis, and treatment. Diabetes care 37, 3124-3131 (2014).

[0239] 31. Mackay, I., Rose N. The Autoimmune Diseases. Academic Press, 57 (2014).

[0240] 32. Diseases, N.I.o.D.a.D.a.K. Diagnosis of Diabetes and Prediabetes. (2014).

[0241] 33. Maruthur, N.M., et al. Diabetes Medications as Monotherapy or Metformin-Based Combination Therapy for Type 2 Diabetes: A Systematic Review and Meta-analysis. Annals of internal medicine 164, 740-751 (2016).

[0242] 34. Krentz, A. J. & Bailey, C. J. Oral antidiabetic agents: current role in type 2 diabetes mellitus. Drugs 65, 385-411 (2005).

[0243] 35. Cetinkunar, S., Erdem, H., Aktimur, R. & Sozen, S. Effect of bariatric surgery on humoral control of metabolic derangements in obese patients with type 2 diabetes mellitus: How it works. World J Clin Cases 3, 504-509 (2015).

[0244] 36. Disease, G.B.D., Injury, I. & Prevalence, C. Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet 388, 1545-1602 (2016).

[0245] 37. Imperatore, G., et al. Projections of type 1 and type 2 diabetes burden in the U.S. population aged <20 years through 2050: dynamic modeling of incidence, mortality, and population growth. Diabetes care 35, 2515-2520 (2012).

[0246] 38. Mandal, N., et al. Role of ceramides in the pathogenesis of diabetes mellitus and its complications. Journal of diabetes and its complications 35, 107734 (2021).

[0247] 39. Nafiye, Y., et al. The effect of serum and intrafollicular insulin resistance parameters and homocysteine levels of nonobese, nonhyperandrogenemic polycystic ovary syndrome patients on in vitro fertilization outcome. Fertil Steril 93, 1864-1869 (2010).

[0248] 40. Milner, K.L., et al. Chronic hepatitis C is associated with peripheral rather than hepatic insulin resistance. Gastroenterology 138, 932-941 e931-933 (2010).

[0249] 41. Kohler, G. & Milstein, C. Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256, 495-497 (1975). 42. Goding, J. Coding, Monoclonal Antibodies: Principles and Practice: Production and Application of Monoclonal Antibodies in Cell Biology, Biochemistry and Immunology. 3rd edition, Academic Press, New York (f 996).

[0250] 43. Jayasena, S.D. Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clinical chemistry 45, 1628-1650 (1999).

[0251] 44. Colas, P., et al. Genetic selection of peptide aptamers that recognize and inhibit cyclin-dependent kinase 2. Nature 380, 548-550 (1996).

[0252] 45. Tuschl, T., Zamore, P.D., Lehmann, R., Bartel, D.P. & Sharp, P.A. Targeted mRNA degradation by double-stranded RNA in vitro. Genes & development 13, 3191-3197 (1999).

[0253] 46. Elbashir, S.M., et al. Duplexes of 21 -nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498 (2001).

[0254] 47. Hannon, G.J. RNA interference. Nature 418, 244-251 (2002).

[0255] 48. McManus, M.T. & Sharp, P.A. Gene silencing in mammals by small interfering RNAs. Nat Rev Genet 3, 737-747 (2002).

[0256] 49. Brummelkamp, T.R., Bernards, R. & Agami, R. A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550-553 (2002).

[0257] 50. Mussolino, C. & Cathomen, T. TALE nucleases: tailored genome engineering made easy. Curr Opin Biotechnol 23, 644-650 (2012).

[0258] 51. Touhami, S., et al. Expert opinion on the use of biological therapy in non-infectious uveitis. Expert Opin Biol Ther 19, 477-490 (2019).

[0259] 52. Kriegler, M. Gene transfer and expression: A laboratory manual. W.H. Freeman C.O., New York (1990).

[0260] 53. Murry, E.J. Methods in Molecular Biology. Humana Press, Inc., Cliffton, New Jersey 7(1991).

[0261] 54. Sambrook, J., Fritsch, E. R., & Maniatis, T. Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. (1989).

[0262] 55. Zinman, B., et al. Empagliflozin, Cardiovascular Outcomes, and Mortality in Type 2 Diabetes. The New England journal of medicine 373, 2117-2128 (2015).

[0263] 56. Sano, R., Shinozaki, Y. & Ohta, T. Sodium-glucose cotransporters: Functional properties and pharmaceutical potential. Journal of diabetes investigation 11, 770-782 (2020).

[0264] 57. Shaffner, J., Chen, B., Malhotra, D.K., Dworkin, L.D. & Gong, R. Therapeutic Targeting of SGLT2: A New Era in the Treatment of Diabetes and Diabetic Kidney Disease. Front Endocrinol (Lausanne) 12, 749010 (2021). 58. Bonner, C., et al. Inhibition of the glucose transporter SGLT2 with dapagliflozin in pancreatic alpha cells triggers glucagon secretion. Nature medicine (2015).

[0265] 59. Saponaro, C., et al. Inter-Individual Heterogeneity of SGLT2 Expression and Function in Human Pancreatic Islets. Diabetes (2020).

[0266] 60. Chen, J., S. Williams, S. Ho, H. Loraine, D. Hagan, J. M. Whaley and J. N. Feder (2010). "Quantitative PCR tissue expression profiling of the human SGLT2 gene and related family members." Diabetes Ther 1(2): 57-92.

[0267] 61. Fan, X., O. Chan, Y. Ding, W. Zhu, J. Mastaitis and R. Sherwin (2015). "Reduction in SGLT1 mRNA Expression in the Ventromedial Hypothalamus Improves the Counterregulatory Responses to Hypoglycemia in Recurrently Hypoglycemic and Diabetic Rats." Diabetes 64(10): 3564-3572.

[0268] 62. Hill, J. O., H. R. Wyatt and J. C. Peters (2012). "Energy balance and obesity." Circulation 126(1): 126-132.

[0269] 63. Nishimura, M. and S. Naito (2005). "Tissue-specific mRNA expression profiles of human ATP -binding cassette and solute carrier transporter superfamilies." Drug Metab Pharmacokinet 20(6): 452-477.

[0270] 64. O'Malley, D., F. Reimann, A. K. Simpson and F. M. Gribble (2006). "Sodium-coupled glucose cotransporters contribute to hypothalamic glucose sensing." Diabetes 55(12): 3381- 3386.

[0271] 65. Poppe, R., U. Karbach, S. Gambaryan, H. Wiesinger, M. Lutzenburg, M. Kraemer, O. W. Witte and H. Koepsell (1997). "Expression of the Na+-D-glucose cotransporter SGLT1 in neurons." J Neurochem 69(1): 84-94.

[0272] 66. Vallon, V., K. A. Platt, R. Cunard, J. Schroth, J. Whaley, S. C. Thomson, H. Koepsell and T. Rieg (2011). "SGLT2 mediates glucose reabsorption in the early proximal tubule." J Am Soc Nephrol 22(1): 104-112.

[0273] 67. Wright, E. M., D. D. Loo and B. A. Hirayama (2011). "Biology of human sodium glucose transporters." Physiol Rev 91(2): 733-794.

Claims

CLAIMS:

1. A Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use in the treatment of a patient affected with a metabolic disorder.

2. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to claim 1 wherein said inhibitor directly binds to Sodium-Glucose-Co-Transporter- 4 (SGTL4) (protein or nucleic sequence (DNA or mRNA)) and / or ii) inhibits serum concentrations of SGLT4 substrates (through blocking Sodium-Glucose- Co-Transporter-4 (SGLT4) transport sugar process) and / or iii) elevating glucose sensitivity / tolerance and / or insulin sensitivity.

3. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to claim 1 to 2 wherein metabolic disorder is selected from the list consisting of overweight, obesity, hepatic steatosis or fatty liver, dyslipidemia and in particular, hypercholesterolemia and / or hypertriglyceridemia; hyperglycemia, insulin resistance and diabetes, preferably Type 2 diabetes and gestational diabetes; metabolic syndrome, chronic renal failure, hypertension and cardiovascular diseases.

4. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to claim 3 wherein the metabolic disorder is selected from the list consisting of overweight, obesity, insulin resistance and diabetes, preferably Type 2 diabetes.

5. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to claim 4 wherein the metabolic disorder is Type 2 diabetes.

6. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to any of claim 1 to 5 to prevent the progression of the metabolic disease to pancreatic cancer, liver cancer, colorectal cancer, kidney cancer, uterine cancer or breast cancer.

7. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to any one of claim 1 to 6 wherein said inhibitor is1) an inhibitor of Sodium-Glucose-Co-Transporter-4 (SGTL4) activity and / or2) an inhibitor of Sodium-Glucose-Co-Transporter-4 (SGTL4) gene expression.

8. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to claim 7 wherein said inhibitor of Sodium-Glucose-Co-Transporter-4 (SGTL4) activity is selected from the list consisting of an anti-Sodium-Glucose-Co- Transporter-4 (SGTL4) neutralizing antibody, an anti-Sodium-Glucose-Co- Transporter-4 (SGTL4) aptamer.

9. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to claim 7 wherein the inhibitor of Sodium-Glucose-Co-Transporter-4 (SGTL4) gene expression is selected from the list consisting of antisense oligonucleotide, nuclease, siRNA, shRNA or ribozyme nucleic acid sequence.

10. The Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use according to any one of claim 1 to 9, in a subject having a higher level of SGTL4 in a biological sample as compared to a predetermined reference value.

11. A method of preventing or treating metabolic disorder in a subject comprising administering to the subject a therapeutically effective amount of a Sodium- Glucose-Co-Transporter-4 (SGTL4) inhibitor and an Sodium-Glucose-Co- Transporter-2 (SGTL2) inhibitor.

12. The method of preventing or treating metabolic disorder according to claim 11 wherein said Sodium-Glucose-Co-Transporter-2 (SGTL2) inhibitor is(A) Inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) activity such as small organic molecule or anti- SGTL2 antibody (neutralizing antibody)B) Inhibitor of Sodium-Glucose-Co-Transporter-2 (SGTL2) gene expression selected from the list consisting of antisense oligonucleotide, nuclease, siRNA, shRNA or ribozyme nucleic acid sequence.

13. The method of preventing or treating according to claim 11 and 12 wherein the metabolic disorder is selected from the list consisting of overweight, obesity, hepatic steatosis or fatty liver, dyslipidemia and in particular, hypercholesterolemia and / or hypertriglyceridemia; hyperglycemia, insulin resistance and diabetes, preferably Type 2 diabetes mellitus and gestationaldiabetes; metabolic syndrome, chronic renal failure, hypertension and cardiovascular diseases14. The method of preventing or treating according to claim 13 wherein the metabolic disorder is selected from the list consisting of overweight, obesity, insulin resistance and diabetes, preferably Type 2 diabetes mellitus.

15. A method for screening a Sodium-Glucose-Co-Transporter-4 (SGTL4) inhibitor for use in the treatment or prevention of metabolic disorder which comprises the step consisting of:(i) providing purified SGLT4 protein, providing a cell, tissue sample or organism expressing the SGLT4,(ii) providing a candidate compound such as small organic molecule, nucleic acids, antibodies, peptide or polypeptide,(iii) measuring the activity of the SGLT4,(iv) and selecting positively candidate compounds that, blocks the biological activity of SGLT4 or inhibits SGLT4 expression.