Synthetic promoters, transcriptional units, vectors, and pharmaceutical compositions with enhanced melanoma specificity and methods

EP4754271A1Pending Publication Date: 2026-06-10DANA FARBER CANCER INSTITUTE INC

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
DANA FARBER CANCER INSTITUTE INC
Filing Date
2024-07-26
Publication Date
2026-06-10

AI Technical Summary

Technical Problem

Current cancer gene therapies lack high tumor-targeting specificity due to the use of promoters that are not substantially tumor-specific.

Method used

Development of synthetic promoters containing 3 to 15 transcription factor binding sites with specific nucleic acid sequences, which preferentially drive the expression of linked nucleic acid coding sequences in melanoma cells compared to non-cancerous skin cells.

Benefits of technology

The synthetic promoters achieve a significant increase in expression in melanoma cells, with some exhibiting a 5-fold or greater increase relative to non-cancerous skin cells, enhancing the specificity and effectiveness of cancer gene therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024039896_06022025_PF_FP_ABST
    Figure US2024039896_06022025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed are synthetic promoters, transcriptional units, vectors, pharmaceutical composition, and methods of use thereof which preferentially drive expression of an operatively linked nucleic acid in a melanoma cell in vitro or in vivo, relative to a non-cancerous skin cell.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] SYNTHETIC PROMOTERS, TRANSCRIPTIONAL UNITS, VECTORS, AND PHARMACEUTICAL COMPOSITIONS WITH ENHANCED MELANOMA SPECIFICITY AND METHODS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003]

[0001] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 529,495, filed on July 28, 2023, the disclosure of which is incorporated by reference herein in its entirety.

[0004] BACKGROUND

[0005]

[0002] Cancer ranks as the second leading cause of death worldwide. However, most of the current treatments have serious side effects and off-target toxicities. Gene therapy, which involves the introduction of a gene encoding a therapeutic protein into a patient’s cells, represents a promising avenue as a cancer therapy. However, most cancer gene therapies have not exhibited high tumor-targeting specificity. One reason is that most cancer-specific promoters used in cancer gene therapy are not substantively tumor specific (Nissim etal., Cell 171(5) : 1138-1150 (2017)).

[0006]

[0003] Therefore, there is a critical need for improved cancer-specific treatments for cancer gene therapy.

[0007] SUMMARY

[0008]

[0004] The synthetic promoters, transcription units, vectors, compositions, and methods provided herein are expected to address the above need.

[0009]

[0005] In an aspect, there is provided a synthetic promoter containing 3 to 15 transcription factor binding sites (TFBSs), wherein each TFBS has any one of the following nucleic acid sequences: GCATTCCN1TGCATTCCN2 (SEQ ID NO: 1), N3GGN4AAN5N6CCC (SEQ ID NO: 2), GGGN7N8TTN9CCN10 (SEQ ID NO: 3), CCGAGCATGCCCGGGCATGT (SEQ ID NO: 4), GGACATGTCCAGGCTTGCTC (SEQ ID NO: 5),

[0010] GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22 (SEQ ID NO: 6),

[0011] N23N24GGN25CATGCCCGGGCN26TGT (SEQ ID NO: 7), GACAAGTTGGGACATGTC (SEQ ID NO: 8), N27GACAN28GN29CTGGN30CN31TGTC (SEQ ID NO: 9), N32N33GGACATGCCCGGN34CATGT (SEQ ID NO: 10), GGGCAAGTCCAGACCTGTAG (SEQ ID NO: 11), AACAAGTTGGGACATGTC (SEQ ID NO: 12), TGGAAATTTCCGT (SEQ ID NO: 172), AGGCACGTGA (SEQ ID NO: 173), or ATCACATGCC (SEQ ID NO: 174), wherein each of Ni - N34 independently represents any nucleotide. Each of Ni - N34 may be the same or different for any of SEQ ID NOs: 1-12 and 172-174. Further, each of the 3 to 15 TFBSs in the synthetic promoter may be the same or different.

[0012]

[0006] As demonstrated in examples provided, the synthetic promoters may preferentially drive expression of an operatively linked nucleic acid coding sequence in a melanoma cell, in vitro or in vivo, relative to a non-cancerous skin cell. And so, in another aspect, there is provided a transcriptional unit containing the synthetic promoter operatively linked to a nucleic acid coding sequence that encodes a therapeutic nucleic acid, peptide, polypeptide, or protein.

[0013]

[0007] In another aspect, a vector containing the transcriptional unit is provided.

[0014]

[0008] In another aspect, a pharmaceutical composition incorporating the vector is provided.

[0015]

[0009] In yet another aspect, a method of transcribing a nucleic acid coding sequence in a melanoma cell is provided. The method entails contacting the melanoma cell with the vector.

[0016] BRIEF DESCRIPTION OF THE DRAWINGS

[0017]

[0010] FIG. l is a bar graph showing transcriptional units each containing a synthetic promoter and a nucleic acid coding sequence, wherein the synthetic promoter preferentially drives the expression of a nucleic acid coding sequence reporter in melanoma cells relative to non-cancerous primary human skin cells.

[0018] [OH] FIG. 2 is a bar graph showing the fold-difference of the expression of a nucleic acid coding sequence between melanoma and non-cancerous skin cells for each synthetic promoter.

[0019]

[0012] FIG. 3 is a bar graph showing promoters identified by a screening platform that are active in murine melanoma cancer cell line (YUMM1.7) and murine primary keratinocytes (MPK); promoter names are listed on the X-axis.

[0020] DETAILED DESCRIPTION

[0021]

[0013] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the subject matter herein belongs. As used in the specification and the appended claims, unless specified to the contrary and / or otherwise clear from context, the following terms have the meaning indicated to facilitate the understanding of the present disclosure.

[0014] The singular forms “a”, “an”, and “the” mean “one or more” and therefore include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a composition” includes mixtures of two or more such compositions, reference to “an inhibitor” includes mixtures of two or more such inhibitors, and the like.

[0022]

[0015] The term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. “About” can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term “about.”

[0023]

[0016] The term “approximately” as used herein refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value (except where such number would exceed 100% of a possible value).

[0024]

[0017] The term “promoter” as used herein refers to a nucleic acid that facilitates, directly or indirectly, the transcription of a corresponding nucleic acid to which it is operatively linked. A promoter may function alone to facilitate transcription, or it may act in concert with one or more other regulatory units (e.g., enhancers and silencers that may be present in the nucleic acids or the vector). Promoters are located near the transcription start sites of nucleic acid coding sequences, on the same strand and upstream on the DNA (towards the 5’ region of the sense strand).

[0025]

[0018] The term “synthetic” as used herein when referring to proteins or nucleic acids refers to a protein or nucleic acid that is not naturally found in an organism (z.c., non-naturally occurring).

[0026]

[0019] The term “non-cancerous” as used herein refers to a skin cell that is not dividing in an uncontrolled fashion, i.e., a cell that would arrest at a cell cycle checkpoint during mitosis.

[0027]

[0020] The term “nucleic acid” as used herein refers to a polymer of nucleotides that contain of a nucleoside (a nucleobase and a five-carbon sugar) and a phosphate. The term nucleotide includes nucleosides that have a ribose sugar (i.e., a ribonucleotide that forms ribonucleic acid, RNA) or a 2’ -deoxyribose sugar (i.e., a deoxyribonucleotide that forms deoxyribonucleic acid, DNA). Nucleotides serve as the monomeric units of nucleic acid polymers or polynucleotides. The four nucleobases in DNA are guanine (G), adenine (A), cytosine (C) and thymine (T). The four nucleobases in RNA are guanine (G), adenine (A), cytosine (C) and uracil (U). Nucleic acids are linear chains of nucleotides e.g., at least 3 nucleotides) chemically bonded by a series of ester linkages between the phosphoryl group of one nucleotide and the hydroxyl group of the sugar (i.e., ribose or 2’ -deoxyribose) in the adjacent nucleotide. The term “nucleic acid coding sequence” as used herein refers to a segment of nucleic acids that encodes a therapeutic nucleic acid, peptide, polypeptide, or protein.

[0028]

[0021] The term “transcription factor binding site” or “TFBS” as used herein refers to a nucleic acid sequence contained in the synthetic promoters disclosed herein to which a transcription factor binds to facilitate expression of a nucleic acid coding sequence operatively linked to the promoter.

[0022] The terms “preferentially,” “preferentially driven” or “preferentially driven transcription” as used herein refer to the increased expression of a nucleic acid operatively linked to a synthetic promoter, i.e., a vector comprising the synthetic promoter, in a melanoma cell relative to the level of expression of the same vector in a non-cancerous skin cell. Thus, a synthetic promoter that preferentially drives expression of an operatively linked nucleic acid in a melanoma cell may drive expression of the nucleic acid in both a melanoma cell and a non- cancerous skin cell (e.g., a melanocyte or a keratinocyte), but the level of expression of the nucleic acid will be higher in the melanoma cell relative to the non-cancerous skin cell. Preferentially driven transcription in melanoma cells may also be referred to herein in terms of a “fold-increase” in activity of the synthetic promoter in a melanoma cell relative to the activity of the synthetic promoter in a non-cancerous skin cell.

[0029]

[0023] The term “operatively linked” as used herein is to be understood that a nucleic acid coding sequence disposed relative to the synthetic promoter such that the synthetic promoter facilitates the transcription of the nucleic acid coding sequence.

[0030]

[0024] The term “protein” as used herein refers to a polymer of amino acid residues, each of which are organic compounds consisting of an amino functional group and a carboxylic acid functional group, where the amino acid residues are bonded together by peptide bonds. Broadly, the therapeutic protein embraces any such protein that as an expression product, may exert an anticancer (e.g., immune stimulatory) effect, at least in the context of melanoma.

[0031]

[0025] The term “derived from” as used herein when referring to proteins and nucleic acids refers to a protein or nucleic acid that originates from another, parental protein or nucleic acid. The derived protein or nucleic acid has a sequence that may be identical to the parental sequence, may be a portion of the parent sequence, or may be a variant of the parent protein or nucleic acid in that it differs from the sequence of the parent. Variants may include amino acid and nucleotide substitutions, insertions, or deletions. Thus, for example, an amino acid sequence derived from a parent sequence may be identical for a specific range of amino acids of the parent but does not include amino acids outside that specific region.

[0032]

[0026] The term “cytokine” refers to low molecular weight extracellular polypeptides / glycoproteins that promote, modulate, and regulate the immune response (z.e., increase or decrease activity, differentiation, or proliferation).

[0033]

[0027] The term “tumor suppressor” as used herein refers to a gene product that reduces cancer cell growth.

[0034]

[0028] The term “signal peptide” as used herein refers to a short (e.g., 5-30 or 10-100 amino acids long) stretch of amino acids that directs the transport of the therapeutic protein during translation.

[0035]

[0029] As used herein, the term “lentiviral vector” refers to an infectious lentiviral particle. Lentivirinae (lentiviruses) is a subfamily of enveloped retrovirinae (retroviruses), that is distinguishable from other viruses by virion structure, host range, and pathological effects. An infectious lentiviral particle is capable of invading a target host cell, including infecting, and transducing non-dividing cells and immune cells.

[0036]

[0030] The term “effective amount” as used herein refers to a sufficient amount of vector to provide the desired effect, e.g., the amount of a vector to introduce the transcriptional unit into a melanoma cell in vitro or in vivo to express the nucleic acid coding sequence.

[0037]

[0031] The term “subject” (or “patient”) as used herein includes all members of the animal kingdom prone (or disposed) to or suffering from melanoma. In some embodiments, the subject is a human. Therefore, a subject “having a cancer” or “in need of’ treatment according to the present disclosure broadly embraces subjects who have been positively diagnosed, including subjects having active disease who may have been previously treated with one or more rounds of therapy, and subjects who are not currently being treated (e.g., in remission) but who might still be at risk of relapse, and subjects who have not been positively diagnosed but who are predisposed to melanoma (e.g., on account of the basis of prior medical history and / or family medical history, or who otherwise present with a one or more risk factors such that a medical professional might reasonably suspect that the subject was predisposed to melanoma).

[0038]

[0032] The terms “treat”, “treating”, and “treatment” as used herein refer to any type of intervention, process performed on, or the administration of an active agent to the subject in need thereof with the therapeutic objective (“therapeutic effect”) of reversing, alleviating, ameliorating, inhibiting, diminishing, slowing down, arresting, stabilizing, or preventing the onset, progression, development, severity or recurrence of a symptom, complication or condition, or biochemical indicia associated with melanoma.

[0039]

[0033] The term “melanoma” as used herein encompasses cancers that develop from melanocytes (cells that make the pigment melanin). Melanoma may develop in any pigmented tissues, for example, the skin, eye, or intestines. Melanomas include skin cutaneous melanoma (SKCM), superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, and acral lentiginous melanoma.

[0040]

[0034] There is provided a synthetic promoter. The synthetic promoter contains a nucleic acid containing 3-15 transcription factor binding sites, wherein i) each TFBS has any one of SEQ ID NOs: 1-12 or 172-174, ii) each N of SEQ ID NOs: 1-12 and 172-174 is independently any nucleotide and iii) each TFBS may be the same or different. Such synthetic promoters have been surprisingly discovered to exhibit increased in activity in a melanoma cell relative to the activity of the synthetic promoter in a non-cancerous skin cell. Each TFBS is about 27-314 nucleotides in length and is connected to an adjacent TFBS via a linker containing at least one nucleotide, wherein the linkers may be the same or different.

[0041]

[0035] A transcriptional unit is also provided and contains the synthetic promoter operatively linked to a nucleic acid coding sequence. In some embodiments, the transcription unit further contains a spacer. In some embodiments, the nucleic acid coding sequence encodes a therapeutic protein, e.g., a transcription factor, a surface T cell engager (STE), a cytokine, a tumor suppressor, or a checkpoint inhibitor. In some embodiments, the nucleic acid coding sequence further encodes a signal protein. In some embodiments, the nucleic acid coding sequence encodes a miRNA. In some embodiments, the transcriptional unit further comprises a regulatory unit.

[0042]

[0036] A vector is also provided and contains an insertion site (z.e., a multiple cloning site) and the synthetic promoter. In other embodiments, the vector contains an insertion site and the transcriptional unit.

[0043]

[0037] A pharmaceutical composition is also provided and contains effective amounts of the vector containing the synthetic promoter or transcriptional unit and a pharmaceutically acceptable carrier. Synthetic Promoters

[0044]

[0038] In one aspect, there is provided a synthetic promoter that may preferentially drive expression of an operatively linked nucleic acid coding sequence in a melanoma cell relative to a non-cancerous skin cell, providing a new means to treat the melanoma cell. The synthetic promoter containing 3 to 15 transcription factor binding sites (TFBSs), wherein each TFBS has any one of the following nucleic acid sequences: GCATTCCN1TGCATTCCN2 (SEQ ID NO: 1), N3GGN4AAN5N6CCC (SEQ ID NO: 2), GGGN7N8TTN9CCN10 (SEQ ID NO: 3), CCGAGCATGCCCGGGCATGT (SEQ ID NO: 4), GGACATGTCCAGGCTTGCTC (SEQ ID NO: 5), GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22 (SEQ ID NO: 6),

[0045] N23N24GGN25CATGCCCGGGCN26TGT (SEQ ID NO: 7), GACAAGTTGGGACATGTC (SEQ ID NO: 8), N27GACAN28GN29CTGGN30CN31TGTC (SEQ ID NO: 9), N32N33GGACATGCCCGGN34CATGT (SEQ ID NO: 10), GGGCAAGTCCAGACCTGTAG (SEQ ID NO: 11), AACAAGTTGGGACATGTC (SEQ ID NO: 12), TGGAAATTTCCGT (SEQ ID NO: 172), AGGCACGTGA (SEQ ID NO: 173), or ATCACATGCC (SEQ ID NO: 174). Each of Ni - N34 may be the same or different for any of SEQ ID NOs: 1-12 and 172-174, e.g., one or more of N23-N26 of SEQ ID NO: 7 may be the same or different, and one or more of N32-N34 of SEQ ID NO: 10 may be the same or different. Further, each of the 3 to 15 TFBSs in the synthetic promoter may be the same or different, e.g., the synthetic promoter may include three of the same TFBSs nucleic acid sequences of SEQ ID NOs: 1-11, one of each of SEQ ID NOs: 1-12 or 172- 174, or any combination therebetween.

[0046]

[0039] In some embodiments, the synthetic promoter exhibits at least about a 5-fold increase in activity in a melanoma cell relative to the activity of the synthetic promoter in a non-cancerous skin cell. In some embodiments, the synthetic promoter exhibits a fold-increase of at least about 3- fold, about 5-fold, about 10-fold, about 20-fold, about 40-fold, about 50-fold, about 75-fold, about 100-fold, about 150-fold, about 200-fold, about 250-fold, or more than about 250-fold.

[0047]

[0040] The identity of the TFBSs in a synthetic promoter may vary. In some embodiments, all of the TFBSs in a synthetic promoter have the same nucleic acid sequence. In some embodiments, all of the TFBSs in a synthetic promoter have different nucleic acid sequences. In some embodiments, at least two TFBSs are the same. In some embodiments, at least three TFBSs are the same. In some embodiments, at least five THFBs are the same. In some embodiments, at least seven TFBSs are the same. In some embodiments, at least nine TFBS are the same. In some embodiments, at least twelve TFBSs are the same. In some embodiments, at least fourteen TFBSs are the same. By way of a representative example, in a synthetic promoter that has 3 TFBSs, 2 TFBSs may have the same nucleic acid sequence and one TFBS may have a different nucleic acid sequence, such that this synthetic promoter has two different TFBSs. By way of another representative example, in a synthetic promoter that has 4 TFBSs, 2 TFBSs may have different nucleic acid sequences and two TFBSs may have the same nucleic acid sequence, such that this synthetic promoter has three different TFBSs. By way of a third representative example, in a synthetic promoter that has 5 TFBSs, all 5 TFBSs can be different, all 5 TFBSs can be the same, or 3 can be the same and 2 can be different.

[0048]

[0041] The order of the TFBSs may also vary. By way of a representative example, in a synthetic promoter that has, c.g., two TFBSs having the same nucleic acid sequence (TFBS1) and two TFBSs having different nucleic acid sequences (TFBS2 and TFBS3), the two TFBSls may be arranged contiguously (so that the TFBS sequence in the synthetic promoter (not including linkers interspersed between TFBSs) is TFBS1, TFBS1, TFBS2, TFBS3) or may be interspersed between TFBS2 and TFBS3 (so that the TFBS sequence in the synthetic promoter (not including linkers interspersed between TFBSs) is TFBS1, TFBS2, TFBS1, TFBS3). By way of another representative example, a synthetic promoter may have 3 TFBSs each having the same nucleic acid sequence and 4 TFBSs each having the same nucleic acid sequence. In some of these embodiments, the first 3 TFBSs each having the same nucleic acid sequence is followed by the 4 TFBSs each having the same nucleic acid sequence. In some embodiments, the 3 TFBSs each having the same nucleic acid sequence is interspersed with the 4 TFBSs each having the same nucleic acid sequences. In some embodiments, the TFBSs alternate, from 5’ to 3’, repeating a TFBS with one sequence followed by a TFBS with a second, different sequence.

[0049]

[0042] In some embodiments of SEQ ID NO: 1 (GCATTCCN1TGCATTCCN2), Ni is A or T, and N2 is A or T. In such embodiments, at least one TFBS in the synthetic promoter has the acid sequence GCATTCCATGCATTCCT (SEQ ID NO: 13), GCATTCCTTGCATTCCA (SEQ ID NO: 14), GCATTCCATGCATTCCA (SEQ ID NO: 15), GCATTCCATGCATTCCT (SEQ ID NO: 16), or GCATTCCTTGCATTCCT (SEQ ID NO: 17). In some embodiments, at least two TFBS in the synthetic promoter have the nucleic acid sequence of SEQ ID NO: 13 or 14. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 13 or 14.

[0043] In some embodiments of SEQ ID NO: 2 (N3GGN4AAN5N6CCC), N3 is C, G or T, N4is A or G, Ns is G or T, and Ne is C or T. In such embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence GGGAAAGCCCC (SEQ ID NO: 18), GGGGAAGCCCC (SEQ ID NO: 19), GGGGAAGTCCC (SEQ ID NO: 20), TGGGAATCCCC (SEQ ID NO: 21), GGGAAAGTCCC (SEQ ID NO: 22), CGGGAATCCCC (SEQ ID NO: 23), GGGAAATCCCC (SEQ ID NO: 24), or GGGAAATTCCC (SEQ ID NO: 25). In some embodiments, at least two TFBSs in the synthetic promoter have any one of the nucleic acid sequences of SEQ ID NOs: 18- 25. In some embodiments, each TFBS has any one of the nucleic acid sequences of SEQ ID NOs: 18-25, and each TFBS in the synthetic promoter in the synthetic promoter is the same.

[0050]

[0044] In such embodiments, at least one TFBS in the synthetic promoter has any one of the nucleic acid sequences CGGAAAGCCCC (SEQ ID NO: 26), TGGAAAGCCCC (SEQ ID NO: 27), CGGGAAGCCCC (SEQ ID NO: 28), TGGGAAGCCCC (SEQ ID NO: 29), CGGAAATCCCC (SEQ ID NO: 30), TGGAAATCCCC (SEQ ID NO: 31), GGGGAATCCCC(SEQ ID NO: 32), CGGAAAGTCCC (SEQ ID NO: 33), TGGAAAGTCCC (SEQ ID NO: 34), CGGGAAGTCCC (SEQ ID NO: 35), TGGGAAGTCCC (SEQ ID NO: 36), CGGAAATTCCC (SEQ ID NO: 37), TGGAAATTCCC (SEQ ID NO: 38), CGGGAATTCCC (SEQ ID NO: 39), GGGGAATTCCC (SEQ ID NO: 40).

[0051]

[0045] In some embodiments of SEQ ID NO: 3 (GGGN7N8TTN9CCN10), N7 is A or G, Ns is A or C, N9 is C or T, and N10 is A or C. In such embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence GGGAATTTCCA (SEQ ID NO: 41), GGGACTTCCCC (SEQ ID NO: 42), GGGAATTCCCC (SEQ ID NO: 43), GGGGCTTTCCA (SEQ ID NO: 44), GGGGCTTTCCC (SEQ ID NO: 45), GGGACTTTCCA (SEQ ID NO: 46), GGGGCTTCCCC (SEQ ID NO: 47), GGGACTTTCCC (SEQ ID NO: 48), or GGGGATTTCCA (SEQ ID NO: 49). In some embodiments, at least two TFBSs in the synthetic promoter have any one of the nucleic acid sequences of SEQ ID NOs: 41-49. In some embodiments, each TFBS has any one of the nucleic acid sequences of SEQ ID NOs: 41-49, and each TFBS in the synthetic promoter in the synthetic promoter is the same.

[0052]

[0046] In some embodiments, at least one TFBS in the synthetic promoter has any one of the nucleic acid sequences GGGAATTCCCA (SEQ ID NO: 50), GGGGATTCCCA (SEQ ID NO: 51), GGGACTTCCCA (SEQ ID NO: 52), GGGGCTTCCCA (SEQ ID NO: 53), GGGGATTCCCC (SEQ ID NO: 54), GGGAATTTCCC (SEQ ID NO: 55), or GGGGATTTCCC (SEQ ID NO: 56).

[0053]

[0047] In some embodiments, at least one TFBS in the synthetic promoter has any one of the nucleic acid sequences CCGAGCATGCCCGGGCATGT (SEQ ID NO: 4). In some embodiments, at least two TFBSs in the synthetic promoter have the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 4.

[0054]

[0048] In some embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence GGACATGTCCAGGCTTGCTC (SEQ ID NO: 5). In some embodiments, at least two TFBSs in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 5.

[0055]

[0049] In some embodiments of SEQ ID NO: 6

[0056] (GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22), Nil is G or T, N12 is A or G, N13 is A or T, N14 is C or T, N15 is C or T, Ni6 is A or T, Nn is A or G, Nis is A or G, N19 is A or T, N20 is C or T, N21 is C or G, and N22 is C or T. In such embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence GGGCATGCCAGAACATGTCC (SEQ ID NO: 57), GGGCAAGTTTGGACTTGTCC (SEQ ID NO: 58), GTGCAAGCCTGGACATGCCT (SEQ ID NO: 59), GGACAAGTCTGGGCATGCCT (SEQ ID NO: 60), or

[0057] GGGCATGTCTGAACTTGTGT (SEQ ID NO: 61). In some embodiments, at least two TFBSs in the synthetic promoter have the nucleic acid sequence of SEQ ID NO: 58. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 58.

[0058]

[0050] In some embodiments, at least one TFBS in the synthetic promoter has the sequence GN11N12CATGCTN16GN17GCTTGTCC (SEQ ID NO: 62), which corresponds to SEQ ID NO: 6 (GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22) when N11 is G or T, N12 is A or G, N13 is T, N14 is C, N15 is T, Ni6 is A or T, N17 is A or G, Nis is G, N19 is T, N20 is T, N21 is C, and N22 is C. Taking into account all possible combinations of N11, N12, Ni6, and N17, SEQ ID NO: 62 includes the TFBSs set forth in Table 1.

[0059] Table 1 : Examples of TFBS sequences

[0060]

[0061]

[0051] In some embodiments of SEQ ID NO: 7 (N23N24GGN25CATGCCCGGGCN26TGT), N23 is A, C, or G, N24 is C or G, N25 is A or G, and N26 is A or T. In such embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence ACGGGCATGCCCGGGCATGT (SEQ ID NO: 71), CCGGACATGCCCGGGCTTGT (SEQ ID NO: 72), or GGGGACATGCCCGGGCATGT (SEQ ID NO: 73). In some embodiments, at least two TFBSs in the synthetic promoter have the nucleic acid sequence of SEQ ID NO: 71 or 72. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 71 or 72, and each TFBS in the synthetic promoter is the same.

[0062]

[0052] In some embodiments, at least one TFBS in the synthetic promoter has any one of the nucleic acid sequences ACGGACATGCCCGGGCATGT (SEQ ID NO: 74), CCGGACATGCCCGGGCATGT (SEQ ID NO: 75), GGGGACATGCCCGGGCATGT (SEQ ID NO: 76), ACGGACATGCCCGGGCATGT (SEQ ID NO: 77), GGGGACATGCCCGGGCATGT (SEQ ID NO: 78), CCGGGCATGCCCGGGCATGT (SEQ ID NO: 79), GCGGGCATGCCCGGGCATGT (SEQ ID NO: 80), AGGGGCATGCCCGGGCATGT (SEQ ID NO: 81), CGGGGCATGCCCGGGCATGT (SEQ ID NO: 82), GGGGGCATGCCCGGGCATGT (SEQ ID NO: 83), ACGGACATGCCCGGGCTTGT (SEQ ID NO: 84), GCGGACATGCCCGGGCTTGT (SEQ ID NO: 85), AGGGACATGCCCGGGCTTGT (SEQ ID NO: 86), CGGGACATGCCCGGGCTTGT (SEQ ID NO: 87), GGGGACATGCCCGGGCTTGT (SEQ ID NO: 88), ACGGGCATGCCCGGGCTTGT (SEQ ID NO: 89), CCGGGCATGCCCGGGCTTGT (SEQ ID NO: 90), GCGGGCATGCCCGGGCTTGT (SEQ ID NO: 91), AGGGGCATGCCCGGGCTTGT (SEQ ID NO: 92), CGGGGCATGCCCGGGCTTGT (SEQ ID NO: 93), or GGGGGCATGCCCGGGCTTGT (SEQ ID NO: 94).

[0063]

[0053] In some embodiments, one or more of the TFBSs in the synthetic promoter has any one of the nucleic acid sequences GACAAGTTGGGACATGTC (SEQ ID NO: 8). In some embodiments, at least two TFBS have the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 8.

[0064]

[0054] In some embodiments of SEQ ID NO: 9 (N27GACAN28GN29CTGGN30CN31TGTC), N27 is A or G, N28 is A or T, N29 is C or T, N30 is A or G, and N31 is A or T. In such embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence GGACATGCCTGGGCATGTC (SEQ ID NO: 95) or AGACAAGTCTGGACTTGTC (SEQ ID NO: 96). In some embodiments, at least two TFBSs in the synthetic promoter have the nucleic acid sequence of SEQ ID NO: 95. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 95.

[0065]

[0055] In some embodiments, at least one TFBS in the synthetic promoter has any one of the nucleic acid sequences AGACAAGCCTGGACATGTC (SEQ ID NO: 97), GGACAAGCCTGGACATGTC (SEQ ID NO: 98), AGACATGCCTGGACATGTC (SEQ ID NO: 99), GGACATGCCTGGACATGTC (SEQ ID NO: 100), AGACAAGTCTGGACATGTC (SEQ ID NO: 101), GGACAAGTCTGGACATGTC (SEQ ID NO: 102), AGACATGTCTGGACATGTC (SEQ ID NO: 103), GGACATGTCTGGACATGTC (SEQ ID NO: 104), AGACAAGCCTGGGCATGTC (SEQ ID NO: 105), GGACAAGCCTGGGCATGTC (SEQ ID NO: 106), AGACATGCCTGGGCATGTC (SEQ ID NO: 107), AGACAAGTCTGGGCATGTC (SEQ ID NO: 108), GGACAAGTCTGGGCATGTC (SEQ ID NO: 109), AGACATGTCTGGGCATGTC (SEQ ID NO: 110), GGACATGTCTGGGCATGTC (SEQ ID NO: 111), AGACAAGCCTGGGCTTGTC (SEQ ID NO: 112), GGACAAGCCTGGGCTTGTC (SEQ ID NO: 113), AGACATGCCTGGGCTTGTC (SEQ ID NO: 114), GGACATGCCTGGGCTTGTC (SEQ ID NO: 115), AGACAAGTCTGGGCTTGTC (SEQ ID NO: 116), GGACAAGTCTGGGCTTGTC (SEQ ID NO: 117), AGACATGTCTGGGCTTGTC (SEQ ID NO: 118), GGACATGTCTGGGCTTGTC (SEQ ID NO: 119), AGACAAGCCTGGACTTGTC (SEQ ID NO: 120), GGACAAGCCTGGACTTGTC (SEQ ID NO: 121), AGACATGCCTGGACTTGTC (SEQ ID NO: 122), GGACATGCCTGGACTTGTC (SEQ ID NO: 123), GGACAAGTCTGGACTTGTC (SEQ ID NO: 124), AGACATGTCTGGACTTGTC (SEQ ID NO: 125), or GGACATGTCTGGACTTGTC (SEQ ID NO: 126).

[0066]

[0056] In some embodiments of SEQ ID NO: 10 (N32N33GGACATGCCCGGN34CATGT), N32 is C or T, N33 is C or G, and N34 is A or G. In such embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence TCGGACATGCCCGGGCATGT (SEQ ID NO: 127), TGGGACATGCCCGGGCATGT (SEQ ID NO: 128), or CGGGACATGCCCGGACATGT (SEQ ID NO: 129). In some embodiments, at least two TFBSs in the synthetic promoter have the nucleic acid sequence of SEQ ID NO: 127. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 127.

[0067]

[0057] In some embodiments, at least one TFBS in the synthetic promoter has any one of the nucleic acid sequences TCGGACATGCCCGGACATGT (SEQ ID NO: 130), TGGGACATGCCCGGACATGT (SEQ ID NO: 131), CCGGACATGCCCGGGCATGT (SEQ ID NO: 132), or CCGGACATGCCCGGGCATGT (SEQ ID NO: 133).

[0068]

[0058] In some embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence GGGCAAGTCCAGACCTGTAG (SEQ ID NO: 11). In some embodiments, at least two TFBS have the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 11.

[0069]

[0059] In some embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence AACAAGTTGGGACATGTC (SEQ ID NO: 12). In some embodiments, at least two TFBS have the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 12.

[0070]

[0060] In some embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence TGGAAATTTCCGT (SEQ ID NO: 172). In some embodiments, at least two TFBS have the nucleic acid sequence of SEQ ID NO: 172. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 172.

[0071]

[0061] In some embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence AGGCACGTGA (SEQ ID NO: 173). In some embodiments, at least two TFBS have the nucleic acid sequence of SEQ ID NO: 173. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 173.

[0062] In some embodiments, at least one TFBS in the synthetic promoter has the nucleic acid sequence ATCACATGCC (SEQ ID NO: 174). In some embodiments, at least two TFBS have the nucleic acid sequence of SEQ ID NO: 174. In some embodiments, each TFBS in the synthetic promoter has the nucleic acid sequence of SEQ ID NO: 174.

[0072]

[0063] A person skilled in the art would immediately recognize that there are additional TFBSs within the scope of SEQ ID NOs: 1-12 and 172-174, and would be able to elucidate their sequences using standard techniques and methodologies.

[0073]

[0064] The synthetic promoters contain 3 to 15 TFBSs. Each TFBS may be the same or different. In some embodiments, the synthetic promoter contains 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, or 15 TFBSs. In some embodiments, the synthetic promoter contains 3 TFBSs. In some embodiments, the synthetic promoter contains 5 TFBSs. In some embodiments, the synthetic promoter contains 6 TFBSs. In some embodiments, the synthetic promoter contains 8 TFBSs. In some embodiments, the synthetic promoter contains 9 TFBSs. In some embodiments, the synthetic promoter contains 12 TFBSs. In some embodiments, the synthetic promoter contains 15 TFBSs.

[0074]

[0065] In some embodiments, each TFBS in the synthetic promoter is connected to an adjacent TFBS via a linker containing at least one nucleotide, where each linker has the same or different nucleic acid sequence. Without being bound by theory, linkers provide steric space between adjacent TFBSs, enabling more efficient or more transcription factor (TF) proteins binding to each TFBS in the synthetic promoter. The nucleotide sequences of the linkers are not critical, provided that they do not interfere with the function of the promoter. Table 18 includes the sequences of synthetic promoters having undefined trinucleotide linkers.

[0075]

[0066] In some embodiments, the linkers (L) are from two to eight nucleotides in length and may be represented by the formula N35N36N37N38N39N40N41N42, where each of N35-N42 may be any one of A, C, T, or G and may be the same or different, and further wherein any one or more of N37-N42 may be absent. In some embodiments, the linkers are two nucleotides in length. In such embodiments, the linkers may have any one of the following sequences: AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT. In some embodiments, the linkers are three nucleotides in length. In such embodiments, the linkers may have any one of the following sequences: AGA, TCG, GAC, ATA, ACT, TAC, TAG, CAT, ATC, GAT, CGT, AGT, CAC, CTG, TAC, TAT, ACA, TAC, CGA, and ACG. In some embodiments, the linkers are from two to four nucleotides in length. In some embodiments, the linkers are from four to eight nucleotides in length. In such embodiments, the linkers have any one of the following sequences: AGAT, TCGG, GACAT, ACTTA, TACTAG, TAGCAT, CATATCG, ATCGATC, and GATCGTAGT. In some embodiments, each linker in the synthetic promoter has a different nucleotide sequence.

[0076]

[0067] In some embodiments, the synthetic promoter is about 27 to about 370 nucleotides in length. In some embodiments, the synthetic promoter is about 33 to about 342 nucleotides in length. In some embodiments, the synthetic promoter is about 37 to about 314 nucleotides in length.

[0077]

[0068] In some embodiments, the synthetic promoter may be represented by the formula TFB Si -Li -TFB S2-L2-TFB S3-L3-TFB S4-L4-TFB S5-L5-TFBS6-L6-TFBS7-L7-TFB Ss-Ls-TFB S9-L9- TFBSio-Lio-TFBSii-Lii-TFBSi2-Li2-TFBSi3-Li3-TFBSi4-Li4-TFBSi5, wherein each of TFBSi- TFBS15 is independently any one of SEQ ID NOs: 1-133 (z.e., each TFBS may be the same or different), and wherein any one or more of TFBS4-15 (and the adjacent L4-14) may be absent, and wherein each of L1-L14 independently represents a linker from two to eight nucleotides in length, and where each linker independently represents N35N36N37N38N39N40N41N42, where each of N35- N42 may be any one of A, C, T, or G and may be the same or different and further wherein any one or more of N37-N42 may be absent.

[0078]

[0069] In some embodiments, the synthetic promoter is about 27 to about 370 nucleotides in length. In some embodiments, the synthetic promoter is about 33 to about 342 nucleotides in length. In some embodiments, the synthetic promoter is about 37 to about 314 nucleotides in length.

[0079]

[0070] In some embodiments, the synthetic promoter has 6 TFBSs, each having the sequence of SEQ ID NO: 13, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, ATA, and ACT, respectively; the nucleic acid sequence of a representative synthetic promoter of which is set forth below (SEQ ID NO: 134):

[0080] 1 gcattccatg cattcctaga gcattccatg cattccttcg gcattccatg cattcctgac 61 gcattccatg cattcctata gcattccatg cattcctact gcattccatg cattcct

[0081]

[0071] In some embodiments, the synthetic promoter has 8 TFBSs, each having the sequence of SEQ ID NO: 18, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, ATA, ACT, TAC, and TAG, respectively; the nucleic acid sequence set forth below (SEQ ID NO: 135): 1 gggaaagccc cagagggaaa gcccctcggg gaaagccccg acgggaaagc cccataggga 61 aagccccact gggaaagccc ctacgggaaa gcccctaggg gaaagcccc

[0082]

[0072] In some embodiments, the synthetic promoter has 8 TFBSs, each having the sequence of SEQ ID NO: 41, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, ATA, ACT, TAC, and TAG; the nucleic acid sequence set forth below (SEQ ID NO: 136):

[0083] 1 gggaatttcc aagagggaat ttccatcggg gaatttccag acgggaattt ccaataggga 61 atttccaact gggaatttcc atacgggaat ttccataggg gaatttcca

[0084]

[0073] In some embodiments, the synthetic promoter has 5 TFBSs, each having the sequence of SEQ ID NO: 4, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, and ATA, respectively; the nucleic acid sequence set forth below (SEQ ID NO: 137):

[0085] 1 ccgagcatgc ccgggcatgt agaccgagca tgcccgggca tgttcgccga gcatgcccgg 61 gcatgtgacc cgagcatgcc cgggcatgta taccgagcat gcccgggcat gt

[0086]

[0074] In some embodiments, the synthetic promoter has 5 TFBSs, each having the sequence of SEQ ID NO: 5, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, and ATA, respectively; the nucleic acid sequence set forth below (SEQ ID NO: 138):

[0087] 1 ggacatgtcc aggcttgctc agaggacatg tccaggcttg ctctcgggac atgtccaggc 61 ttgctcgacg gacatgtcca ggcttgctca taggacatgt ccaggcttgc tc

[0088]

[0075] In some embodiments, the synthetic promoter has 5 TFBSs, each having the sequence of SEQ ID NO: 57, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, and ATA, respectively; the nucleic acid sequence set forth below (SEQ ID NO: 139)

[0089] 1 gggcatgcca gaacatgtcc agagggcatg ccagaacatg tcctcggggc atgccagaac 61 atgtccgacg ggcatgccag aacatgtcca tagggcatgc cagaacatgt cc

[0090]

[0076] In some embodiments, the synthetic promoter has 5 TFBSs, each having the sequence of SEQ ID NO: 71, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, and ATA, respectively; the nucleic acid sequence set forth below (SEQ ID NO: 140):

[0091] 1 acgggcatgc ccgggcatgt agaacgggca tgcccgggca tgttcgacgg gcatgcccgg 61 gcatgtgaca cgggcatgcc cgggcatgta taacgggcat gcccgggcat gt

[0077] In some embodiments, the synthetic promoter has 6 TFBSs, each having the sequence of SEQ ID NO: 14, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, ATA, and ACT, respectively; the nucleic acid sequence set forth below (SEQ ID NO: 14141):

[0092] 1 gcattccttg cattccaaga gcattccttg cattccatcg gcattccttg cattccagac 61 gcattccttg cattccaata gcattccttg cattccaact gcattccttg cattcca

[0093]

[0078] In some embodiments, the synthetic promoter has 5 TFBSs, each having the sequence of SEQ ID NO: 8, separated by linkers containing three nucleotides, the linkers having the nucleic acid sequences AGA, TCG, GAC, and ATA, respectively; has the nucleic acid sequence set forth below (SEQ ID NO: 142):

[0094] 1 gacaagttgg gacatgtcag agacaagttg ggacatgtct cggacaagtt gggacatgtc 61 gacgacaagt tgggacatgt catagacaag ttgggacatg tc

[0095]

[0079] In some embodiments, the synthetic promoter has 5 TFBSs, each having the sequence of SEQ ID NO: 95, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, and ATA, respectively; has the nucleic acid sequence set forth below (SEQ ID NO: 143):

[0096] 1 ggacatgcct gggcatgtca gaggacatgc ctgggcatgt ctcgggacat gcctgggcat 61 gtcgacggac atgcctgggc atgtcatagg acatgcctgg gcatgtc

[0097]

[0080] In some embodiments, the synthetic promoter has 6 TFBSs, each having the sequence of SEQ ID NO: 127, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, ATA, and ACT, respectively; has the nucleic acid sequence set forth below (SEQ ID NO: 144):

[0098] 1 tcggacatgc ccgggcatgt agatcggaca tgcccgggca tgttcgtcgg acatgcccgg 61 gcatgtgact cggacatgcc cgggcatgta tatcggacat gcccgggcat gt

[0099]

[0081] In some embodiments, the synthetic promoter has 5 TFBSs, each having the sequence of SEQ ID NO: 11, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, and ATA, respectively; has the nucleic acid sequence set forth below (SEQ ID NO: 145):

[0100] 1 gggcaagtcc agacctgtag agagggcaag tccagacctg tagtcggggc aagtccagac

[0101] 61 ctgtaggacg ggcaagtcca gacctgtaga tagggcaagt ccagacctgt ag

[0082] In some embodiments, the synthetic promoter has 4 TFBSs, each having the sequence of SEQ ID NO: 12, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, and ATA, respectively; has the nucleic acid sequence set forth below (SEQ ID NO: 146):

[0102] 1 aacaagttgg gacatgtcag aaacaagttg ggacatgtct cgaacaagtt gggacatgtc 61 gacaacaagt tgggacatgt cataaacaag ttgggacatg tc

[0103]

[0083] In some embodiments, the synthetic promoter (referred to as S(NFAC1 18)p) has 7 TFBSs, each having the sequence of SEQ ID NO: 172, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, ATA, ACT, and TAC, respectively; has the nucleic acid sequence set forth below (SEQ ID NO: 175):

[0104] TGGAAATTTCCGTAGATGGAAATTTCCGTTCGTGGAAATTTCCGTGACTGGAAATTTCCG TATATGGAAATTTCCGTACTTGGAAATTTCCGTTACTGGAAATTTCCGT

[0105]

[0084] In some embodiments, the synthetic promoter (referred to as S(MAX_7)p) has 9 TFBSs, each having the sequence of SEQ ID NO: 173, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, ATA, ACT, TAC, TAG, and CAT, respectively; has the nucleic acid sequence set forth below (SEQ ID NO: 176):

[0106] AGGCACGTGAAGAAGGCACGTGATCGAGGCACGTGAGACAGGCACGTGAATAAGGCAC GTGAACTAGGCACGTGATACAGGCACGTGATAGAGGCACGTGACATAGGCACGTGA

[0107]

[0085] In some embodiments, the synthetic promoter (referred to as S(TFEB_10)p) has 9 TFBSs, each having the sequence of SEQ ID NO: 174, wherein each TFBS is separated from an adjacent TFBS by a linker containing three nucleotides, and which has the nucleic acid sequence AGA, TCG, GAC, ATA, ACT, TAC, TAG, and CAT, respectively; has the nucleic acid sequence set forth below (SEQ ID NO: 177):

[0108] ATCACATGCCAGAATCACATGCCTCGATCACATGCCGACATCACATGCCATAATCACAT GCCACTATCACATGCCTACATCACATGCCTAGATCACATGCCCATATCACATGCC

[0109]

[0086] The sequences of additional synthetic promoters are listed below in Table 17.

[0110] Transcriptional Units

[0087] In one aspect, the disclosure provides a transcriptional unit containing a synthetic promoter operatively linked to a nucleic acid (also referred to herein as a “nucleic acid coding sequence”) that encodes a therapeutic nucleic acid, peptide, polypeptide, or protein. In some embodiments, the nucleic acid coding sequence encodes a therapeutic nucleic acid, a reporter, or a therapeutic protein. The synthetic promoter preferentially drives expression of the nucleic acid coding sequence in a melanoma cell, in vitro or in vivo.

[0111]

[0088] In some embodiments, the transcriptional unit further contains a regulatory unit. In some embodiments, the transcriptional unit contains a spacer containing additional nucleotides disposed between the synthetic promoter and the nucleic acid coding sequence. In some embodiments, the spacer contains 30 nucleotides or less disposed toward the 3’ end of the transcriptional unit, downstream of the synthetic promoter (z.e., between the synthetic promoter and the nucleic acid coding sequence). In some embodiments, the spacer contains 30 nucleotides or less disposed toward the 5’ end of the transcriptional unit, upstream of the synthetic promoter.

[0112]

[0089] Methods of determining the therapeutic effect of a putative therapeutic protein or a therapeutic nucleic acid in melanoma cancer cells are known in the art. See, e.g., Nissim et al., Cell 77 / (5 1138-1150 (2017).

[0113] Nucleic Acid Coding Sequences

[0114]

[0090] The nucleic acid coding sequence encodes a therapeutic nucleic acid, peptide, polypeptide, or protein. In some embodiments, the nucleic acid coding sequence is a reporter. In some embodiments, the nucleic acid coding sequence encodes a therapeutic protein or a therapeutic nucleic acid. In some embodiments, the therapeutic protein is a transcription factor, a surface T cell engager (STE), a cytokine, a tumor suppressor, or a checkpoint inhibitor.

[0115]

[0091] In embodiments wherein the therapeutic protein is a transcription factor, representative examples of transcription factors include a fusion protein containing a galactose-responsive transcription factor GAL4 fused to VP 16 (GAL4-VP16), GAL4 fused to VP64 (GAL4-VP64), and GAIN fused to VP64, p65, and Rta (VPR) domains (GAL4-VPR).

[0116]

[0092] In some embodiments, the therapeutic protein is a STE. In some embodiments, the STE is a fusion protein containing an antibody fragment, e.g., a single-chain variable antibody fragment (scFv), that binds CD3 and a membrane anchor domain. The membrane anchor domain localizes the STE to the cell plasma membrane and may be any transmembrane domain. In some embodiments, the antibody fragment of the STE fusion protein is derived from a commercially available anti-CD3 antibody, antibody fragment, or derivative thereof. The names of anti-CD3 antibodies from which the therapeutic protein may be derived are provided at the NCBI and FDA Global Substance Registration System (GSRS), with accession numbers set forth herein, include, e.g., blinatumomab (available under the tradename BLINCYTO; NCBI 6AL5), catumaxomab (available under the tradename REMOVAB; NCBI 4DZ8), flotetuzumab (MGD006; GSRS 0AHT0IC02G), muromonab-CD3 (available under the tradename ORTHOCLONE 0KT3; NCBI 8F0L), otelixizumab (ChAglyC D3, TRX4; GSRS I5HF2X04PB), tebentafusp (available under the tradename KIMMTRAK; GSRS N658GY6L3E), teplizumab (available under the tradename TZIELD; GSRS S4M959U2IJ), and visilizumab (available under the tradename NUVION; GSRS H18SKU3289).

[0117]

[0093] In some embodiments, the membrane anchor domain of the STE fusion protein is derived from the Duffy antigen / receptor for chemokines (DARC). DARC is also known as Atypical Chemokine Receptor 1 (Duffy blood group) (ACKR1; NCBI gene ID 2532).

[0118]

[0094] In some embodiments, the therapeutic protein is a cytokine, or a non-naturally occurring variant or fragment thereof that binds to the cytokine’s cognate target. Representative examples of cytokines include chemokines, interferons (IFNs), interleukins (Ils), lymphokines and tumor necrosis factors (TNFs). Cytokine variants are non-naturally occurring proteins capable of binding to a cytokine receptor on an immune cell and initiating signal transduction through that receptor to achieve substantially the same effect as the naturally occurring cytokine.

[0119]

[0095] In embodiments wherein the therapeutic protein is a cytokine, or a non-naturally occurring variant or fragment thereof, the cytokine may be derived from IL-la, IL-10, IL-2, IL-5, IL- 12, IL- 17, CCL21, TNF-a, IFN-a, IFN-0, or IFN-y. The amino acid sequences of additional representative cytokines from which the therapeutic protein may be derived are provided at the NCBI Accession numbers set forth in Table 2.

[0120] Table 2: Examples of therapeutic proteins

[0121]

[0096] In those embodiments wherein the therapeutic protein is or is derived from a cytokine, the cytokine may be CCL21 (NCBI gene ID 6366) or single-chain IL- 12 (derived from IL-12A; NCBI gene ID 3592 and IL-12B; NCBI gene ID 3593).

[0122]

[0097] In some embodiments, the therapeutic protein is a tumor suppressor. In those embodiments wherein the therapeutic protein is or is derived from a tumor suppressor, the tumor suppressor may be derived from GSDMD (NCBI gene ID 79792), CDKN2A (NCBI gene ID 1029), CDK4 (NCBI gene ID 1019), p53 (NCBI gene ID 7157), PTEN (NCBI gene ID 5728), INK4 (NCBI gene ID 1029), RBI (NCBI gene ID 5925), or APC (NCBI gene ID 324).

[0123]

[0098] In some embodiments, the therapeutic protein is a checkpoint inhibitor. Checkpoint inhibitors are inhibitors that target key regulators of the immune system. When the key regulators, or immune checkpoints are stimulated they can dampen the immune response to an immunologic stimulus. In those embodiments wherein therapeutic protein is a checkpoint inhibitor, the checkpoint inhibitor may be an antibody fragment, e.g., a scFv, that binds EGFR, NKG2A, PD-1, or PD-Ll.

[0099] Tn those embodiments wherein the therapeutic protein is or is derived from a checkpoint inhibitor, the checkpoint inhibitor may be derived from a commercially available anti-EGFR antibody, antibody fragment, or derivative thereof. The sequences of anti-CD3 antibodies from which the therapeutic protein may be derived are provided at the NCBI and FDA GSRS Accession numbers set forth herein, e.g., amivantamab (Rybrevant®; NCBI 6WVZ), cetuximab (Erbitux®; GSRS PQX0D8J21J), duligotuzumab (GSRS 8PMF8YQX2T), imgatuzumab (GSRS V77J4WJF9Z), modotuximab (GSRS 1W7BD1M08N), necitumumab (Portrazza®; NCBI 6B3S), panitumumab (Vectibix®; GSRS 6A901E312A), petosemtamab (GSRS Z6Z6IVE7W4), serclutamab (GSRS RY62FD82YX), and zalutumumab (GSRS DA709Q5020).

[0124]

[0100] In those embodiments wherein the therapeutic protein is or is derived from a checkpoint inhibitor, the checkpoint inhibitor may be derived from a commercially available anti-NKG2A antibody, antibody fragment, or derivative thereof, e.g., monalizumab (GSRS 3ZXZ2V0588).

[0125]

[0101] In those embodiments wherein the therapeutic protein is or is derived from a checkpoint inhibitor, the checkpoint inhibitor may be derived from a commercially available anti-PD-1 antibody, antibody fragment, or derivative thereof. Additional information relating to the anti-PD- 1 antibodies from which the therapeutic protein may be derived is provided at the FDA GSRS Accession numbers set forth herein, including, e.g., balstilimab (GSRS 1Q2QT5M7EO), budigalimab (GSRS 6VDO4TY3OO), cadonilimab (GSRS 6FYG1DS4NW), cemiplimab (available under the tradename LIBTAYO; GSRS 6QVL057INT), cetrelimab (GSRS LYK98WP91F), dostarlimab (available under the tradename JEMPERLI; GSRS P0GVQ9A4S5), izuralimab (GSRS 9D2R4T39AY), nivolumab (available under the tradename OPDIVO; GSRS nivolumab), pacmilimab (GSRS 31YO63LBSN), pembrolizumab (available under the tradename KEYTRUDA; GSRS DPT0O3T46P), penpulimab (GSRS IBS1BZ4E4I), peresolimab (GSRS DI4N99Q6KK), pidilizumab (GSRS B932PAQ1BQ), retifanlimab (GSRS 2Y3T5IF01Z), rosnilimab (GSRS 93OKX5KD2L), sintilimab (GSRS 8FU7FQ8UPK), spartalizumab (GSRS QOG25L6Z8Z), tislelizumab (GSRS 0KVO411B3N), toripalimab (GSRS 8JXN261VVA), volrustomig (GSRS K96EGJ218N), vudalimab (GSRS 4I9I5X3Z6N), zeluvalimab (GSRS DX474PAV6P), and zimberelimab (GSRS ZBL7O904IL).

[0126]

[0102] In those embodiments wherein the therapeutic protein is a checkpoint inhibitor, the checkpoint inhibitor may be derived from a commercially available anti-PD-Ll antibody, antibody fragment, or derivative thereof. Additional information relating to the anti-PD-Ll antibodies from which the therapeutic protein may be derived are provided at the FDA GSRS Accession numbers set forth herein, including, e.g., atezolizumab (available under the tradename TECENTRIQ; GSRS 52CMI0WC3Y), avelumab (available under the tradename BAVENCIO; GSRS KXG2PJ551I), cosibelimab (GSRS PNW7GBB44P), danburstotug (GSRS F44C4N45HG), durvalumab (GSRS 28X28X9OKV), inbakicept (GSRS QN4LI58PJ5), lodapolimab (GSRS NR4MAD6PPB), pimivalimab (GSRS MA05AF40UO), and socazolimab (GSRS 82P4S8Q3FB).

[0127] Signal Peptides

[0128]

[0103] In some embodiments, the nucleic acid coding sequence further includes a sequence that encodes a signal peptide. In some embodiments, these embodiments, the nucleic acid coding sequence encodes a peptide, polypeptide, or protein connected to an in-frame nucleic acid encoding the signal peptide such that a single, contiguous peptide, polypeptide, or protein is translated. The signal peptide may be 5’ or 3’ to the nucleic acid coding sequence. Therapeutic proteins containing a signal peptide and no transmembrane domain will be secreted from a cell. Therapeutic proteins containing a signal peptide and a transmembrane domain will be transported to the cell membrane. Typically, the signal peptide is cleaved from the protein encoded by the nucleic acid coding sequence before secretion or transport to the cell membrane.

[0129]

[0104] In some embodiments, the signal peptide is derived from albumin (NCBI gene ID 213), CD8a (NCBI gene ID 925), CD33 (NCBI gene ID 945), erythropoietin (EPO; NCBI gene ID 2056), IL-2 (NCBI gene ID 3558), human Ig-kappa chain V-III (IgK VIII; NCBI gene ID 28912), mouse IgK VIII (NCBI gene ID 667924), tissue plasminogen activator (tPA; NCBI gene ID 5340), or secreted alkaline phosphatase (SEAP; NCBI gene ID 250). Signal peptides may also be synthetic (z.e., non-naturally occurring).

[0130] Therapeutic Nucleic Acids

[0131]

[0105] In some embodiments, the nucleic acid coding sequence does not encode a translated product (z.e., peptides, polypeptides, or proteins), but instead is therapeutic in its own right by encoding a therapeutic nucleic acid. In some embodiments, the therapeutic nucleic acid is a miRNA. The miRNA is expressed preferentially in melanoma cells relative to non-cancerous cells and enables the transcriptional unit to express miRNAs that have anti-cancer or immune- stimulating effects. The miRNA may function as tumor suppressors to inhibit cancer cell growth, metastasis, differentiation, regenerative potential, or a combination of two or more thereof. In some embodiments, the miRNA is let-7a, miR-15a, miR-34a, or miR-200.

[0132] Regulatory Units

[0133]

[0106] In some embodiments, the transcriptional unit further contains at least one additional regulatory unit functional in a melanoma cell. The regulatory unit is a segment of nucleic acids that is capable of increasing expression of the nucleic acid coding sequence by providing a binding motif to endogenous proteins (e.g., transcription factors) to the regulatory unit. Representative regulatory units include enhancers, additional promoters, TATA motifs, and sequences that promote binding to RNA polymerase proteins. The regulatory unit may be disposed 5’ to the synthetic promoter (upstream of the synthetic promoter) or 3’ to the synthetic promoter (disposed between the synthetic promoter and the nucleic acid coding sequence).

[0134]

[0107] In some embodiments, the regulatory unit is derived from the Adenovirus major late promoter.

[0135] The nucleic acid sequence of a representative Adenovirus major late promoter is set forth below (SEQ ID NO: 147):

[0136] 1 agacgctagc ggggggctat aaaagggggt gggggcgttc gtcctcactc t

[0137] Vectors

[0138]

[0108] The synthetic promoter or transcriptional unit may be introduced to a cell by a suitable vector. Vectors are configured to contain the elements necessary to effect transport of the synthetic promoter or transcriptional unit into the cell. Such elements may include an origin of replication, a poly-A tail sequence, a selectable marker, and one or more suitable insertion sites for the inclusion of a nucleic acid coding sequence or a transcriptional unit, such as a multiple cloning site (MCS), and additional optional regulatory elements.

[0139]

[0109] In some embodiments, the vector contains a synthetic promoter and an insertion site. The vector is therefore suitable for the inclusion of a nucleic acid coding sequence at the insertion site. In some embodiments, the vector contains a transcriptional unit (which contains a synthetic promoter and a nucleic acid coding sequence). [HO] Tn some embodiments, the vector is a viral vector, for example, a retroviral vector, a lentiviral vector, an adenoviral vector, a herpesvirus vector, an adenovirus, or an adeno-associated virus (AAV) vector.

[0140] [Hl] In some embodiments, the vector containing the transcriptional unit is a non-integrative and non-replicative recombinant lentivirus vector. The construction of lentiviral vectors has been described, for example, in U.S. Patent Nos. 5,665,577 (Sodroski et al.), 5,981,276 (Sodroski et al.), 6,013,516 (Verma et al.), 7,090,837 (Spencer et al.), 8,119,119 (Mallet et al.), and 10,954,530 (Pule et al.). Lentivirus vectors include a defective lentiviral genome, i.e., in which at least one of the lentivirus genes gag,pol, and env, has been inactivated or deleted.

[0141]

[0112] A lentiviral vector can exhibit functions additional to, or different from, a naturally occurring lentivirus. For example, a lentiviral vector can be modified to change or reduce a lentivirus characteristic. A lentiviral vector also can be modified to exhibit characteristics of one or more other retroviruses, retroviral vectors, host cells or heterologous cells. Modifications can include, for example, pseudotyping, modifying binding and / or fusion functions of the envelope polypeptide, incorporating heterologous, chimeric, or multifunctional polypeptides into the vector, incorporating non-lentivirus genomes, or incorporating heterologous genes into the lentiviral vector genome.

[0142]

[0113] In some embodiments, the vector containing the transcriptional unit is a Herpes Simplex virus (HSV) vector. Construction of HSV vectors has been described, for example, in U.S. Patent Nos. 5,849,572 (Glorioso et al ), 6,261,552 (DeLuca), 6,764,675 (Whitley et al.), 7,531,167 (Glorioso et al.), 7,749,745 (Johnson et al.), 10,174,341 (Glorioso et al.), and 10,172,893 (Uchida et al.) and U.S. Patent Application Publication Nos. 2019 / 0106709 (Jia et al.), 2020 / 0071679 (Huang et al.), and 2022 / 0213508 (Glorioso et al.).

[0143]

[0114] In other embodiments, the vector is a non-viral vector, representative examples of which include plasmids, mRNA, linear single stranded (ss) DNA or linear double stranded (ds) DNA, minicircles, and transposon-based vectors, such as Sleeping Beauty (SB)-based vectors and piggyBac (PB)-based vectors. In yet other embodiments, the vector may include both viral and non-viral elements.

[0144]

[0115] In some embodiments the vector is a plasmid. In addition to a promoter operatively linked to the nucleic acids, the plasmid may also contain other elements e. , that facilitate transport and expression of the nucleic acid in an immune cell. The plasmid may be linearized with restriction enzymes, in vitro transcribed to produce mRNA, and then modified with a 5’ cap and 3’ poly- A tail.

[0145]

[0116] In some embodiments, the vector may be disposed (e. , encapsulated) in a carrier. The carrier may be lipid-based, e.g., lipid nanoparticles (LNPs), liposomes, lipid vesicles, or lipoplexes. In some embodiments, the carrier is an LNP. In certain embodiments, an LNP includes two or more concentric bilayers separated by aqueous compartments. Lipid bilayers may be functionalized and / or crosslinked to one another. Lipid bilayers may include one or more ligands, proteins, or channels.

[0146]

[0117] Lipid carriers, e.g., LNPs may include one or more cationic / ionizable lipids, one or more polymer conjugated lipids, one or more structural lipids, and / or one or more phospholipids. A “cationic lipid” refers to positively charged lipid or a lipid capable of holding a positive charge. Cationic lipids include one or more amine group(s) which bear the positive charge, depending on pH. A “polymer conjugated lipid” refers to a lipid with a conjugated polymer portion. Polymer conjugated lipids include a pegylated lipids, which are lipids conjugated to polyethylene glycol. A “structure lipid” refers to a non-cationic lipid that does not have a net charge at physiological pH. Exemplary structural lipids include cholesterol, fecosterol, sitosterol, ergosterol, campesterol and the like. A “phospholipid” refers to lipids that have a triester of glycerol with two fatty acids and one phosphate ion. Phospholipids in LNPs assemble the lipids into one or more lipid bilayers. LNPs, their method of preparation, formulation, and delivery are disclosed in, e.g., U.S. Patent Application Publication Nos. 2004 / 0142025 (Maclachlan et al ), 2007 / 0042031 (Maclachlan et al.), and 2020 / 0237679 (Kaufman) and U.S. Patent Nos. 9,364,435 (Yaworski et al.), 9,518,272 (Yaworski et al.), 10,022,435 (Ciaramella et al.), and 11,191,849 (Abrams et al.).

[0147]

[0118] Lipoplexes, liposomes, and lipid nanoparticles may include a combination of lipid molecules, e.g., a cationic lipid, a neutral lipid, an anionic lipid, polypeptide-lipid conjugates, and other stabilization components. Representative stabilization components include antioxidants, surfactants, and salts. Compositions and preparation methods of lipoplexes, liposomes, and lipid nanoparticles are known in the art. See, e.g., U.S. Patent Nos. 8,058,069 (Yaworski et al.), 8,969,353 (Mahon et al.), 9,682,139 (Manoharan et al.), 10,238,754 (Guild et al.), and U.S. Patent Application Publication Nos. 2005 / 0064026 (Garidel et al.) and 2018 / 0291086 (Anchordoquy et al.), and Lasic, Trends Biotechnol. 76(7 / 307-21 (1998), Lasic et al., FEBS Lett. 372(2-3 / 255-8 (1992), and Drummond et al., Pharmacol. Rev. 57(7 / 691-743 (1999). Screening Methods

[0148]

[0119] There are also provided methods of testing the activity of one or more synthetic promoters in melanoma cells. In some embodiments, a method includes measuring the activity of one or more synthetic promoters in a melanoma cell. In some embodiments, a method includes measuring the activity of more than one synthetic promoter in melanoma cells and comparing the activity of each promoter. For example, a method may include ranking the activity of each promoter. In some embodiments, a method includes identifying a synthetic promoter having the highest activity in an ovarian cancer cell from a group of more than one synthetic promoter, such as a group of five or more, ten or more, or fifteen or more synthetic promoters.

[0149]

[0120] In some embodiments, a method of measuring the activity of a synthetic promoter in a melanoma cell, includes contacting the melanoma cell with a vector including a gene under the control of the synthetic promoter; and measuring expression of the gene in the melanoma cell, thereby measuring the activity of the synthetic promoter. The synthetic promoters used in such methods may be any disclosed herein. In some embodiments, the synthetic promoter includes a nucleic acid including 3 to 15 transcription factor binding sites (TFBS); wherein each TFBS has any one of the following nucleic acid sequences: GCATTCCN1TGCATTCCN2 (SEQ ID NO: 1), N3GGN4AAN5N6CCC (SEQ ID NO: 2), GGGN7N8TTN9CCN10 (SEQ ID NO: 3), CCGAGCATGCCCGGGCATGT (SEQ ID NO: 4), GGACATGTCCAGGCTTGCTC (SEQ ID NO: 5), GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22 (SEQ ID NO: 6),

[0150] N23N24GGN25CATGCCCGGGCN26TGT (SEQ ID NO: 7), GACAAGTTGGGACATGTC (SEQ ID NO: 8), N27GACAN28GN29CTGGN30CN31TGTC (SEQ ID NO: 9), N32N33GGACATGCCCGGN34CATGT (SEQ ID NO: 10), GGGCAAGTCCAGACCTGTAG (SEQ ID NO: 11), AACAAGTTGGGACATGTC (SEQ ID NO: 12), TGGAAATTTCCGT (SEQ ID NO: 172), AGGCACGTGA (SEQ ID NO: 173), or ATCACATGCC (SEQ ID NO: 174); wherein each Ni - N34 independently represents any nucleotide, and which for any of SEQ ID Nos: 1-12 may be the same or different; and each TFBS may be the same or different. In some embodiments, the synthetic promoter includes any one of SEQ ID NO: 134-171 and 175-217. In some embodiments, the synthetic promoter includes any one of SEQ ID NO: 134-171 and 175- 177. In some embodiments, the synthetic promoter includes any one of SEQ ID NO: 134-147 and 175-177.

[0121] Tn some embodiments, a method of ranking the activity of more than one synthetic promoter in melanoma cells, includes for each synthetic promoter of interest, contacting a melanoma cell with a vector including a gene under the control of the synthetic promoter; measuring expression of the gene in each ovarian cancer cell; and comparing expression of the gene in each melanoma cell, thereby comparing the activity of each synthetic promoter in melanoma cells. In some embodiments, the synthetic promoter includes a nucleic acid including 3 to 15 transcription factor binding sites (TFBS); wherein each TFBS has any one of the following nucleic acid sequences: GCATTCCN1TGCATTCCN2 (SEQ ID NO: 1), N3GGN4AAN5N6CCC (SEQ ID NO: 2), GGGN7N8TTN9CCN10 (SEQ ID NO: 3), CCGAGCATGCCCGGGCATGT (SEQ ID NO: 4), GGACATGTCCAGGCTTGCTC (SEQ ID NO: 5), GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22 (SEQ ID NO: 6),

[0151] N23N24GGN25CATGCCCGGGCN26TGT (SEQ ID NO: 7), GACAAGTTGGGACATGTC (SEQ ID NO: 8), N27GACAN28GN29CTGGN30CN31TGTC (SEQ ID NO: 9), N32N33GGACATGCCCGGN34CATGT (SEQ ID NO: 10), GGGCAAGTCCAGACCTGTAG (SEQ ID NO: 11), AACAAGTTGGGACATGTC (SEQ ID NO: 12), TGGAAATTTCCGT (SEQ ID NO: 172), AGGCACGTGA (SEQ ID NO: 173), or ATCACATGCC (SEQ ID NO: 174); wherein each Ni - N34 independently represents any nucleotide, and which for any of SEQ ID Nos: 1-12 may be the same or different; and each TFBS may be the same or different. In some embodiments, the synthetic promoter includes one or more of SEQ ID NO: 134-171 and 175-217. In some embodiments, the synthetic promoter includes one or more of SEQ ID NO: 134-171 and 175-177. In some embodiments, the synthetic promoter includes one or more of SEQ ID NO: 134- 147 and 175-177.

[0152] Cancer

[0153]

[0122] There are also provided methods of transcribing a nucleic acid coding sequence operatively linked to the synthetic promoter in a melanoma cell. The method entails contacting the melanoma cell with a vector encoding the transcriptional unit.

[0154]

[0123] In some embodiments, the melanoma cell is contacted with the vector in vitro. In some embodiments, a subject in need thereof is administered a pharmaceutical composition containing the vector and a pharmaceutically acceptable carrier (z.c., in vivo) to treat melanoma. Pharmaceutical Compositions

[0155]

[0124] Pharmaceutical compositions include effective amounts of the vector containing the synthetic promoter or transcriptional unit and a pharmaceutically acceptable carrier. The amount of vector in the pharmaceutical composition administered to a subject will vary between wide limits, depending upon one or more factors that may include the location, type, and severity of the cancer, the age, body weight, and condition of the individual to be treated. A physician will ultimately determine appropriate doses to be used.

[0156]

[0125] Compositions may be provided as sterile lyophilized or liquid preparations. Lyophilized preparations may be reconstituted and diluted into a liquid preparation before use, e.g.. with carriers containing isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous solutions, which may be buffered to a selected pH. Liquid carriers include aqueous or non-aqueous carriers alike. Representative examples of liquid carriers include sterile water for injection, saline, Lactated Ringer Injection solution, phosphate buffered saline, a soluble protein, soluble sugars (e.g., dextrose), dimethyl sulfoxide (DMSO), polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like), ethanol, and suitable mixtures thereof. In some embodiments, the liquid carrier includes a protein dissolved or dispersed therein, representative examples include serum albumin (e.g., human serum albumin, recombinant human albumin), gelatin, and casein. The compositions are typically isotonic, i.e., they have the same osmotic pressure as blood. Citric acid, sodium chloride, sugars, polyalcohols, and isotonic electrolyte solutions (e.g., that available under the tradename PLASMA-LYTE) may be used to achieve the desired isotonicity. Depending on the carrier, and the vector other excipients may be added, e.g., wetting, dispersing, or emulsifying agents, gelling and viscosity enhancing agents, preservatives and the like as known in the art. In some embodiments, the compositions include the vector, sucrose, polysorbate-20, potassium chloride, potassium phosphate, sodium chloride, and sodium phosphate. In some embodiments, the composition is further diluted in a 0.9% normal saline solution.

[0157]

[0126] Additional pharmaceutically acceptable excipients used in the manufacture of pharmaceutical compositions, their formulation, and delivery of expression vectors such as viral vectors are known in the art. See, for example, U.S. Patent Application Publication Nos. 2013 / 0090374 (Sena-Esteves et al ), and 2012 / 0309050 (Kumon et al.), and U.S. Patent Nos. 7,858,367 (Amalfitano et al.), 11,020,443 (Sena-Esteves et al.), and 11,041,171 (Gao et al.). Administration

[0158]

[0127] The amount of pharmaceutical composition containing the vector administered to a melanoma cell or subject may vary between wide limits.

[0159]

[0128] In embodiments where the melanoma cell is contacted with the vector in vitro, the effective amount of the vector may range from approximately 0.3 to approximately 5 genome copies (gc) per cell.

[0160]

[0129] In some embodiments, where the melanoma cell is contacted with the vector in vivo, as in a subject to be treated, the amount of pharmaceutical composition or vector will vary between wide limits, depending on factors that may include the location, type, and severity of the melanoma, the age, body weight, and condition of the individual to be treated. A physician will ultimately determine appropriate amount of vector to be used. Typically, the vector will be given in a single dose. In some embodiments, an effective amount of the vector in the pharmaceutical composition may range from approximately 1 x 106to approximately 5 x 1014gc per kg body weight (gc / kg). In some embodiments, the effective amount of the vector in the pharmaceutical composition may range from approximately 1 x 1010to approximately 2 x 1013gc / kg. In some embodiments, the effective amount of the vector in the pharmaceutical composition is approximately 2 x 1013gc / kg. In some embodiments, the effective amount of the vector in the pharmaceutical composition is approximately 1 x 107gc per subject. In some embodiments, the effective amount of the vector in the pharmaceutical composition is approximately 2 x 108gc per subject. In some embodiments, the effective amount of the vector in the pharmaceutical composition is approximately 1 x 109gc per subject. In some embodiments, the effective amount of the vector in the pharmaceutical composition is approximately 1.5 x 1011gc per subject.

[0161]

[0130] Pharmaceutical compositions containing an effective amount of the vector may be brought into contact with a melanoma cell in vivo by any medically acceptable route. In some embodiments, the pharmaceutical compositions are administered to a subject for the treatment of melanoma. The pharmaceutical composition may often be delivered intravenously or intraperitoneally, although they may also be introduced into other convenient sites (e.g., intratumorally to an affected organ or tissue) or modes, as determined by an attending physician.

[0162]

[0131] In some embodiments, the pharmaceutical composition is administered as an infusion (e.g., intravenously, or intraperitoneally) to the subject over a period of time. Representative infusion times are 30 minutes, 60 minutes, 90 minutes, and 120 minutes. In some embodiments, the infusion time is between 60 and 120 minutes. In some embodiments, the pharmaceutical composition is administered intratum orally. Representative intratumoral injection volumes are 0.1 milliliter (mL), 0.2 mL, 0.3 mL, 0.4 mL, 0.5 mL, 1 mL, 2 mL, 5 mL, and 10 mL.

[0163] Combination Therapy

[0164]

[0132] In some embodiments, the present methods may include co-administration of the pharmaceutical composition along with one or more anti-cancer agents. The term “coadministered” includes substantially contemporaneous administration, by the same or separate dosage forms, or sequentially, e.g., as part of the same treatment regimen or by way of successive treatment regimens. The sequence and time interval may be determined such that the coadministered therapies can act together (e.g., synergistically to provide an increased benefit than if they were administered otherwise). For example, the therapeutics may be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, they may be administered sufficiently close in time so as to provide the desired therapeutic effect, which may be in a synergistic fashion.

[0165]

[0133] Anti-cancer agents that may be used in combination with the inventive pharmaceutical compositions are known in the art. See, e.g., U.S. Patent No. 9,101,622 (Zeldis; Section 5.2 thereof). An “anti-cancer” agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer.

[0166]

[0134] In some embodiments, the provided methods are used before, in conjunction with, or following therapies known in the art, such as chemotherapeutic, radiotherapeutic, immunotherapeutic intervention, targeted therapy, pro-apoptotic therapy, or cell cycle regulation therapy.

[0167]

[0135] These and other aspects of the present application will be further appreciated upon consideration of the following Examples, which are intended to illustrate certain embodiments of the application but are not intended to limit its scope, as defined by the claims. EXAMPLES

[0168] Example 1 : Materials and Methods

[0169]

[0136] Promoter cloning. Synthetic promoters were synthesized by Integrated DNA Technologies (IDT; Coralville, IA) as pooled DNA oligonucleotides. Each individual synthetic promoter was amplified by polymerase chain reaction (PCR). The PCR product was further cloned into vectors with conventional restriction enzyme cloning, upstream of an adenovirus minimal promoter to control the expression of a nucleic acid coding sequence encoding a green fluorescent protein (GFP) gene.

[0170]

[0137] Lentiviral production and infection. Lentiviruses containing a synthetic promoter were produced in HEK-293T cells using co-transfection in a 24-well plate format. In brief, 2.4 pL of FuGENE HD (Promega, Madison, WI) was mixed with 20 pL of Opti-MEM medium (Thermo Fisher Scientific, Waltham, MA) and added to a mixture of the 3 plasmids 0.1 pg of pCMV-VSV- G vector, 0.1 pg of lentiviral packaging psPAX2 vector, and 0.1 pg of lentiviral expression vector containing a synthetic promoter and incubated for 20 minutes. After which, HEK-293 cells were harvested and diluted to a density of 3.6 x io6cells / ml in cell culture medium. 100 pL of diluted cells (containing 3.6 x I CP cells) were added to each FuGENE HD / DNA mixture. The culture medium of transfected cells was replaced with 400 pL fresh culture medium 18 h posttransfection. Supernatants containing newly produced viruses were collected 48 h posttransfection and filtered through a 0.45 pm syringe filter. The viral supernatant was used to infect target cells with 8 pg / mL of Polybrene (Sigma) overnight.

[0171]

[0138] Quantifying the tumor-specificity of identified promoters. Each synthetic promoter was operatively linked to a nucleic acid encoding the GFP. Flow cytometry was used to measure the GFP intensity to characterize the synthetic promoter activity in tumor cells and normal cells. To quantify the tumor-specificity of identified promoters, the mean fluorescence intensity (MFI) measured in tumor cells was divided by the MFI measured in normal cells. Data analysis was performed by FlowJo software (TreeStar Inc, Ashland, OR).

[0172] Example 2: Preferential Expression of Synthetic Promoters in Melanoma Cells

[0173]

[0139] Synthetic promoters with the nucleic acid sequences of SEQ ID NOs: 134-146 were operatively linked to a nucleic acid coding sequence encoding a GFP protein. The transcriptional units were introduced into the melanoma cell lines A375, UACC62, and SK-MEL-2 and non- cancerous human primary melanocytes (HPM) and human primary keratinocytes (HPK) and assayed for activity. Normalized activity for each synthetic promoter is illustrated in FIG. 1.

[0174]

[0140] To analyze the preferential expression of the synthetic promoters for melanoma cells as compared to non-cancerous skin cells, the expression levels were calculated in terms of a foldincrease based on the averaged activity in the three melanoma cell lines against the activity in each of the non-cancerous skin cells (FIG. 2). The synthetic promoters may be categorized as (i) tumor- preferential compared to melanocytes (e.g., SEQ ID NOs: 135 and 136), (ii) tumor-preferential compared to keratinocytes (e.g., SEQ ID NOs: 137, 138, 140, and 143-146), or (iii) tumor- preferential as compared to both melanocytes and keratinocytes (e.g., SEQ ID NOs: 134, 139, 141, and 142). The fold-increases of expression of an operatively linked nucleic acid for each synthetic promoter in a melanoma cell relative to a non-cancerous melanocyte and a non-cancerous keratinocyte are summarized in Table 3.

[0175] Table 3: Fold-increase of Synthetic Promoters Example 3: Sequence-specific Effects on TFBS Preferential Expression

[0176]

[0141] To analyze the sequence-specific effects of the TFBSs on preferential expression in keratinocytes, the nucleic acid sequences of select TFBSs (i.e., SEQ ID Nos: 4, 5, 8, 11, 12, 13, 14, 18, 41, 57, 74, 95, and 127) were altered and combined with linkers to produce expanded sets of synthetic promoters described in the paragraphs below, and that contain varying numbers of repeating TFBSs as listed in Tables 4-15, wherein each TFBS is separated by a linker. Transcriptional units were then synthesized as per Example 1. The fold-increase in expression was calculated based on a next-generation sequencing-based activity measurement in melanoma cells against the activity in non-cancerous keratinocytes. Tumor-preferentiality indexes were calculated as the percent change of the fold-increase of activity in a melanoma cell related to the unaltered synthetic promoter. The data obtained are shown in Table 4 to Table 15, below.

[0177]

[0142] The select synthetic promoters that contain TFBSs that fall within the scope of SEQ ID NO: 1 are set forth in Table 4. Their nucleic acid sequences are set forth in the sequence listing as SEQ ID NOs: 134 and 148. Each synthetic promoter contains 6 TFBSs, each with the nucleic acid sequences set forth in the table, separated by linkers three nucleotides in length. By way of example, for Table 4, and similarly for Table 5 - Table 15 below, the first row in Table 4 refers to a synthetic promoter having the nucleic acid sequence of SEQ ID NO: 134, which has 6 TFBSs each having the sequence identified by SEQ ID NO: 13, wherein the first and second TFBS are connected via the linker AGA, the second and third TFBS are connected via the linker TCG, the third and fourth TFBS are connected via the linker GAC, and the fourth and the fifth TFBS are connected via the linker ATA, and the fifth and sixth TFBS are connected via the linker ACT. For example, the nucleic acid sequence of SEQ ID NO: 148 includes 6 repeats of the TFBS GCATTCCTTGCATTCCA (SEQ ID NO: 14), and is represented by (SEQ ID NO: 14) -AGA- (SEQ ID NO: 14) -TCG-(SEQ ID NO: 14) -GAC-(SEQ ID NO: 14) -ATA-(SEQ ID NO: 14) - ACT-(SEQ ID NO: 14) or has the following nucleic acid sequence:

[0178] GCATTCCTTGCATTCCAAGAGCATTCCTTGCATTCCATCGGCATTCCTTGCATTCCAGACG CATTCCTTGCATTCCAATAGCATTCCTTGCATTCCAACTGCATTCCTTGCATTCCA (SEQ ID NO: 148).

[0179]

[0143] The altered tumor-specificity index for each synthetic promoter was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 134, multiplied by 100 and expressed as a percentage. These data are set forth in Table 4.

[0180] Table 4: Tumor-Specificity of Synthetic Promoters

[0181]

[0144] The select synthetic promoters that contain TFBSs that fall within the scope of SEQ ID NO: 2 are set forth in Table 5. Their nucleic acid sequences are set forth in the sequence listing as SEQ ID NOs: 135 and 149-155. Each synthetic promoter contains 8 TFBSs each with the nucleic acid sequences set forth in the table separated by linkers three nucleotides in length. The altered tumor-specificity index for each synthetic promoter was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 135, multiplied by 100 and expressed as a percentage.

[0182] Table 5: Tumor-Specificity of Synthetic Promoters

[0183]

[0145] The select synthetic promoters that contain TFBSs that fall within the scope of SEQ ID NO: 3 are set forth in Table 6. Their nucleic acid sequences are set forth in the sequence listing as SEQ ID NOs: 136 and 156-162. Each synthetic promoter contains 8 TFBSs each with the nucleic acid sequences set forth in the table separated by linkers three nucleotides in length. The altered tumor-specificity index for each synthetic promoter was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 136, multiplied by 100 and expressed as a percentage.

[0184] Table 6: Tumor-Specificity of Synthetic Promoters

[0185]

[0146] The synthetic promoter that contains TFBSs that fall within the scope of SEQ ID NO: 4 is set forth in Table 7. Its nucleic acid sequence is set forth in the sequence listing as SEQ ID NO: 137, which contains 5 TFBSs each with the nucleic acid sequence of SEQ ID NO: 4 separated by linkers three nucleotides in length. The altered tumor-specificity index for SEQ ID NO: 137 was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 137, multiplied by 100 and expressed as a percentage.

[0186] Table 7: Tumor-Specificity of Synthetic Promoters

[0187]

[0147] The synthetic promoter that contains TFBSs that fall within the scope of SEQ ID NO: 5 is set forth in Table 8. Its nucleic acid sequence is set forth in the sequence listing as SEQ ID NO: 138, which contains 5 TFBSs each with the nucleic acid sequence of SEQ ID NO: 5 separated by linkers three nucleotides in length. The altered tumor-specificity index for SEQ ID NO: 138 was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 138, multiplied by 100 and expressed as a percentage.

[0188] Table 8: Tumor-Specificity of Synthetic Promoters

[0189]

[0148] The select synthetic promoters that contain TFBSs that fall within the scope of SEQ ID NO: 6 are set forth in Table 9. Their nucleic acid sequences are set forth in the sequence listing as SEQ ID NOs: 139 and 163-166. Each synthetic promoter contains 5 TFBSs each with the nucleic acid sequences set forth in the table separated by linkers three nucleotides in length. The altered tumor-specificity index for each synthetic promoter was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 139, multiplied by 100 and expressed as a percentage.

[0190] Table 9: Tumor-Specificity of Synthetic Promoters

[0191]

[0149] The select synthetic promoters that contain TFBSs that fall within the scope of SEQ ID NO: 7 are set forth in Table 10. Their nucleic acid sequences are set forth in the sequence listing as SEQ ID NOs: 140 and 167-168. Each synthetic promoter contains 5 TFBSs each with the nucleic acid sequences set forth in the table separated by linkers three nucleotides in length. The altered tumor-specificity index for each synthetic promoter was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 140, multiplied by 100 and expressed as a percentage.

[0192] Table 10: Tumor-Specificity of Synthetic Promoters

[0193]

[0150] The synthetic promoter that contains TFBSs that fall within the scope of SEQ ID NO: 8 is set forth in Table 11. Its nucleic acid sequence is set forth in the sequence listing as SEQ ID NO: 142, which contains 6 TFBSs each with the nucleic acid sequence of SEQ ID NO: 8 separated by linkers three nucleotides in length. The altered tumor-specificity index for SEQ ID NO: 142 was calculated as tumor-specificity of the given synthetic promoter divided by the tumorspecificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 142, multiplied by 100 and expressed as a percentage.

[0194] Table 11 : Tumor-Specificity of Synthetic Promoters

[0195]

[0151] The select synthetic promoters that contain TFBSs that fall within the scope of SEQ ID NO: 9 are set forth in Table 12. Their nucleic acid sequences are set forth in the sequence listing as SEQ ID NOs: 143 and 169. Each synthetic promoter contains 5 TFBSs each with the nucleic acid sequences set forth in the table separated by linkers. The altered tumor-specificity index for each synthetic promoter was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 143, multiplied by 100 and expressed as a percentage.

[0196] Table 12: Tumor-Specificity of Synthetic Promoters

[0197]

[0152] The select synthetic promoters that contain TFBSs that fall within the scope of SEQ ID NO: 10 are set forth in Table 13. Their nucleic acid sequences are set forth in the sequence listing as SEQ ID NOs: 144 and 170-171. Each synthetic promoter contains 5 TFBSs each with the nucleic acid sequences set forth in the table separated by linkers. The altered tumor-specificity index for each synthetic promoter was calculated as tumor-specificity of the given synthetic promoter divided by the tumor-specificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 144, multiplied by 100 and expressed as a percentage.

[0198] Table 13: Tumor-Specificity of Synthetic Promoters

[0199]

[0153] The synthetic promoter that contains TFBSs that fall within the scope of SEQ ID NO: 11 is set forth in Table 14. Its nucleic acid sequence is set forth in the sequence listing as SEQ ID NO: 145, which contains 6 TFBSs each with the nucleic acid sequence of SEQ ID NO: 11 separated by linkers three nucleotides in length. The altered tumor-specificity index for SEQ ID NO: 145 was calculated as tumor-specificity of the given synthetic promoter divided by the tumorspecificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 145, multiplied by 100 and expressed as a percentage.

[0200] Table 14: Tumor-Specificity of Synthetic Promoters

[0201]

[0154] The synthetic promoter that contains TFBSs that fall within the scope of SEQ ID NO: 12 is set forth in Table 15. Its nucleic acid sequence is set forth in the sequence listing as SEQ ID NO: 146, which contains 5 TFBSs each with the nucleic acid sequence of SEQ ID NO: 12 separated by linkers three nucleotides in length. The altered tumor-specificity index for SEQ ID NO: 146 was calculated as tumor-specificity of the given synthetic promoter divided by the tumorspecificity of the synthetic promoter that has the nucleic acid sequence of SEQ ID NO: 146, multiplied by 100 and expressed as a percentage.

[0202] Table 15: Tumor-Specificity of Synthetic Promoters

[0203] Example 4: In vivo synthetic promoter screening and activity in YUMM1.7 and MPK cells.

[0204]

[0155] Promoters listed in Table 16 were identified by performing an in vivo synthetic promoter library screening consisting of approximately 57000 synthetic promoters on a murine melanoma cell line (YUMM1.7) and murine primary keratinocytes (MPK), and then validated the top hits on these two cell lines in vitro.

[0205] Table 16: In Vivo Synthetic Promoter and TFBS Sequences

[0206]

[0156] For cell assays, lentivirus encoding a GFP reporter gene under the control of each synthetic promoter of interest was prepared in HEK-293T cells. HEK-293T cells were transfected to produce lentivirus according to standard protocols. Lentivirus was collected 48 hours after transduction.

[0207]

[0157] YUMM1.7 and MPK cells were obtained from ATCC. To test the activity of each promoter in cells, harvested lentivirus was diluted 1 :4 in DMEM, and added to cultured YUMM1.7 or MPK tumor cells. YUMM1.7 and MPK cells were chosen because they are all clinically relevant murine melanoma and normal cell lines. Five days after infection, expression of the GFP reporter gene was measured using flow cytometry. For each promoter, the activity was significantly higher in YUMM1.7 than in MPK.

[0158] The results are shown in FIG. 3. The promoters identified by the screening platform were highly active in the murine melanoma cell line (YUMM1.7) but minimally active in the murine primary keratinocyte cell line (MPK). The promoter names are listed on the X-axis.

[0208]

[0159] Tables 17 and 18 below include the sequences of synthetic promoters encompassed by this disclosure.

[0209] Table 17 : Synthetic promoters including defined trinucleotide linkers

[0210] Table 18: Synthetic promoters including undefined trinucleotide linkers

[0211]

[0160] All patent publications, non-patent publications, and Accession numbers are indicative of the level of skill of those skilled in the art to which this disclosure pertains. All these publications and Accession numbers, including gene ID numbers, are herein incorporated by reference to the same extent as if each individual publication were specifically and individually indicated as being incorporated by reference.

[0212]

[0161] Various aspects of the foregoing description may be used alone, in combination, or in a variety of arrangements not specifically discussed in the embodiments described. The provided synthetic promoters, transcriptional units, vectors, pharmaceutical compositions, and methods are, therefore, not limited in application to the details and arrangement of components set forth in the foregoing description or illustrated in the drawings. For example, aspects described in one embodiment may be combined in any manner with aspects described in other embodiments.

Claims

What is claimed is:

1. A synthetic promoter comprising a nucleic acid comprising 3 to 15 transcription factor binding sites (TFBS); wherein each TFBS has any one of the following nucleic acid sequences: GCATTCCN1TGCATTCCN2 (SEQ ID NO: 1), N3GGN4AAN5N6CCC (SEQ ID NO: 2), GGGN7N8TTN9CCN10 (SEQ ID NO: 3), CCGAGCATGCCCGGGCATGT (SEQ ID NO: 4), GGACATGTCCAGGCTTGCTC (SEQ ID NO: 5), GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22 (SEQ ID NO: 6), N23N24GGN25CATGCCCGGGCN26TGT (SEQ ID NO: 7), GACAAGTTGGGACATGTC (SEQ ID NO: 8), N27GACAN28GN29CTGGN30CN31TGTC (SEQ ID NO: 9), N32N33GGACATGCCCGGN34CATGT (SEQ ID NO: 10), GGGCAAGTCCAGACCTGTAG (SEQ ID NO: 11), AACAAGTTGGGACATGTC (SEQ ID NO: 12), TGGAAATTTCCGT (SEQ ID NO: 172), AGGCACGTGA (SEQ ID NO: 173), or ATCACATGCC (SEQ ID NO: 174); wherein each Ni -N34 independently represents any nucleotide, and which for any of SEQ ID Nos: 1-12 and 172-174 may be the same or different; and each TFBS may be the same or different.

2. The synthetic promoter of claim 1, wherein each TFBS is connected to an adjacent TFBS via a linker comprising at least one nucleotide, wherein the linkers may be the same or different.

3. The synthetic promoter of claim 2, wherein the linkers are from two to eight nucleotides in length.

4. The synthetic promoter of claim 2, wherein the linkers are two to four nucleotides in length.

5. The synthetic promoter of claim 2, wherein the linkers are three nucleotides in length.

6. The synthetic promoter of claim 2, wherein the linkers are seven nucleotides in length.

7. The synthetic promoter of any one of claims 1 -6, which is about 27 to about 314 nucleotides in length.

8. The synthetic promoter of any one of claims 1-6, which is about 33 to about 342 nucleotides in length.

9. The synthetic promoter of any one of claims 1-6, which is about 37 to about 370 nucleotides in length.

10. The synthetic promoter of any one of claims 1-6, which contains 3 TFBSs.

11. The synthetic promoter of claim 10, which is about 27 to about 70 nucleotides in length.

12. The synthetic promoter of any one of claims 1-11, wherein at least two TFBSs are the same.

13. The synthetic promoter of any one of claims 1-12, wherein at least three TFBSs are the same.

14. The synthetic promoter of any one of claims 1-13, wherein the TFBSs are the same.

15. The synthetic promoter of any one of claims 1-11, wherein each TFBS is different.

16. The synthetic promoter of any one of claims 1-15, which exhibits at least about a 5-fold increase in activity in a melanoma cell relative to the activity of the synthetic promoter in a non- cancerous skin cell.

17. The synthetic promoter of any one of claims 1-15, which exhibits at least about 10-fold increase in activity in a melanoma cell relative to the activity of the synthetic promoter in a non- cancerous skin cell.

18. The synthetic promoter of any one of claims 1-15, which exhibits at least about 20-fold increase in activity in a melanoma cell relative to the activity of the synthetic promoter in a non- cancerous skin cell.

19. The synthetic promoter of any one of claims 1-15, which exhibits at least about 50-fold increase in activity in a melanoma cell relative to the activity of the synthetic promoter in a non- cancerous skin cell.

20. The synthetic promoter of any one of claims 1-15, wherein for SEQ ID NO: 1, Ni is A or T, and N2 is A or T; wherein for SEQ ID NO: 2, N3 is C, G, or T, N4 is A or G, Ns is G or T, and Ns is C or T; wherein for SEQ ID NO: 3, N7 is A or G, Ns is A or C, N9 is C or T, and N10 is A or C; wherein for SEQ ID NO: 6, N11 is G or T, N12 is A or G, N13 is A or T, N14 is C or T, Nis is C or T, Nis is A or T, Nnis A or G, Nis is A or G, N19 is A or T, N20 is C or T, N21 is C or G, N22 is C or T; wherein for SEQ ID NO: 7, N23 is A, C, or G, N24 is C or G, N25 is A or G, and N26 is A or T; wherein for SEQ ID NO: 9, N27 is A or G, N28 is A or T, N29 is C or T, N30 is A or G, N31 is A or T; and wherein for SEQ ID NO: 10, N32 is C or T, N33 is C or G, and N34 is A or G.

21. The synthetic promoter of any one of claims 1-20, wherein the TFBs have one or more of the nucleic acid sequences SEQ ID Nos: 13-133.

22. The synthetic promoter of any one of claims 1-21, wherein each TFBS has any one of the nucleic acid sequences of SEQ ID NOs: 4, 5, 8, 11, 12, 13, 14, 18, 41, 57, 71, 95, and 127.

23. The synthetic promoter of claim 1, in which the synthetic promoter is represented by the formula:TFB S 1-L1-TFB S2-L2-TFB S3-L3-TFB S4-L4-TFB S5-L5-TFB Se-Le-TFB S7-L7-TFB Ss-Ls- TFBS9-L9-TFBS10-L10-TFBS11-L11-TFBS12-L12-TFBS13-L13-TFBS14-L14-TFBS15;wherein each of TFBS1-TFBS15 independently has any one of the nucleic acid sequences of SEQ ID NOs: 1-133, and wherein any one or more of TFBS4-TFBS15 may be absent; wherein each of L1-L14 independently represents a linker from two to eight nucleotides in length, and wherein each linker independently represents N35N36N37N38N39N40N41N42, wherein each of N35-N42 may be any one of A, C, T, or G and may be the same or different and wherein any one or more of N37-N42 may be absent.

24. The synthetic promoter of claim 1, which has the sequence of any one of the nucleic acid sequences of SEQ ID NOs: 134-146, 148-171, or 175-177.

25. The synthetic promoter of claim 1, which has the sequence of any one of the nucleic acid sequences of SEQ ID NOs: 134-146 or 175-177.

26. A transcriptional unit comprising the synthetic promoter of any one of claims 1-25 operatively linked to a nucleic acid coding sequence that encodes a therapeutic nucleic acid, peptide, polypeptide, or protein.

27. The transcriptional unit of claim 26, further comprising at least one spacer; wherein the at least one spacer comprises 30 nucleotides or less, and which is disposed 3’ and / or 5’ of the synthetic promoter.

28. The transcriptional unit of claim 26 or 27, wherein the nucleic acid coding sequence encodes a therapeutic protein or therapeutic nucleic acid.

29. The transcriptional unit of claim 28, wherein the therapeutic protein is a transcription factor.

30. The transcriptional unit of claim 29, wherein the transcription factor is a GAL4-VP16, GAL4-VP64, or GAL4VPR fusion protein.

31. The transcriptional unit of claim 28, wherein the therapeutic protein comprises a surface T cell engager (STE), a cytokine, or a checkpoint inhibitor.

32. The transcriptional unit of claim 31 , wherein the therapeutic protein is a STE comprising an anti-CD3 single-chain variable antibody fragment (scFv) and a membrane anchor domain.

33. The transcriptional unit of claim 31, wherein the therapeutic protein comprises CCL21.

34. The transcriptional unit of claim 31, wherein the therapeutic protein comprises IL-12.

35. The transcriptional unit of claim 31, wherein the therapeutic protein is Gasdermin-D(GSDMD).

36. The transcriptional unit of claim 31, wherein the therapeutic protein comprises a checkpoint inhibitor comprising an EGFR inhibitor, a NKG2A inhibitor, PD-1 inhibitor, or a PD-L1 inhibitor.

37. The transcriptional unit of any one of claims 31-36, wherein the nucleic acid coding sequence further comprises nucleic acid encoding a signal peptide.

38. The transcriptional unit of claim 28, wherein the nucleic acid coding sequence encodes a miRNA.

39. The transcriptional unit of claim 38, wherein the miRNA is let-7, miR-15 / 16, miR-34, or miR-200.

40. The transcriptional unit of any one of claims 26-39, further comprising a regulatory unit functional in a melanoma cell.

41. The transcriptional unit of claim 40, wherein the regulatory unit is derived from the Adenovirus major late promoter.

42. A vector comprising the synthetic promoter of any one of claims 1-25.

43. A vector comprising the transcriptional unit of any one of claims 26-41 .

44. A pharmaceutical composition comprising the vector of any one of claims 42-43 and a pharmaceutically acceptable carrier.

45. A method of transcribing a nucleic acid coding sequence in a melanoma cell, comprising: contacting the melanoma cell with the vector of any one of claims 42-43.

46. The method of claim 45, wherein the contacting is conducted in vitro.

47. The method of claim 45, wherein the contacting is conducted in vivo in a subject.

48. A method of measuring the activity of a synthetic promoter in a melanoma cell, comprising: contacting the melanoma cell with a vector comprising a gene under the control of the synthetic promoter; and measuring expression of the gene in the melanoma cell, thereby measuring the activity of the synthetic promoter; wherein the synthetic promoter comprises a nucleic acid comprising 3 to 15 transcription factor binding sites (TFBS); wherein each TFBS has any one of the following nucleic acid sequences: GCATTCCN1TGCATTCCN2 (SEQ ID NO: 1), N3GGN4AAN5N6CCC (SEQ ID NO: 2), GGGN7N8TTN9CCN10 (SEQ ID NO: 3), CCGAGCATGCCCGGGCATGT (SEQ ID NO: 4), GGACATGTCCAGGCTTGCTC (SEQ ID NO: 5), GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22 (SEQ ID NO: 6), N23N24GGN25CATGCCCGGGCN26TGT (SEQ ID NO: 7), GACAAGTTGGGACATGTC (SEQ ID NO: 8), N27GACAN28GN29CTGGN30CN31TGTC (SEQ ID NO: 9), N32N33GGACATGCCCGGN34CATGT (SEQ ID NO: 10), GGGCAAGTCCAGACCTGTAG (SEQ ID NO: 11), AACAAGTTGGGACATGTC (SEQ ID NO: 12), TGGAAATTTCCGT (SEQ ID NO: 172), AGGCACGTGA (SEQ ID NO: 173), or ATCACATGCC (SEQ ID NO: 174);wherein each Ni - N34 independently represents any nucleotide, and which for any of SEQ ID Nos: 1-12 may be the same or different; and each TFBS may be the same or different.

49. A method of ranking the activity of more than one synthetic promoter in melanoma cells, comprising: for each synthetic promoter of interest, contacting a melanoma cell with a vector comprising a gene under the control of the synthetic promoter; measuring expression of the gene in each melanoma cell; and comparing expression of the gene in each melanoma cell, thereby comparing the activity of each synthetic promoter in melanoma cells; wherein the synthetic promoter comprises a nucleic acid comprising 3 to 15 transcription factor binding sites (TFBS); wherein each TFBS has any one of the following nucleic acid sequences: GCATTCCN1TGCATTCCN2 (SEQ ID NO: 1), N3GGN4AAN5N6CCC (SEQ ID NO: 2), GGGN7N8TTN9CCN10 (SEQ ID NO: 3), CCGAGCATGCCCGGGCATGT (SEQ ID NO: 4), GGACATGTCCAGGCTTGCTC (SEQ ID NO: 5), GN11N12CAN13GN14N15N16GN17N18CN19TGN20N21N22 (SEQ ID NO: 6), N23N24GGN25CATGCCCGGGCN26TGT (SEQ ID NO: 7), GACAAGTTGGGACATGTC (SEQ ID NO: 8), N27GACAN28GN29CTGGN30CN31TGTC (SEQ ID NO: 9), N32N33GGACATGCCCGGN34CATGT (SEQ ID NO: 10), GGGCAAGTCCAGACCTGTAG (SEQ ID NO: 11), AACAAGTTGGGACATGTC (SEQ ID NO: 12), TGGAAATTTCCGT (SEQ ID NO: 172), AGGCACGTGA (SEQ ID NO: 173), or ATCACATGCC (SEQ ID NO: 174); wherein each Ni - N34 independently represents any nucleotide, and which for any of SEQ ID Nos: 1-12 may be the same or different; and each TFBS may be the same or different.