Engineered t cells with nk cell receptors & uses thereof

Abstract

Disclosed are compositions and methods for Disclosed herein are engineered T cells expressing a DNAX accessory molecule-1 (DNAM-1) polypeptide and / or a NKG2D polypeptide and methods of treating cancer.

Description

[0001] Attorney Docket Number 11390-016WO1 ENGINEERED T CELLS WITH NK CELL RECEPTORS & USES THEREOF CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No.63 / 518,174, filed August 8, 2023, which is incorporated by reference herein in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under Grant Nos.1P01CA234212, 2P30A016056, and 2P50CA159981, awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING The sequence listing submitted on August 8, 2024, as an .XML file entitled “11390- 016WO1_ST26.xml” created on August 8, 2024, and having a file size of 19,220 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). BACKGROUND CD28-driven “signal 2” is required for activation of naïve CD8+ T cells by dendritic cells (DCs). However, it is unclear how effector / cytotoxic CD8+ T lymphocytes (CTLs) primed by DC-presented weak tumor-associated antigens (TAA) identify the same epitopes on cancer cells which lack CD28 ligands, while avoid the recognition of similar epitopes of healthy cells. Cytotoxic CD8+T lymphocytes (CTL) recognizing unmutated tumor-associated antigens (TAA), preferentially expressed by cancer cells, but also present in healthy tissues, constitutes an important component of spontaneous and immunotherapy-induced cancer immunity. However, the mechanisms of their selectivity in killing cancer cells are only partially understood, limiting the effectiveness and safety of their therapeutic targeting. What are needed are new engineered T cells and methods for treatment of cancer. SUMMARY The present disclosure relates to compositions and engineered T cells for treatment of cancer. Disclosed herein are genetically modified T cells (including, but not limited to primary T cell, a T cell line, a tumor infiltrating lymphocyte, an effector T cell, a memory T cell, a TEMRA, or a stem cell-like memory T cell) comprising one or more recombinant nucleic acid Attorney Docket Number 11390-016WO1 sequences encoding a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9. In some embodiments, nucleic acid sequences comprise point mutations as comprised in SEQ ID NO: 1. In some embodiments, the NKR comprises DNAM-1 or NKG2D. In some aspects, the modified T cell comprises an increased level of NKR relevant to a reference control. In some embodiments, the one or more recombinant nucleic acid sequences encoding the NKR comprise one or more point mutations. Also disclosed herein are genetically modified T cells of any preceding aspect, wherein the engineered T cell further comprises a recombinant nucleic acid sequence encoding a chimeric antigen receptor (CAR) polypeptide or a transgenic T cell receptor (TCR) polypeptide. In some aspects, the CAR polypeptide comprises a single-chain variable fragment (scFV) that binds to a tumor antigen (such as, for example, a low affinity for the tumor antigen). In some aspects, the TCR binds to the tumor antigen (such as, for example, a low affinity for the tumor antigen). In one aspect, disclosed herein are genetically modified T cells of any preceding aspect, wherein the recombinant nucleic acid sequences encoding the NKR (such as for example, DNAM-1 polypeptide, NKG2D polypeptide) and the CAR polypeptides can be operatively linked. In some aspects, the recombinant nucleic acid sequences encoding the NKR (such as for example, DNAM-1 polypeptide, NKG2D polypeptide) and the CAR polypeptides can be encoded on the same vector or different vectors. In one aspect, disclosed herein are genetically modified T cells of any preceding aspect, wherein the recombinant nucleic acid sequences encoding the DNAM-1 polypeptide, NKG2D polypeptide, and the TCR polypeptide can be operatively linked. In some aspects, the recombinant nucleic acid sequences encoding the DNAM-1 polypeptide, NKG2D polypeptide, and the TCR polypeptides can be on the same vector or different vectors. Also disclosed herein are genetically modified T cells of any preceding aspect, wherein the genetically modified T cell comprises a deletion of a CD28 gene or a fragment thereof. In one aspect, disclosed herein is are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis in a subject (such as, for example, cancers (including, but not limited to melanoma, ovarian cancer, colorectal cancer, lymphomas, and / or leukemias) treated with chemotherapy, radiotherapy, targeted therapy, biologic therapy, Attorney Docket Number 11390-016WO1 or combinations thereof) or the symptoms thereof, comprising administering to the subject a therapeutically effective amount of the genetically modified T cell of any preceding aspect to increase levels of one or more ligands of NKR (such as, for example, DNAM-1 (including, but not limited to Nectin-2 or poliovirus receptor (PVR)) and / or NKG2D (including, but not limited to ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A) on a cancer cell from the subject. For example, disclosed herein are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis in a subject (such as, for example, cancers including, but not limited to melanoma, ovarian cancer, colorectal cancer, lymphomas, and / or leukemias) or the symptoms thereof with increased levels of one or more ligands of DNAM-1 (including, but not limited to Nectin-2 or poliovirus receptor (PVR)) and / or NKG2D (including, but not limited to ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A), comprising administering to the subject a therapeutically effective amount of the genetically modified T cell (including, but not limited to primary T cell, a T cell line, a tumor infiltrating lymphocyte, an effector T cell, a memory T cell, a TEMRA, or a stem cell-like memory T cell) comprising one or more recombinant nucleic acid sequences encoding a DNAX accessory molecule-1 (DNAM-1) polypeptide and / or a NKG2D polypeptide. In some aspects, the subject has previously received chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof. Also disclosed herein are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis in a subject or the symptoms thereof, (such as, for example, a subject treated with chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof), wherein said treatments increase levels of one or more ligands of NKR (such as, for example, DNAM-1 (including, but not limited to Nectin-2 or poliovirus receptor (PVR)) and / or NKG2D (including, but not limited to ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A) comprising creating a genetically modified T cell (including, but not limited to primary T cell, a T cell line, a tumor infiltrating lymphocyte, an effector T cell, a memory T cell, a TEMRA, or a stem cell-like memory T cell) comprising one or more recombinant nucleic acid sequences encoding a encoding a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, Attorney Docket Number 11390-016WO1 TLR3, TLR5, TLR7 / 8, or TLR9. In some embodiments, nucleic acid sequences comprise point mutations as comprised in SEQ ID NO: 1. In some embodiments, the NKR comprises DNAM-1 or NKG2D. In some aspects, the modified T cell comprises an increased level of NKR relevant to a reference control. In some embodiments, the one or more recombinant nucleic acid sequences encoding the NKR comprise one or more point mutations. In one aspect, also disclosed herein are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis of any preceding aspect, wherein the recombinant nucleic acid sequences encoding the NKR (such as, for example, DNAM-1 polypeptide, NKG2D polypeptide) and the CAR polypeptides or TCR polypeptides can be operatively linked. In some aspects, the recombinant nucleic acid sequences encoding the NKR (such as, for example, DNAM-1 polypeptide, NKG2D polypeptide) and the CAR polypeptides or TCR polypeptides can be on a same vector or different vectors. In some aspects, the CAR polypeptide comprises a single-chain variable fragment (scFV) that binds to a tumor antigen (such as, for example, a low affinity for the tumor antigen). In some aspects, the TCR binds to the tumor antigen (such as, for example, a low affinity for the tumor antigen). Also disclosed herein are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis of any preceding aspect, wherein the recombinant nucleic acid sequences encoding the NKR (such as, for example, DNAM-1 polypeptide, NKG2D polypeptide) and the CAR polypeptides or TCR polypeptides can be operatively linked. In some aspects, the recombinant nucleic acid sequences encoding the NKR (such as, for example, DNAM-1 polypeptide, NKG2D polypeptide) and the CAR polypeptides or TCR polypeptides can be on a same vector or different vectors. In one aspect, disclosed herein are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis of any preceding aspect, wherein the genetically modified T cell comprises a deletion of a CD28 gene or a fragment thereof. Also disclosed herein are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis of any preceding aspect, further comprising treating the subject with from chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof prior to administration of the T cells. In one aspect, disclosed herein are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis of any preceding aspect, wherein Chemotherapy can increase the levels of one or more ligands of NKR (such as, for example, DNAM-1 (including, but not limited to Nectin-2 or poliovirus receptor (PVR)) and / or NKG2D Attorney Docket Number 11390-016WO1 (including, but not limited to ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A). BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments and together with the description illustrate the disclosed compositions and methods. Figures 1A, 1B, 1C, 1D, 1E, and 1F show that CTL-associated DNAM-1 and NKG2D are associated with the effector status of tumor-infiltrating CD8+T cells and predict clinical outcomes of melanoma patients. Figure 1A shows the correlation between DNAM-1 / NKG2D gene expression and CTL / NK cell lineage markers. Size and shade of the squares represent correlation coefficient and p values, respectively. Figure 1B shows the 10-year overall survival probability of metastatic melanoma (SKCM) patients with different expression levels of CD8A, DNAM-1, and NKG2D. Figure 1C shows hazard ratios of CD8A, DNAM-1, NKG2D and their combination to estimate overall survival (means and upper / lower limits). Figure 1D shows the expression of DNAM-1 and NKG2D on effector and exhausted CD8+TILs from melanoma patients. Left: A representative dot plot showing effector (Teff) and exhausted (Texh) identified by TIM-3 and PD-1 expression. Right: Expression of DNAM-1 and NKG2D on Teff vs. Texh CD8+TILs from a representative donor are shown in histograms and their mean florescent index (MFI) are compared (n=6 donors, each pair of dots represents TILs from an individual donor). Figure 1E shows expression of DNAM-1 and NKG2D on effector vs. exhausted MART-1– specific melanoma TILs. Figure 1F shows expression of DNAM-1 and NKG2D on different CD8+T-cell populations in the PBMCs of healthy donors. Populations of naive (Tn), central memory (Tcm), effector memory (Tem), and terminally differentiated effector memory (Temra), were gated based on their expression of CD62L and CD45RA. Expression of DNAM-1 (left) and NKG2D (right) on CD8+cells from a representative donor are shown in histograms and their MFI are shown in bar graphs (n=11 donors, mean ± SEM). Data in Figure 1A were modeled by simple linear regression and analyzed by Spearman correlation. Kaplan-Meier survival curves in Figure 1B were analyzed by log-rank test. Data in Figure 1D and 1F were analyzed by two-tailed ratio paired t test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, not significant (ns): P > 0.05. Figures 2A, 2B, 2C, 2D, 2E, 2F, 2G, 2H, and 2I show that DNAM-1 and NKG2D set the threshold for TCR-dependent recognition and killing of cancer cells presenting low levels of MHC I / TAA peptide complexes. Figure 2A shows different levels of endogenous MART- Attorney Docket Number 11390-016WO1 1 / Melan A in melanoma cells are associated with their different levels of (re)activation of DC- primed MART-1-specific CTLs. Left: Expression of MART-1 / Melan A in cancer cells are shown in histograms with MFI. Right: IFN-γ ELISPOT (n=4 donors, mean ± SEM). Figure 2B shows IFN-γ secretion by DC-primed MART-1–specific CTLs against melanoma cells expressing different levels of MART-1 / Melan A in the absence or presence of NKG2D / DNAM- 1 blockade (n=4 donors, each pair of dots represents means of paired triplicate cultures from each individual donor). Figure 2C shows the correlation between the inhibitory effect of NKG2D / DNAM-1 blockade and the strength of effector response in the recognition of melanoma cells by DC-primed MART-1-specific CTLs. Figures 2D and 2E show IFN-γ secretion by DC-primed MART-1–specific CTLs as shown in Figure 2D and a patient-derived MART-1–specific clone as shown in Figure 2E in response to cancer cells (SW620) loaded with high- or low-dose MART-1 peptides (1 or 0.01 µg / ml), in the absence or presence of NKR blockers. Figure 2D shows representative images of ELISPOT (triplicate wells per condition) and quantification of spots (n=5 donors, mean ± SEM). Figure 2E shows data with MART-1- specific clone from a representative experiment performed in triplicate cultures per condition. Figure 2F shows IFN-γ secretion by NY-ESO-1–specific TCR-transduced CD8+T cells (19305DP and CD8SP) against cancer cells loaded with decreasing doses of NY-ESO-1 peptides, with or without NKR blockade (triplicate cultures per condition, mean ± SD). Figure 2G shows representative brightfield pictures of CTL–cancer cell conjugates, and fluorescent pictures showing CFSE labelled cancer cells, CD3, LFA-1, NKG2D or DNAM-1, F-actin and their colocalization. Figure 2H shows degranulation of CTLs under indicated conditions was monitored by surface expression of CD107a on CTLs and presented as histograms with mean fluorescent index (MFI) (left) or the ratios of CD107a MFI in each of the indicated conditions to the MFI of unloaded control (right, n=3 donors). Figure 2I Killing of target cells by DC-primed MART-1–specific CTLs under the indicated conditions was analyzed by LDH cytotoxicity assay (n=3 donors). Each pair of dots represents means of paired triplicate cultures from each individual donor. Data were analyzed by two-tailed ratio paired t test (Figures 2A, 2B, 2D, 2H, and 2I), or two-tailed unpaired t test (Figures 2E and 2F). Data in Figure 2C were modeled by simple linear regression and analyzed by Pearson correlation. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, not significant (ns): P > 0.05. ND: not detected. Figures 3A, 3B, 3C, 3D, and 3E show that DNAM-1, and to a lesser extend NKG2D, enhance CTL polyfunctionality. Dynabead-induced CTLs were activated by immobilized antibodies. Figure 3A shows intracellular IFN-γ levels in CTLs activated by increasing concentrations of OKT3 in the absence or presence of NKR costimulation. Left: Representative Attorney Docket Number 11390-016WO1 flow cytometry histograms showing intracellular IFN-γ levels of differentially stimulated CTLs. Right: Percentages of IFN-γ–producing CTLs activated by low-dose OKT3 in the absence or presence of NKR costimulation (n=5 donors; mean ± SEM). Figures 3B, 3C, 3D and 3E show single-cell secretome of CTLs activated under the indicated conditions were analyzed using Adaptive Immune ISOCODE chips and isoLight system (IsoPlexis), showing summary results of 2 separate experiments using different donors. Figure 3B shows a 3D-UMAP projection showing clusters of CTLs activated by OKT3 alone and CTLs activated by OKT3 plus NKR- costimulation. Figure 3C shows the expression of effector cytokines was overlayed on t-SNE projections, showing intensity of cytokines in CTLs activated by low-dose OKT3 either alone or in combination with the indicated NKR-costimulation. Figure 3D shows that the polyfunctionality was calculated as the percentages of activated CTLs secreting ≥ 2 types of proteins. Figure 3E shows that the Polyfunctional Strength Index (PSI) was computed as the percentage of polyfunctional cells, multiplied by the sum of the mean fluorescence intensity of the proteins secreted by those cells. Proteins were grouped and color-coded based on their functions: Effector: Granzyme B, IFN-γ, Perforin, TNFα; Stimulatory: GM-CSF, IL-2, IL-12, IL-15; Chemo-attractive: CCL4, CCL5; Modulatory: IL4, IL10, sCD40L. Data in Figure 3A were analyzed by two-tailed ratio paired t test. **P < 0.01. Figures 4A, 4B, 4C, 4D, 4E, 4F, and 4G. DNAM-1 provides superior costimulation of effector CTLs, lowering the TCR activation threshold, enhancing metabolic reprogramming, and all major TCR signaling pathways. Figures 4A, 4B, 4C, 4D, and 4E show RNA sequencing data: Gene expression profiles of CTLs from 3 donors stimulated by OKT3 either alone (control) or in combination with DNAM-1, NKG2D, or CD28 costimulation. Figure 4A shows Principal component analysis (PC3 and PC4) comparing patterns of gene expression in CTLs activated under the indicated conditions. Figure 4B shows a volcano plot showing the differentially expressed genes (DEGs) in CTLs activated with the indicated costimulation versus control CTLs. DEGs with log2 fold change > 1 and adjusted P value< 0.05 were defined as significant. Figure 4C shows a heatmap showing DNAM-1-unique DEGs which are associated with CTL effector and regulatory functions. Figure 4D shows top enriched pathways in DNAM-1- costimulated CTLs compared to control CTLs from Gene Set Enrichment Analysis (GSEA). Figure 4E shows enrichment of mTORC1 signaling and glycolysis in DNAM-1-costimulated CTLs compared to control CTLs. Figures 4F and 4G show that CTLs were stimulated by streptavidin crosslinking of biotinylated αCD3 (OKT3) with or without biotinylated αDNAM-1. Figure 4F shows induction of calcium flux by OKT3 with or without DNAM-1 costimulation. Left: Intracellular calcium levels over time in CTLs stimulated with OKT3 and different Attorney Docket Number 11390-016WO1 concentrations of αDNAM-1 (the arrow indicated the addition of streptavidin). Right: Results from 3 independent experiments were normalized by Fluo-4 Peak MFI Ratio calculated as Fluo- 4 Peak MFI divided by baseline MFI (n=3 donors; mean ± SEM). Figure 4G shows a western blot of phosphorylated AKT and ERK in CTLs stimulated with or without DNAM-1 costimulation at different timepoints. Data in Figure 4F were analyzed by multiple paired t test. *P < 0.05, not significant (ns): P > 0.05. Figures 5A, 5B, 5C, 5D, 5E, 5F, and 5G show that effector versus naïve CD8+T cells rely on DNAM-1 versus CD28 as the dominant costimulatory pathways. Figure 5A shows intracellular calcium levels over time in CTLs stimulated with OKT3, OKT3 and αDNAM-1, or OKT3 and αCD28. The arrow indicated the addition of streptavidin for crosslinking of biotinylated antibodies. Figure 5B shows effects of DNAM-1 versus CD28 costimulation in activation of naïve CD8+T cells. Left: CFSE dilution of naïve CD8+T cells activated by immobilized OKT3 with different costimulatory signals in a representative donor. Right: Percentages of CFSElowactivated cells (n=3 donors; mean ± SEM). Figure 5C shows IFN-γ secretion by naïve CD8+T cells (left, n=3 donors) or Dynabead-induced CTLs (right, n=4 donors) activated by immobilized OKT3 with the indicated costimulatory signals (mean ± SEM). Figure 5D shows the expression of DNAM-1 ligands (PVR and Nectin2) and CD28 ligands (B7.1 and B7.2) on DCs. Figures 5E and 5F show that DCs were pulsed with Staphylococcus Enterotoxin (SEB) to induce polyclonal T cell activation. %inhibition = [%Activated T cells (control) - %Activated T cells (blockade)] / [%Activated T cells (control) - %Activated T cells (no SEB)] × 100. Figure 5E shows the activation of naïve CD8+T cells by SEB-pulsed DCs in the presence of blocking antibodies against DNAM-1 or CD28. Left: Representative flow cytometry histograms of T cell CFSE dilution. Right: Summary data of triplicate cultures from 3 donors showing inhibitory effect of each blocker on naïve cell activation. Figure 5F shows Re-activation of Dynabead-induced CTLs by SEB-pulsed DCs in the presence of blocking antibodies against DNAM-1 or CD28. Left: Representative contour plots of side scatter and IFN-γ expression. Right: Summary data of triplicate cultures from 3 donors showing inhibitory effect of each blocker on CTL re-activation. Figure 5G shows a model of NKR-mediated “alternative signal 2” supporting the specificity of CTL anti-cancer function. Data in Figures 5B and 5C were analyzed by two-tailed ratio paired t test. *P < 0.05, **P < 0.01. ND: not detected. Figures 6A, 6B, 6C, 6D, 6E, and 6F. Enhancing NKR-mediated recognition improves CTL functional avidity and cancer cell elimination. Figure 6A shows overexpression of NKG2D and DNAM-1 on TCR transduced CD8+T cells. Upper: Design of the NKG2D / DNAM-1 co- Attorney Docket Number 11390-016WO1 expressing vector (IC: intracellular domain; TM: transmembrane domain; EC: extracellular domain; SS: spacer sequence). Lower: Contour plots comparing the expression of NKG2D and DNAM-1 on blood-isolated CD8+T cells transduced with the TCR construct (single-transduced) or with the TCR construct and the additional NKG2D / DNAM-1 co-expressing vector (double- transduced). Figure 6A shows the construction of functional CD314 / CD226 co-expressing retroviral vectors. pDONII-CD314CD226: Human full length CD314 and CD226 coding sequences were fused via P2A-skipping site and cloned in a MSCV-based retroviral vector (pDONII) comprising SEQ ID NO: 1. Figure 6B shows survival of SW620 cells loaded with increasing concentrations of NY-ESO-1 (0, 0.01, and 0.1 μg / ml) after 24-hour co-culture with single-transduced T cells or double-transduced T cells. Data shows representative contour plots of AnnexinV and DAPI (left) and summary results of independent experiments quantifying the percentage of AnnexinV–DAPI–surviving cancer cells (right, n=3 donors; mean ± SEM). Figure 6C shows comparison of expression of NKG2D and DNAM-1 ligands on untreated or oxaliplatin-treated (100 μM; 72 hours) SW620 cells. Figure 6D shows IFN-γ secretion by DC- primed MART-1–specific CTLs against untreated or oxaliplatin-treated SW620 cells loaded with MART-1 peptide (low-dose: 0.01 μg / ml, high-dose: 1 μg / ml). Data show a representative image of ELISPOT performed in triplicate wells per condition and quantification of spot number from the same experiment (mean ± SD). Figure 6E shows IFN-γ secretion by DC-primed MART-1–specific CTLs against SW620 untreated or pre-treated with oxaliplatin for 72 hours and loaded with 0.001 μg / ml MART-1 peptide. Data show summary result of 5 independent experiments performed in triplicate wells per condition (means and individual data points). Figure 6F shows schematic depiction of sensitizing chemo-resistant cancer cells to immune recognition through upregulation of NKR ligands. Data in were analyzed by multiple paired t test as shown in Figure 6B, or two-tailed unpaired t test shown in Figure 6D. *P < 0.05, **P < 0.01, not significant (ns): P > 0.05. Figure 7 shows the complete map of the 1928Dz_1 construct. The 19-28ζ CAR fusion gene was constructed and cloned into a retroviral vector. The dsDNA insert of DNAM-1 intracellular domain was synthesized using IDT gBlocks. Figures 8A and 8B show that DNAM-1 and NKG2D expression levels are correlated with long term survival and cytotoxic genes in tumor samples from melanoma patients (TCGA). Figure 8A shows the 10-year overall survival probability of metastatic melanoma (SKCM) patients with high and low expression of DNAM-1 or NKG2D. Figure 8B shows correlations between DNAM-1 / NKG2D and functional genes in metastatic melanoma patients. Kaplan- Meier survival curves shown in Figure 8A were analyzed by log-rank test. Data in Figure 8B Attorney Docket Number 11390-016WO1 were analyzed by Spearman correlation. Figures 9A and 9B show the expression levels of DNAM-1 and DNAM-1-competing (inhibitory) receptors reflect CTL cytotoxic function. Figure 9A shows expression of inhibitory receptors TIGIT, CD96, and CD112R on Teff vs. Texh CD8+ TILs (defined by PD-1 and TIM- 3; please see main Figure 2 for the gating strategy) from a representative donor are shown in histograms and their mean florescent index (MFI) are compared (n=6 donors, each pair of dots represents TILs from an individual donor). Figure 9B shows degranulation of DNAM-1+ and DNAM-1- CD8+ TILs in response to anti-CD3 (OKT3), showing histograms from a representative donor and summary results comparing MFI (n=3 donors, mean ± SEM). Data were analyzed by two-tailed ratio paired t test. *P < 0.05, **P < 0.01, ***P < 0.001, not significant (ns): P > 0.05. Figures 10A, 10B, 10C, 10D, 10E, and 10F. DC-primed MART-1-specific CTLs express high levels of NKRs but recognize and kill cancer cells in a strictly TCR-dependent manner. Figure 10A shows a schematic depiction of in vitro sensitization (IVS) using MART-1 loaded αDC1 to induce MART-1-specific CTLs from autologous CD8+ T cells. flow cytometry panels showing induction of MART-1-specific CTLs from day 7 IVS. Figure 10B shows the upregulation of DNAM-1 and NKG2D on DC-primed MART-1-specific CTLs (Dextramer+) from day 7 IVS. Figure 10C shows DNAM-1 and NKG2D expression levels over time on DC- primed MART-1-specific CTLs. Figure 10D shows expression of NK receptor ligands and CD28 ligands on multiple cancer cell lines, including colorectal cancer (SW620), ovarian cancer (OVCAR3), and melanoma (2183-Her4, Mel526, Mel624). Figure 10E shows IFN-γ secretion by MART-1-specific CTLs against MART-1-negative SW620 cells loaded with increasing doses of MART-1 peptides (triplicate cultures, mean ± SD). Figure 10F shows killing of cancer cells by MART-1-specific CTLs, showing subtracted absorbance value of indicated conditions performed in triplicated wells (mean ± SD). Data were analyzed by two-tailed unpaired t test. Not significant (ns): P > 0.05. ND: not detected. Figures 11A, 11B, and 11C show that NKRs assist CTLs to recognize and conjugate cancer cells expressing low-level MHCI / peptide complexes. Figure 11A shows IFN-γ secretion by DC-primed MART-1-specific CTLs in response to cancer cells (OVCAR3 or Caco-2) loaded with high- or low-dose MART-1 peptides, in the absence or presence of NKR blockers (triplicate cultures per condition, mean ± SD). Figure 11B shows IFN-γ secretion by DC-primed MART-1-specific CTLs against high-MART-1 loaded cancer cells with MHCI blockade, in the absence or presence of NKR blockers. Data show representative images of ELISPOT (triplicate wells per condition) and quantification of spots (n=4 donors, mean ± SEM). Figure 11C shows Attorney Docket Number 11390-016WO1 contour plots (left) and histogram (right) showing the percentages of CM-Dil+CFSE+ conjugates formed by CM-Dil-labelled CTLs and CFSE-labelled MART-1-loaded cancer cells in the absence or presence of NKR blocking antibodies (triplicate cultures per condition; mean ± SD). Data were analyzed by two-tailed unpaired t test as shown in Figures 11A and 11C, or two- tailed ratio paired t test as shown in Figure 11B. *P < 0.05, **P < 0.01, ***P < 0.001, not significant (ns): P > 0.05. Figure 12 shows that human peripheral blood CD8+ T cells require NKR-mediated costimulation for optimal effector response to weak TCR stimulation. Left: Representative flow cytometry contour plots showing intracellular IFN-γ and surface CD107a levels of CD8+ T cells stimulated by increasing concentrations of OKT3 in the absence or presence of NKR costimulation. Right: Percentages of IFN-γ+CD107+ CD8+ T cells stimulated by the indicated conditions (n=5 donors; mean ± SEM). Data were analyzed by two-tailed ratio paired t test. *P < 0.05, **P < 0.01, not significant (ns): P > 0.05. Figures 13A and 13B show that DNAM-1 signaling assists TCR signaling in CTLs. Figure 13A shows Taqman qPCR results showing expression of effector genes in differentially costimulated CTLs (n=4 donors, mean ± SEM). Figure 13B shows intracellular calcium levels over time in differentially stimulated CTLs, comparing DNAM-1-induced vs. TCR-induced calcium flux. The arrow indicates the addition of streptavidin for crosslinking of biotinylated Abs. Data in Figure 13A were analyzed by two-tailed ratio paired t test. *P < 0.05, **P < 0.01, ***P < 0.001, not significant (ns): P > 0.05. Figures 14A, 14B, and 14C show that chemotherapeutic drugs elevate NKR-L expression on cancer cells. Histograms showing mRNA expression of NKG2D and DNAM-1 ligands on SW620 as shown in Figure 14A, Caco-2 as shown in Figure 14B, and SKOV3 as shown in Figure 14C treated with increasing doses of the indicated chemotherapeutic drugs. Data were calculated as relative expression to housekeeping gene HPRT1 (mean ± SEM of 3 independent experiments). Data were analyzed by two-tailed ratio paired t test. *P < 0.05, **P < 0.01, ***P < 0.001. Figures 15A and 15B show the downregulation of NKRs impairs the killing function of CTLs. Figure 15A shows flow cytometry histograms comparing NKG2D and DNAM-1 expression on CTLs transduced with lentiviral shRNA vectors versus scramble control. Figure 15B shows survival of cancer cells after 24-hour coculture with CTLs transduced with lentiviral shRNA vectors versus scramble control was measured by AnnexinV and DAPI. Left: Flow cytometry contour plots showing the population of live cancer cells under indicated conditions from a representative experiment. Right: Bar graph showing the percentages of live cancer cells Attorney Docket Number 11390-016WO1 (triplicate cultures, mean ± SD). Data were analyzed by unpaired t test. **P < 0.01, ****P < 0.0001. Figure 16 shows the expression of DNAM-1 ligands and CD28 ligands on leukemia cells. Flow cytometry histograms showing surface expression of DNAM-1 ligands (PVR, Nectin2) and CD28 ligands (B7.1, B7.2) on CD19-expressing cancer cells Daudi (lymphoma), Raji (lymphoma), and NALM6 (leukemia). Figures 17A, 17B, and 17C show the generation of 19-28ζ and 19-28Dζ CAR T cells. Figure 17A shows schematics of 19-28ζ and 19-28Dζ CAR constructs. Figure 17B shows CAR expression ratios of 19-28ζ and 19-28Dζ transduced T cells. Left: Flow cytometry histograms showing staining of anti-CAR on untransduced (UT) T cells and 19-28ζ or 19-28Dζ transduced T cells. Right: Bar graph showing the percentages of CD19-targeted CAR positive T cells from 3 independent experiments (mean ± SEM). Figure 17C shows phosphorylation of DNAM-1 at serine residue 329 in 19-28Dζ CAR T cells incubated with Raji cells at various time points. Numbers indicate mean fluorescent indexes. Figures 18A, 18B, and 18C show cytotoxic function of 19-28ζ versus 19-28Dζ CAR T cells. Figure 18A shows flow cytometry dot plots showing the percentages of CAR-expressing cells in untransduced (UT) T cells and 19-28ζ or 19-28Dζ transduced T cells. Figure 18B shows cytotoxic effects of differentially transduced T cells shown in Figure 18A. T cells were cocultured with cancer cells at indicated E:T ratios. Survival cancer cells were measured by luciferase assay and determined as relative light units (RLU) (triplicate cultures per condition, mean ± SD). Figure 18C shows percentages of survival cancer cells cocultured with untransduced T cells or flow sorted CAR-expressing T cells (triplicate cultures per condition, mean ± SD). Data were analyzed by unpaired t test. *P < 0.05, **P < 0.01. Figures 19A and 19B show IFN-γ secretion by differentially transduced T cells in response to different strengths of CAR activation. Figure 19A shows the baseline IFN-γ release by differentially transduced T cells, showing IFN-γ in the medium of untransduced (UT) and CAR T cells rested for 3 hours in absence of CAR stimulation (triplicate cultures per condition, mean ± SD). Figure 19B shows CAR-specific IFN-γ release by differentially transduced T cells, showing IFN-γ in the medium of untransduced (UT) and CAR T cells activated for 3 hours by increasing doses of immobilized anti-CAR (triplicate cultures per condition, mean ± SD). IFN-γ concentrations were normalized by subtraction of baseline IFN-γ shown in Figure 19A. ND: not detected. Figures 20A and 20B show expression of activating NK receptors on CD8+T cells and their ligands on cancer cells. Figure 20A shows a heatmap comparing expression of activating Attorney Docket Number 11390-016WO1 NK receptors on naïve CD8+T cells, activated CD8+T cells, and NK cells. Genes upregulated in activated CD8+T cells are highlighted in bold. Data retrieved from Database of Immune Cell Expression. Figure 20B shows flow cytometry histograms showing surface expression of indicated activating NK receptors on naïve (CFSEhigh) versus activated (CFSElow) CD8+T cells from 8-day co-culture of CFSE-labeled naïve CD8+ T cells and autologous DCs. DETAILED DESCRIPTION Before the present compounds, compositions, articles, devices, and / or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. Definitions As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is Attorney Docket Number 11390-016WO1 understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. “Administration” or “administering” to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. "Concurrent administration", "administration in combination", "simultaneous administration" or "administered simultaneously" as used herein, means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. “Systemic administration” refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject’s body (e.g., greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, “local administration” refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration but are undetectable or detectable at negligible amounts in distal parts of the subject’s body. Administration includes self-administration and the administration by another. A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative." “Complementary” or “substantially complementary” refers to the hybridization or base pairing or the formation of a duplex between nucleotides or nucleic acids, such as, for instance, between the two strands of a double stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid. Complementary nucleotides are, generally, A and T / U, or C and G. Two single-stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and Attorney Docket Number 11390-016WO1 compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98% to 100%. Alternatively, substantial complementarity exists when an RNA or DNA strand hybridizes under selective hybridization conditions to its complement. Typically, selective hybridization will occur when there is at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary. See Kanehisa (1984) Nucl. Acids Res.12:203. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc. A DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein (and therefore the DNA and the mRNA both encode the protein), or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g. tRNA, rRNA, microRNA (miRNA), a "non-coding" RNA (ncRNA), a guide RNA, etc.). "Expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or Attorney Docket Number 11390-016WO1 contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno- associated viruses) that incorporate the recombinant polynucleotide.) The “fragments,” whether attached to other sequences or not, can include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the fragment is not significantly altered or impaired compared to the nonmodified peptide or protein. These modifications can provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the fragment must possess a bioactive property, such as regulating the transcription of the target gene. The term "gene" or "gene sequence" refers to the coding sequence or control sequence, or fragments thereof. A gene may include any combination of coding sequence and control sequence, or fragments thereof. Thus, a "gene" as referred to herein may be all or part of a native gene. A polynucleotide sequence as referred to herein may be used interchangeably with the term "gene”, or may include any coding sequence, non-coding sequence or control sequence, fragments thereof, and combinations thereof. The term "gene" or "gene sequence" includes, for example, control sequences upstream of the coding sequence (for example, the ribosome binding site). The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10 amino acids or 20 nucleotides in length, or more preferably over a region that is 10-50 amino acids or 20-50 nucleotides in length. As used herein, percent (%) nucleotide sequence identity is defined as the percentage of amino acids in a candidate sequence that are identical to the nucleotides in a reference sequence, after Attorney Docket Number 11390-016WO1 aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods. For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res.25:3389-3402, and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a Attorney Docket Number 11390-016WO1 wordlength (W) of 11, an expectation (E) or 10, M=5, N=−4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=−4, and a comparison of both strands. The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01. The term "naturally-occurring" or "unmodified" or "wild type" as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature, and which has not been intentionally modified by a human in the laboratory is wild type (and naturally occurring). The term “increased” or “increase” as used herein generally means an increase by a statically significant amount; for the avoidance of any doubt, “increased” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10- fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level so long as the increase is statistically significant. A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a Attorney Docket Number 11390-016WO1 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant. The term "nucleic acid" as used herein means a polymer composed of nucleotides, e.g., deoxyribonucleotides (DNA) or ribonucleotides (RNA). The terms "ribonucleic acid" and "RNA" as used herein mean a polymer composed of ribonucleotides. The terms "deoxyribonucleic acid" and "DNA" as used herein mean a polymer composed of deoxyribonucleotides. “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. As used herein, "operatively linked" can indicate that the regulatory sequences useful for expression of the coding sequences of a nucleic acid are placed in the nucleic acid molecule in the appropriate positions relative to the coding sequence so as to effect expression of the coding sequence. This same definition is sometimes applied to the arrangement of coding sequences and / or transcription control elements (e.g. promoters, enhancers, and termination elements), and / or selectable markers in an expression vector. The term "operatively linked" can also refer to the arrangement of polypeptide segments within a single polypeptide chain, where the individual polypeptide segments can be, without limitation, a protein, fragments thereof, linking peptides, and / or signal peptides. The term operatively linked can refer to direct fusion of different individual polypeptides within the single polypeptides or fragments thereof where there are no intervening amino acids between the different segments as well as when the individual polypeptides are connected to one another via one or more intervening amino acids. The term "polynucleotide" refers to a single or double stranded polymer composed of nucleotide monomers. "Pharmaceutically acceptable" component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration. "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is Attorney Docket Number 11390-016WO1 generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein. As used herein, by a “subject” means an individual. Thus, the “subject” can include domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, chickens, ducks, geese, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.), and birds. “Subject” can also include a mammal, such as a primate or a human. Thus, the subject can be a human or veterinary patient. The terms “treat,” “treating,” “treatment,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating, or reducing the intensity of one or more attendant symptoms of a disorder or condition and / or alleviating, mitigating, or impeding one or more causes of a disorder or condition. Treatments according to the disclosure may be applied preventively, prophylactically, palliatively, or remedially. Treatments are administered to a subject prior to onset (e.g., before obvious signs of a genetic disorder), during early onset (e.g., upon initial signs and symptoms of a genetic disorder), or after an established development of a cancer. Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of a cancer. As used herein, the term, “deletion”, also called gene deletion, deficiency, or deletion mutation, refers to part of a chromosome or a sequence of DNA being left out during DNA replication. Deletion, or gene deletions can cause any number of nucleotides to be deleted from a single base to an entire piece of chromosome. “Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect. The amount of agent that is “effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent, or agents, and the like. Thus, it is not always possible to specify a quantified “effective amount.” However, an appropriate “effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of an agent necessary to achieve a therapeutic effect may vary according Attorney Docket Number 11390-016WO1 to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. “Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a genetic disorder). The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the terms “therapeutic agent” is used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc. “Therapeutically effective amount” or “therapeutically effective dose” of a composition (e.g., a composition comprising an agent) refers to an amount that is effective to achieve a desired therapeutic result. In some embodiments, a desired therapeutic result is the control of cancer. In some embodiments, a desired therapeutic result is the control of metastasis. In some embodiments, a desired therapeutic result is the reduction of tumor size. In some embodiments, a desired therapeutic result is the prevention and / or treatment of relapse. Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and / or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years. Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are Attorney Docket Number 11390-016WO1 also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon. COMPOSITIONS AND METHODS Genetically modified T cells The concept of transferring T cells to subjects to treat disease (such as, for example cancer) has become an established practice based on the premise that the antigen specificity of T cells can be manipulated by genetic modification and redirected to target antigen expressed by cancer cells. T cells can be engineered to express modified surface receptors (such as, for example natural killer (NK) receptors, T cell receptors (TCRs), and chimeric antigen receptors (CARs)) that can enhance antigen affinities and specificities. In some instances, synergy between NK receptors, TCRs, and CARs is required for optimal activation of the T cell response and target of tumor antigens. However, insufficient cancer cell recognition results when synergy between two or more receptors is lacking. Thus, the present disclosure provided engineered T cells expressing surface receptors for the treatment and / or prevention of cancer. In one aspect, disclosed herein is a genetically modified T cell comprising one or more recombinant nucleic acid sequences encoding a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9. The recombinant nucleic acid sequence of the present disclosure comprises a promoter operably linked to the nucleic acid sequence a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9. In some embodiments, the promoter is positioned within the nucleic acid sequence so as to promote transcription or expression of a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, Attorney Docket Number 11390-016WO1 SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9. In some embodiments, nucleic acid sequences comprise point mutations as comprised in SEQ ID NO: 1. In some embodiments, the promoter can be of genomic origin or synthetically generated. A variety of promoters for use in T cells are well-known in the art including, but not limited to Marodon et al. (2003) Blood 101(9): 3416-23, incorporated herein in its entirety for its teachings of T cell promoters. The promoter can also be constitutive or inducible, wherein induction is associated with the specific cell type or a specified level of cellular maturation. Alternatively, a number of well-known viral promoters are also suitable. Viral promoters suitable for use in the present disclosure include but are not limited to the β- actin promoter, SV40 early and SV40 late promoters, immunoglobulin promoters, human cytomegalovirus promoters, retrovirus promoters, and the Friend spleen focus-forming virus promoters. The promoters may or may not by associated with enhancer elements, wherein enhancers may be naturally associated with a chosen promoter or associated with a different promoter. The nucleic acid sequence of the open reading frame (ORF) encoding a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprising a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9 can be obtained from a genomic DNA source, a cDNA source, or can be synthesized (such as, for example generated through polymerase chain reactions (PCR)), or combinations thereof. In some embodiments, the suitable T cells comprising the recombinant nucleic sequence includes but is not limited cytotoxic lymphocytes (CTLs) (such as, for example effector / cytotoxic CD8+ T lymphocytes), tumor-infiltrating lymphocytes (TILs), and / or other cells capable of killing target cells with activated. In some embodiments, the T cells can be harvested from a subject to receive subsequent T cell therapy or harvested from a different host or subject. In some embodiments, an increased level of a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM- 1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, Attorney Docket Number 11390-016WO1 KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9 relevant to a reference control. In some embodiments, the DNAM-1, NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9 polypeptide levels are increased by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, or more relative to a reference control. In some embodiments, the genetically modified T cell further comprises a recombinant nucleic acid sequence encoding a chimeric antigen receptor (CAR) polypeptide comprising a single-chain variable fragment (scFV) that binds to a tumor antigen. In some embodiments, the scFV is low affinity for the tumor antigen. In some embodiments, the genetically modified T cell further comprises a recombinant nucleic acid sequence encoding a transgenic T cell receptor (TCR) polypeptide that binds to a tumor antigen. In some embodiments, the TCR is low affinity for the tumor antigen. In some embodiments, the recombinant nucleic acid sequences encoding natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9, or TCR polypeptides are operatively linked. It should be understood that the DNAM-1 polypeptide, NKG2D polypeptide, and the CAR polypeptides or TCR polypeptides can be placed in any order to achieve optimal expression and the desired effect. Non-limiting examples include the recombinant nucleic acid sequence can have any one of the following orders: 1) DNAM-1 polypeptide, NKG2D polypeptide, and the CAR polypeptides; 2) NKG2D polypeptide, the CAR polypeptides, and DNAM-1 polypeptide; 3) NKG2D polypeptide, DNAM-1 polypeptide, and the CAR polypeptides; 4) the CAR polypeptides, DNAM-1 polypeptide, and NKG2D polypeptide; 5) the CAR polypeptides, NKG2D polypeptide, and DNAM-1 polypeptide; 6) DNAM-1 polypeptide, the CAR polypeptides, and NKG2D polypeptide; 7) DNAM-1 polypeptide, NKG2D polypeptide, and the TCR polypeptides; 8) NKG2D polypeptide, the TCR polypeptides, and DNAM-1 polypeptide; 9) NKG2D polypeptide, DNAM-1 polypeptide, and the TCR polypeptides; 10) the TCR polypeptides, DNAM-1 polypeptide, and NKG2D polypeptide; 11) the TCR polypeptides, NKG2D Attorney Docket Number 11390-016WO1 polypeptide, and DNAM-1 polypeptide; or 12) DNAM-1 polypeptide, the TCR polypeptides, and NKG2D polypeptide. It has been contemplated that the recombinant nucleic acid sequence encoding natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9, and the CAR polypeptides or TCR polypeptides can be placed in a suitable expression vector (also referred to herein as a vector) or as naked DNA. In some embodiments, the recombinant nucleic acid sequence encoding the natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM- 1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9, and the CAR polypeptides or TCR polypeptides can be placed into any vector disclosed herein. In some embodiments, the recombinant nucleic acid sequences encoding the DNAM-1 polypeptide, NKG2D polypeptide, and the CAR polypeptides or TCR polypeptides are on a same vector or different vectors. In some embodiments, the genetically modified T cell comprises a deletion of a CD28 gene or a fragment thereof. In some embodiments, the T cell is a primary T cell, a T cell line, a tumor infiltrating lymphocyte, an effector T cell, a memory T cell, a TEMRA, or a stem cell-like memory T cell. It should be noted that the DNAM-1, NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9of the genetically modified T cell represent functional DNAM-1, NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9 molecules, involving the following functions: a) ligand-binding domain(s) capable of engaging their cognate ligands on cancer cells and b) intracellular signaling domain(s) able of deliver co-stimulatory signals when Attorney Docket Number 11390-016WO1 the relevant ligand(s) of DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9 is / are engaged. In should also be noted that the genetically modified T cell comprises the intracellular signaling domains of DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9operably linked to extracellular antigen-binding CAR or TCR that are able to deliver the costimulatory signal(s) to location where said CAR or TCR binds to its antigenic ligands, without need for additional interaction between extracellular (ligand-binding) domains of DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9 and their specific ligands. In cases wherein the intracellular signaling domains DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9 are operably linked to extracellular antigen- binding of CAR or TCR, intracellular signaling domains DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9 amplify the CAR or TCR signaling. In some embodiments, the co-stimulatory molecules can bind to their antigenic ligands at bi-specific locations. Delivery of the compositions to cells There are a number of compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems. For Attorney Docket Number 11390-016WO1 example, the nucleic acids can be delivered through a number of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes. Appropriate means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA, are described by, for example, Wolff, J. A., et al., Science, 247, 1465-1468, (1990); and Wolff, J. A. Nature, 352, 815-818, (1991). Such methods are well known in the art and readily adaptable for use with the compositions and methods described herein. In certain cases, the methods will be modified to specifically function with large DNA molecules. Further, these methods can be used to target certain diseases and cell populations by using the targeting characteristics of the carrier. Nucleic acid-based delivery systems Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res.53:83-88, (1993)). As used herein, plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as the gRNA and the nucleic acids encoding the Cas endonuclease, into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered. In some embodiments, the gRNA and the nucleic acids encoding the Cas endonuclease are derived from either a virus or a retrovirus. Viral vectors are, for example, Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, AIDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells. Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non- dividing cells. Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature. A preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens. Preferred vectors of this type will carry coding regions for Interleukin 8 or 10. Attorney Docket Number 11390-016WO1 Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells. Typically, viral vectors contain, nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary for replication and encapsulation, and promoters to control the transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene / promotor cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material. The necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans. Retroviral Vectors A retrovirus is an animal virus belonging to the virus family of Retroviridae, including any type, subfamilies, genus, or tropisms. Retroviral vectors, in general, are described by Verma, I.M., Retroviral vectors for gene transfer. A retrovirus is essentially a package which has packed into its nucleic acid cargo. The nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat. In addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus. Typically, a retroviral genome contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that is to be transferred to the target cell. Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome. The removal of the gag, pol, and env genes allows for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle. This amount of nucleic acid is sufficient for the delivery of a one-to-many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert. Attorney Docket Number 11390-016WO1 Since the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically generated by placing them into a packaging cell line. A packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery but lacks any packaging signal. When the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals. Adenoviral Vectors The construction of replication-defective adenoviruses has been described (Berkner et al., J. Virology 61:1213-1220 (1987); Massie et al., Mol. Cell. Biol.6:2872-2883 (1986); Haj- Ahmad et al., J. Virology 57:267-274 (1986); Davidson et al., J. Virology 61:1226-1239 (1987); Zhang "Generation and identification of recombinant adenovirus by liposome-mediated transfection and PCR analysis” BioTechniques 15:868-872 (1993)). The benefit of the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest.92:381-387 (1993); Roessler, J. Clin. Invest. 92:1085-1092 (1993); Moullier, Nature Genetics 4:154-159 (1993); La Salle, Science 259:988- 990 (1993); Gomez-Foix, J. Biol. Chem.267:25129-25134 (1992); Rich, Human Gene Therapy 4:461-476 (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, Circulation Research 73:1201-1207 (1993); Bout, Human Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); and Ragot, J. Gen. Virology 74:501-507 (1993)). Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51:650-655 (1984); Seth, et al., Mol. Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319 (1993)). Attorney Docket Number 11390-016WO1 A viral vector can be one based on an adenovirus which has had the E1 gene removed, and these virions are generated in a cell line such as the human 293 cell line. In another preferred embodiment both the E1 and E3 genes are removed from the adenovirus genome. Adeno-associated viral vectors Another type of viral vector is based on an adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site-specific integration property are preferred. An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and / or a marker gene, such as the gene encoding the green fluorescent protein, GFP. In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell-specific expression operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or B19 parvovirus. Typically, the AAV and B19 coding regions have been deleted, resulting in a safe, noncytotoxic vector. The AAV ITRs, or modifications thereof, confer infectivity and site- specific integration, but not cytotoxicity, and the promoter directs cell-specific expression. United states Patent No.6,261,834 is herein incorporated by reference for material related to the AAV vector. The disclosed vectors thus provide DNA molecules which are capable of integration into a mammalian chromosome without substantial toxicity. The inserted genes in viral and retroviral usually contain promoters, and / or enhancers to help control the expression of the desired gene product. A promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site. A promoter contains core elements required for basic interaction of RNA polymerase and transcription factors and may contain upstream elements and response elements. Large payload viral vectors Molecular genetic experiments with large human herpesviruses have provided a means whereby large heterologous DNA fragments can be cloned, propagated, and established in cells permissive for infection with herpesviruses (Sun et al., Nature genetics 8: 33-41, 1994; Cotter and Robertson,.Curr Opin Mol Ther 5: 633-644, 1999). These large DNA viruses (herpes Attorney Docket Number 11390-016WO1 simplex virus (HSV) and Epstein-Barr virus (EBV), have the potential to deliver fragments of human heterologous DNA > 150 kb to specific cells. EBV recombinants can maintain large pieces of DNA in the infected B-cells as episomal DNA. Individual clones carried human genomic inserts up to 330 kb and appeared genetically stable. The maintenance of these episomes requires a specific EBV nuclear protein, EBNA1, constitutively expressed during infection with EBV. Additionally, these vectors can be used for transfection, where large amounts of protein can be generated transiently in vitro. Herpesvirus amplicon systems are also being used to package pieces of DNA > 220 kb and to infect cells that can stably maintain DNA as episomes. Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors. Non-nucleic acid-based systems The disclosed compositions can be delivered to the target cells in a variety of ways. For example, the compositions can be delivered through electroporation, or through lipofection, or through calcium phosphate precipitation. The delivery mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example in vivo or in vitro. Thus, the compositions can comprise, in addition to the disclosed compositions or vectors for example, lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes. Liposomes can further comprise proteins to facilitate targeting a particular cell, if desired. Administration of a composition comprising a compound, and a cationic liposome can be administered to the blood afferent to a target organ or inhaled into the respiratory tract to target cells of the respiratory tract. Regarding liposomes, see, e.g., Brigham et al. Am. J. Resp. Cell. Mol. Biol.1:95-100 (1989); Felgner et al. Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); U.S. Pat. No.4,897,355. Furthermore, the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage. In the methods described above which include the administration and uptake of exogenous DNA into the cells of a subject (i.e., gene transduction or transfection), delivery of the compositions to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art. In addition, the disclosed Attorney Docket Number 11390-016WO1 nucleic acid or vector can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Tucson, AZ). The materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062-2065, (1991)). These techniques can be used for a variety of other specific cell types. Vehicles such as "stealth" and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). In general, receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes. The internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis have been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)). Nucleic acids that are delivered to cells which are to be integrated into the host cell genome typically contain integration sequences. These sequences are often viral related sequences, particularly when viral based systems are used. These viral integration systems can also be incorporated into nucleic acids which are to be delivered using a non-nucleic acid-based Attorney Docket Number 11390-016WO1 system of deliver, such as a liposome, so that the nucleic acid contained in the delivery system can be come integrated into the host genome. Other general techniques for integration into the host genome include, for example, systems designed to promote homologous recombination with the host genome. These systems typically rely on sequence flanking the nucleic acid to be expressed that has enough homology with a target sequence within the host cell genome that recombination between the vector nucleic acid and the target nucleic acid takes place, causing the delivered nucleic acid to be integrated into the host genome. These systems and the methods necessary to promote homologous recombination are known to those of skill in the art. In vivo / ex vivo As described above, the compositions can be administered in a pharmaceutically acceptable carrier and can be delivered to the subjects’ cells in vivo and / or ex vivo by a variety of mechanisms well known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis, and the like). If ex vivo methods are employed, cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art. The compositions can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes. The transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject. Methods of treating and / or preventing cancer It is understood and herein contemplated that the genetically modified T cells disclosed herein can be used in the treatment, inhibition, reduction, decrease, amelioration, and / or prevention of a cancer and / or metastasis. A representative but non-limiting list of cancers that the disclosed compositions can be used to treat is the following: lymphomas such as B cell lymphoma and T cell lymphoma; mycosis fungoides; Hodgkin’s Disease; myeloid leukemia (including, but not limited to acute myeloid leukemia (AML) and / or chronic myeloid leukemia (CML)); bladder cancer; brain cancer; nervous system cancer; head and neck cancer; squamous cell carcinoma of head and neck; renal cancer; lung cancers such as small cell lung cancer, non- small cell lung carcinoma (NSCLC), lung squamous cell carcinoma (LUSC), and Lung Adenocarcinomas (LUAD); neuroblastoma / glioblastoma; ovarian cancer; pancreatic cancer; prostate cancer; skin cancer; hepatic cancer; melanoma; squamous cell carcinomas of the mouth, Attorney Docket Number 11390-016WO1 throat, larynx, and lung; cervical cancer; cervical carcinoma; breast cancer including, but not limited to triple negative breast cancer; genitourinary cancer; pulmonary cancer; esophageal carcinoma; head and neck carcinoma; large bowel cancer; hematopoietic cancers; testicular cancer; and colon and rectal cancers. Accordingly, in one aspect, disclosed herein is are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis in a subject (such as, for example, cancers treated with chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof to increase levels of one or more ligands of DNAM-1 (including, but not limited to Nectin-2 or poliovirus receptor (PVR)) and / or NKG2D (including, but not limited to ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A) including, but not limited to melanoma, ovarian cancer, colorectal cancer, lymphomas, and / or leukemias) or the symptoms thereof, comprising administering to the subject a therapeutically effective amount of any of the genetically modified T cells disclosed herein. For example, disclosed herein are methods of treating, inhibiting, decreasing, reducing, ameliorating, and / or preventing cancer and / or metastasis in a subject (such as, for example, cancers treated with chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof to increase levels of one or more ligands of DNAM-1 (including, but not limited to Nectin-2 or poliovirus receptor (PVR)) and / or NKG2D (including, but not limited to ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A) including, but not limited to melanoma, ovarian cancer, colorectal cancer, lymphomas, and / or leukemias) or the symptoms thereof, comprising administering to the subject a therapeutically effective amount of the genetically modified T cell (including, but not limited to primary T cell, a T cell line, a tumor infiltrating lymphocyte, an effector T cell, a memory T cell, a TEMRA, or a stem cell-like memory T cell) comprising one or more recombinant nucleic acid sequences encoding a DNAX accessory molecule-1 (DNAM-1) polypeptide and / or a NKG2D polypeptide. In some aspects, the subject has previously received chemotherapy, targeted therapy, or radiotherapy. It is understood and herein contemplated that the disclosed genetically modified T cells can used alone or in combination with any chemotherapeutic and / or anti-cancer therapy known in the art including, but not limited to Abemaciclib, Abiraterone Acetate, ABITREXATE® (Methotrexate), ABRAXANE® (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, ADCETRIS® (Brentuximab Vedotin), ADE, Ado- Trastuzumab Emtansine, ADRIAMYCIN® (Doxorubicin Hydrochloride), Afatinib Dimaleate, AFINITOR® (Everolimus), AKYNZEO® (Netupitant and Palonosetron Hydrochloride), Attorney Docket Number 11390-016WO1 ALDARA® (Imiquimod), Aldesleukin, ALECENSA® (Alectinib), Alectinib, Alemtuzumab, ALIMTA® (Pemetrexed Disodium), ALIQOPA® (Copanlisib Hydrochloride), ALKERAN™ for Injection (Melphalan Hydrochloride), ALKERAN™ Tablets (Melphalan), ALOXI® (Palonosetron Hydrochloride), ALUNBRIG® (Brigatinib), AMBOCHLORIN® (Chlorambucil), AMBOCLORIN® (Chlorambucil), Amifostine, Aminolevulinic Acid, Anastrozole, Aprepitant, AREDIA® (Pamidronate Disodium), ARIMIDEX® (Anastrozole), AROMASIN® (Exemestane),ARRANON® (Nelarabine), Arsenic Trioxide, ARZERRA® (Ofatumumab), Asparaginase Erwinia chrysanthemi, Atezolizumab, AVASTIN® (Bevacizumab), Avelumab, Axitinib, Azacitidine, BAVENCIO® (Avelumab), BEACOPP, BECENUM® (Carmustine), BELEODAQ® (Belinostat), Belinostat, Bendamustine Hydrochloride, BEP, BESPONSA® (Inotuzumab Ozogamicin) , Bevacizumab, Bexarotene, BEXXAR® (Tositumomab and Iodine I 131 Tositumomab), Bicalutamide, BICNU® (Carmustine), Bleomycin, Blinatumomab, BLINCYTO® (Blinatumomab), Bortezomib, BOSULIF® (Bosutinib), Bosutinib, Brentuximab Vedotin, Brigatinib, BuMel, Busulfan, BUSULFEX® (Busulfan), Cabazitaxel, CABOMETYX® (Cabozantinib-S-Malate), Cabozantinib-S-Malate, CAF, CAMPATH® (Alemtuzumab), CAMPTOSAR® (Irinotecan Hydrochloride), Capecitabine, CAPOX, CARAC® (Fluorouracil--Topical), Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, CARMUBRIS® (Carmustine), Carmustine, Carmustine Implant, CASODEX® (Bicalutamide), CEM, Ceritinib, CERUBIDINE® (Daunorubicin Hydrochloride), CERVARIX® (Recombinant HPV Bivalent Vaccine), Cetuximab, CEV, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Cladribine, CLAFEN® (Cyclophosphamide), Clofarabine, CLOFAREX® (Clofarabine), CLOLAR® (Clofarabine), CMF, Cobimetinib, COMETRIQ® (Cabozantinib-S- Malate), Copanlisib Hydrochloride, COPDAC, COPP, COPP-ABV, COSMEGEN® (Dactinomycin), COTELLIC® (Cobimetinib), Crizotinib, CVP, Cyclophosphamide, CYFOS® (Ifosfamide), CYRAMZA® (Ramucirumab), Cytarabine, Cytarabine Liposome, CYTOSAR- U® (Cytarabine), CYTOXAN® (Cyclophosphamide), Dabrafenib, Dacarbazine, DACOGEN® (Decitabine), Dactinomycin, Daratumumab, DARZALEX® (Daratumumab), Dasatinib, Daunorubicin Hydrochloride, Daunorubicin Hydrochloride and Cytarabine Liposome, Decitabine, Defibrotide Sodium, DEFITELIO® (Defibrotide Sodium), Degarelix, Denileukin Diftitox, Denosumab, DEPOCYT® (Cytarabine Liposome), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, DOXIL® (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, DOX-SL® (Doxorubicin Hydrochloride Liposome), DTIC-DOME® (Dacarbazine), Durvalumab, EFUDEX® (Fluorouracil--Topical), ELITEK® (Rasburicase), ELLENCE® (Epirubicin Hydrochloride), Attorney Docket Number 11390-016WO1 Elotuzumab, ELOXATIN® (Oxaliplatin), Eltrombopag Olamine, EMEND® (Aprepitant), EMPLICITI® (Elotuzumab), Enasidenib Mesylate, Enzalutamide, Epirubicin Hydrochloride , EPOCH, ERBITUX® (Cetuximab), Eribulin Mesylate, ERIVEDGE® (Vismodegib), Erlotinib Hydrochloride, ERWINAZE® (Asparaginase Erwinia chrysanthemi), ETHYOL® (Amifostine), Etopophos ETOPOPHOS® (Etoposide Phosphate), Etoposide, Etoposide Phosphate, EVACET® (Doxorubicin Hydrochloride Liposome), Everolimus, EVISTA® (Raloxifene Hydrochloride), EVOMELA® (Melphalan Hydrochloride), Exemestane, 5-FU® (Fluorouracil Injection), 5-FU® (Fluorouracil--Topical), FARESTON® (Toremifene), FARYDAK® (Panobinostat), FASLODEX® (Fulvestrant), FEC, FEMARA® (Letrozole), Filgrastim, FLUDARA® (Fludarabine Phosphate), Fludarabine Phosphate, FLUOROPLEX® (Fluorouracil- -Topical), Fluorouracil Injection, Fluorouracil--Topical, Flutamide, FOLEX® (Methotrexate), FOLEX PFS® (Methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRI- CETUXIMAB, FOLFIRINOX, FOLFOX, FOLOTYN® (Pralatrexate), FU-LV, Fulvestrant, GARDASIL® (Recombinant HPV Quadrivalent Vaccine), GARDASIL 9® (Recombinant HPV Nonavalent Vaccine), GAZYVA® (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, GEMCITABINE-OXALIPLATIN, Gemtuzumab Ozogamicin, GEMZAR® (Gemcitabine Hydrochloride), GILOTRIF® (Afatinib Dimaleate), GLEEVEC® (Imatinib Mesylate), GLIADEL® (Carmustine Implant), GLIADEL WAFER® (Carmustine Implant), Glucarpidase, Goserelin Acetate, HALAVEN® (Eribulin Mesylate), HEMANGEOL® (Propranolol Hydrochloride), HERCEPTIN® (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine, Recombinant, HYCAMTIN® (Topotecan Hydrochloride), HYDREA® (Hydroxyurea), Hydroxyurea, Hyper-CVAD, IBRANCE® (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, ICLUSIG® (Ponatinib Hydrochloride), IDAMYCIN® (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, IDHIFA® (Enasidenib Mesylate), IFEX® (Ifosfamide), Ifosfamide, IFOSFAMIDUM® (Ifosfamide), IL-2 (Aldesleukin), Imatinib Mesylate, IMBRUVICA® (Ibrutinib), IMFINZI® (Durvalumab), Imiquimod, IMLYGIC® (Talimogene Laherparepvec), INLYTA® (Axitinib), Inotuzumab Ozogamicin, Interferon Alfa-2b, Recombinant, Interleukin-2 (Aldesleukin), INTRON A® (Recombinant Interferon Alfa-2b), Iodine I 131 Tositumomab and Tositumomab, Ipilimumab, IRESSA® (Gefitinib), Irinotecan Hydrochloride, Irinotecan Hydrochloride Liposome, ISTODAX® (Romidepsin), Ixabepilone, Ixazomib Citrate, IXEMPRA® (Ixabepilone), JAKAFI® (Ruxolitinib Phosphate), JEB, JEVTANA® (Cabazitaxel), KADCYLA® (Ado-Trastuzumab Emtansine), KEOXIFENE® (Raloxifene Hydrochloride), KEPIVANCE® (Palifermin), KEYTRUDA® (Pembrolizumab), KISQALI® Attorney Docket Number 11390-016WO1 (Ribociclib), KYMRIAH® (Tisagenlecleucel), KYPROLIS® (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, LARTRUVO® (Olaratumab), Lenalidomide, Lenvatinib Mesylate, LENVIMA® (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, LEUKERAN® (Chlorambucil), Leuprolide Acetate, LEUSTATIN® (Cladribine), LEVULAN® (Aminolevulinic Acid), LINFOLIZIN® (Chlorambucil), LIPODOX® (Doxorubicin Hydrochloride Liposome), Lomustine, LONSURF® (Trifluridine and Tipiracil Hydrochloride), LUPRON® (Leuprolide Acetate), LUPRON DEPOT® (Leuprolide Acetate), LUPRON DEPOT-PED® (Leuprolide Acetate), LYNPARZA® (Olaparib), MARQIBO® (Vincristine Sulfate Liposome), MATULANE® (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megestrol Acetate, MEKINIST® (Trametinib), Melphalan, Melphalan Hydrochloride, Mercaptopurine, Mesna, MESNEX® (Mesna), METHAZOLASTONE® (Temozolomide), Methotrexate, METHOTREXATE LPF® (Methotrexate), Methylnaltrexone Bromide, MEXATE® (Methotrexate), MEXATE-AQ® (Methotrexate), Midostaurin, Mitomycin C, Mitoxantrone Hydrochloride, MITOZYTREX® (Mitomycin C), MOPP, MOZOBIL® (Plerixafor), MUSTARGEN® (Mechlorethamine Hydrochloride) , MUTAMYCIN® (Mitomycin C), MYLERAN® (Busulfan), MYLOSAR® (Azacitidine), MYLOTARG® (Gemtuzumab Ozogamicin), NANOPARTICLE PACLITAXEL® (Paclitaxel Albumin-stabilized Nanoparticle Formulation), NAVELBINE® (Vinorelbine Tartrate), Necitumumab, Nelarabine, NEOSAR® (Cyclophosphamide), Neratinib Maleate, NERLYNX® (Neratinib Maleate), Netupitant and Palonosetron Hydrochloride, NEULASTA® (Pegfilgrastim), NEUPOGEN® (Filgrastim), NEXAVAR® (Sorafenib Tosylate), NILANDRON® (Nilutamide), Nilotinib, Nilutamide, NINLARO® (Ixazomib Citrate), Niraparib Tosylate Monohydrate, Nivolumab, NOLVADEX® (Tamoxifen Citrate), NPLATE® (Romiplostim), Obinutuzumab, ODOMZO® (Sonidegib), OEPA, Ofatumumab, OFF, Olaparib, Olaratumab, Omacetaxine Mepesuccinate, ONCASPAR® (Pegaspargase), Ondansetron Hydrochloride, ONIVYDE® (Irinotecan Hydrochloride Liposome), ONTAK® (Denileukin Diftitox), OPDIVO® (Nivolumab), OPPA, Osimertinib, Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, PAD, Palbociclib, Palifermin, Palonosetron Hydrochloride, Palonosetron Hydrochloride and Netupitant, Pamidronate Disodium, Panitumumab, Panobinostat, PARAPLAT® (Carboplatin), PARAPLATIN® (Carboplatin), Pazopanib Hydrochloride, PCV, PEB, Pegaspargase, Pegfilgrastim, Peginterferon Alfa-2b, PEG-INTRON® (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, PERJETA® (Pertuzumab), Pertuzumab, PLATINOL® (Cisplatin), PLATINOL-AQ® (Cisplatin), Plerixafor, Pomalidomide, POMALYST® (Pomalidomide), Ponatinib Hydrochloride, Attorney Docket Number 11390-016WO1 PORTRAZZA® (Necitumumab), Pralatrexate, Prednisone, Procarbazine Hydrochloride, PROLEUKIN® (Aldesleukin), PROLIA® (Denosumab), PROMACTA® (Eltrombopag Olamine), Propranolol Hydrochloride, PROVENGE® (Sipuleucel-T), PURINETHOL® (Mercaptopurine), PURIXAN® (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, R-CHOP, R-CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, RELISTOR® (Methylnaltrexone Bromide), R- EPOCH, REVLIMID® (Lenalidomide), RHEUMATREX® (Methotrexate), Ribociclib, R-ICE, RITUXAN® (Rituximab), RITUXAN HYCELA® (Rituximab and Hyaluronidase Human), Rituximab, Rituximab and , Hyaluronidase Human, ,Rolapitant Hydrochloride, Romidepsin, Romiplostim, RUBIDOMYCIN® (Daunorubicin Hydrochloride), RUBRACA® (Rucaparib Camsylate), Rucaparib Camsylate, Ruxolitinib Phosphate, RYDAPT® (Midostaurin), Sclerosol Intrapleural Aerosol (Talc), Siltuximab, Sipuleucel-T, SOMATULINE DEPOT® (Lanreotide Acetate), Sonidegib, Sorafenib Tosylate, SPRYCEL® (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), STERITALC® (Talc), STIVARGA® (Regorafenib), Sunitinib Malate, SUTENT® (Sunitinib Malate), SYLATRON® (Peginterferon Alfa-2b), SYLVANT® (Siltuximab), Synribo SYNRIBO® (Omacetaxine Mepesuccinate), TABLOID® (Thioguanine), TAC, TAFINLAR® (Dabrafenib), TAGRISSO® (Osimertinib), Talc, Talimogene Laherparepvec, Tamoxifen Citrate, TARABINE PFS® (Cytarabine), TARCEVA® (Erlotinib Hydrochloride), TARGRETIN® (Bexarotene), TASIGNA® (Nilotinib), TAXOL® (Paclitaxel), TAXOTERE® (Docetaxel), TECENTRIQ® (Atezolizumab), TEMODAR® (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, THALOMID® (Thalidomide), Thioguanine, Thiotepa, Tisagenlecleucel, TOLAK® (Fluorouracil--Topical), Topotecan Hydrochloride, Toremifene, TORISEL® (Temsirolimus), Tositumomab and Iodine I 131 Tositumomab, TOTECT® (Dexrazoxane Hydrochloride), TPF, Trabectedin, Trametinib, Trastuzumab, TREANDA® (Bendamustine Hydrochloride), Trifluridine and Tipiracil Hydrochloride, TRISENOX® (Arsenic Trioxide), TYKERB® (Lapatinib Ditosylate) , UNITUXIN® (Dinutuximab), Uridine Triacetate, VAC, Vandetanib, VAMP, VARUBI® (Rolapitant Hydrochloride), VECTIBIX® (Panitumumab), VeIP, VELBAN® (Vinblastine Sulfate), VELCADE® (Bortezomib), VELSAR® (Vinblastine Sulfate), Vemurafenib, VENCLEXTA® (Venetoclax), Venetoclax, VERZENIO® (Abemaciclib), VIADUR® (Leuprolide Acetate), VIDAZA® (Azacitidine), Vinblastine Sulfate, VINCASAR PFS® (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, VIP, Vismodegib, Attorney Docket Number 11390-016WO1 VISTOGARD® (Uridine Triacetate), VORAXAZE® (Glucarpidase), Vorinostat, VOTRIENT® (Pazopanib Hydrochloride), VYXEOS® (Daunorubicin Hydrochloride and Cytarabine Liposome), WELLCOVORIN® (Leucovorin Calcium), XALKORI® (Crizotinib), XELODA® (Capecitabine), XELIRI, XELOX, XGEVA® (Denosumab), XOFIGO® (Radium 223 Dichloride), XTANDI® (Enzalutamide), YERVOY® (Ipilimumab), YONDELIS® (Trabectedin), ZALTRAP® (Ziv-Aflibercept), ZARXIO® (Filgrastim), ZEJULA® (Niraparib Tosylate Monohydrate), ZELBORAF® (Vemurafenib), ZEVALIN® (Ibritumomab Tiuxetan), ZINECARD® (Dexrazoxane Hydrochloride), Ziv-Aflibercept, ZOFRAN® (Ondansetron Hydrochloride), ZOLADEX® (Goserelin Acetate), Zoledronic Acid, ZOLINZA® (Vorinostat), ZOMETA® (Zoledronic Acid), ZYDELIG® (Idelalisib), ZYKADIA® (Ceritinib), and / or ZYTIGA® (Abiraterone Acetate). The treatment methods can include or further include checkpoint inhibitors including, but are not limited to antibodies that block PD-1 (such as, for example, Nivolumab (BMS-936558 or MDX1106), pembrolizumab, cemiplimab , CT-011, MK- 3475), PD-L1 (such as, for example, atezolizumab, avelumab, durvalumab, MDX-1105 (BMS- 936559), MPDL3280A, or MSB0010718C), PD-L2 (such as, for example, rHIgM12B7), CTLA- 4 (such as, for example, Ipilimumab (MDX-010), Tremelimumab (CP-675,206)), IDO, B7-H3 (such as, for example, MGA271, MGD009, omburtamab), B7-H4, B7-H3, T cell immunoreceptor with Ig and ITIM domains (TIGIT)(such as, for example BMS-986207, OMP- 313M32, MK-7684, AB-154, ASP-8374, MTIG7192A, or PVSRIPO), CD96, B- and T- lymphocyte attenuator (BTLA), V-domain Ig suppressor of T cell activation (VISTA)(such as, for example, JNJ-61610588, CA-170), TIM3 (such as, for example, TSR-022, MBG453, Sym023, INCAGN2390, LY3321367, BMS-986258, SHR-1702, RO7121661), LAG-3 (such as, for example, BMS-986016, LAG525, MK-4280, REGN3767, TSR-033, BI754111, Sym022, FS118, MGD013, and Immutep). In some embodiments, the subject has been previously received a treatment comprising chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof. In some embodiments, the treatment increases levels of one or more ligands of DNAM-1 and / or NKG2D. In some embodiments, the one or more ligands of DNAM-1 comprise Nectin-2 or poliovirus receptor (PVR). In some embodiments, the one or more ligands of NKG2D comprise ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A. In one aspect, disclosed herein is a method of treating cancer in a subject in need, comprising creating a genetically modified T cell comprising one or more recombinant nucleic acid sequences encoding a DNAX accessory molecule-1 (DNAM-1) polypeptide and / or a NKG2D polypeptide, determining if the genetically modified T cell has a low affinity T cell Attorney Docket Number 11390-016WO1 receptor for a tumor antigen, and administering to the subject a therapeutically effective amount of the genetically modified T cell if the T cell has a low affinity T cell receptor for a tumor antigen. In some embodiments, the T cell comprises an increased level of DNAM-1 polypeptide and / or NKG2D polypeptide relevant to a reference control. In some embodiments, the T cell comprises a recombinant nucleic acid sequence encoding a chimeric antigen receptor (CAR) polypeptide comprising a single-chain variable fragment (scFV) that binds to a tumor antigen. In some embodiments, the scFV is low affinity for the tumor antigen. In some embodiments, the T cell further comprises a recombinant nucleic acid sequence encoding a transgenic T cell receptor (TCR) polypeptide that binds to a tumor antigen. In some embodiments, the TCR is low affinity for the tumor antigen. In some embodiments, the recombinant nucleic acid sequences encoding natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9, and the CAR polypeptides or TCR polypeptides are operatively linked. In some embodiments, the recombinant nucleic acid sequences encoding the DNAM-1 polypeptide, NKG2D polypeptide, and the CAR polypeptides or TCR polypeptides are on a same vector or different vectors. In some embodiments, the T cell comprises a deletion of a CD28 gene or a fragment thereof. In some embodiments, the T cell is a primary T cell, a T cell line, a tumor infiltrating lymphocyte, an effector T cell, a memory T cell, a TEMRA, or a stem cell-like memory T cell. In some embodiments, the method further comprises treating the subject with chemotherapy prior to administration of the T cells. In some embodiments, the subject has been previously received a treatment comprising chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof to increase levels of one or more ligands of natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9. In some embodiments, the one Attorney Docket Number 11390-016WO1 or more ligands of DNAM-1 comprise Nectin-2 or poliovirus receptor (PVR). In some embodiments, the one or more ligands of NKG2D comprise ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A. The genetically modified T cell may be administered in such amounts, time, and route deemed necessary in order to achieve the desired result. The exact amount of the genetically modified T cell will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the cancer, the particular genetically modified T cell, its mode of administration, its mode of activity, and the like. The genetically modified T cell is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the genetically modified T cell will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the cancer being treated and the severity of the cancer; the activity of the genetically modified T cell employed; the specific genetically modified T cell employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific genetically modified T cell employed; the duration of the treatment; drugs used in combination or coincidental with the specific genetically modified T cell employed; and like factors well known in the medical arts. The genetically modified T cell may be administered by any route. In some embodiments, the genetically modified T cell is administered via a variety of routes, including intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, and / or intraperitoneal. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the genetically modified T cell (e.g., its stability in the environment of the subject), the condition of the subject (e.g., whether the subject is able to tolerate oral administration), etc. The exact amount of genetically modified T cell required to achieve a therapeutically or prophylactically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult. In some embodiments, the genetically modified T cell is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, Attorney Docket Number 11390-016WO1 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more times. In some embodiments, the genetically modified T cell is administered daily. In some embodiments, the genetically modified T cell is administered every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, or more. In some embodiments, the genetically modified T cell is administered every week, every 2 weeks, every 3 weeks, every 4 weeks, or more. In some embodiments, the genetically modified T cell is administered every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months, or more. In some embodiments, the genetically modified T cell is administered every year, every 2 years, every 3 years, every 4 years, every 5 years, or more. In some embodiments, the method comprises administering the genetically modified T cell of any preceding aspect alone or in combination with one or more anti-cancer agents. Anti- cancer agents encompass biotherapeutic anti-cancer agents as well as chemotherapeutic agents. Exemplary biotherapeutic anti-cancer agents include, but are not limited to, interferons, cytokines (e.g., tumor necrosis factor, interferon α, interferon γ), vaccines, hematopoietic growth factors, monoclonal serotherapy, immunostimulants and / or immunodulatory agents (e.g., IL-1, 2, 4, 6, or 12), immune cell growth factors (e.g., GM-CSF) and antibodies (e.g. HERCEPTIN (trastuzumab), T-DM1, AVASTIN (bevacizumab), ERBITUX (cetuximab), VECTIBIX (panitumumab), RITUXAN (rituximab), BEXXAR (tositumomab)). Exemplary chemotherapeutic agents include, but are not limited to, anti-estrogens (e.g. tamoxifen, raloxifene, and megestrol), LHRH agonists (e.g. goscrclin and leuprolide), anti- androgens (e.g. flutamide and bicalutamide), photodynamic therapies (e.g. vertoporfin (BPD- MA), phthalocyanine, photosensitizer Pc4, and demethoxy-hypocrellin A (2BA-2-DMHA)), nitrogen mustards (e.g. cyclophosphamide, ifosfamide, trofosfamide, chlorambucil, estramustine, and melphalan), nitrosoureas (e.g. carmustine (BCNU) and lomustine (CCNU)), alkylsulphonates (e.g. busulfan and treosulfan), triazenes (e.g. dacarbazine, temozolomide), platinum containing compounds (e.g. cisplatin, carboplatin, oxaliplatin), vinca alkaloids (e.g. vincristine, vinblastine, vindesine, and vinorelbine), taxoids (e.g. paclitaxel or a paclitaxel equivalent such as nanoparticle albumin-bound paclitaxel (ABRAXANE), docosahexaenoic acid bound-paclitaxel (DHA-paclitaxel, Taxoprexin), polyglutamate bound-paclitaxel (PG-paclitaxel, paclitaxel poliglumex, CT-2103, XYOTAX), the tumor-activated prodrug (TAP) ANG1005 (Angiopep-2 bound to three molecules of paclitaxel), paclitaxel-EC-1 (paclitaxel bound to the erbB2-recognizing peptide EC-1), and glucose-conjugated paclitaxel, e.g., 2′-paclitaxel methyl Attorney Docket Number 11390-016WO1 2-glucopyranosyl succinate; docetaxel, taxol), epipodophyllins (e.g. etoposide, etoposide phosphate, teniposide, topotecan, 9-aminocamptothecin, camptoirinotecan, irinotecan, crisnatol, mytomycin C), anti-metabolites, DHFR inhibitors (e.g. methotrexate, dichloromethotrexate, trimetrexate, edatrexate), IMP dehydrogenase inhibitors (e.g. mycophenolic acid, tiazofurin, ribavirin, and EICAR), ribonucleotide reductase inhibitors (e.g. hydroxyurea and deferoxamine), uracil analogs (e.g.5-fluorouracil (5-FU), floxuridine, doxifluridine, ratitrexed, tegafur-uracil, capecitabine), cytosine analogs (e.g. cytarabine (ara C), cytosine arabinoside, and fludarabine), purine analogs (e.g. mercaptopurine and Thioguanine), Vitamin D3 analogs (e.g. EB 1089, CB 1093, and KH 1060), isoprenylation inhibitors (e.g. lovastatin), dopaminergic neurotoxins (e.g. 1-methyl-4-phenylpyridinium ion), cell cycle inhibitors (e.g. staurosporine), actinomycin (e.g. actinomycin D, dactinomycin), bleomycin (e.g. bleomycin A2, bleomycin B2, peplomycin), anthracycline (e.g. daunorubicin, doxorubicin, pegylated liposomal doxorubicin, idarubicin, epirubicin, pirarubicin, zorubicin, mitoxantrone), MDR inhibitors (e.g. verapamil), Ca2+ATPase inhibitors (e.g. thapsigargin), imatinib, thalidomide, lenalidomide, tyrosine kinase inhibitors (e.g., axitinib (AG013736), bosutinib (SKI-606), cediranib (RECENTIN™, AZD2171), dasatinib (SPRYCEL®, BMS-354825), erlotinib (TARCEVA®), gefitinib (IRESSA®), imatinib (Gleevec®, CGP57148B, STI-571), lapatinib (TYKERB®, TYVERB®), lestaurtinib (CEP- 701), neratinib (HKI-272), nilotinib (TASIGNA®), semaxanib (semaxinib, SU5416), sunitinib (SUTENT®, SU11248), toceranib (PALLADIA®), vandetanib (ZACTIMA®, ZD6474), vatalanib (PTK787, PTK / ZK), trastuzumab (HERCEPTIN®), bevacizumab (AVASTIN®), rituximab (RITUXAN®), cetuximab (ERBITUX®), panitumumab (VECTIBIX®), ranibizumab (Lucentis®), nilotinib (TASIGNA®), sorafenib (NEXAVAR®), everolimus (AFINITOR®), alemtuzumab (CAMPATH®), gemtuzumab ozogamicin (MYLOTARG®), temsirolimus (TORISEL®), ENMD-2076, PCI-32765, AC220, dovitinib lactate (TKI258, CHIR-258), BIBW 2992 (TOVOK™), SGX523, PF-04217903, PF-02341066, PF-299804, BMS-777607, ABT-869, MP470, BIBF 1120 (VARGATEF®), AP24534, JNJ-26483327, MGCD265, DCC-2036, BMS- 690154, CEP-11981, tivozanib (AV-951), OSI-930, MM-121, XL-184, XL-647, and / or XL228), proteasome inhibitors (e.g., bortezomib (VELCADE)), mTOR inhibitors (e.g., rapamycin, temsirolimus (CCI-779), everolimus (RAD-001), ridaforolimus, AP23573 (Ariad), AZD8055 (AstraZeneca), BEZ235 (Novartis), BGT226 (Norvartis), XL765 (Sanofi Aventis), PF-4691502 (Pfizer), GDC0980 (Genetech), SF1126 (Semafoe) and OSI-027 (OSI)), oblimersen, gemcitabine, caminomycin, leucovorin, pemetrexed, cyclophosphamide, dacarbazine, procarbizine, prednisolone, dexamethasone, campathecin, plicamycin, asparaginase, aminopterin, methopterin, porfiromycin, melphalan, leurosidine, leurosine, chlorambucil, Attorney Docket Number 11390-016WO1 trabectedin, procarbazine, discodermolide, caminomycin, aminopterin, and hexamethyl melamine. In some embodiments, the cancer includes, but is not limited to acoustic neuroma, adenocarcinoma, adrenal gland cancer, anal cancer, angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma), appendix cancer, benign monoclonal gammopathy, biliary cancer (e.g., cholangiocarcinoma), bladder cancer, breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast), brain cancer (e.g., meningioma; glioma, e.g., astrocytoma, oligodendroglioma; medulloblastoma), bronchus cancer, carcinoid tumor, cervical cancer (e.g., cervical adenocarcinoma), choriocarcinoma, chordoma, craniopharyngioma, colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma), epithelial carcinoma, ependymoma, endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma), endometrial cancer (e.g., uterine cancer, uterine sarcoma), esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarinoma), Ewing's sarcoma, eye cancer (e.g., intraocular melanoma, retinoblastoma), familiar hypereosinophilia, gall bladder cancer, gastric cancer (e.g., stomach adenocarcinoma), gastrointestinal stromal tumor (GIST), head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma (OSCC), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)), hemangioblastoma, inflammatory myofibroblastic tumors, immunocytic amyloidosis, kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma), liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma), lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung), leiomyosarcoma (LMS), mastocytosis (e.g., systemic mastocytosis), myelodysplastic syndrome (MDS), mesothelioma, myeloproliferative disorder (MPD) (e.g., polycythemia Vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, hypereosinophilic syndrome (HES)), neuroblastoma, neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis), neuroendocrine cancer (e.g., gastroenteropancreatic neuroendoctrine tumor (GEP-NET), carcinoid tumor), osteosarcoma, ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma), papillary adenocarcinoma, pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors), penile cancer (e.g., Paget's disease of the penis and scrotum), pinealoma, primitive neuroectodermal tumor (PNT), prostate cancer (e.g., prostate adenocarcinoma), rectal cancer, rhabdomyosarcoma, salivary gland cancer, skin cancer (e.g., Attorney Docket Number 11390-016WO1 squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)), small bowel cancer (e.g., appendix cancer), soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma), sebaceous gland carcinoma, sweat gland carcinoma, synovioma, testicular cancer (e.g., seminoma, testicular embryonal carcinoma), thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer), urethral cancer, vaginal cancer and vulvar cancer (e.g., Paget's disease of the vulva). I. Examples The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and / or methods claimed herein are made and evaluated and are intended to be purely exemplary and are not intended to limit the disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.). Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric. Example 1: NK Receptor Signaling Lowers TCR Activation Threshold, Enhancing Selective Recognition of Cancer Cells by TAA-Specific CTLs Disclosed herein is that NKR-assisted TCR signaling enhances the sensitivity and selectivity of recognition of “distressed” cancer cells by human CTLs, providing tools to develop new immunotherapies, such as TCR / NKR-double-transduced T cells with enhanced potency and selectivity. Cytotoxic CD8+T lymphocytes (CTL) recognition of non-mutated tumor-associated antigens (TAA), present on cancer cells but also in healthy tissues, is an important element of cancer immunity, but the mechanism of its selectivity for cancer cells and opportunities for its enhancement remain elusive. In this study, it was found that CTL expression of the NK receptors (NKR) DNAM-1 and NKG2D was associated with the effector status of CD8+tumor- infiltrating lymphocytes (TIL) and long-term survival of melanoma patients. Using MART-1 and NY-ESO-1 as model TAAs, it was demonstrated that DNAM-1 and NKG2D regulate T-cell receptor (TCR) functional avidity and set the threshold for TCR activation of human TAA- specific CTLs. Superior costimulatory effects of DNAM-1 over CD28 involved enhanced TCR signaling, CTL killer function and polyfunctionality. Double transduction of human CTLs with TAA-specific TCR and NKRs resulted in strongly enhanced antigen sensitivity, without a Attorney Docket Number 11390-016WO1 reduction in the antigen specificity and selectivity of killer function. In addition, the elevation of NKR-Ligand expression on cancer cells by chemotherapy also increased CTL recognition of cancer cells expressing low levels of TAA. These data help to explain the ability of self-antigens to mediate tumor rejection in the absence of autoimmunity and support the development of dual- targeting adoptive T cell therapies that use NKRs to enhance the potency and selectivity of recognition of TAA-expressing cancer cells. Prototypal TAAs, such as MART-1 / Melan-A or NY-ESO-1, are abundant in cancer- bearing individuals and involved in control of highly heterogenous solid tumors, raising the questions about how TAA-specific CTLs avoid eliminating healthy tissues. This paradox is partially explained by the generally higher expression of TAAs on cancer cells in combination with the low affinity of TAA-specific TCRs, but the recently-recognized high promiscuity of individual TAA-specific T cells for multiple T-cell receptor (TCR) ligands, indicates that additional mechanisms can be involved in the discrimination between TAAs expressed on different target cells. The “self / non-self” discrimination at the stage of the initiation of adaptive immunity is explained by thymic elimination of CTL precursors bearing high-affinity TCRs able to recognize own (self) antigens and by the “two-signal” paradigm of T-cell activation. Resting T cells avoid responses against TCR-binding antigens (signal 1) expressed by healthy cells that do not provide costimulatory signal 2, only responding to signal 1 provided jointly with the CD28-mediated signal 2 by professional antigen-presenting cells (APC), such as dendritic cells (DC). Upon binding to its cognate ligands B7.1 (CD80) and B7.2 (CD86) on activated DCs, CD28 mediates multiple costimulatory effects, reducing the threshold for cognate TCR triggering, promoting T- cell cytokine production, survival and clonal expansion. However, the above processes do not prevent multiple low-, medium- and even high-affinity CTLs against TAAs from persisting and expanding in cancer patients, without overt autoimmunity. In contrast to the requirement for CD28-mediated costimulation during the (cross)priming of naïve CD8+T cells, the role of signal 2 in the reactivation of CTLs is less clear, especially within the context of anticancer responses. Expression of “classical signal 2” ligands is restricted to professional APCs, with non-hematologic (solid) cancers failing to express these molecules. Meanwhile, activated CTLs upregulate expression of CTLA-4, a much higher affinity receptor for B7.1 / B7.2, which has an inhibitory function. This raises the question of whether effector CTLs can receive an alternative signal 2 to replace classical costimulatory signals during the recognition and killing of TAA-expressing cancer cells. Attorney Docket Number 11390-016WO1 The NK receptors (NKR) DNAM-1 and NKG2D were first demonstrated to mediate cytotoxicity of NK cells but have been also shown to regulate CTL function and to mediate TCR-independent “NK-like” activation of cytokine-activated CTLs, raising the question of whether they have a role in the interplay with TCR during the recognition and killing of cancer cells. Unlike CD28 ligands, the ligands for DNAM-1 and NKG2D are widely expressed by stressed, infected and mutated cells, but are not expressed by most differentiated healthy tissues, making them suitable candidates as cancer-specific sources of costimulation for CTLs. Disclosed herein is that DNAM-1, and to a lesser extend NKG2D, regulate TCR functional avidity of human TAA-specific CTLs, allowing effective recognition and killing of low-TAA-expressing cancer cells in a TCR-restricted manner. These data indicate that the ability of self-antigens to mediate tumor rejection in the absence of autoimmunity benefits from the interplay between NKR- and TCR-mediated cancer recognition. Materials and Methods Human samples. Human melanoma tumor-infiltrating lymphocytes (TILs) from 6 patients were isolated from melanoma tissues collected during surgery using protocols approved by the Institutional Review Board of the University of Pittsburgh (IRB: CR19080226-009), between 2011 and 2016, and stored in LN2 vapor phase until processing. Human peripheral blood cones (byproduct of platelet collection) were obtained from 35 healthy adult volunteers under the Roswell Park Comprehensive Cancer Center IRB-approved protocol 163222, between 2018 and 2023. Additional human peripheral blood leukopaks from 4 healthy donors were purchased from StemCell Technologies Inc, Vancouver, Canada in 2020. Mononuclear cells were isolated from blood cones and leukopaks and stored in LN2 vapor phase until further processing. Informed written consent was obtained from each subject. The studies were conducted in accordance with U.S. Common Rule. Cell lines, media, and reagents. Human HLA-A*02:01+, MART-1+melanoma cell lines Mel526 (RRID:CVCL_8051) and Mel624 (RRID:CVCL_8054) were kind gifts from Dr. Steven Rosenberg (NCI). Human melanoma cell line 2183-Her4 (RRID:CVCL_L268) was provided by Dr. Marc Ernstoff (Roswell Park) in 2020. Human HLA-A*02:01+cancer cell lines SW620 (Cat# CCL-227, RRID:CVCL_0547), Caco-2 (Cat# HTB-37, RRID:CVCL_0025) and OVCAR3 (Cat# HTB- 161, RRID:CVCL_0465) were purchased from ATCC from 2018 to 2022. MART-1–specific clone (clone 40) was established from the expanded metastatic tumor-infiltrated lymph node cells of a melanoma cancer patient at the University of Lausanne, as described. All cell lines Attorney Docket Number 11390-016WO1 were authenticated and tested negative for mycoplasma contamination, respectively by IDEXX BioAnalytics (2021) and MycoAlertTMmycoplasma detection kit (Lonza; repeated monthly). All cell lines were used within 10 passages. Mel526 and Mel624 were cultured in Dulbecco’s Modified Eagle Medium (Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco). SW620 were cultured in Leibovitz’s L-15 medium (Gibco) supplemented with 10% FBS. Caco- 2 were cultured in Minimum Essential Medium (Gibco) supplemented with 20% FBS.2183- Her4 and OVCAR3 were cultured in RPMI1640 (Gibco) supplemented with 10% FBS. SW620 was incubated at 37°C without CO2. All other cells were incubated at 37°C with 5% CO2. CellGenix DC medium (Sartorius CellGenix) was used to generate monocyte-derived dendritic cells. AIM-V medium (Gibco) supplemented with 5% human serum (GeminiBio) was used as the base T-cell culture medium. The following cytokines and reagents were used to generate immature DCs and induce DC maturation, or to activate and culture T cells: GM-CSF (Leukine sargramostim) was purchased from Partner Therapeutics; IL-4, IL-1β, TNFα, and IFN-γ were purchased from Miltenyi; IL-6 was purchased from R&D Systems; IFN-α (Intron A- IFN-α-2b) and IL-2 (Proleukin aldesleukin) were purchased from McKesson; PGE2 and poly-I:C were purchased from Sigma-Aldrich; IL-7 and IL-12p70 were purchased from Peprotech; Staphylococcus Enterotoxin B (SEB) was purchased from List Labs; Dynabeads Human T- Activator CD3 / CD28 was purchased from Gibco; purified Streptavidin was purchased from Biolegend to crosslink biotinylated-antibodies for short-term CTL stimulation. Oxaliplatin and cis-Diammineplatinum(II) Dichloride (Cisplatin) were purchased from Sigma-Aldrich. Generation of DCs. Peripheral blood mononuclear cells (PBMCs) were obtained from blood cones and leukopaks using gradient centrifugation with Ficoll Paque Plus (Sigma-Aldrich). Fractions of monocytes and lymphocytes were further separated using density gradients made with Percoll (Sigma-Aldrich). Monocytes were purified by plastic adherence and cultured for 6 days in 24- well plates in CellGenix DC medium supplemented with 1000 IU / ml GM-CSF and 1000 IU / ml IL-4. At day 6, DCs were exposed to the following combinations of stimuli for 18 hours to induce standard mature DCs (sDCs; induced by 25 ng / ml IL-1β, 50 ng / ml TNFα, 1000 IU / ml IL- 6, and 1 μM PGE2) or α-type-1 polarized DCs (αDC1s; induced by 25 ng / ml IL-1β, 50 ng / ml TNFα, 3000 IU / ml IFN-α, 1000 IU / ml IFN-γ, and 20 μg / ml poly-I:C). These DCs were then used for the induction of MART-1-specific CTLs and the SEB-based polyclonal T-cell activation. DC induction of MART-1–specific CTLs in in vitro sensitization. Attorney Docket Number 11390-016WO1 To induce MART-1–specific CTLs, bulk CD8+T cells were isolated from the lymphocyte fraction of PBMCs from HLA-A*02:01+donors by magnetic cell separation using CD8 MicroBeads (Miltenyi). T cells were cocultured with 1 μg / ml MART-1 (ELAGIGILTV; AnaSpec)-loaded autologous αDC1s in a 10:1 (T:DC) ratio. The cultures were supplemented with 50 IU / ml IL-2 and 10 ng / ml IL-7 on day 3 and every 2-3 days afterwards. MART-1– specific CTLs were sorted by flow cytometry based on the staining of MART-1 Dextramer (Immudex Cat# WB2162-PE) on day 8±1. Sorted CTLs were incubated for at least 2 days before using them in functional assays. MART-1–specific clone (clone 40) was restimulated in vitro by MART-1 peptide–loaded αDC1s using the same method. DC-induced polyclonal T-cell activation and restimulation. To induce polyclonal activation of naïve CD8+T cells by DCs, naïve CD8+T cells were isolated from the lymphocyte fraction of PBMCs by magnetic cell separation using EasySepTMHuman Naïve CD8+T Cell Isolation Kit II (StemCell), labeled with CFSE (Invitrogen), and cocultured with SEB (1 ng / ml)-loaded sDCs (generated from autologous monocytes) in a 5:1 (T:DC) ratio. When indicated, prior to coculture, T cells were incubated with anti-human NKG2D (BioLegend Cat# 320814, RRID:AB_2810480) or anti-human DNAM-1 (Abcam Cat# ab33397, RRID:AB_726268) (both 10 μg / ml) and DCs were incubated with recombinant CTLA-4-Ig (Bio X Cell Cat# BE0099, RRID:AB_10949064) (50 μg / ml) for 15 minutes at 37°C, to block NKG2D, DNAM-1, and B7 molecules, respectively. The cultures were supplemented with medium containing the same blocking antibodies along with 50 IU / ml IL-2 and 10 ng / ml IL-7 on day 2. T-cell proliferation was analyzed based on the CFSE dilution using flow cytometry at day 5. When testing the restimulation of CTLs by DCs, Dynabeads-induced CTLs were cocultured with SEB (0.1 ng / ml) loaded autologous sDCs in a 5:1 (T:DC) ratio for 6 hours. When indicated, blocking Abs were applied using the same method as described above. Brefeldin A (Invitrogen) was added to the coculture 4 hours before the end of incubation. CTL restimulation was analyzed based on intracellular IFN-γ staining using flow cytometry. CTL induction by Dynabeads. Naïve CD8+T cells were isolated from PBMCs or the lymphocyte fraction of PBMCs by magnetic cell separation using EasySepTMHuman Naïve CD8+T Cell Isolation Kit II (StemCell). Cells were then activated at 8×104cells per well in 96-well round-bottomed plates with an equivalent number of washed CD3 / CD28-coated Dynabeads, 50 IU / ml IL-2, 10 ng / ml IL-7, and 10 ng / ml IL-12 in 200 μl of AIM-V medium supplemented with 5% human serum (starting point = day 0). Cells were activated for 48 hours, then the beads were magnetically removed, and the cells were incubated in 24-well plates with 50 IU / ml IL-2 and 10 ng / ml IL-7. Attorney Docket Number 11390-016WO1 Cultures were split and replenished with fresh medium supplemented with IL-2 and IL-7 every 2-3 days. Effector CTLs were harvested for functional assays between days 7 and 14. T-cell activation by immobilized antibodies. To activate naïve CD8+T cells, 1μg / ml solution of anti-human CD3 (OKT3) (BioLegend Cat# 317326, RRID:AB_11150592) was prepared in sterile PBS and dispensed to 96-well flat bottom plate. The plate was sealed and incubated at 4 °C overnight. When indicated, OKT3- coated plates were washed and coated with the following antibody solutions at 37 °C for 2 hours: anti-human NKG2D (BioLegend Cat# 320814, RRID:AB_2810480), anti-human DNAM-1 (Abcam Cat# ab33397, RRID:AB_726268), or mouse IgG1, κ (BioLegend Cat# 400165, RRID:AB_11150399); all were used at 10 μg / ml. CFSE-labeled naïve CD8+T cells were aliquoted into microwells of antibody-coated plates at 2×104cells per well in 200 μl of culture medium supplemented with 50 IU / ml IL-2 and 10 ng / ml IL-7. To activate CD28, 5 μg / ml anti-human CD28 (BioLegend Cat# 302934, RRID:AB_11148949) was added into cell suspension. On day 3, for each condition, 100 μl supernatant was carefully harvested for IFN-γ ELISA and replenished by 100 μl fresh medium supplemented with IL-2 and IL-7. T-cell proliferation was analyzed based on the CFSE dilution using flow cytometry on day 6. To stimulate effector CTLs, OKT3 was coated at different concentrations as indicated in figure legends, and other antibody stimuli were given in the same method as described above. After 4 hours of stimulation, supernatant was harvested for IFN-γ ELISA, and cells were harvested for cytokine and gene expression profiling. For examining CTL activation by intracellular IFN-γ, brefeldin A was added after 2 hours of stimulation and cells were cultured for an additional 4 hours before intracellular staining. T-cell transduction. The retroviral vector production and transduction of NY-ESO-1–specific TCR genes 19305DP and CD8SP were performed. RetroNectin (catalog #T1008; TaKaRa) was used for coating of retrovirus. Transduction efficiency was determined by flow cytometry using NY- ESO-1157-165 (SLLMWITQC) tetramer (MBL Cat#TB-M011-1). To generate a NKG2D / DNAM- 1 co-expressing vector, human full-length CD314 (SEQ ID NO: 2 and SEQ ID NO: 4) and CD226 (SEQ ID NO: 5 and SEQ ID NO: 6) coding sequences were fused via P2A-skipping site (SEQ ID NO: 3) and cloned into the MSCV-based retroviral vector. To generate TCR / NKR double-transgenic T cells, HLA-A*02:01+PBMCs were preactivated using 50 ng / ml OKT3 and 300 IU / ml IL-2 (starting point = day 0). On day 2, cells were added to the 19305DP retrovirus– coated plate with T-cell culture medium containing 300 IU / ml IL-2, spun at 1,000×g at 32 °C for 10 minutes and incubated at 37 °C and 5% CO2. The same process was repeated after 8 hours of Attorney Docket Number 11390-016WO1 incubation. On day 3, cells were transduced with NKG2D / DNAM-1 co-expressing retrovirus using the same protocol. On day 4, double-transgenic T cells were harvested and cultured in T- cell culture medium containing 300 IU / ml IL-2. CD8+tetramer+T cells were flow sorted on day 7 and cultured for at least 2 days in T-cell culture medium containing 50 IU / ml IL-2 and 10 ng / ml IL-7 before use in functional assays. Loading cancer cells with tumor-associated antigens (TAAs). To model cancer cells expressing different levels of TAAs as target cells for TAA- specific CTL recognition and killing, HLA-A*02:01+cancer cells (SW620, Caco-2, or OVCAR3) were suspended at 1×106cells / ml in T-cell culture medium mixed with MART-1 (ELAGIGILTV; AnaSpec) or NY-ESO-1 (SLLMWITQC; MBL International) at indicated concentrations. Cell suspensions were incubated at 37 °C for 2 hours with mixing by vortex every 30 minutes, followed by washing 3 times using T-cell culture medium to remove residual free peptides. Antibody blockade of CTL–cancer cell interactions. To block target molecules prior to coculture, CTLs and cancer cells were incubated with indicated antibodies for 15 minutes at 37 °C. For CTLs, the antibodies were anti-human NKG2D (BioLegend Cat# 320814, RRID:AB_2810480) and anti-human DNAM-1 (Abcam Cat# ab33397, RRID:AB_726268) were used at 10 μg / ml. Mouse IgG1, κ (BioLegend Cat# 400165, RRID:AB_11150399) was used as the isotype control for anti-NKG2D and DNAM-1. For cancer cells, anti-human HLA-ABC (BioLegend Cat# 311412, RRID:AB_493132) was used at 5 μg / ml as a suboptimal concentration to partially block MHC class I. IFN-γ ELISA. IFN-γ in the supernatant of T-cell cultures was measured using a human IFN-γ ELISA kit according to the manufacturer’s protocol (catalog #DY285B, R&D Systems). Plate washing was performed using a BioTek 405LS Microplate Washer. Plate reading was performed using BioTek Epoch Microplate Spectrophotometer with Gen5 software. IFN-γ ELISPOT assay. To perform IFN-γ ELISPOT assays, 96-well MultiScreen Filter Plates (Millipore) were coated with 10 μg / ml anti-human IFN-γ (mAb 1-D1K) (MABTECH Cat# 3420-3-1000, RRID:AB_907282) at 4 °C overnight, washed with PBS, and blocked with T-cell culture medium at 37 °C for 1 hour before use.2×104cells / well TAA-loaded cancer cells or melanoma cancer cells were cocultured with effector cells (numbers are indicated in figure legends) in 100 μl T-cell culture medium at 37°C with 5% CO2 for 24 hours. Plates were rinsed with PBS containing 0.05% Tween-20 and coated with 10 μg / ml anti-human IFN-γ (7-B6-1–Biotin) Attorney Docket Number 11390-016WO1 (MABTECH Cat# 3420-6-1000, RRID:AB_907272) at 4 °C overnight. Immunospots were developed using VECTASTAIN Elite ABC-HRP Kit, Peroxidase (Standard) and AEC Substrate Kit, Peroxidase (HRP), (3-amino-9-ethylcarbazole) according to the manufacturer’s protocol (catalog #PK-6100 and SK4200, Vector Laboratories, Inc.). Spots were imaged and enumerated using CTL ImmunoSpot S6 Core Analyzer (Cellular Technology Ltd). Cytotoxicity assays. For the LDH cytotoxicity assay, 1×104MART-1–specific CTLs were preincubated with indicated blocking antibodies as described above and cocultured with 2×104MART-1–loaded SW620 in 200 μl T-cell culture medium in a 96-well plate at 37 °C with 5% CO2 for 24 hours. LDH activity of each sample was determined using a CyQUANT LDH Cytotoxicity Assay Kit according to the manufacturer’s protocol (catalog #C20300, Thermo Fisher Scientific). For the apoptosis assay, 1×105T cells were cocultured with 2×105peptide-loaded SW620 in 500 μl T- cell culture medium in 24-well ultra-low attachment plate at 37 °C with 5% CO2 for 24 hours. Cells were then harvested and stained using Alexa Fluor 488 annexin V / Dead Cell Apoptosis Kit (catalog #V13245, Invitrogen) with an adapted protocol. In brief, cells were washed in cold PBS, and resuspended in 100 μl 1× annexin-binding buffer containing Alexa Fluor 488 annexin V and BV786 mouse anti-human CD8 (BD Biosciences Cat# 563823, RRID:AB_2687487). Samples were incubated at room temperature for 15 minutes and 400 μl 1× annexin-binding buffer containing 1 μM DAPI (Sigma-Aldrich) were added. Samples were then kept on ice and acquired on a flow cytometer immediately. Intracellular Ca2+flux assay. Cell labeling, stimulation and detection were performed in HBSS (1X) with calcium chloride, magnesium chloride (Gibco) supplemented with 2% FBS. CTLs were labeled with Fluo-4, AM using a Fluo-4 Calcium Imaging Kit according to the manufacturer’s protocol (catalog #F10489, Thermo Fisher Scientific). Cells were then incubated with the following antibodies either alone or in combination at 37 °C for 15 minutes: biotin anti-human CD3 (BioLegend Cat# 317320, RRID:AB_10916519), biotin anti-human NKG2D (BioLegend Cat# 320804, RRID:AB_492958), biotin anti-human DNAM-1 (BioLegend Cat# 338326, RRID:AB_2721495), and biotin anti-human CD28 (BioLegend Cat# 302904, RRID:AB_314306). After incubation, cells were collected by centrifugation and resuspended in assay buffer containing 1 μM DAPI. Intracellular Ca2+levels over time were detected by flow cytometry. For each sample, baseline fluorescent signal was recorded for 30 seconds, then streptavidin was added at a final concentration of 20 μg / ml for crosslinking and the fluorescent signal was followed for an additional 9 minutes. Attorney Docket Number 11390-016WO1 Flow cytometry. Surface staining was performed in PBS containing 2% BSA, 1 mM EDTA and 0.02% NaN3. Antibodies used for surface staining are as follows: APC anti-NKG2D (BD Biosciences Cat# 558071, RRID:AB_398654), BV510 anti-NKG2D (BioLegend Cat# 320815, RRID:AB_2562746), FITC anti-DNAM-1 (BD Biosciences Cat# 559788, RRID:AB_397329), BV510 anti-DNAM-1 (BioLegend Cat# 338330, RRID:AB_2728300), BV786 anti-CD8 (BD Biosciences Cat# 563823, RRID:AB_2687487), PerCP / Cyanine5.5 anti-TIGIT (BioLegend Cat# 372717, RRID:AB_2632932), APC anti-CD112R (BioLegend Cat# 301505, RRID:AB_2876586), BV421 anti-CD96 (BioLegend Cat# 338417, RRID:AB_2629536), BV785 anti-PD-1 (BioLegend Cat# 329929, RRID:AB_11218984), BV605 anti-TIM-3 (BioLegend Cat# 345018, RRID:AB_2563859), PE anti-PVR (BioLegend Cat# 337610, RRID:AB_2174019), PE anti-Nectin-2 (BioLegend Cat# 337410, RRID:AB_2269088), PE anti- MICA / MICB (BioLegend Cat# 320906, RRID:AB_493193), PE anti-ULBP1 (R and D Systems Cat# FAB1380P, RRID:AB_2687471), PE anti-ULBP3 (R and D Systems Cat# FAB1517P, RRID:AB_10719122), PE anti-ULBP4 (R and D Systems Cat# FAB6285P, RRID:AB_3083729), and PE anti-ULBP2 / 5 / 6 (R and D Systems Cat# FAB1298P, RRID:AB_2214693). For IFN-γ intracellular staining, T cells were stimulated in the presence of brefeldin A as described above. Cells were fixed and permeabilized using the BD Fixation / Permeabilization Kit according to the manufacturer’s protocol (catalog #554714, BD Biosciences), and stained with APC mouse anti-human IFN-γ (BD Biosciences Cat# 554702, RRID:AB_398580) or BV711 mouse anti-human IFN-γ (BD Biosciences Cat# 564039, RRID:AB_2738557). Intracellular Melan A was stained by Alexa Fluor 647 anti-MelanA (Abcam Cat# ab225500, RRID:AB_2868593). For the degranulation assay, 2×105MART-1– specific CTLs were cocultured with 8×105MART-1–loaded SW620 in T-cell culture medium for 6 hours at 37 °C, in the presence of PE mouse anti-human CD107a (BD Biosciences Cat# 555801, RRID:AB_396135) and BD GolgiStop protein transport inhibitor (containing monensin) (catalog #554724, BD Biosciences). Cells were then stained with BV786 mouse anti- human CD8 (BD Biosciences Cat# 563823, RRID:AB_2687487) and resuspended in staining buffer containing 1 μM DAPI. When CD8+TILs and peripheral blood cells were used, cells were rested in T-cell culture medium supplemented with 50 IU / ml IL-2 and 10 ng / ml IL-7 overnight, before being stimulated by immobilized antibodies as described above. For cell sorting, sample preparation was performed in PBS containing 2% BSA with 1% penicillin / streptomycin (Gibco). Cells were stained with MART-1 Dextramer (Immudex Cat# WB2162-PE), or NY-ESO-1 Tetramer (MBL Cat#TB-M011-1). To detect CTL–cancer cell Attorney Docket Number 11390-016WO1 conjugates, MART-1–specific CTLs were labelled with CM-Dil according to the manufacturer’s protocol (Invitrogen Cat#C7001), incubated with indicated blocking antibodies, and cocultured with CFSE-labelled MART-1–loaded SW620 in 100 μl T-cell culture medium at E:T ratio of 1:1. Samples were incubated at 37 °C incubator for 10 minutes, then resuspended by adding 400 μl PBS containing 2% BSA and mild pipetting, and immediately acquired on a flow cytometer. Flow cytometry and cell sorting were performed using a BD LSRFortessa Cell Analyzer and a BD FACSAria II Cell Sorter (BD Biosciences). Data was analyzed using FlowJo 10.10.0 (RRID:SCR_008520). Analysis of synapse formation by ImageStream. DC-primed MART-1–specific CTLs were incubated with CFSE-labelled MART-1– loaded SW620 at an E:T ratio of 1:1 in a 37°C incubator for 15 minutes. Samples were fixed with 4% paraformaldehyde and permeabilized using 0.3% Triton X-100, both at room temperature for 10 minutes. Samples were stained with PE anti-human CD3 (BD Biosciences Cat# 555340, RRID:AB_395746), PerCP / Cyanine5.5 anti-human CD11a / CD18 (BioLegend Cat# 363413, RRID:AB_2721710), BV510 anti-human NKG2D (BioLegend Cat# 320815, RRID:AB_2562747) or BV510 anti-human DNAM-1 (BioLegend Cat# 338330, RRID:AB_2728299), and Alexa Fluor 647 Phalloidin (Invitrogen Cat#A22287) at room temperature for 30 minutes. After staining, samples were washed and immediately acquired on an ImageStreamXMKII (Amnis). Data analysis was performed using IDEAS software version 6.2 (Amnis). Western blot. To prepare samples for western blot, 3×106CTLs were incubated with 0.5 μg / ml biotin anti-human CD3 (BioLegend Cat# 317320, RRID:AB_10916519) with or without 10 μg / ml biotin anti-human DNAM-1 (BioLegend Cat# 338326, RRID:AB_2721495) in T-cell culture medium at 37°C for 15 minutes. After incubation, cells were collected by centrifugation and resuspended in 200 μl T-cell culture medium. Samples were mixed with 200 μl HBSS (with CaCl2, MgCl2) containing 40 μg / ml streptavidin and incubated at 37°C in a water bath for indicated time length. Cells were collected by centrifugation at 4°C and 1,250×g for 2 minutes and washed with ice-cold PBS. Proteins were extracted with lysis buffer containing 1× HALT Protease and Phosphatase Inhibitor Cocktail and quantitated using Pierce BCA Protein Assay Kit, with both reagents purchased from Thermo Fisher Scientific. SDS PAGE was performed using 4-15% Mini-PROTEAN TGX Precast Protein Gels with Precision Plus Protein Dual Color Standards. Wet transfer was performed using PVDF Membrane. All were purchased from Bio- Rad Life Science. After protein transfer, membranes were blocked with 5% BSA for 30 minutes Attorney Docket Number 11390-016WO1 at room temperature and then incubated with primary antibodies at 4°C overnight: Akt (pan) Rabbit mAb (Cell Signaling Technology Cat# 4691, RRID:AB_915783), phospho-Akt (Ser473) Rabbit mAb (Cell Signaling Technology Cat# 4060, RRID:AB_2315049), p44 / 42 MAPK (Erk1 / 2) Rabbit mAb (Cell Signaling Technology Cat# 4695, RRID:AB_390779), Phospho- p44 / 42 MAPK (Erk1 / 2) (Thr202 / Tyr204) Rabbit mAb (Cell Signaling Technology Cat# 4370, RRID:AB_2315112), and mouse anti-β-Actin (Sigma-Aldrich Cat# A5441, RRID:AB_476744). Membranes were then washed and incubated with fluorescent-conjugated secondary antibodies for 1 hour at room temperature: IRDye 680LT Goat anti-Rabbit IgG (LI-COR Biosciences Cat# 925-68021, RRID:AB_2713919) or IRDye 800CW Goat anti-Mouse IgG (LI-COR Biosciences Cat# 925-32210, RRID:AB_2687825). The protein bands were imaged using Odyssey Fc Imager with Image Studio Lite software version 5.5 (LI-COR Biosciences). Single cell multiplex cytokine profiling. CTLs were stimulated by immobilized antibodies for 4 hours as described above. Cells were harvested for cytokine profiling using Single-Cell Adaptive Immune Chip and Panel according to the manufacturer’s protocol (catalog #ISOCODE-1001-4 and PANEL-1001-4; IsoPlexis). In brief, cells were stained with Stain Cell Membrane 405 (catalog #STAIN-1001-1; IsoPlexis) and approximately 30,000 cells were loaded onto the chip containing 12,000 chambers prepatterned with an array of 32 cytokine capture antibodies. Chips were incubated in the IsoLight system at 37°C with 5% CO2 for an additional 16 hours and labelled with detection antibodies. The fluorescent signals of each cytokine at single-cell level were detected and analyzed by IsoLight system with IsoSpeak software version 2.9.0 (IsoPlexis). The polyfunctional strength index (PSI) was computed as the percentage of polyfunctional cells, multiplied by the sum of the mean fluorescence intensity of the proteins secreted by those cells. RNA sequencing. Dynabead-induced CTLs from 3 donors were stimulated by anti-human CD3 either alone or in combination with anti-human DNAM-1, NKG2D, or CD28 for 4 hours, as described above. Total RNA was prepared using the RNeasy Mini Kit and RNase-Free DNase Set according to the manufacturer’s protocol (catalog #74104 and 79254; Qiagen). Paired-end sequencing was performed by the Roswell Park Genomics Shared Resource on an Illumina NovaSeq 6000. Reads were aligned to the human genome (GRCh38) using STAR (RRID:SCR_004463) (version 2.7.9a) and transcripts were quantified by featureCounts (RRID:SCR_012919) from the Subread package (version 2.0.1). Normalization and differential expression analysis was completed with DESeq2 (RRID:SCR_015687) while modeling sample donor as a covariate. Gene Set Enrichment Analysis (GSEA) was performed with the fgsea Attorney Docket Number 11390-016WO1 (RRID:SCR_020938) (version 1.18.0) using rank ordered differential expression and gene sets derived from the Molecular Signatures Database (RRID:SCR_016863). qPCR. RNA was isolated as described above. Reverse transcription was performed using qScript cDNA Synthesis Kit (QuantaBio) according to the manufacturer's protocol with a T100 Thermal Cycler (Bio-Rad).250ng RNA per sample was used to make cDNA in a 20 µl reaction volume. The cDNA product was diluted 5 times. Real-Time PCR assay was performed in CFX96 Real-Time PCR System (Bio-Rad) with 40 replication cycles, using 4 µl cDNA template per reaction and iTaq Universal Probes Supermix (Bio-Rad) according to the manufacturer's protocol. HPRT1 was used as endogenous control (catalog #4325801; Life technologies). The individual gene expression levels were determined as the relative expression to HPRT1 using 2^- ΔΔCT method. Primers were purchased from Thermo Fisher Scientific, including: PVR (Hs00197846_m1), NECTIN2 (Hs01071562_m1), MICA (Hs00792195_m1), MICB (Hs00792952_m1), ULBP1 (Hs00360941_m1), ULBP2 (Hs01127964_m1), ULBP3 (Hs00225909_m1), RAET1E (ULBP4) (Hs01026643_g1), RAET1G (ULBP5) (Hs01584111_mH), RAET1L (ULBP6) (Hs00867544_gH), IFNG (Hs00989291_m1), GZMB (Hs00188051_m1), and PRF1 (Hs00169473_m1). Analysis of TCGA-SKCM metastatic melanoma cancer cohort. TCGA-SKCM expression and clinical annotations (352 samples) were obtained from the Genomic Data Commons data portal and processed via TCGAbiolinks package in R using TCGAWorkflow guided practices. Associations between normalized DNAM-1 (CD226) and NKG2D (KLRK1) expression and typical CD8+T Cell (CD3G, CD8A, CD8B) and NK cell (NCR1, NCR2, NCAM1) lineage and functional (IFNG, GZMK, GZMB, PRF1) markers was performed via Spearman correlation analysis. Overall survival analysis was conducted by Kaplan-Meier curve and log-rank test using the survival package in R. High and low subsets of indicated genes were defined using median expression or scaled z-scores. Hazard ratios for overall survival were calculated using individual log-transformed gene expressions. The functional hotness score for combined expression of CD8A, DNAM-1, and NKG2D was calculated. Statistical analysis. All statistical analyses were performed using GraphPad Prism 9 (RRID:SCR_002798). Data from replicate cultures were presented as mean ± SD. Data from multiple donors were presented as mean ± SEM. The numbers of replicates and donors are provided in the figure legends. A Student’s t-test or paired t-test was used to compare two independent or matched Attorney Docket Number 11390-016WO1 groups. P-values < 0.05 were considered to be significant (*P < 0.05, **P < 0.01, ***P < 0.001). Due to the character of the study (in vitro experiments), no power analysis, sample size determination or randomization were needed. Unless indicated otherwise, each experiment was performed in triplicate per each condition. All experiments were repeated independently using blood from at least 3 different donors. The relevant numbers of donors and replicates for all experiments are described in the figure legends and were sufficient to perform statistical analyses. All data were recorded and analyzed by software with objective readouts, thus blinding was not relevant to this study. No data was excluded from the analysis. Results Intratumoral CD8+T cell–associated DNAM-1 and NKG2D predict clinical outcomes in melanoma patients: To study the role of CTL-expressed DNAM-1 and NKG2D, TCGA analysis of markers of CTLs and NK cells in tumor samples from metastatic melanoma patients was performed. DNAM-1 (CD226) and NKG2D (KLRK1) expression levels were associated with improved overall survival and higher CTL effector markers IFNG, GZMK, GZMB, and PRF1 (Fig.8). Both DNAM-1 and NKG2D were most strongly correlated with intratumoral CTL markers CD3G, CD8A, and CD8B, rather than NK-cell markers (Fig.1A). Moreover, only the patients with both elevated CD8A and elevated DNAM-1 and NKG2D, showed survival superior to CD8A-low patients, while the patients with high CD8A expression alone but low expression of DNAM-1 or NKG2D showed no survival advantage compared to patients with low CD8A expression, and showed significantly worse survival than patients with high expression of CD8A, DNAM-1, and NKG2D, indicating that CD8+T cells lacking DNAM-1 and NKG2D are not effective in tumor control (Fig.1B). Analysis of hazard ratios further indicated that combined expression of CD8A, DNAM-1, and NKG2D predicted prognosis better than each single gene expression (Fig.1C). The expression of DNAM-1 and NKG2D reflected the functional status of tumor- infiltrating CTLs and circulating CD8+T cells. Within the CD8+TILs of melanoma patients, DNAM-1 and NKG2D were exclusively expressed by TILs at the effector stage (Teff), both within total TILs and the MART-1–specific CD8+TIL population (Fig.1D-E). In contrast, TIM- 3+PD-1+exhausted TILs (Texh) lacked surface expression of DNAM-1 and NKG2D. Compared to TIM-3–PD-1–effector TILs, exhausted TILs further expressed significantly higher levels of TIGIT and lower levels of CD96 (Fig.9A), which are known to act as competitive inhibitors of the PVR–DNAM-1 interaction and mediate inhibitory signals. In line with the exhausted phenotype, CD8+TILs lacking DNAM-1 were not able to degranulate in response to anti-CD3 Attorney Docket Number 11390-016WO1 stimulation (Fig.9B). In analogy to TILs, DNAM-1 and NKG2D were preferentially expressed on peripheral blood central memory and effector memory CD8+T cells, compared to their naïve or terminally differentiated counterparts (Fig.1F). DNAM-1 and NKG2D are involved in TCR recognition of melanoma cells by MART-1– specific CTLs: To determine the contribution of DNAM-1 and NKG2D to CTL recognition of cancer cells, MART-1 (Melan A), a differentiation antigen expressed by melanoma and normal melanocytes was used as a model TAA. MART-1–specific CTLs were induced by in vitro sensitization (IVS) using autologous MART-1 peptide–loaded DCs and CD8+T cells isolated from healthy normal HLA-A*02:01+donors (Fig.10A). DC-primed MART-1–specific CTLs transiently upregulated surface expression of DNAM-1 and NKG2D, compared to naïve and MART-1–nonspecific CD8+T cells, but lost their expression of these NKRs at later stages of activation (Fig.10B and 10C). Ligands of DNAM-1 (PVR and Nectin2) and NKG2D (MICA, MICB and ULBP1-6) are commonly expressed on human cancer cell lines of diverse tissue histology, such as colon cancer (SW620), ovarian cancer (OVCAR3) and melanoma (2183- Her4, Mel526, Mel624), while none of the cell lines expressed CD28 ligands (Fig.10D). The CTL recognition of cancer cells expressing different levels of endogenous MART- 1 / Melan A was evaluated by IFN-γ ELISPOT. Blockade of DNAM-1 and NKG2D significantly inhibited CTL recognition of weakly-immunogenic Mel624 melanoma cells, but not the more immunogenic 2183-Her4 or Mel526 melanoma cells (Fig.2A and B), indicating a negative correlation between the overall strength of effector response and the inhibitory effect of NKR blockade across multiple experiments (Fig.2C). DNAM-1 and NKG2D set the threshold of TCR-mediated recognition of MHC I / TAA complexes: To test whether the NKR-assisted recognition of cancer cells by DC-primed MART-1– specific CTLs is TCR dependent, MART-1–negative (but HLA-A*02:01+) SW620 colorectal cancer cells were loaded with increasing concentrations of MART-1 peptide as target cells. Despite the expression of multiple ligands for DNAM-1 and NKG2D by SW620 cells (Fig. 10D), DC-primed CTLs exclusively recognized and killed only MART-1–loaded cancer cells, and fully ignored MART-1–negative cells (Fig.2A, Fig.10E and 10F). These results demonstrate that the activation of DC-primed CTLs is fully dependent on TCR-delivered signal 1, in contrast to LAK / CIK-type activation, which is TCR independent. The selective role of NKRs in the recognition of cancer cells with lower antigenicity indicated that NKR-mediated costimulation may be particularly needed to assist in T-cell Attorney Docket Number 11390-016WO1 activation in the presence of low levels of TCR–pMHC-I–delivered signals. To test this hypothesis, SW620 cells were loaded with different concentrations of MART-1 peptide to mimic cancer cells presenting low- and high-levels of TAAs. As shown in Fig.2D, blockade of NKG2D and DNAM-1, either individually or in combination, had no detectable inhibitory effect on CTL recognition of SW620 cells loaded with high-dose MART-1. In contrast, blockade of DNAM-1 inhibited CTL recognition of SW620 cells pulsed with low doses of the MART-1 peptide, with the maximal inhibition observed upon coordinate blockade of both DNAM-1 and NKG2D. The results were confirmed with additional MART-1–negative cancer cells loaded with increasing doses of exogenous MART-1 (Fig.11A). Similar to in vitro DC–sensitized polyclonal MART-1–specific CTLs from healthy donors, a MART-1–specific CTL clone established from tumor-infiltrated lymph node cells from an HLA-A*02:01+melanoma patient also required NKG2D and DNAM-1 for optimal recognition of HLA-matched tumor cells loaded with low, but not high, doses of the MART-1 peptide (Fig.2E). Moreover, partial blockade of MHC-I on cancer cells loaded with high-dose MART-1 peptide revealed the same requirement of DNAM-1 and NKG2D in cancer-cell recognition by DC-activated CTLs (Fig. 11B). The same pattern was observed using NY-ESO-1, a TAA shared by normal testis and multiple tumors, as an alternative model TAA, where NY-ESO-1–loaded cancer cells were targeted by NY-ESO-1–specific TCR-transduced CD8+T cells [19305DP and CD8SP]. NKR blockade prevented the CTL recognition of cancer cells presenting low levels of peptides, showing a progressively lesser role in cancer cells expressing higher levels of MHC I / TAA peptide complexes (Fig.2F). The involvement of DNAM-1 and NKG2D was next tested in the sequential steps of CTL-mediated cytolysis: cell-conjugate formation, CTL cytoplasmic rearrangement, and degranulation. Coculture of CM-Dil labelled MART-1–specific CTLs with CFSE-labelled MART-1–loaded SW620 showed that blockade of NKRs strongly inhibited the development of CTL conjugation with low-dose MART-1–loaded cancer cells, without affecting conjugation with high-dose MART-1–loaded cancer cells (Fig.11C). ImageStream analyses further revealed that both DNAM-1 and NKG2D were polarized at the CTL–cancer cell contact zone, and colocalized with markers of the immune synapse including CD3, LFA-1, and F-Actin (Fig.2G). Consistently, CTL degranulation (measured as CD107a translocation to plasma membrane) in response to low-dose MART-1–loaded cancer cells was critically dependent on NKRs (Fig.2H). Furthermore, LDH cytotoxicity assay confirmed that DNAM-1 and NKG2D blockade inhibited the T-cell killing of low-dose, but not high-dose MART-1–loaded cancer cells (Fig.2I). Attorney Docket Number 11390-016WO1 DNAM-1 and NKG2D costimulation enhance CTL polyfunctionality: The costimulatory role of NKR signals was further validated using Dynabead-induced CTLs and freshly isolated peripheral blood CD8+T cells, which all showed a similar dependence on DNAM-1, and to a lesser extent NKG2D, in response to weak TCR triggering by low-dose anti-CD3 (OKT3) (Fig.3A, Fig.12). The DC / target cell–free model of Dynabead-induced CTLs allowed to perform single- cell secretome analysis of the impact of NKR costimulation on CTL functions. The 3D-UMAP projection of 32 mediators of adaptive immunity showed profound differences between the control (CD3-only activated) CTLs and the NKG2D- or DNAM-1-costimulated CTLs (Fig.3B). DNAM-1, and to a lesser extent NKG2D, enhanced T-cell secretion of effector function- associated factors including Granzyme B, IFN-γ, Perforin, and TNFα (Fig.3C), and increased the number of individual CTLs secreting multiple factors (Fig.3D). The polyfunctional strength index (PSI) reflects the ability of a T cell to carry out multiple functions and has been shown to predict the efficacy of immune therapies. As shown in Fig.3E, NKR-mediated costimulation of CTLs increased the PSI score and the ability of CTLs to secrete cytokines across all functional categories. DNAM-1 costimulation lowers TCR activation threshold and enhances TCR signaling: NKG2D signaling in human NK cells and T cells is known to involve the DAP10 adaptor protein, which uses a similar YXNM motif as CD28 to mediate signal transduction. However, the optimal responsiveness of CD8+T cells to NKG2D activation requires IL-15 or high dose IL-2 to induce DAP10 expression. Consistently, these results showed only a weak NKG2D-mediated costimulatory effect on CTLs induced in absence of high dose IL-2 or IL-15. In contrast, these observations indicated that DNAM-1 was dominant in assisting TCR-driven activation. In the case of NK cells, DNAM-1 transduces signals through a SLP76 / VAV1-PLCγ2 pathway, leading to the activation of transcriptional factors AP-1, NFAT, and NF-κB, known to be also involved in TCR signaling. Using RNA sequencing, the gene expression profiles of early CTL activation induced by anti-CD3 (OKT3) alone or in the presence of DNAM-1, NKG2D, or CD28 costimulation were compared. Principle component analysis indicated a profound separation between DNAM-1 costimulated CTLs and CTLs activated under other conditions (Fig.4A). Differential gene expression analysis, accounting for donor source as a covariate, revealed DNAM-1 costimulation induced significantly more differentially expressed genes compared to NKG2D and CD28 costimulation (log2FC > 1.0, p adj. < 0.05, Fig.4B), including key biomarkers of initial effector T-cell responses, PRF1, IFNG, GZMB, IL2RA, and IL2 (Fig.4C, Fig.13A). Gene Attorney Docket Number 11390-016WO1 set enrichment analyses showed strong upregulation of TCR downstream transcriptional factors by DNAM-1 signaling, including those involved in the Myc pathway, IL2-STAT5 pathway and TNFα signaling, as well as genes known to be regulated by CD28 costimulation, such as the AKT–mTORc1 and glycolytic pathways (Fig.4D and 4E). This data demonstrates that DNAM- 1 signaling is superior to NKG2D and even CD28 in providing costimulatory effects to assist early effector phase of TCR-driven CTL reactivation. To further validate these results, it was tested whether DNAM-1 engagement decreased the threshold of TCR triggering. Dynabead-induced CTLs were labelled with the calcium indicator Fluo-4 and pre-incubated with different doses of biotinylated anti-CD3 and anti- DNAM-1. TCR and DNAM-1 signals were then triggered by cross-linking antibodies with streptavidin. Activation of DNAM-1 increased the TCR-triggered intracellular calcium flux in a DNAM-1 dose-dependent manner. Moreover, DNAM-1 engagement allowed CTLs to respond to low-level CD3 stimulation (which was insufficient to induce calcium flux by itself). In contrast, calcium flux in CTLs induced by high-level CD3 engagement was minimally affected by DNAM-1 engagement (Fig.4F). In the absence of TCR stimulation, even maximal DNAM-1 cross-linking induced only a low level of delayed calcium signaling in T cells (Fig.13B). In addition to the calcium flux (as a marker of calcineurin–NFAT pathway activation), strong increases in phosphorylated AKT and ERK in DNAM-1–costimulated CTLs, reflecting the respective activation of the AKT / mTOR and Ras / MAPK pathways were observed (Fig.4G). Effector versus naïve CD8+T cells rely on DNAM-1 versus CD28 costimulatory pathways: Consistent with RNA sequencing results, calcium flux demonstrated that DNAM-1 is superior to CD28 in supporting CTL activation (Fig.5A), indicating that CD8+T cells at different stages of activation preferentially use different costimulatory pathways. To test this hypothesis, naïve CD8+T cells and effector CTLs were stimulated by immobilized anti-CD3 (OKT3), alone or in combination with agonistic antibodies to DNAM-1 or CD28. CD28- costimulation was key to the activation of naïve CD8+T cells, based on both proliferation (Fig. 5B) and IFN-γ secretion (Fig.5C left). However, CTL reactivation required DNAM-1 signaling, rather than CD28, for the optimal costimulation, with CD28 showing only modest costimulatory effects (Fig.5C right). These observations were confirmed in a model where naïve CD8+T cells and effector CTLs were activated by SEB-pulsed DCs that expressed both DNAM-1 and CD28 ligands (Fig.5D). Blockade of CD28 engagement by CTLA4-Ig strongly inhibited the proliferation of naïve CD8+T cells by DCs, while blockade of DNAM-1 showed only weak inhibitory effects (Fig.5E). In contrast, in preactivated CTLs, blockade of DNAM-1, rather than CD28, showed the dominant inhibitory effect (Fig.5F). Attorney Docket Number 11390-016WO1 These activation stage–dependent differences indicate that effector CTLs acquire NKRs, which recognize their ligands that are highly expressed on cancer cells, as a source of an “alternative signal 2.” This alternative signal 2 replaces CD28 costimulation to allow selective recognition and killing of cancer cells expressing TAAs, while healthy cells are ignored due to lack of NKR engagement (Fig.5G). Application of NKR-costimulation to adoptive T cell therapies and chemo / immuno- therapies: It was next evaluated the relevance of these findings to cancer therapy and tested if the modulation of the levels of DNAM-1 and NKG2D on CTLs can be used to enhance their antitumor activity. Retroviral vectors encoding NKG2D / DNAM-1 were employed to engineer overexpression of these NKRs by HLA-A*02:01-restricted NY-ESO-1 TCR-transgenic CD8+T cells (Fig.6A). As shown in Fig.6B, the TCR / NKR “double-transduced” T cells demonstrated strongly elevated cytotoxic activity against peptide-loaded SW620 tumor cells when compared to the TCR-only “single-transduced” T cells, especially against low-TAA–expressing targets. Furthermore, the “double-transduced” T cells did not show any increase in nonspecific killing of NY-ESO-1–unloaded cancer cells. These results demonstrate the ability for manipulating the NKR levels on the T cells to enhance the effectiveness of T-cell recognition and killing of weakly immunogenic cancer cells. Since the DNA damage response is known to result in elevated expression of NKG2D and DNAM-1 ligands, it was tested to observe whether chemotherapeutic agents could upregulate theses ligands and thus facilitate cancer cell recognition by DC-primed TAA-specific CTLs. Oxaliplatin and cisplatin, frequently used to treat colorectal and ovarian cancers, enhanced the expression of NKR ligands (NKR-L) on SW620 (colorectal) and SKOV3 (ovarian) cells, but not Caco-2 (colorectal). The upregulation of NKR-Ls was achieved with low-dose oxaliplatin and cisplatin, which were insufficient for direct cytotoxic effects (Fig.14). Moreover, SW620 cells surviving prolonged high-dose oxaliplatin exposure exhibited elevated NKR-L expression (Fig.6C). Oxaliplatin-treated SW620 triggered a significantly stronger response from MART-1–specific CTLs, compared to untreated SW620, especially when loaded with a low- dose of MART-1 peptide (Fig.6D). NKR blockade counteracted the enhanced CTL recognition of oxaliplatin-treated cancer cells, indicating a key role for elevated NKR-L expression in the immuno-sensitizing effects of oxaliplatin (Fig.6E). While traditional approaches to combine chemo- and immunotherapy have focused on the induction of immunogenic cell death and depletion of Treg / MDSC by chemotherapy, these data highlight the synergy at the effector stage of antitumor T-cell responses by sensitizing cancer cells to immune attack, indicating that the Attorney Docket Number 11390-016WO1 proper timing of chemotherapy and immunotherapy can help eliminate chemo-resistant and weakly immunogenic cancer cell variants (Fig.6F). Discussion We show that DNAM-1, and to a lesser extend NKG2D, enhance CTL functional avidity, allowing TCR-restricted activation of DC-primed CTL by low-level MHC-I / peptide complexes or suboptimal levels of TCR stimulation. these data help to reconcile the controversies regarding the physiologic role of NKRs on human CD8+T cells, highlight their importance in the CTL effector response against weakly immunogenic cancer cells, and indicates new ways of enhancing the effectiveness of adoptive T cell therapies and other cancer treatments. Lack of classical signal 2 delivery by cancer cells has been recognized in the field of CAR T-cell therapy as a factor limiting its efficacy. Synthetic CD28 signaling domains (or alternatively, 4-1BB or OX40) have been shown necessary to provide “artificial signal 2”, assuring persistence and therapeutic efficacy of modern CAR T cell–based immunotherapies. CAR-NK cells with CAR-linked DNAM-1 intracellular domain have been recently shown to have higher cytotoxic abilities vs. CAR-NK cells integrating CD28 signaling domain. These observations, and the current results showing a particularly strong benefit of DNAM-1 costimulation in CTL responses against cancer cells expressing low levels of MHC I / TAA peptide complexes, provide a strong rationale to integrate DNAM-1 as a costimulatory component in the engineering of improved TCR- transgenic T cell and CAR T-cell products for therapeutic intervention. Effective targeting of TAAs in cancer immunotherapy is limited by the expression of overlapping levels of TAAs between cancer and healthy cells and associated risks of immune toxicities. Current designs of CAR T-cell constructs include intracellular domains providing signal 1 and 2 with the same antigen / ligand binder. While this enhances the potency of CARs, it does not enhance the discrimination between cancer and healthy cells expressing the same target antigens, introducing the risk of autoimmunity and T-cell hyperactivation. In sharp contrast, these data demonstrate that the TAA-specific killing of cancer cells by CTLs can be achieved by double-transduction of CTLs with separate TCR and NKRs constructs, which bind to their separate ligands (pMHC I and NKR-Ls). This supports the feasibility of more selective “dual- recognition” systems involving the delivery of a) signal 1 by TCRs or CARs recognizing tumor antigens and b) delivery of signal 2 by modified NKRs or CARs recognizing NKR-Ls on cancer cells. Such “dual-recognition” can allow CTLs to selectively receive two separate cancer- specific signals to achieve higher functional avidity and enhanced recognition of cancer cells vs. Attorney Docket Number 11390-016WO1 healthy cells, even under conditions when both cell types expressing a comparable level of TAAs. The heterogenous expression of multiple NKR-Ls, at baseline or in response to stressors such as chemo-, radio- or targeted therapies, indicates the general applicability of targeting NKR-Ls in the context of chemo / immunotherapy of diverse forms of solid cancer. Therapeutic agents and irradiation that induce DNA damage responses can upregulate NKR-Ls in different types of cancers and enhance NK cell–mediated antitumor responses. Paradoxically, a high expression level of NKR-Ls has shown to be correlated with poor prognosis of cancer patients, which can result from the ability of soluble NKR-Ls released by cancer cells to block immune cell–expressed NKRs or induce their internalization. These studies support the need for further in-depth analyses of the impact of different forms of chemo-, radio- and targeted therapy on the induction of cell surface versus soluble NKR-Ls in cancer cells. These studies tested the role of DNAM-1–mediated recognition during the priming stage of naïve CD8+T-cell activation and early effector phase of CTL activation. This data raises the question of whether there is a role for DNAM-1 at other activation stages of CD8+T cells, including their exhaustion, and whether enhanced delivery of NKR signals can affect antitumor activity of other forms of cancer therapies such as immune checkpoint blockade. The results raise the possibility that the DNAM-1 signal can override the TCR-modulating suppressive signals provided by inhibitory receptors such as CTLA4, PD1 or other inhibitory checkpoint molecules present on exhausted T cells and repetitively stimulated CAR T cells, which can help them to survive and retain effector polyfunctionality and prolong cytotoxic activity against large tumor masses. Moreover, the DNAM-1 / TIGIT axis is analogous to the CD28 / CTLA4 axis, as DNAM-1 and TIGIT compete for PVR in providing stimulatory versus inhibitory signals to CTLs. These data help to understand the immune deficit in DNAM-1–CD8+T cells, which have been identified as a dysfunctional T-cell subpopulation of TILs associated with disease progression. Meanwhile, the frequency of DNAM-1highCD8+T cells appear to hold positive predictive value in patients receiving anti-TIGIT therapy. These findings, together with these data showing that overexpression of NKRs benefits CTL function, indicate that enhancing the bioavailability of PVR to DNAM-1 can interfere with TIGIT-mediated suppression and improve the efficacy of TIGIT blockade therapy. Due to key differences of DNAM-1 and NKG2D signaling and ligand utilization between human and mouse systems, preclinical studies of adoptive transfer of NKR-assisted TCR- and CAR-transgenic T cells and their combinations prioritize patient-derived xenograft Attorney Docket Number 11390-016WO1 models and humanized mouse models to validate the antitumor efficacy of enhanced NKR- mediated recognition against tumor targets with heterogenous TAA expression. Example 2: Targeting NK Receptors to Enhance the Effectiveness and Selectivity of CTL Recognition of Cancer Cells Different mechanisms have been shown to mediate the downregulation of NKG2D and DNAM-1, protecting cancer from NK and T cell cytotoxicity. Different forms of soluble NKG2D ligands have been detected in the sera of patients with a variety of cancers and are associated with poor prognosis. Cancer-derived soluble NKG2D ligands can induce internalization of NKG2D on NK and T cells, impairing their anti-cancer functions. Paradoxically, persistent surface expression of NKG2D ligands by tumors does not enhance tumor rejection but can systemically down-modulate NKG2D on lymphocytes and thus impair immunosurveillance, as shown in mouse studies. In addition, transforming growth factor-β (TGF-β), a cancer-associated immunosuppressive factor, down-modulates NKG2D through post-transcriptional mechanisms involving microRNAs. Binding of tumor-expressed DNAM-1 ligand PVR induces ubiquitination of DNAM-1, resulting in its downregulation through internalization and proteasomal degradation. Recent studies have also indicated that DNAM- negative tumor infiltrating lymphocytes (TILs) show dysfunctional phenotypes, resulting in resistance to immunotherapies. Thus, increasing expression of NKG2D and DNAM-1 in CTLs represents a new strategy to enhance immune elimination of cancer. Lack of classical signal 2 delivery by cancer cells has been recognized as a factor limiting the efficacy of CAR-T therapy. Synthetic CD28 signaling domains (or alternatively, 4- 1BB or OX40) have been shown to be necessary to provide “artificial signal 2”, assuring persistence and therapeutic efficacy of modern CAR-T cell-based immunotherapies. CAR-NK cells with CAR-linked DNAM-1 intracellular domain have been recently shown to have higher cytotoxic abilities vs. CAR-NK cells integrating CD28 signaling domain. These observations, and the current results showing a strong benefit of DNAM-1 costimulation in CTL responses against cancer cells expressing low levels of MHC I / TAA peptide complexes, provide rationale to integrate DNAM-1 as a costimulatory component in CAR-T or TCR-transgenic T cell products for therapeutic intervention. Guided by these considerations, the modulation of NKR-mediated recognition and signaling were evaluated as a tool to enhance the potency and selectivity of cancer therapies. Two strategies were tested: a) overexpression of NKRs on TCR-transduced CTLs, and b) integration of DNAM-1 intracellular domain into CD19-targeted CAR constructs. Materials and Methods Attorney Docket Number 11390-016WO1 Human samples. All healthy adult donors (> 18 years old; independently on the body mass index; both male and female) were recruited through regular visits at the Roswell Park Donor Center. Peripheral blood cones (byproduct of platelet collection) were obtained after informed consent under the Institutional Review Board of Roswell Park Comprehensive Cancer Center approved BDR protocol 163223). Additional HLA-A*02:01+peripheral blood leukapheresis packs were purchased from StemCell Technologies Inc, Vancouver, Canada. Sex age and body weight of participants reflect the demographics of Western New York State. Cell lines, media, and reagents. Human HLA-A*02:01+cancer cell lines SW620 was purchased from ATCC. Human lymphoma cell lines Daudi (FFLuc), Raji (GFP-FFLuc), and leukemia cell line NALM6 (GFP- FFLue) was provided by Dr. Renier Brentjens (Roswell Park). SW620 was cultured in Leibovitz’s L-15 medium (Gibco) supplemented with 10% FBS. Daudi, Raji, and NALM6 were cultured in RPMI1640 (Gibco) supplemented with 10% FBS. SW620 cells were incubated at 37°C without CO2. Other cells were incubated at 37°C with 5% CO2. AIM-V medium (Gibco) supplemented with 5% human serum (GeminiBio) was used as the base T cell culture medium. IL-2 (Proleukin aldesleukin) was purchased from McKesson; IL-7 was purchased from Peprotech. Retroviral transduction of human T cells. The retroviral vector production and transduction of RetroNectin (catalog #T1008; TaKaRa) was used for coating of retrovirus. NY-ESO-1-specific TCR (19305DP)-transduced T cells were generated. Transduction efficiency was determined by NY-ESO-1157-165(SLLMWITQC) tetramer (iTAg MHC tetramer; MBL International). To generate NKG2D / DNAM-1 co-expressing vector, human full length CD314 and CD226 coding sequences were fused via P2A-skipping site and cloned into the MSCV-based retroviral vector. To generate TCR / NKRs double-transgenic T cells, HLA-A*02:01+PBMCs were preactivated using 50 ng / ml OKT3 and 300 IU / ml IL-2 (starting point = day 0). On day 2, the cells were placed in the 19305DP retrovirus-coated plate with T cell culture medium containing 300 IU / ml IL-2, centrifuged at 1000×g at 32 °C for 10 minutes and incubated at 37 °C with 5% CO2. The same process was repeated after 8 hours of incubation. On day 3, cells were transduced with NKG2D / DNAM-1 co-expressing retrovirus using the same protocol. On day 4, the double- transgenic T cells were harvested and cultured in T cell culture medium containing 300 IU / ml IL-2. CD8+tetramer+T cells were flow sorted on day 7 and cultured for at least 2 days in T cell culture medium containing 50 IU / ml IL-2 and 10 ng / ml IL-7 before functional assays. The 19- Attorney Docket Number 11390-016WO1 28ζ CAR fusion gene was constructed and cloned into a retroviral vector. The dsDNA inserts of DNAM-1 intracellular domain (SEQ ID NO: 7) were synthesized using IDT gBlocks. CAR transduction was performed. CAR expression was determined by flow cytometry using an anti- CAR monoclonal antibody 19E3. Lentiviral transduction of human T cells. Target sequences of shRNA directed against NKG2D and DNAM-1 are: NKG2D (CGGGGTCAGGGAGGTGGTG), DNAM-1 (CCGGTCAACCTACCAATCAAT). Lentiviruses expressing shRNAs were purchased from VectorBuilder. T cells were plated on a 12-well plate at a concentration of 1 × 106cells / ml in 0.5 ml medium per well and mixed with 50 µl virus, 5 µg / ml polybrene (R&D system) and 300 IU / ml IL-2. The plate was centrifuged 1000×g at 32 °C for 1 hour and incubated at 37 °C with 5% CO2. After overnight incubation, cells were harvested, washed, and cultured in media containing 50 IU / ml IL-2 and 10 ng / ml IL- 7. Cells were collected for analysis 72 hours after transduction. IFN-γ ELISA. IFN-γ in supernatant of T cell culture was measured using a human IFN-γ ELISA kit according to the manufacturer’s protocol (catalog #DY285B, R&D Systems). Plate washing was performed using BioTek 405LS Microplate Washer. Plate reading was performed using BioTek Epoch Microplate Spectrophotometer with Gen5 software. Cytotoxicity assays. For apoptosis assay, 1×105T cells were cocultured with 2×105peptide-loaded SW620 in 500 μl T cell culture medium in 24-well ultra-low attachment plate at 37 °C with 5% CO2 for 24 hours. Cells were then harvested and stained using Alexa Fluor 488 annexin V / Dead Cell Apoptosis Kit (catalog #V13245, Invitrogen) with an adapted protocol. In brief, cells were washed in cold PBS, and resuspended in 100 μl 1× annexin-binding buffer containing Alexa Fluor 488 annexin V and BV786 mouse anti-human CD8 (clone RPA-T8). Samples were incubated at room temperature for 15 minutes and 400 μl 1× annexin-binding buffer containing 1 μM DAPI (Sigma-Aldrich) were added. Samples were then kept on ice and acquired on flow cytometer immediately. For luciferase assay, CAR transduced T cells were cocultured with firefly luciferase-expressing Daudi, Raji, or NALM6 at the indicated effector: target ratios for 24 hours. Luciferase assay reagents were added according to the manufacturer’s protocol (catalog E4550, E1483, and E1531, Promega). Relative light units (RLU) were measured using BioTek Epoch Microplate Spectrophotometer with Gen5 software. Flow cytometry. Attorney Docket Number 11390-016WO1 Surface staining was performed in PBS containing 2% BSA, 1 mM EDTA and 0.02% NaN3. For cell sorting, sample preparation was performed in PBS containing 2% BSA with 1% penicillin / streptomycin (Gibco). Flow cytometry and cell sorting were performed using BD LSRFortessa Cell Analyzer and BD FACSAria II Cell Sorter (BD Biosciences). Data was analyzed using FlowJo software (FlowJo, LLC). Statistical analysis. All statistical analyses were performed using GraphPad Prism 9. Data from replicate cultures were presented as mean ± SD. Data from multiple donors were presented as mean ± SEM. The numbers of replicates and donors were provided in the figure legends. A Student’s t-test or paired t-test was used to compare two independent or matched groups. P-values < 0.05 were considered to be significant (*P < 0.05, **P < 0.01, ***P < 0.001). Results NKR-overexpression enhances antigen sensitivity of TCR-transduced T cells: Downregulation of NKG2D and DNAM-1 can be applied by cancers as an immune evasion strategy. This was verified by using lentiviral shRNA to knockdown NKG2D or DNAM-1 on NY-ESO-1-specific TCR-transduced CTLs (Fig.16A). Survival of NY-ESO-1- expressing cancer cells after 24-hour coculture with differentially transduced CTLs was determined by AnnexinV and DAPI staining. Knockdown of DNAM-1, and to a lesser extent NKG2D, significantly increased the survival ratios of cancer cells (Fig.16B). This result is consistent with the understanding that DNAM-1 is superior in costimulating CTL reactivation, and further indicates that maintaining high expression of NKG2D and DNAM-1 is important for CTL effector function. Retroviral vectors encoding NKG2D / DNAM-1 were employed to engineer overexpression of these NKRs by HLA-A*02:01-restricted NY-ESO-1 TCR-transgenic CD8+T cells (Fig.6A). As shown in Fig.6B, the TCR / NKR “double-transduced” T cells demonstrated strongly elevated cytotoxic activity against peptide-loaded SW620 tumor cells when compared to the TCR-only “single-transduced” T cells, especially against low-TAA-expressing targets. Importantly, the “double-transduced” T cells did not show an increased nonspecific killing of NY-ESO-1-unloaded cancer cells. These results demonstrate the manipulation of the T cell NKR levels to enhance the effectiveness of T cell recognition and killing of weakly immunogenic cancer cells. Integration of DNAM-1 costimulatory domain in CD19 CAR: pros and cons: Guided by the results showing that DNAM-1 dominates over CD28 in costimulating effector phase of CTL activation, it was tested whether DNAM-1 costimulatory domain can Attorney Docket Number 11390-016WO1 enhance the elimination of CD19-expressing blood cancer by CD19-targeted CAR T cells. Notably, unlike solid tumors which do not express CD28 ligands but commonly express high- level DNAM-1 ligands, cancer cells derived from hematological malignancies can express high- level CD28 ligands, but express DNAM-1 ligands at much lower levels (Fig.17). This result indicates that while elimination of blood cancer by CAR T cells can benefit from exogenous CD28 domain in CARs and endogenous CD28, endogenous DNAM-1 costimulation is largely limited, thus further strengthens the rationale of adding DNAM-1 domain in CD19 CAR construct. 19-28Dζ CAR was generated using a second generation CD28-based CD19-targeted CAR (19-28ζ) as the backbone, inserting DNAM-1 intracellular domain between CD28 and CD3ζ domains (Fig.18A). Unexpectedly, integration of DNAM-1 intracellular domain largely decreased the expression of CAR on T cells (Fig.18B). The function of DNAM-1 domain in 19- 28Dζ CAR was determined by detection of phosphorylated serine residue 329 in 19-28Dζ CAR T cells incubated with Raji, a CD19 positive but PVR / Nectin2 negative lymphoma cell line (Fig. 18C). Thus, the decreased CAR expression is not due to the protein misfolding. The function of 19-28Dζ CAR was further determined by killing of CD19 positive cancer cells. Strikingly, even though 19-28Dζ transduced T cells had almost 6-fold smaller population of CAR-expressing cells and expressed CAR at lower levels (Fig.19A), they showed a similar ability of killing cancer cells as 19-28ζ CAR at various E:T ratios (Fig.19B). Moreover, CAR-expressing cells sorted from 19-28ζ or 19-28Dζ transduced T cells further showed that 19-28Dζ-expressing T cells show superior cancer cell killing (Fig.19C). The selectivity and sensitivity of 19-28ζ and 19-28Dζ CAR was determined by IFN-γ secretion in response to increasing doses of immobilized anti-CAR antibody. Unlike 19-28ζ CAR T cells which constitutively produced relatively high-level IFN-γ, 19-28Dζ CAR T cells did not produce any IFN-γ in the absence of antibody-mediated CAR activation, indicating their higher selectivity (Fig.20A). Compared to 19-28Dζ CAR T cells, 19-28ζ CAR T cells produced more IFN-γ in response to higher doses of anti-CAR, which was due to their higher CAR expression ratio (Fig.19A). However, maximal level of IFN-γ production by 19-28Dζ CAR T cells was achieved with 10-fold lower doses of anti-CAR compared to 19-28ζ. What’s more, 19- 28Dζ CAR T cells were superior to 19-28ζ in response to suboptimal CAR stimulation, indicating their higher antigen sensitivity (Fig.20B). Conclusions These results demonstrate that different means of targeting NKR system, including its receptors and signaling, improve sensitivity and selectivity of cancer therapies. Attorney Docket Number 11390-016WO1 Additional NKR transduction of TCR-transduced CTLs allows them to selectively kill low-TAA-expressing cancer cells, without affecting bystander cells, indicating the feasibility of using such new class of dual-targeting T cells in adoptive cell therapy of cancer. The prototype DNAM-1 / CD28 dual-costimulation CAR showed lower CAR expression but enhanced selectivity and antigen sensitivity compared to the conventional CD28-based second generation CAR, showing its ability to improve CAR T therapy. The modulation of DNAM-1 domain motifs further enhances the function of DNAM-1 / CD28 dual-costimulation CAR.

[0002] Attorney Docket Number 11390-016WO1 REFERENCES A. Dobin, C. A. Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson, T. R. Gingeras, STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013). A. Paschen, A. Sucker, B. Hill, I. Moll, M. Zapatka, X. D. Nguyen, G. C. Sim, I. Gutmann, J. Hassel, J. C. Becker, A. Steinle, D. Schadendorf, S. Ugurel, Differential clinical significance of individual NKG2D ligands in melanoma: soluble ULBP2 as an indicator of poor prognosis superior to S100B. Clin Cancer Res 15, 5208-5215 (2009). A. Pievani, G. Borleri, D. Pende, L. Moretta, A. Rambaldi, J. Golay, M. Introna, Dual-functional capability of CD3+CD56+ CIK cells, a T-cell subset that acquires NK function and retains TCR- mediated specific cytotoxicity. Blood 118, 3301-3310 (2011). A. Shibuya, D. Campbell, C. Hannum, H. Yssel, K. Franz-Bacon, T. McClanahan, T. Kitamura, J. Nicholl, G. R. Sutherland, L. L. Lanier, J. H. Phillips, DNAM-1, a novel adhesion molecule involved in the cytolytic function of T lymphocytes. Immunity 4, 573-581 (1996). A. Soriani, A. Zingoni, C. Cerboni, M. L. Iannitto, M. R. Ricciardi, V. Di Gialleonardo, M. Cippitelli, C. Fionda, M. T. Petrucci, A. Guarini, R. Foa, A. Santoni, ATM-ATR-dependent up- regulation of DNAM-1 and NKG2D ligands on multiple myeloma cells by therapeutic agents results in enhanced NK-cell susceptibility and is associated with a senescent phenotype. Blood 113, 3503-3511 (2009). B. C. Creelan, C. Wang, J. K. Teer, E. M. Toloza, J. Yao, S. Kim, A. M. Landin, J. E. Mullinax, J. J. Saller, A. N. Saltos, D. R. Noyes, L. B. Montoya, W. Curry, S. A. Pilon-Thomas, A. A. Chiappori, T. Tanvetyanon, F. J. Kaye, Z. J. Thompson, S. J. Yoder, B. Fang, J. M. Koomen, A. A. Sarnaik, D. T. Chen, J. R. Conejo-Garcia, E. B. Haura, S. J. Antonia, Tumor-infiltrating lymphocyte treatment for anti-PD-1-resistant metastatic lung cancer: a phase 1 trial. Nat Med 27, 1410-1418 (2021). B. Meresse, Z. Chen, C. Ciszewski, M. Tretiakova, G. Bhagat, T. N. Krausz, D. H. Raulet, L. L. Lanier, V. Groh, T. Spies, E. C. Ebert, P. H. Green, B. Jabri, Coordinated induction by IL15 of a TCR-independent NKG2D signaling pathway converts CTL into lymphokine-activated killer cells in celiac disease. Immunity 21, 357-366 (2004). Attorney Docket Number 11390-016WO1 C. Cerboni, C. Fionda, A. Soriani, A. Zingoni, M. Doria, M. Cippitelli, A. Santoni, The DNA Damage Response: A Common Pathway in the Regulation of NKG2D and DNAM-1 Ligand Expression in Normal, Infected, and Cancer Cells. Front Immunol 4, 508 (2014). C. R. Good, M. A. Aznar, S. Kuramitsu, P. Samareh, S. Agarwal, G. Donahue, K. Ishiyama, N. Wellhausen, A. K. Rennels, Y. Ma, L. Tian, S. Guedan, K. A. Alexander, Z. Zhang, P. C. Rommel, N. Singh, K. M. Glastad, M. W. Richardson, K. Watanabe, J. L. Tanyi, M. H. O'Hara, M. Ruella, S. F. Lacey, E. K. Moon, S. J. Schuster, S. M. Albelda, L. L. Lanier, R. M. Young, S. L. Berger, C. H. June, An NK-like CAR T cell transition in CAR T cell dysfunction. Cell 184, 6081-6100 e6026 (2021). D. H. Raulet, S. Gasser, B. G. Gowen, W. Deng, H. Jung, Regulation of ligands for the NKG2D activating receptor. Annu Rev Immunol 31, 413-441 (2013). D. Salas-Benito, J. L. Perez-Gracia, M. Ponz-Sarvise, M. E. Rodriguez-Ruiz, I. Martinez-Forero, E. Castanon, J. M. Lopez-Picazo, M. F. Sanmamed, I. Melero, Paradigms on Immunotherapy Combinations with Chemotherapy. Cancer Discov 11, 1353-1367 (2021). E. Katsuta, L. Yan, M. Opyrchal, P. Kalinski, K. Takabe, Cytotoxic T-lymphocyte infiltration and chemokine predict long-term patient survival independently of tumor mutational burden in triple-negative breast cancer. Ther Adv Med Oncol 13, 17588359211006680 (2021). E. Y. Chiang, I. Mellman, TIGIT-CD226-PVR axis: advancing immune checkpoint blockade for cancer immunotherapy. J Immunother Cancer 10, (2022). G. Dolton, C. Rius, A. Wall, B. Szomolay, V. Bianchi, S. A. E. Galloway, M. S. Hasan, T. Morin, M. E. Caillaud, H. L. Thomas, S. Theaker, L. R. Tan, A. Fuller, K. Topley, M. Legut, M. Attaf, J. R. Hopkins, E. Behiry, J. Zabkiewicz, C. Alvares, A. Lloyd, A. Rogers, P. Henley, C. Fegan, O. Ottmann, S. Man, M. D. Crowther, M. Donia, I. M. Svane, D. K. Cole, P. E. Brown, P. Rizkallah, A. K. Sewell, Targeting of multiple tumor-associated antigens by individual T cell receptors during successful cancer immunotherapy. Cell 186, 3333-3349 e3327 (2023). G. Korotkevich, V. Sukhov, N. Budin, B. Shpak, M. N. Artyomov, A. Sergushichev, Fast gene set enrichment analysis. BioRxiv, 060012 (2016). H. A. Abbas, Z. Alaniz, S. Mackay, M. Cyr, J. Zhou, G. C. Issa, M. Alfayez, J. Matthews, S. M. Kornblau, E. Jabbour, G. Garcia-Manero, M. Konopleva, M. Andreeff, N. Daver, Single-cell Attorney Docket Number 11390-016WO1 polyfunctional proteomics of CD4 cells from patients with AML predicts responses to anti-PD- 1-based therapy. Blood Adv 5, 4569-4574 (2021). H. J. Jackson, S. Rafiq, R. J. Brentjens, Driving CAR T-cells forward. Nat Rev Clin Oncol 13, 370-383 (2016). H. S. Jin, M. Ko, D. S. Choi, J. H. Kim, D. H. Lee, S. H. Kang, I. Kim, H. J. Lee, E. K. Choi, K. P. Kim, C. Yoo, Y. Park, CD226(hi)CD8(+) T Cells Are a Prerequisite for Anti-TIGIT Immunotherapy. Cancer Immunol Res 8, 912-925 (2020). J. A. Best, D. A. Blair, J. Knell, E. Yang, V. Mayya, A. Doedens, M. L. Dustin, A. W. Goldrath, C. Immunological Genome Project, Transcriptional insights into the CD8(+) T cell response to infection and memory T cell formation. Nat Immunol 14, 404-412 (2013). J. H. Esensten, Y. A. Helou, G. Chopra, A. Weiss, J. A. Bluestone, CD28 Costimulation: From Mechanism to Therapy. Immunity 44, 973-988 (2016). J. L. Upshaw, L. N. Arneson, R. A. Schoon, C. J. Dick, D. D. Billadeau, P. J. Leibson, NKG2D- mediated signaling requires a DAP10-bound Grb2-Vav1 intermediate and phosphatidylinositol- 3-kinase in human natural killer cells. Nat Immunol 7, 524-532 (2006). J. Matsuzaki, T. Tsuji, T. Chodon, C. Ryan, R. C. Koya, K. Odunsi, A rare population of tumor antigen-specific CD4(+)CD8(+) double-positive alphabeta T lymphocytes uniquely provide CD8-independent TCR genes for engineering therapeutic T cells. J Immunother Cancer 7, 7 (2019). J. Rossi, P. Paczkowski, Y. W. Shen, K. Morse, B. Flynn, A. Kaiser, C. Ng, K. Gallatin, T. Cain, R. Fan, S. Mackay, J. R. Heath, S. A. Rosenberg, J. N. Kochenderfer, J. Zhou, A. Bot, Preinfusion polyfunctional anti-CD19 chimeric antigen receptor T cells are associated with clinical outcomes in NHL. Blood 132, 804-814 (2018). K. Li, M. Mandai, J. Hamanishi, N. Matsumura, A. Suzuki, H. Yagi, K. Yamaguchi, T. Baba, S. Fujii, I. Konishi, Clinical significance of the NKG2D ligands, MICA / B and ULBP2 in ovarian cancer: high expression of ULBP2 is an indicator of poor prognosis. Cancer Immunol Immunother 58, 641-652 (2009). K. Prajapati, C. Perez, L. B. P. Rojas, B. Burke, J. A. Guevara-Patino, Functions of NKG2D in CD8(+) T cells: an opportunity for immunotherapy. Cell Mol Immunol 15, 470-479 (2018). Attorney Docket Number 11390-016WO1 L. Martinet, M. J. Smyth, Balancing natural killer cell activation through paired receptors. Nat Rev Immunol 15, 243-254 (2015). M. Braun, A. R. Aguilera, A. Sundarrajan, D. Corvino, K. Stannard, S. Krumeich, I. Das, L. G. Lima, L. G. Meza Guzman, K. Li, R. Li, N. Salim, M. V. Jorge, S. Ham, G. Kelly, F. Vari, A. Lepletier, A. Raghavendra, S. Pearson, J. Madore, S. Jacquelin, M. Effern, B. Quine, L. T. Koufariotis, M. Casey, K. Nakamura, E. Y. Seo, M. Holzel, M. Geyer, G. Kristiansen, T. Taheri, E. Ahern, B. G. M. Hughes, J. S. Wilmott, G. V. Long, R. A. Scolyer, M. D. Batstone, J. Landsberg, D. Dietrich, O. T. Pop, L. Flatz, W. C. Dougall, A. Veillette, S. E. Nicholson, A. Moller, R. J. Johnston, L. Martinet, M. J. Smyth, T. Bald, CD155 on Tumor Cells Drives Resistance to Immunotherapy by Inducing the Degradation of the Activating Receptor CD226 in CD8(+) T Cells. Immunity 53, 805-823 e815 (2020). M. I. Love, W. Huber, S. Anders, Moderated estimation of fold change and dispersion for RNA- seq data with DESeq2. Genome Biol 15, 550 (2014). M. J. Pittet, D. Valmori, P. R. Dunbar, D. E. Speiser, D. Lienard, F. Lejeune, K. Fleischhauer, V. Cerundolo, J. C. Cerottini, P. Romero, High frequencies of naive Melan-A / MART-1-specific CD8(+) T cells in a large proportion of human histocompatibility leukocyte antigen (HLA)-A2 individuals. J Exp Med 190, 705-715 (1999). M. Mounir, M. Lucchetta, T. C. Silva, C. Olsen, G. Bontempi, X. Chen, H. Noushmehr, A. Colaprico, E. Papaleo, New functionalities in the TCGAbiolinks package for the study and integration of cancer data from GDC and GTEx. PLoS Comput Biol 15, e1006701 (2019). M. R. Verneris, M. Karimi, J. Baker, A. Jayaswal, R. S. Negrin, Role of NKG2D signaling in the cytotoxicity of activated and expanded CD8+ T cells. Blood 103, 3065-3072 (2004). M. Weulersse, A. Asrir, A. C. Pichler, L. Lemaitre, M. Braun, N. Carrie, M. V. Joubert, M. Le Moine, L. Do Souto, G. Gaud, I. Das, E. Brauns, C. M. Scarlata, E. Morandi, A. Sundarrajan, M. Cuisinier, L. Buisson, S. Maheo, S. Kassem, A. Agesta, M. Peres, E. Verhoeyen, A. Martinez, J. Mazieres, L. Dupre, T. Gossye, V. Pancaldi, C. Guillerey, M. Ayyoub, A. S. Dejean, A. Saoudi, S. Goriely, H. Avet-Loiseau, T. Bald, M. J. Smyth, L. Martinet, Eomes-Dependent Loss of the Co-activating Receptor CD226 Restrains CD8(+) T Cell Anti-tumor Functions and Limits the Efficacy of Cancer Immunotherapy. Immunity 53, 824-839 e810 (2020). Attorney Docket Number 11390-016WO1 O. Acuto, F. Michel, CD28-mediated co-stimulation: a quantitative support for TCR signalling. Nat Rev Immunol 3, 939-951 (2003). P. B. Watchmaker, E. Berk, R. Muthuswamy, R. B. Mailliard, J. A. Urban, J. M. Kirkwood, P. Kalinski, Independent regulation of chemokine responsiveness and cytolytic function versus CD8+ T cell expansion by dendritic cells. J Immunol 184, 591-597 (2010). P. Bretscher, M. Cohn, A theory of self-nonself discrimination. Science 169, 1042-1049 (1970). P. G. Coulie, V. Brichard, A. Van Pel, T. Wolfel, J. Schneider, C. Traversari, S. Mattei, E. De Plaen, C. Lurquin, J. P. Szikora, J. C. Renauld, T. Boon, A new gene coding for a differentiation antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J Exp Med 180, 35-42 (1994). P. P. Lee, C. Yee, P. A. Savage, L. Fong, D. Brockstedt, J. S. Weber, D. Johnson, S. Swetter, J. Thompson, P. D. Greenberg, M. Roederer, M. M. Davis, Characterization of circulating T cells specific for tumor-associated antigens in melanoma patients. Nat Med 5, 677-685 (1999). R. B. Mailliard, A. Wankowicz-Kalinska, Q. Cai, A. Wesa, C. M. Hilkens, M. L. Kapsenberg, J. M. Kirkwood, W. J. Storkus, P. Kalinski, alpha-type-1 polarized dendritic cells: a novel immunization tool with optimized CTL-inducing activity. Cancer Res 64, 5934-5937 (2004). S. Bauer, V. Groh, J. Wu, A. Steinle, J. H. Phillips, L. L. Lanier, T. Spies, Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 285, 727-729 (1999). S. P. Haen, M. W. Loffler, H. G. Rammensee, P. Brossart, Towards new horizons: characterization, classification and implications of the tumour antigenic repertoire. Nat Rev Clin Oncol 17, 595-610 (2020). T. Horng, J. S. Bezbradica, R. Medzhitov, NKG2D signaling is coupled to the interleukin 15 receptor signaling pathway. Nat Immunol 8, 1345-1352 (2007). T. Tsuji, A. Yoneda, J. Matsuzaki, A. Miliotto, C. Ryan, R. C. Koya, K. Odunsi, Rapid Construction of Antitumor T-cell Receptor Vectors from Frozen Tumors for Engineered T-cell Therapy. Cancer Immunol Res 6, 594-604 (2018). Attorney Docket Number 11390-016WO1 T. Weiss, H. Schneider, M. Silginer, A. Steinle, M. Pruschy, B. Polic, M. Weller, P. Roth, NKG2D-Dependent Antitumor Effects of Chemotherapy and Radiotherapy against Glioblastoma. Clin Cancer Res 24, 882-895 (2018). V. Dutoit, V. Rubio-Godoy, M. A. Doucey, P. Batard, D. Lienard, D. Rimoldi, D. Speiser, P. Guillaume, J. C. Cerottini, P. Romero, D. Valmori, Functional avidity of tumor antigen-specific CTL recognition directly correlates with the stability of MHC / peptide multimer binding to TCR. J Immunol 168, 1167-1171 (2002). V. Groh, J. Wu, C. Yee, T. Spies, Tumour-derived soluble MIC ligands impair expression of NKG2D and T-cell activation. Nature 419, 734-738 (2002). V. Groh, R. Rhinehart, J. Randolph-Habecker, M. S. Topp, S. R. Riddell, T. Spies, Costimulation of CD8alphabeta T cells by NKG2D via engagement by MIC induced on virus- infected cells. Nat Immunol 2, 255-260 (2001). V. Leko, S. A. Rosenberg, Identifying and Targeting Human Tumor Antigens for T Cell-Based Immunotherapy of Solid Tumors. Cancer Cell 38, 454-472 (2020). Y. Huang, J. Zeng, T. Liu, Q. Xu, X. Song, J. Zeng, DNAM1 and 2B4 Costimulatory Domains Enhance the Cytotoxicity of Anti-GPC3 Chimeric Antigen Receptor-Modified Natural Killer Cells Against Hepatocellular Cancer Cells in vitro. Cancer Manag Res 12, 3247-3255 (2020). Y. Kawakami, S. Eliyahu, C. H. Delgado, P. F. Robbins, L. Rivoltini, S. L. Topalian, T. Miki, S. A. Rosenberg, Cloning of the gene coding for a shared human melanoma antigen recognized by autologous T cells infiltrating into tumor. Proc Natl Acad Sci U S A 91, 3515-3519 (1994). Y. Liao, G. K. Smyth, W. Shi, featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930 (2014). Z. Alteber, M. F. Kotturi, S. Whelan, S. Ganguly, E. Weyl, D. M. Pardoll, J. Hunter, E. Ophir, Therapeutic Targeting of Checkpoint Receptors within the DNAM1 Axis. Cancer Discov 11, 1040-1051 (2021). Z. Zhang, N. Wu, Y. Lu, D. Davidson, M. Colonna, A. Veillette, DNAM-1 controls NK cell activation via an ITT-like motif. J Exp Med 212, 2165-2182 (2015). Attorney Docket Number 11390-016WO1 Sequences SEQ ID NO: 1 >pDONII-CD314 / 226 (Ggt: S->G SNP)>CD314(TM)-SGSG-P2A- CD226(TM) CGAATTCCCAAACTTAAGCTTGGTACCGAGCTCGGATCTGCGGCCGCCACCatggggtggattc gtggtcggaggtctcgacacagctgggagatgagtgaatttcataattataacttggatctgaa gaagagtgatttttcaacacgatggcaaaagcaaagatgtccagtagtcaaaagcaaatgtaga gaaaatgcatctccattttttttctgctgcttcatcgctgtagccatgggaatccgtttcatta ttatggtaacaatatggagtgctgtattcctaaactcattattcaaccaagaagttcaaattcc cttgaccgaaagttactgtggcccatgtcctaaaaactggatatgttacaaaaataactgctac caattttttgatgagagtaaaaactggtatgagagccaggcttcttgtatgtctcaaaatgcca gccttctgaaagtatacagcaaagaggaccaggatttacttaaactggtgaagtcatatcattg gatgggactagtacacattccaacaaatggatcttggcagtgggaagatggctccattctctca cccaacctactaacaataattgaaatgcagaagggagactgtgcactctatgcctcgagcttta aaggctatatagaaaactgttcaactccaaatacgtacatctgcatgcaaaggactgtgAGTGG CTCCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCC atggattatcctactttacttttggctcttcttcatgtatacagagctctatgtgaagaggtgc tttggcatacatcagttccctttgccgagaacatgtctctagaatgtgtgtatccatcaatggg catcttaacacaggtggagtggttcaagatcgggacccagcaggattccatagccattttcagc cctactcatggcatggtcataaggaagccctatgctgagagggtttactttttgaattcaacga tggcttccaataacatgactcttttctttcggaatgcctctgaagatgatgttggctactattc ctgctctctttacacttacccacagggaacttggcagaaggtgatacaggtggttcagtcagat agttttgaggcagctgtgccatcaaatagccacattgtttcggaacctggaaagaatgtcacac tcacttgtcagcctcagatgacgtggcctgtgcaggcagtgaggtgggaaaagatccagccccg tcagatcgacctcttaacttactgcaacttggtccatggcagaaatttcacctccaagttccca agacaaatagtgagcaactgcagccacggaaggtggagcgtcatcgtcatccccgatgtcacag tctcagactcggggctttaccgctgctacttgcaggccagcgcaggagaaaacgaaaccttcgt gatgagattgactgtagccgagggtaaaaccgataaccaatataccctctttgtggctggaggg acagttttattgttgttgtttgttatctcaattaccaccatcattgtcattttccttaacagaa ggagaaggagagagagaagagatctatttacagagtcctgggatacacagaaggcacccaataa ctatagaagtcccatctctaccGgtcaacctaccaatcaatccatggatgatacaagagaggat atttatgtcaactatccaaccttctctcgcagaccaaagactagagtttaa SEQ ID NO: 2 CD314 atggggtggattcgtggtcggaggtctcgacacagctgggagatgagtgaatttcataattataacttggatctgaagaagagtgatttttcaa cacgatggcaaaagcaaagatgtccagtagtcaaaagcaaatgtagagaaaatgcatctccattttttttctgctgcttcatcgctgtagccat gggaatccgtttcattattatggtaacaatatggagtgctgtattcctaaactcattattcaaccaagaagttcaaattcccttgaccgaaagttac tgtggcccatgtcctaaaaactggatatgttacaaaaataactgctaccaattttttgatgagagtaaaaactggtatgagagccaggcttcttg tatgtctcaaaatgccagccttctgaaagtatacagcaaagaggaccaggatttacttaaactggtgaagtcatatcattggatgggactagta cacattccaacaaatggatcttggcagtgggaagatggctccattctctcacccaacctactaacaataattgaaatgcagaagggagactg tgcactctatgcctcgagctttaaaggctatatagaaaactgttcaactccaaatacgtacatctgcatgcaaaggactgtg SEQ ID NO: 3 SGSG-P2A Attorney Docket Number 11390-016WO1 AGTGGCTCCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGA AAACCCCGGTCCC SEQ ID NO: 4 R CD314 (TM) ccattttttttctgctgcttcatcgctgtagccatgggaatccgtttcattattatggtaaca SEQ ID NO: 5 CD226 atggattatcctactttacttttggctcttcttcatgtatacagagctctatgtgaagaggtgctttggcatacatcagttccctttgccgagaacat gtctctagaatgtgtgtatccatcaatgggcatcttaacacaggtggagtggttcaagatcgggacccagcaggattccatagccattttcag ccctactcatggcatggtcataaggaagccctatgctgagagggtttactttttgaattcaacgatggcttccaataacatgactcttttctttcg gaatgcctctgaagatgatgttggctactattcctgctctctttacacttacccacagggaacttggcagaaggtgatacaggtggttcagtca gatagttttgaggcagctgtgccatcaaatagccacattgtttcggaacctggaaagaatgtcacactcacttgtcagcctcagatgacgtgg cctgtgcaggcagtgaggtgggaaaagatccagccccgtcagatcgacctcttaacttactgcaacttggtccatggcagaaatttcacctc caagttcccaagacaaatagtgagcaactgcagccacggaaggtggagcgtcatcgtcatccccgatgtcacagtctcagactcggggct ttaccgctgctacttgcaggccagcgcaggagaaaacgaaaccttcgtgatgagattgactgtagccgagggtaaaaccgataaccaatat accctctttgtggctggagggacagttttattgttgttgtttgttatctcaattaccaccatcattgtcattttccttaacagaaggagaaggagag agagaagagatctatttacagagtcctgggatacacagaaggcacccaataactatagaagtcccatctctaccGgtcaacctaccaatca atccatggatgatacaagagaggatatttatgtcaactatccaaccttctctcgcagaccaaagactagagtttaa SEQ ID NO: 6 CD226 (TM) Ggagggacagttttattgttgttgtttgttatctcaattaccaccatcattgtcattttcctt SEQ ID NO: 7 CD226 (ICD) AACAGAAGGAGAAGGAGAGAGAGAAGAGATCTATTTACAGAGTCCTGGGATACAC AGAAGGCACCCAATAACTATAGAAGTCCCATCTCTACCAGTCAACCTACCAATCAA TCCATGGATGATACAAGAGAGGATATTTATGTCAACTATCCAACCTTCTCTCGCAGA CCAAAGACTAGAGTT SEQ ID NO: 8 NY-ESO-1157-165 SLLMWITQC SEQ ID NO: 9 MART-1 ELAGIGILTV Attorney Docket Number 11390-016WO1 SEQ ID NO: 10 Target sequences of shRNA directed against NKG2D CGGGGTCAGGGAGGTGGTG SEQ ID NO: 11 Target sequences of shRNA directed against DNAM-1 CCGGTCAACCTACCAATCAAT SEQ ID NO: 12 Part of >pDONII-CD314 / 226 (Ggt: S->G SNP)>CD314(TM)-SGSG-P2A- CD226™ GCGGCCGC

Claims

Attorney Docket Number 11390-016WO1 CLAIMS What is claimed is:

1. A genetically modified T cell comprising one or more recombinant nucleic acid sequences encoding a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9.

2. The genetically modified T cell of claim 1, wherein the NKR comprises DNAM-1 or NKG2D.

3. The genetically modified T cell of claim 1 or 2, comprising an increased level of the NKR relative to a reference control.

4. The genetically modified T cell of any one of claims 1-3, wherein the one or more recombinant nucleic acid sequences encoding the NKR comprise one or more point mutations.

5. The genetically modified T cell of any one of claims 1-4, further comprising one or more recombinant nucleic acid sequences encoding a chimeric antigen receptor (CAR) polypeptide or a transgenic T cell receptor (TCR) polypeptide.

6. The genetically modified T cell of any one of claims 1-5, wherein the CAR polypeptide comprises a single-chain variable fragment (scFV) that binds to a tumor antigen.

7. The genetically modified T cell of claim 6, wherein the scFV or the TCR polypeptide recognizes the tumor antigen.

8. The genetically modified T cell of claim 6 or 7, wherein the scFV or the TCR polypeptide are low affinity for the tumor antigen.Attorney Docket Number 11390-016WO1 9. The genetically modified T cell of any one of claims 1-8, wherein the recombinant nucleic acid sequences encoding the NKR, and the CAR polypeptides are operatively linked.

10. The genetically modified T cell of any one of claims 1-8, wherein the recombinant nucleic acid sequences encoding the NKR and the TCR polypeptide are operatively linked.

11. The genetically modified T cell of any one of claims 1-9, wherein the recombinant nucleic acid sequences encoding the NKR, and the CAR polypeptides are encoded on a vector, and wherein the nucleic acid sequences encoding the NKR, and the CAR are encoded on the same vector or different vectors.

12. The genetically modified T cell of any one of claim 1-8 and 10, wherein the recombinant nucleic acid sequences encoding the NKR and the TCR polypeptide are encoded on a vector, and wherein the nucleic acid sequences encoding the NKR and the TCR polypeptide are on the same vector or different vectors.

13. The genetically modified T cell of any one of claims 1-12, comprising a deletion of a CD28 gene or a fragment thereof.

14. The genetically modified T cell of any one of claims 1-13, wherein the T cell is a primary T cell, a T cell line, a tumor infiltrating lymphocyte, an effector T cell, a memory T cell, a TEMRA, or a stem cell-like memory T cell.

15. A method of treating cancer in a subject in need, comprising administering to the subject a therapeutically effective amount of the genetically modified T cell of any one of claims 1-14.

16. The method of claim 15, wherein the subject has previously received a treatment comprising chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof.

17. The method of claims 15 or 16, wherein the treatment enhances levels of one or more ligands of the NKR on a cancer cell from the subject.Attorney Docket Number 11390-016WO1 18. The method of claim 17, wherein the NKR is DNAM-1; and wherein one or more ligands of DNAM-1 comprise Nectin-2 or poliovirus receptor (PVR).

19. The method of claim 17, wherein the NKR is NKG2D; and wherein the one or more ligands of NKG2D comprise ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A.

20. A method of treating cancer in a subject in need, comprising a) creating a genetically modified T cell comprising one or more recombinant nucleic acid sequences encoding a natural killer (NK) cell receptor (NKR); wherein the NK cell receptor comprises a polypeptide of DNAX accessory molecule-1 (DNAM-1), NKG2D, NKp46, NKp30, NKp44, NKp80, 2B4, CD2, CD16 (FcγRIIIα), CD27, CD94 / NKG2C, SEMA4D, CRTAM, CD160, CD244, SLAMF6, SLAMF7, KLRD1, KLRD3, KLRC3, KLRC2, NCR1, NCR2, NCR3, KLRF1, FCGR3A, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DS1, TLR2, TLR3, TLR5, TLR7 / 8, or TLR9; b) determining if the genetically modified T cell has a low affinity T cell receptor for a tumor antigen; and c) administering to the subject a therapeutically effective amount of the genetically modified T cell if the T cell has a low affinity T cell receptor for a tumor antigen.

21. The method of claim 20, wherein the one or more recombinant nucleic acid sequences encoding the NKR comprise one or more point mutations.

22. The method of claim 20 or 21, wherein the T cell comprises an increased level of DNAM-1 polypeptide, NKG2D polypeptide, and / or alternative NKR polypeptide relevant to a reference control.

23. The method of any one of claims 20-22, wherein the T cell comprises one or more recombinant nucleic acid sequences encoding a chimeric antigen receptor (CAR) polypeptide or a transgenic T cell receptor (TCR) polypeptide, wherein the CAR polypeptide comprises a single-chain variable fragment (scFV) that binds to a tumor antigen.Attorney Docket Number 11390-016WO1 24. The method of any one of claims 20-23, wherein the scFV or the TCR polypeptide recognizes the tumor antigen.

25. The method of any one of claims 20-24, wherein the scFV or the TCR polypeptide are low affinity for the tumor antigen.

26. The method of any one of claims 20-25, wherein the recombinant nucleic acid sequences encoding the NKR, and the CAR polypeptides are operatively linked.

27. The method of any one of claims 20-25, wherein the recombinant nucleic acid sequences encoding the NKR and the TCR polypeptides are operatively linked.

28. The method of any one of claims 20-26, wherein the recombinant nucleic acid sequences encoding the NKR, and the CAR polypeptides are encoded on a vector, and wherein the nucleic acid sequences encoding the NKR, and the CAR are encoded on the same vector or different vectors.

29. The method of any one of claims 20-25 and 27, wherein the recombinant nucleic acid sequences encoding the NKR and the TCR polypeptide are encoded on a vector, and wherein the nucleic acid sequences encoding the NKR and the TCR polypeptide are on the same vector or different vectors.

30. The method of any one of claims 20-29, wherein the T cell comprises a deletion of a CD28 gene or a fragment thereof.

31. The method of any one of claims 20-30, wherein the T cell is a primary T cell, a T cell line, a tumor infiltrating lymphocyte, an effector T cell, a memory T cell, a TEMRA, or a stem cell-like memory T cell.

32. The method of any one of claims 20-31, further comprising treating the subject with a treatment selected from chemotherapy, radiotherapy, targeted therapy, biologic therapy, or combinations thereof prior to administration of the T cells.Attorney Docket Number 11390-016WO1 33. The method of claim 32, wherein the treatment enhances levels of one or more ligands of the NKR on a cancer cell from the subject.

34. The method of claim 33, wherein the NKR is DNAM-1; and wherein one or more ligands of DNAM-1 comprise Nectin-2 or poliovirus receptor (PVR).

35. The method of claim 34, wherein the NKR is NKG2D; and wherein the one or more ligands of NKG2D comprise ULBP1, ULBP2, ULBP3, H60, Rae-1α, Rae-1β, Rae-1δ, Rae-1γ, MICA, MICB, or HLA-A.

Images