Compositions and methods for genetically modifying cd70
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- INTELLIA THERAPEUTICS INC
- Filing Date
- 2024-08-13
- Publication Date
- 2026-06-24
AI Technical Summary
There is a need for improved methods and compositions to modify cells and overcome chronic CD70-mediated aberrant immune responses such as T-cell exhaustion, while enhancing the immune response.
The development of compositions and methods for genetically modifying the CD70 gene, including editing techniques such as inserting, deleting, or substituting nucleosides in the CD70 target sequence, to reduce or eliminate the surface expression of the CD70 protein, thereby mitigating T-cell exhaustion and enhancing immune responses.
The genetic modification of CD70 in cells results in reduced or eliminated surface expression of the CD70 protein, leading to decreased chronic CD70-mediated aberrant immune responses and enhanced immune responses, making the modified cells suitable for use in therapies such as cancer treatment and immunotherapy.
Smart Images

Figure US2024042122_20022025_PF_FP_ABST
Abstract
Description
COMPOSITIONS AND METHODS FOR GENETICALLY MODIFYING CD70I. CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 USC 119(e) of US Provisional Application No. 63 / 519,495, filed August 14, 2023, and US Provisional Application No. 63 / 610,531, filed December 15, 2023, the content of each of which is herein incorporated by reference in its entirety.II. REFERENCE TO ELECTRONIC SEQUENCE LISTING
[0002] This application contains a sequence listing, which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML file, created on August 12, 2024, is named “01155-0058-00PCT.xml” and is 3,315,072 bytes in size.III. INTRODUCTION AND SUMMARY
[0003] The present disclosure relates to CRISPR / Cas9 genome editing systems. The present disclosure particularly relates to genetic modification of the CD70 gene.
[0004] Cluster of Differentiation 70 (CD70) is a cytokine belonging to the Tumor Necrosis Factor (TNF) family (Goodwin et al., 1993). CD70 is a transmembrane protein that is typically transiently expressed on the surface of CD4+ and CD8+ T-cells, regulatory T-cells (Tregs), B cells, antigen-presenting cells such as dendritic cells, and natural killer (NK) cells in response to immune activation.
[0005] CD70 is the known ligand for the TNF receptor superfamily protein CD27. Upon binding to CD27, CD70 triggers an intracellular signaling cascade culminating in a diverse array of outcomes, including T-cell expansion and B-cell differentiation. While transient CD70 expression plays a key role in promoting a normal immune response, chronic CD70 expression has been implicated in T-cell exhaustion, a broad term that has been used to describe the response of T cells to chronic antigen stimulation (van Gisbergen et al. 2009; Yang et al. 2014). This was first observed in the setting of chronic viral infection but has also been studied in the immune response to tumors. The features and characteristics of the T-cell exhaustion mechanism may have crucial implications for the success of checkpoint blockade and adoptive T-cell transfer therapies.
[0006] Thus, there exists a need for improved methods and compositions for modifying cells to overcome the problem of chronic CD70-mediated aberrant immune responses such as T-cell exhaustion and to further enhance the immune response.
[0007] Provided herein are compounds, compositions, systems, and methods for genetically modifying CD70. For example, provided are compositions and methods for editing (e.g., inserting, deleting, or substituting nucleosides) a CD70 target sequence. Also encompassed are cells with genetic modifications in CD70. Also provided are methods of promoting an immune response and treating cancer and infectious disease using the provided compositions.
[0008] The present disclosure relates to populations of cells including cells with a genetic modification in the CD70 sequence as provided herein. The cells may be used in adoptive T cell transfer therapies.
[0009] The present disclosure relates to compositions and uses of the cells with genetic modification of the CD70 sequence for use in therapy, e.g., cancer therapy and immunotherapy. The present disclosure relates to and provides gRNA molecules, CRISPR systems, cells, and methods useful for genome editing of cells.
[0010] Provided herein is an engineered cell comprising a genetic modification in a CD70 sequence, within the genomic coordinates of chrl9:6586002-6591015.
[0011] In some embodiments, the disclosure provides engineered cells with reduced or eliminated surface expression of CD70 protein as a result of a genetic modification in the CD70 gene. The engineered cell compositions produced by the methods disclosed herein have desirable properties, including e.g., reduced or eliminated expression of CD70 protein, reduced chronic CD70-mediated aberrant immune responses such as T-cell exhaustion, thereby enhanced immune responses.
[0012] Also disclosed is the use of a composition or formulation of a cell of any of the foregoing embodiments for the preparation of a medicament for treating a subject. The subject may be a human or animal (e.g., human or non-human animal, e.g., cynomolgus monkey). Preferably, the subject is human.
[0013] Also disclosed are any of the foregoing compositions or formulations for use in producing a genetic modification (e.g., an insertion, a substitution, or a deletion) a CD70 gene sequence. In certain embodiments, the genetic modification within the sequence results in a change in the nucleic acid sequence that prevents translation of a full-length protein prior to genetic modification of the genomic locus, e.g., by forming a frameshift or nonsense mutation, such that translation is terminated prematurely. The genetic modification can include insertion, substitution, or deletion at a splice site, i.e., a splice acceptor site or a splicedonor site, such that the abnormal splicing results in a frameshift mutation, nonsense mutation, or truncated mRNA, such that translation is terminated prematurely. Genetic modifications can also disrupt translation or folding of the encoded protein resulting in premature translation termination.
[0014] In another aspect, the present disclosure provides a method of treating a subject that includes administering cells (e.g., a population of cells) prepared by a method of preparing cells described herein, for example, a method of any of the aforementioned aspects and embodiments of methods of preparing cells.
[0015] Also disclosed are any of the foregoing compositions or formulations for use in producing a genetic modification (e.g., an insertion, a substitution, or a deletion) in a CD70 sequence. In certain embodiments, the genetic modification within the sequence results in a change in the nucleic acid sequence that prevents translation of a full-length protein prior to genetic modification of the genomic locus, e.g., by forming a frameshift or nonsense mutation, such that translation is terminated prematurely. The genetic modification can include insertion, substitution, or deletion at a splice site, i.e., a splice acceptor site or a splice donor site, such that the abnormal splicing results in a frameshift mutation, nonsense mutation, or truncated mRNA, such that translation is terminated prematurely. Genetic modifications can also disrupt translation or folding of the encoded protein resulting in premature translation termination.
[0016] In another aspect, the present disclosure provides a method of providing an enhanced immunotherapy to a subject, the method including administering to the subject an effective amount of cells as described herein, for example, a cell of any of the aforementioned cell aspects and embodiments.
[0017] In some embodiments, the present disclosure provides an engineered cell, comprising a genetic modification within genomic coordinates chrl9:6586002-6591015. In some embodiments, the present disclosure provides an engineered cell, which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification within genomic coordinates chrl9:6586002-6591015.
[0018] In some embodiments, the engineered cell comprises a genetic modification within any one of the genomic coordinates listed in Table 2 A. In some embodiments, the genetic modification is within the genomic coordinates targeted by a CD70 guide RNA comprising a guide sequence of any one of SEQ ID NOs: 1-38.
[0019] In some embodiments, the engineered cell comprises a genetic modification within any one of the genomic coordinates listed in Table 3 A. In some embodiments, the geneticmodification is within the genomic coordinates targeted by a CD70 guide RNA comprising a guide sequence of any one of SEQ ID NOs: 101-169.
[0020] Further embodiments are provided throughout and described in the claims and Figures.IV. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 shows the mean % indels and mean percentage of CD70 negative cells following editing.
[0022] FIGs. 2A-2C show the mean % indels following editing of the CD70 gene.
[0023] FIG. 3 shows the mean % editing and mean percentage of CD70 negative T cells following editing.
[0024] FIG. 4A shows the mean % editing and mean percentage of stop codons created following editing.
[0025] FIG. 4B shows the mean percentage of CD70 negative T cells following editing.
[0026] FIGs. 5A-5D show the impact of double (DKO) versus a single (SKO) IEE (immune enhancing edit) knockout with either construct 5719, construct 5718, or a construct 4645 against a 786-0 tumor cell line measured by the percent of viable tumor cells remaining. Unedited cells were used as a control. Constructs 5719 and 5718 were tested alone, with CD70 SKO, and with CD70 + TGFPR2 DKO. FIG. 5A shows the percent tumor cell viability for construct 5719 without the presence of TGFP and FIG. 5B shows the results for construct 5719 in the presence of TGFp. FIG. 5C shows the percent tumor cell viability for construct 5718 without the presence of TGFP and FIG. 5D shows the results for construct 5718 in the presence of TGFp.
[0027] FIGs. 6A-D show the in-vitro rechallenge of four CD70 constructs alone, with a SKO, or with DKO IEE edits against a 768-0 tumor cell line, measured by tumor cell area (mm2). The constructs were compared to benchmark construct 4645 and TRAC KO alone. FIG. 6A shows the results for construct 5719, FIG. 6B shows the results for construct 5281, FIG. 6C shows the results for construct 5715, and FIG. 6D shows the results for construct 6115.
[0028] FIGs. 7A-7D show the in-vitro rechallenge of four CD70 constructs alone, with a SKO, or with DKO IEE edits against an ACHN tumor cell line, measured by tumor cell area (mm2). The constructs were compared to benchmark construct 4645 and TRAC KO alone. FIG. 7A shows the results for construct 5719, FIG. 7B shows the results for construct 5281,FIG. 7C shows the results for construct 5715, and FIG. 7D shows the results for construct 6115.
[0029] FIGs. 8A-8C show the efficacy of three CD70 CAR constructs alone, with a SKO, or with DKO IEE edits in a 786-0 mouse tumor cell model against benchmark construct 4645, measured by tumor volume (mm3). FIG. 8A shows the results for construct 5719, FIG. 8B shows the results for construct 5715, and FIG. 8C shows the results for construct 5281.
[0030] FIG. 9A-9D show the rechallenge results measured by tumor volume (mm3) for the CD70 CAR constructs with either SKO or DKO IEE edits that fully controlled tumor growth in FIGs. 8A-8C. Constructs were compared to mice with tumor only. FIG. 9A shows the rechallenge results for construct 5719 + CD70 KO. FIG. 9B shows the rechallenge results for construct 5715 + CD70 + TGFPR2 DKO. FIG. 9C shows the rechallenge results for construct 5281 + CD70 + TGFPR2 DKO. FIG. 9D shows the rechallenge results for construct 5719 + CD70 + TGFPR2 DKO.
[0031] FIG. 10 shows percentage of editing for each edit of the allogeneic edited CD70 CAR-T cells across three donors as assessed by flow cytometry or by genomic sequencing (results from each donor are shown in solid dots).
[0032] FIGs. 11A-11C show the percent of CAR T cells that present specified activation markers. FIG. 11A shows the percent of CAR T cells positive for CD69, FIG. 11B shows the percent of CAR T cells positive for CD107a, and FIG. 11C shows the percent of CAR T cells positive for CD25.
[0033] FIGs. 12A-12B show the re-challenge results measured by number of tumor cells with three different lots of CAR-T cells against a high CD70 and a medium CD70 expressing tumor cell line. FIG. 12A shows the re-challenge results for T cells challenged against the 786-0 tumor cell line and FIG. 12B shows the re-challenge results for T cells challenged against the ACHN tumor cell line.
[0034] FIG. 13 shows the efficacy as measured by tumor volume (mm3) of two different lots of T cells at three different doses (10e6, 3e6, le6) against 786-0 tumor cells over the course of 115 days.
[0035] FIG. 14 shows the efficacy as measured by tumor volume (mm3) of engineered T cells against 11 different PDX tumor models over the course of 42 days.
[0036] FIG. 15 shows karyotyping data comparing edited cells with donor matched unedited controls. 200 cell spreads were analyzed for each sample (N = 3 donors). Statistical analysis was performed for each indicated aberration on a donor wise basis using Fisher’sExact Test. * denotes p < 0.05 for any donor set. Bars represent mean + / - SD from three matched donors (dots).
[0037] FIGs. 16A-16B show the average percent of engineered donor T cell killing (either all donors of B2M CD70-CAR T cell group or all donors of Allo CD70-CAR T cell group) by host NK cells as normalized to a CAR alone group following treatment with genotypically mismatched or HLA-C-matched host NK cells. FIG. 16A shows the results for a genotypically mismatched system and FIG. 16B shows the results for a HLA-C-matched system.
[0038] FIGs. 17A-17C show the average percent proliferation of engineered donor T cells (either all donors of CAR alone group (solid circles) or all donors of allo CD70 CAR T cell group (solid squares)) as compared to a normalized value following treatment with genotypically mismatched or C-matched host PBMC. FIG. 17A shows the results for a genotypically mismatched system and FIG. 17B shows the results for a C-matched system. FIG. 17C shows the average percent proliferation of engineered donor T cells in the presence of autologous PBMCs.V. DETAILED DESCRIPTION
[0039] Reference will now be made in detail to certain embodiments of the disclosure, examples of which are illustrated in the accompanying drawings. While the present teachings are described in conjunction with various embodiments, it is not intended to limit the present teachings to those embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
[0040] The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined in this specification or any other express content of this specification, this specification controls.
[0041] Provided herein are the following numbered embodiments:
[0042] Embodiment 1 is an engineered cell, comprising a genetic modification within genomic coordinates chr 19:6586002- 6591015.
[0043] Embodiment 2 is an engineered cell, which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification within genomic coordinates chrl9:6586002-6591015.
[0044] Embodiment 3 is the engineered cell of embodiment 1 or 2, wherein the genetic modification is within the genomic coordinates targeted by a CD70 guide RNA comprising a guide sequence of any one of SEQ ID NOs: 1-38.
[0045] Embodiment 4 is the engineered cell of any one of embodiments 1-3, which has reduced or eliminated surface expression of CD70 relative to an unmodified cell, comprising a genetic modification within any one of the genomic coordinates listed in Table 2A.
[0046] Embodiment 5 is the engineered cell of any one of embodiments 1-4, wherein the genetic modification is within genomic coordinates chosen from: chrl9:6590121-6590145; chrl9:6586002-6586026; chrl9:6586003-6586027; chrl9:6586013-6586037; chrl9:6586357-6586381; chrl9:6586365-6586389; chrl9:6586376-6586400; chrl9:6590988-6591012; chrl9:6590991-6591015; chrl9:6590862-6590886; chrl9:6586396-6586420; chr 19:6586372-6586396; chr 19:6586371-6586395; chrl9:6586360-6586384; chrl9:6586355-6586379; chrl9:6586268-6586292; chrl9:6586259-6586283; chrl9:6586256-6586280; chrl9:6586142-6586166; chrl9:6586141-6586165; chrl9:6586135-6586159; chrl9:6586128-6586152; chrl9:6586127-6586151; chrl9:6586126-6586150; chrl9:6586121-6586145; chrl9:6586120-6586144; chrl9:6586096-6586120; chrl9:6586055-6586079; chrl9:6586029-6586053; chrl9:6586023-6586047; chr 19:6586312-6586336; chrl9:6586151-6586175; chrl9:6586145-6586169; chrl9:6586100-6586124; chrl9:6586030-6586054; chrl9:6586028-6586052; chrl9:6586395-6586419; and chrl9:6586394-6586418.
[0047] Embodiment 6 is the engineered cell of any one of embodiments 1-5, wherein the genetic modification is within the genomic coordinates chosen from: chrl9:6590121- 6590145 and chrl9:6586268-6586292.
[0048] Embodiment 7 is the engineered cell of any one of embodiments 1-6, wherein the genetic modification is within genomic coordinates targeted by a guide RNA comprising a guide sequence of SEQ ID NO: 1 or 16.
[0049] Embodiment 8 is the engineered cell of embodiment 1 or 2, wherein the genetic modification is within the genomic coordinates targeted by a guide RNA comprising a guide sequence of any one of SEQ ID NOs: 101-169.
[0050] Embodiment 9 is the engineered cell of any one of embodiments 1, 2, and 8, which has reduced or eliminated surface expression of CD70 relative to an unmodified cell, comprising a genetic modification within any one of the genomic coordinates listed in Table 3A.
[0051] Embodiment 10 is the engineered cell of any one of embodiments 1, 2, 8, and 9, wherein the genetic modification is within genomic coordinates chosen from: (a) chrl9:6590998-6591018; chrl9:6590995-6591015; chrl9:6590992-6591012; chrl9:6590991-6591011; chrl9:6590987-6591007; chrl9:6590986-6591006; chrl9:6590985-6591005; chrl9:6590977-6590997; chrl9:6590972-6590992; chrl9:6590966-6590986; chrl9:6590958-6590978; chrl9:6590957-6590977; chrl9:6590945-6590965; chrl9:6590944-6590964; chrl9:6590940-6590960; chrl9:6590939-6590959; chrl9:6590935-6590955; chrl9:6590926-6590946; chrl9:6590920-6590940; chrl9:6590919-6590939; chrl9:6590914-6590934; chrl9:6590908-6590928; chrl9:6590907-6590927; chrl9:6590899-6590919; chrl9:6590875-6590895; chrl9:6590866-6590886; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6586374-6586394; chrl9:6586368-6586388; chrl9:6586288-6586308; chrl9:6586285-6586305; chrl9:6586276-6586296; chrl9:6586267-6586287; chrl9:6586199-6586219; chrl9:6586172-6586192; chrl9:6586138-6586158; chrl9:6586099-6586119; and chrl9:6586050-6586070; and (b) chrl9:6590875-6590895; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6590835-6590855; chrl9:6590104-6590124; chrl9:6590096-6590116; chrl9:6590095-6590115; chrl9:6590094-6590114; chrl9:6590093-6590113; chrl9:6590087-6590107; chrl9:6590084-6590104; chrl9:6590083-6590103; chrl9:6590078-6590098; chrl9:6586368-6586388; chrl9:6586299-6586319; chrl9:6586267-6586287; chrl9:6590842-6590862; chrl9:6590139-6590159; chrl9:6590138-6590158; chrl9:6590135-6590155; chrl9:6590079-6590099; chrl9:6590077-6590097; chrl9:6586412-6586432; chrl9:6586404-6586424; chrl9:6586403-6586423; chrl9:6586396-6586416; chrl9:6586396-6586416; chrl9:6586395-6586415; chrl9:6586388-6586408; chrl9:6586380-6586400; chrl9:6586379-6586399; chrl9:6586375-6586395; chrl9:6586369-6586389; chrl9:6586367-6586387; chrl9:6586360-6586380; chrl9:6586359-6586379; chrl9:6586120-6586140; and chrl9:6586028-6586048.
[0052] Embodiment 11 is the engineered cell of any one of embodiments 1, 2, and 8-10, wherein the genetic modification is within genomic coordinates targeted by a guide RNA comprising a guide sequence of any one of SEQ ID NOs: 101, 104, 109, 115, 116, and 123.
[0053] Embodiment 12 is the engineered cell of any one of embodiments 1, 2, and 8-11, wherein the genetic modification is within the genomic coordinates chosen from:chrl9:6590998-6591018; chrl9:6590991-6591011; chrl9:6590939-6590959; chrl9:6590972-6590992; chrl9:6590940-6590960; and chrl9:6590907-6590927.
[0054] Embodiment 13 is the engineered cell of any one of embodiments 1, 2, and 8-10, wherein the genetic modification is within genomic coordinates targeted by a guide RNA comprising a guide sequence of any one of SEQ ID NOs: 125, 157, 160, 162, 164, and 168.
[0055] Embodiment 14 is the engineered cell of any one of embodiments 1, 2, 8-10, and 13, wherein the genetic modification is within the genomic coordinates chosen from: chrl9:6590875-6590895; chrl9:6586396-6586416; chrl9:6586388-6586408; chrl9:6586379-6586399; chrl9:6586369-6586389; and chrl9:6586120-6586140.
[0056] Embodiment 15 is a composition comprising a guide RNA and optionally an RNA- guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent, wherein the guide RNA comprises a. a guide sequence selected from SEQ ID NOs: 1-38; b. a guide sequence that is at least 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-38; c. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from SEQ ID NOs: 1-38; d. a sequence that comprises 10 contiguous nucleotides ±10 nucleotides of a genomic coordinate listed in Table 2A; e. at least 20, 21, 22, 23, or 24, contiguous nucleotides of a sequence from (d); or f. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from (d).
[0057] Embodiment 16 is a composition comprising a guide RNA and optionally an RNA- guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 101-169; b. a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 101-169; c. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from SEQ ID NOs: 101-169; d. a sequence that comprises 10 contiguous nucleotides ±10 nucleotides of a genomic coordinate listed in Table 3A; e. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (d); or f. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from (d).
[0058] Embodiment 17 is the composition of embodiment 15 or 16, for use in altering a DNA sequence within the CD70 gene in a cell.
[0059] Embodiment 18 is a pharmaceutical composition comprising, or use of, the composition of embodiment 15 or 16 for inducing a double stranded break or a single stranded break within the CD70 gene in a cell, modifying the nucleic acid sequence of the CD70 gene in a cell, or reducing expression of the CD70 gene in a cell.
[0060] Embodiment 19 is a method of making an engineered human cell, which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising contacting a cell with the composition of embodiment 15 or 16.
[0061] Embodiment 20 is a method of reducing surface expression of CD70 protein in a cell relative to an unmodified cell, comprising contacting a cell with a composition comprising a guide RNA and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent, wherein the guide RNA comprises a. a guide sequence selected from SEQ ID NOs: 1-38; b. a guide sequence that is at least 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-38; c. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from SEQ ID NOs: 1-38; d. a sequence that comprises 10 contiguous nucleotides ±10 nucleotides of a genomic coordinate listed in Table 2A; e. at least 20, 21, 22, 23, or 24, or 25 contiguous nucleotides of a sequence from (d); or f. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from (d).
[0062] Embodiment 21 is the composition, use, or method of any one of embodiments 15 and 17-20, wherein the guide RNA comprises a guide sequence of SEQ ID NO: 1 or 16.
[0063] Embodiment 22 is a method of reducing surface expression of CD70 protein in a cell relative to an unmodified cell, comprising contacting a cell with a composition comprising a guide RNA and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 101-169; b. a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 101-169; c. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from SEQ ID NOs: 101-169; d. a sequence that comprises 10 contiguous nucleotides ±10 nucleotides of a genomic coordinate listed in Table 3A; e. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (d); or f. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from (d).
[0064] Embodiment 23 is the composition, use, or method of any one of embodiments 16- 19 and 22, wherein the guide RNA comprises a guide sequence of any one of SEQ ID NO: 101, 104, 109, 115, 116, and 123.
[0065] Embodiment 24 is the composition, use, or method of any one of embodiments 15- 23, wherein the RNA-guided DNA binding agent is a cleavase.
[0066] Embodiment 25 is the composition, use, or method of any one of embodiments 16- 19, 22, and 24, wherein the guide RNA comprises a guide sequence of any one of SEQ ID NO: 125, 157, 160, 162, 164, and 168.
[0067] Embodiment 26 is the composition, use, or method of any one of embodiments 15-25, wherein the RNA-guided DNA binding agent is a base editor.
[0068] Embodiment 27 is a population of cells comprising the engineered cell of any one of embodiments 1-14 or comprising the engineered cell produced by use of the composition of any one of embodiments 15-18, 21, and 23-26, or the method of any one of embodiments 19-26.
[0069] Embodiment 28 is a pharmaceutical composition comprising (a) the engineered cell of any one of embodiments 1-14 or the engineered cell produced by the composition or method of any one of embodiments 15-26; or (b) the population of cells of embodiment 27.
[0070] Embodiment 29 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-28, wherein the genetic modification comprises at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates.
[0071] Embodiment 30 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-29, wherein the genetic modification comprises at least 5, 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates.
[0072] Embodiment 31 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-30, wherein the genetic modification comprises an insertion, a deletion, or a substitution.
[0073] Embodiment 32 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-31, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates.
[0074] Embodiment 33 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-32, wherein the genetic modification comprises an indel.
[0075] Embodiment 34 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-33, wherein the genetic modification comprises an insertion of a heterologous coding sequence.
[0076] Embodiment 35 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-34, wherein the genetic modification comprises a substitution.
[0077] Embodiment 36 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-35, wherein the genetic modification comprises an A to G substitution.
[0078] Embodiment 37 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-36, wherein the genetic modification comprises a C to T substitution.
[0079] Embodiment 38 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-37, wherein the cells are engineered with a genomic editing system.
[0080] Embodiment 39 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 38, wherein the genomic editing system comprises an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
[0081] Embodiment 40 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 39, wherein the nucleic acid encoding the RNA- guided DNA binding agent comprises an mRNA comprising an open reading frame (ORF) encoding the RNA-guided DNA binding agent.
[0082] Embodiment 41 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 39 or 40, wherein the RNA-guided DNA-binding agent or the RNA-guided DNA-binding agent encoded by the nucleic acid comprises a Cas9 nuclease.
[0083] Embodiment 42 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 39-41, wherein the RNA-guided DNA binding agent is a nuclease.
[0084] Embodiment 43 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 39-42, wherein the RNA-guided DNA binding agent is a Cas9 nuclease.
[0085] Embodiment 44 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 43, wherein the Cas9 is S. pyogenes Cas9.
[0086] Embodiment 45 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 44, wherein the S. pyogenes Cas9 comprises anamino acid sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 853-857 or an ORF encoding a S. pyogenes Cas9 having at least 90% identity to a sequence selected from SEQ ID NOs: 853-857.
[0087] Embodiment 46 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 45, wherein the ORF encoding the amino acid sequence has at least 85% identity to a sequence selected from SEQ ID NOs: 813, 814, and 816-819.
[0088] Embodiment 47 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 43, wherein the Cas9 is N. meningitidis Cas9 (NmeCas9).
[0089] Embodiment 48 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 47, wherein the NmeCas9 comprises an amino acid sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 832-834 or an ORF encoding an NmeCas9 having at least 90% identity to a sequence selected from SEQ ID NOs: 832-834.
[0090] Embodiment 49 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 48, wherein the ORF encoding the amino acid sequence has at least 85% identity to a sequence selected from SEQ ID NOs: 802, 803, and 805-807.
[0091] Embodiment 50 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 41-49, wherein the nuclease has double stranded endonuclease activity.
[0092] Embodiment 51 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 41-49, wherein the nuclease has nickase activity.
[0093] Embodiment 52 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 41-49, wherein the nuclease is catalytically inactive.
[0094] Embodiment 53 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 41-52, wherein the nuclease further comprises a heterologous functional domain.
[0095] Embodiment 54 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 53, wherein the nuclease is a nickase and the heterologous functional domain is a deaminase.
[0096] Embodiment 55 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 54, wherein the deaminase is a cytidine deaminase or an adenine deaminase.
[0097] Embodiment 56 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 55, wherein the deaminase is a cytidine deaminase.
[0098] Embodiment 57 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 56, wherein the deaminase is an apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.
[0099] Embodiment 58 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 54-57, wherein the nuclease and the deaminase comprise an amino acid sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 831, 835-838, 851, 852, and 858 or an ORF encoding an amino acid sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 831, 835-838, 851, 852, and 858.
[0100] Embodiment 59 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 58, wherein the ORF encoding the amino acid sequence has at least 85% identity to a sequence selected from SEQ ID NOs: 801, 804, 811, 812, and 815.
[0101] Embodiment 60 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 56-59, further comprising a uracil glycosylase inhibitor (UGI) or nucleic acid encoding a UGI, wherein the nuclease does not comprise a UGI or the nucleic acid encoding the nuclease does not encode a UGI.
[0102] Embodiment 61 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 60, wherein the UGI comprises an amino acid sequence having at least 90% identity to SEQ ID NO: 859 or an ORF encoding an amino acid sequence having at least 90% identity to the sequence of SEQ ID NO: 859.
[0103] Embodiment 62 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 61, wherein the ORF encoding the amino acid sequence has at least 85% identity to any one of SEQ ID NOs: 823-826, optionally SEQ ID NO: 823.
[0104] Embodiment 63 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 40-62, wherein the ORF is a modified ORF.
[0105] Embodiment 64 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 41-63, wherein the nuclease has nickase activity.
[0106] Embodiment 65 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 41-64, wherein the nuclease or the nuclease encoded by the nucleic acid comprises N. meningitidis Cas9 (NmeCas9).
[0107] Embodiment 66 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 65, wherein NmeCas9 comprises Nme2Cas9.
[0108] Embodiment 67 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 65 or 66, wherein the nucleic acid encoding Nme2Cas9 is an mRNA comprising a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 834.
[0109] Embodiment 68 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 58-67, wherein the nucleic acid encoding base editor comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 801.
[0110] Embodiment 69 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 41-64, wherein the Cas9 nuclease comprises S. pyogenes (Spy) Cas9.
[0111] Embodiment 70 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 69, wherein the nucleic acid encoding an RNA- guided DNA binding agent is an mRNA comprising a nucleotide sequence is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 813.
[0112] Embodiment 71 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 70, wherein the nucleic acid encoding base editor comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 98%, or 100% identical to SEQ ID NO: 811.
[0113] Embodiment 72 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 3-71, wherein the guide RNA is a dual guide RNA (dgRNA).
[0114] Embodiment 73 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 3-71, wherein the guide RNA is a single guide RNA (sgRNA).
[0115] Embodiment 74 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 73, wherein the sgRNA is a Spy sgRNA.
[0116] Embodiment 75 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 74, wherein the Spy sgRNA further comprises one or more of: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein 1. at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl- 10, or Hl-4 and Hl-9, and the hairpin 1 region optionally lacks a. any one or two of Hl-5 through Hl-8, b. one, two, or three of the following pairs of nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl-10, and Hl-4 and Hl-9, or c. 1-8 nucleotides of hairpin 1 region; or 2. the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides; and a. one or more of positions Hl-1, Hl-2, or Hl-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) or b. one or more of positions Hl-6 through Hl-10 is substituted relative to Exemplary SpyCas9 sgRNA-l(SEQ ID NO: 601); or 3. the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, Hl-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or B. a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or C. a substitution relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) at any one or more of LS6, LS7, US3, US 10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or D. an Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US 1-US 12 in the upper stem region.
[0117] Embodiment 76 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 75, wherein the guide RNA lacks 6 nucleotides in shortened hairpin 1.
[0118] Embodiment 77 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 75, wherein the guide RNA lacks 8 nucleotides in shortened hairpin 1.
[0119] Embodiment 78 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 75-77, wherein H-l and H-3 are deleted.
[0120] Embodiment 79 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 75-78, wherein the guide RNA further comprises a 3’ tail.
[0121] Embodiment 80 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 79, wherein the 3’ tail is 1-4 nucleotides in length, optionally 1 nucleotide in length.
[0122] Embodiment 81 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 75-80, wherein the guide RNA comprises an upper stem region comprising a modification to any one or more of US 1 -US 12 in the upper stem region.
[0123] Embodiment 82 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 73 or 74, wherein the sgRNA comprises a nucleotide sequence selected from the sequences in Tables 4A-5B.
[0124] Embodiment 83 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 73 or 74, wherein the guide RNA comprises a modified nucleotide sequence selected from the modified Spy guide scaffold sequences in Table 5A, wherein the modified nucleotide sequence is 3’ of the guide sequence.
[0125] Embodiment 84 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 83, wherein the guide RNA is modified according to the pattern of a nucleotide sequence selected from the modified Spy guide RNA sequences in Table 5B.
[0126] Embodiment 85 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 73-84, wherein the guide comprises a nucleotide sequence selected from the unmodified Spy guide RNA Sequences in Table 4B, wherein the N20’s are collectively a guide sequence of embodiment 3.
[0127] Embodiment 86 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 85, wherein each nucleotide of the unmodified Spy guide RNA Sequences in Tables 4A-4B is any natural or non-natural nucleotide.
[0128] Embodiment 87 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 73-86, wherein the guide RNA is modified according to a pattern selected from the modification patterns in Table 5B, wherein the (mN*)3N17 refers to the guide sequence in which the first three nucleotides comprises a 2’-0-Me modification and a phosphorothioate linkage.
[0129] Embodiment 88 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 73 or 74, comprising a sequence or modification pattern selected from SEQ ID NOs: 620, 630-641, and 658-669.
[0130] Embodiment 89 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 73 or 74, comprising a sequence or modification pattern selected from SEQ ID NOs: 641 and 669.
[0131] Embodiment 90 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 73, wherein the sgRNA is a Nme sgRNA that comprises a guide region and a conserved region.
[0132] Embodiment 91 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 90, wherein the conserved region comprises one or more of: (a) a shortened repeat / anti-repeat region, wherein the shortened repeat / anti-repeat region lacks 2-24 nucleotides relative to SEQ ID NO: 700, wherein (i) one or more of nucleotides 37-48 and 53-64 is deleted relative to SEQ ID NO: 700 and optionally one or more of nucleotides 37-64 is substituted relative to SEQ ID NO: 700; and (ii) nucleotide 36 is linked to nucleotide 65 by at least 2 nucleotides; or (b) a shortened hairpin 1 region, wherein the shortened hairpin 1 lacks 2-10 nucleotides, optionally 2-8 nucleotides relative to SEQ ID NO: 700 wherein (i) one or more of nucleotides 82-86 and 91-95 is deleted relative to SEQ ID NO: 700 and optionally one or more of positions 82-96 is substituted relative to SEQ ID NO: 700; and (ii) nucleotide 81 is linked to nucleotide 96 by at least 4 nucleotides; or (c) a shortened hairpin 2 region, wherein the shortened hairpin 2 lacks 2-18 nucleotides, optionally 2-16 nucleotides relative to SEQ ID NO: 700, wherein (i) one or more of nucleotides 113-121 and 126-134 is deleted relative to SEQ ID NO: 700 and optionally one or more of nucleotides 113-134 is substituted relative to SEQ ID NO: 700; and (ii) nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; wherein one or both nucleotides 144-145 are optionally deleted relative to SEQ ID NO: 700; optionally, wherein at least 10 nucleotides are modified nucleotides.
[0133] Embodiment 92 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 90 or 91, wherein the conserved region comprises a modified nucleotide sequence selected from the modified conserved region Nme guide RNA motifs in Table 6, and wherein the conserved region is 3’ of the guide region.
[0134] Embodiment 93 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 90-92, wherein the guide RNA comprises a nucleotide sequence selected from any one of SEQ ID NOs: 700-706, 1018,1019, and 720-732 or any other modified sequence shown in Tables 7A-7B, wherein the N’s represent the guide sequence of any one of SEQ ID NOs: 1-38.
[0135] Embodiment 94 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 93, wherein each nucleotide is any natural or nonnatural nucleotide.
[0136] Embodiment 95 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 93 or 94, wherein the guide RNA is modified according to a pattern selected from SEQ ID NOs: 720-732, wherein the N’s are collectively the guide sequence of any one of SEQ ID NO: 1-38, N, A, C, G, and U are ribonucleotides (2’-OH), “m” indicates a 2’-0-Me modification, “f” indicates a 2’-fluoro modification, and a indicates a phosphorothioate linkage between nucleotides.
[0137] Embodiment 96 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 3-95, wherein the guide RNA comprises at least one end modification.
[0138] Embodiment 97 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 96, wherein the modification comprises a 5’ end modification.
[0139] Embodiment 98 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 96 or 97, wherein the modification comprises a 3’ end modification.
[0140] Embodiment 99 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 96-98, wherein the guide RNA comprises a modification in a hairpin region.
[0141] Embodiment 100 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 99, wherein the modification in a hairpin region is also an end modification.
[0142] Embodiment 101 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 96-100, wherein the modification comprises a 2’-O-methyl (2’-0-Me) modified nucleotide.
[0143] Embodiment 102 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 96-101, wherein the modification comprises a phosphorothioate (PS) bond between nucleotides.
[0144] Embodiment 103 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 96-102, wherein the modificationcomprises a 2’-O-methyl (2’-O-Me) modified nucleotide with a phosphorothioate (PS) bond to a 3’ adjacent nucleotide.
[0145] Embodiment 104 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 96-103, wherein the modification comprises a 2 ’-fluor (2’F) modified nucleotide.
[0146] Embodiment 105 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 97-104, wherein the 5’ end modification comprises a 2’-O-methyl (2’-0-Me) modified nucleotide with a phosphorothioate (PS) bond to a 3’ adjacent nucleotide at nucleotides 1-3 of the 5’ end of the guide sequence.
[0147] Embodiment 106 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 3-105, wherein the guide RNA is associated with a lipid nanoparticle (LNP).
[0148] Embodiment 107 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 106, wherein the LNP comprises a cationic lipid, a helper lipid, a neutral lipid, a stealth lipid, or a combination of two or more thereof.
[0149] Embodiment 108 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 107, wherein the cationic lipid is (9Z,12Z)-3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z, 12Z)-octadeca-9, 12-dienoate.
[0150] Embodiment 109 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 107 or 108, wherein the helper lipid is cholesterol.
[0151] Embodiment 110 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 107-109, wherein the neutral lipid is 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC).
[0152] Embodiment 111 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 107-110, wherein the stealth lipid is 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000 (PEG2k-DMG).
[0153] Embodiment 112 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 107-111, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9, 12-dienoate, also called 3- ((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9, 12-dienoate, DSPC, cholesterol, and PEG2k-DMG.
[0154] Embodiment 113 is a pharmaceutical composition comprising the engineered cell of any one of embodiments 1-112.
[0155] Embodiment 114 is a population of cells comprising the engineered cell of any one of embodiments 1-112.
[0156] Embodiment 115 is a pharmaceutical composition comprising a population of cells, wherein the population of cells comprises a plurality of the engineered cell of any one of embodiments 1-112.
[0157] Embodiment 116 is the pharmaceutical composition of embodiment 113 or 115, further comprising a pharmaceutical excipient.
[0158] Embodiment 117 is a method of administering the engineered cell, population of cells, or pharmaceutical composition of any one of embodiments 1-116 to a subject in need thereof.
[0159] Embodiment 118 is a method of administering the engineered cell, population of cells, or pharmaceutical composition of any one of embodiments 1-116 to a subject as an adoptive cell transfer (ACT) therapy.
[0160] Embodiment 119 is a method of administering the engineered cell, population of cells, or pharmaceutical composition of any one of embodiments 1-116 to a subject as an immunotherapy.
[0161] Embodiment 120 is an engineered cell, population of cells, or pharmaceutical composition of any one of embodiments 1-116, for use as an ACT therapy.
[0162] Embodiment 121 is a method of treating a disease or disorder comprising administering the engineered cell, population of cells, or pharmaceutical composition of any one of embodiments 1-116 to a subject in need thereof.
[0163] Embodiment 122 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 3-121, wherein the guide RNA is provided to the cell in a vector.
[0164] Embodiment 123 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 15-122, wherein the nucleic acid encoding the RNA-guided DNA binding agent is provided to the cell in the same vector as the guide RNA.
[0165] Embodiment 124 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-123, wherein an exogenous nucleic acid is provided to the cell, optionally in a vector.
[0166] Embodiment 125 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 122-124, wherein the vector is a viral vector.
[0167] Embodiment 126 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 125, wherein the vector is an AAV.
[0168] Embodiment 127 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-126, wherein the genetic modification inhibits expression of the gene in which the genetic modification is present.
[0169] Embodiment 128 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-127, wherein the genetic modification inhibits expression of the CD70 gene.
[0170] Embodiment 129 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-128, wherein the engineered cell has reduced surface expression of CD70 protein relative to an unmodified cell.
[0171] Embodiment 130 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 129, wherein cell surface expression of CD70 protein is below the level of detection.
[0172] Embodiment 131 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-130, wherein the cell comprises an exogenous nucleic acid encoding a targeting receptor that is expressed on the surface of the engineered cell.
[0173] Embodiment 132 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 131, wherein the targeting receptor is a T cell receptor (TCR).
[0174] Embodiment 133 is the engineered cell, population of cells, pharmaceutical composition, or method of cell of embodiment 132, wherein the targeting receptor is a WT1 TCR.
[0175] Embodiment 134 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 131, wherein the targeting receptor is a chimeric antigen receptor (CAR).
[0176] Embodiment 135 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 134, wherein the targeting receptor is an anti-CD70 CAR.
[0177] Embodiment 136 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-135, wherein the engineered cell further comprises a genetic modification in the TGFBR2 gene.
[0178] Embodiment 137 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 136, wherein the genetic modification in the TGFBR2 gene is within the genomic coordinates chr3:30674205-30674229.
[0179] Embodiment 138 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 136 or 137, wherein the genetic modification in the TGFBR2 gene comprises at least one nucleotide within the genomic coordinates targeted by a TGFBR2 guide RNA comprising a guide sequence of SEQ ID NO: 301.
[0180] Embodiment 139 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-138, wherein the engineered cell further comprises a genetic modification in one or more of CIITA, HLA-A, HLA-B, or TRAC gene.
[0181] Embodiment 140 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-139, wherein the engineered cell further comprises a genetic modification in one or more of CIITA, HLA-A, HLA-B, TRAC, or TGFBR2 gene.
[0182] Embodiment 141 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-140, wherein the engineered cell further has reduced surface expression of one or more of MHC class II, HLA-A, HLA-B, TRAC, or TGFBR2 relative to an unmodified cell.
[0183] Embodiment 142 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-141, wherein the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915 or chr6:29942609-29942633; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246, chr6:31355221- 31355245, or chr6:31355205-31355229; iii. a genetic modification in the TRAC gene within the genomic coordinates chrl4:22547524-22547544, chrl4:22550574-22550598, or chrl4:22550544-22550568; iv. a genetic modification in the CIITA gene within the genomic coordinates chrl6: 10906643-10906667 or chrl6:10907504-10907528; or v. a combination of two or more of (i)-(iv).
[0184] Embodiment 143 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-142, wherein the engineered cellcomprises at least one genetic modification (i) within the genomic coordinates targeted by a HLA-A guide RNA comprising a guide sequence of SEQ ID NO: 403 or 404; (ii) within the genomic coordinates targeted by a HLA-B guide RNA comprising a guide sequence of SEQ ID NO: 406, 405, or 407; (iii) within the genomic coordinates targeted by an TRAC guide RNA comprising a guide sequence of SEQ ID NO: 413, 408, or 409; (iv) within the genomic coordinates targeted by a OITA guide RNA comprising a guide sequence of SEQ ID NO: 402 or 401; or (v) a combination of two or more of (i)-(iv).
[0185] Embodiment 144 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-143, wherein the engineered cell comprises a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229 or chr3: 30671941-30671961.
[0186] Embodiment 145 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-144, wherein the engineered cell comprises at least one genetic modification within the genomic coordinates targeted by a TGFBR2 guide RNA comprising a guide sequence of SEQ ID NO: 301 or 302.
[0187] Embodiment 145.1 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-145, wherein the engineered cell comprises a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, and a genetic modification in the CIITA gene.
[0188] Embodiment 145.2 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-145 and 145.1, wherein the engineered cell comprises a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, a genetic modification in the CIITA gene, and a genetic modification in the TGFBR2 gene.
[0189] Embodiment 145.3 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-145, 145.1, and 145.2, wherein the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chr 14:22547524- 22547544; and iv. a genetic modification in the CIITA gene within the genomic coordinates chrl6: 10906643-10906667.
[0190] Embodiment 145.4 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-145 and 145.1-145.3, wherein theengineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chr 14:22547524- 22547544; iv. a genetic modification in the OITA gene within the genomic coordinates chrl6:10906643-10906667; and v. a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205- 30674229.
[0191] Embodiment 145.5 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 139-145 and 145.1-145.4, wherein the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chr 14:22547524- 22547544; iv. a genetic modification in the OITA gene within the genomic coordinates chrl6:10906643-10906667; v. a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229; and vi. a genetic modification in the CD70 gene within the genomic coordinates chrl9:6590121-6590145.
[0192] Embodiment 145.6 is an engineered human cell comprising a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915, a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246, a genetic modification in the CIITA gene within the genomic coordinates chrl6: 10906643- 10906667, a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229, a genetic modification in the TRAC gene within the genomic coordinates chrl4:22547524-22547544, and a genetic modification in the CD70 gene within the genomic coordinates chrl9:6590121-6590145.
[0193] Embodiment 146 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-145 and 145.1-145.6, wherein the engineered cell is an immune cell.
[0194] Embodiment 147 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 146, wherein the engineered cell is a monocyte, macrophage, mast cell, dendritic cell, or granulocyte.
[0195] Embodiment 148 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 146, wherein the engineered cell is a lymphocyte.
[0196] Embodiment 149 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 148, wherein the engineered cell is a T cell.
[0197] Embodiment 150 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-149 and 145.1-145.6, wherein the cell is a CD4+ T cell or a CD8+T cell
[0198] Embodiment 151 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-149 and 145.1-145.6, wherein the cell is a memory T cell.
[0199] Embodiment 152 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-151 and 145.1-145.6, wherein the cell is a stem-cell memory T cell (Tscm).
[0200] Embodiment 153 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-152 and 145.1-145.6, wherein the cell is a primary cell.
[0201] Embodiment 154 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-153 and 145.1-145.6, wherein the cell is a tissue-specific primary cell.
[0202] Embodiment 155 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-154 and 145.1-145.6, wherein the cell is an activated cell.
[0203] Embodiment 156 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-154 and 145.1-145.6, wherein the cell is a non-activated cell.
[0204] Embodiment 157 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-156 and 145.1-145.6, wherein the cell is an allogeneic cell.
[0205] Embodiment 158 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-145 and 145.1-145.6, wherein the cell is a stem cell.
[0206] Embodiment 159 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-158 and 145.1-145.6, for use in administering to a subject as an adoptive cell transfer (ACT) therapy.
[0207] Embodiment 160 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-158 and 145.1-145.6, for use in treating a subject with cancer.
[0208] Embodiment 161 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-158 and 145.1-145.6, for use in treating a subject with an infectious disease.
[0209] Embodiment 162 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiments 1-158 and 145.1-145.6, for use in treating a subject with an autoimmune disease.
[0210] Embodiment 163 is the population of cells or the pharmaceutical composition of any one of embodiments 27-162, wherein the population of cells is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% CD70 negative as measured by flow cytometry.
[0211] Embodiment 164 is the population of cells or pharmaceutical composition of any one of embodiments 27-163, wherein at least 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the population of cells comprises the genetic modification in the CD70 gene, as measured by next-generation sequencing (NGS).
[0212] Embodiment 165 is an engineered cell comprising a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, a genetic modification in the CIITA gene, and / or a genetic modification in the CD70 gene, wherein the genetic modification in the HLA-A gene is within the genomic coordinates chr6:29942891-29942915; wherein the genetic modification in the HLA-B gene is within the genomic coordinates chr6:31355222-31355246; wherein the genetic modification in the TRAC gene is within the genomic coordinates chrl4:22547524-22547544; wherein the genetic modification in the CIITA gene is within the genomic coordinates chrl 6: 10906643 - 10906667; and wherein the genetic modification in the CD70 gene is within the genomic coordinates chr 19:6590121-6590145.
[0213] Embodiment 166 is an engineered cell comprising a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, a genetic modification in the CIITA gene, a genetic modification in the TGFBR2 gene, and / or a genetic modification in the CD70 gene, wherein the genetic modification in the HLA-A gene is within the genomic coordinates chr6:29942891-29942915; wherein the genetic modification in the HLA-B gene is within the genomic coordinates chr6:31355222- 31355246; wherein the genetic modification in the TRAC gene is within the genomiccoordinates chrl4:22547524-22547544; wherein the genetic modification in the OITA gene is within the genomic coordinates chrl6:10906643-10906667; wherein the genetic modification in the TGFBR2 gene is within the genomic coordinates chr3 : 30674205- 30674229; and wherein the genetic modification in the CD70 gene is within the genomic coordinates chr 19:6590121-6590145.Definitions
[0214] Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:
[0215] The term “or combinations thereof’ as used herein refers to all permutations and combinations of the listed terms preceding the term. For example, “A, B, C, or combinations thereof’ is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, ACB, CBA, BCA, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AAB, BBC, CBBA, CAB A, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
[0216] As used herein, the term “kit” refers to a packaged set of related components, such as one or more polynucleotides or compositions and one or more related materials such as delivery devices (e.g., syringes), solvents, solutions, buffers, instructions, or desiccants.
[0217] An “allogeneic” cell, as used herein, refers to a cell originating from a donor subject of the same species as a recipient subject, wherein the donor subject and recipient subject have genetic dissimilarity, e.g., genes at one or more loci that are not identical. Thus, e.g., a cell is allogeneic with respect to the subject to be administered the cell. As used herein, a cell that is removed or isolated from a donor, that will not be re-introduced into the original donor, is considered an allogeneic cell.
[0218] An “autologous” cell, as used herein, refers to a cell derived from the same subject to whom the material will later be re-introduced. Thus, e.g., a cell is considered autologous if it is removed from a subject and it will then be re-introduced into the same subject.
[0219] The term “CD70,” as used herein in the context of CD70 protein, refers to the cytokine belonging to the tumor necrosis factor (TNF) family of ligands. “CD70” as used herein in the context of nucleic acids refers to the gene encoding the CD70 protein molecule. The human gene has accession number NC_000019.10 (6581648..6591150).
[0220] As used herein, the term “within the genomic coordinates” includes the boundaries of the genomic coordinate range given. For example, if chr6:29942854- chr6:29942913 is given, the coordinates chr6:29942854-chr6:29942913 are encompassed. Throughout this application, the referenced genomic coordinates are based on genomic annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available at the National Center for Biotechnology Information website. Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates provided herein to the corresponding coordinates in another assembly of the human genome, including conversion to an earlier assembly generated by the same institution or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversion of an assembly generated by a different institution or algorithm (e.g., from GRCh38 to NCBI33, generated by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, NCBI Genome Remapping Service, available at the National Center for Biotechnology Information website, UCSC LiftOver, available at the UCSC Genome Brower website, and Assembly Converter, available at the Ensembl.org website.
[0221] “Polynucleotide” and “nucleic acid” are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof. A nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugarphosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy, 2’ halide, or a 2’-O-(2-methoxyethyl) (2’-O- moe) substitutions. An RNA may comprise one or more deoxyribose nucleotides, e.g. as modifications, and similarly a DNA may comprise one or more ribonucleotides. Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5 -methoxyuridine, pseudouridine, or N1 -methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N4-methyl deoxy guanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5-methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6- methylaminopurine, O6-methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazine-pyrimidines, and O4-alkyl-pyrimidines; US Pat. No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11thed., 1992). Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (US Pat. No. 5,585,481). A nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional nucleosides with 2’ methoxy substituents, or polymers containing both conventional nucleosides and one or more nucleoside analogs). Nucleic acid includes “locked nucleic acid” (LNA), an analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42): 13233-41). Nucleic acid includes “unlocked nucleic acid” enables the modulation of the thermodynamic stability and also provides nuclease stability. RNA and DNA have different sugar moieties and can differ by the presence of uracil or analogs thereof in RNA and thymine or analogs thereof in DNA.
[0222] “Polypeptide” as used herein refers to a multimeric compound comprising amino acid residues that can adopt a three-dimensional conformation. Polypeptides include but are not limited to enzymes, enzyme precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, antibodies, etc. Polypeptides may, but do not necessarily, comprise post- translational modifications, non-natural amino acids, prosthetic groups, and the like.
[0223] “Guide RNA,” “gRNA,” and simply “guide” are used herein interchangeably to refer to, for example, either a single guide RNA or the combination of a crRNA and a trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single RNA strand (as a single guide RNA, sgRNA) or, for example, in two separate RNA strands (dual guide RNA, dgRNA). “Guide RNA” or “gRNA” refers to each type. The trRNA may be a naturally-occurring sequence, or a trRNA sequence with modifications or variations.
[0224] As used herein, a “guide sequence” refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct a guide RNA to a target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binding agent.
[0225] In the case of Neisseria meningitides Cas9 (i.e., Nme Cas9 (NmeCas9)) and related Cas9 homologs / orthologs, a guide sequence may be 19, 20, 21, preferably 22, 23, or 24 nucleotides in length, or may be 20-25 nucleotides in length. In some embodiments, the target sequence is in a gene or on a chromosome, for example, and is complementary to the guidesequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence is at least 80%, 85%, preferably 90%, or 95%. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch, i.e., one nucleotide that is not identical or not complementary, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1-2, preferably no more than 1 mismatch, where the total length of the target sequence is 19, 20, 21, 22, preferably 23, or 24, nucleotides, or more. In some embodiments, the guide sequence and the target region may contain 1-2 mismatches where the guide sequence comprises at least 24 nucleotides, or more. In some embodiments, the guide sequence and the target region may contain 1-2 mismatches where the guide sequence comprises 24 nucleotides. That is, the guide sequence and the target region may form a duplex region having at least 2X base pairs, or more. In certain embodiments, the duplex region may include 1-2 mismatches such that guide strand and target sequence are not fully complementary. Mismatch positions are known in the art as provided in, for example, PAM distal mismatches tend to be better tolerated than PAM proximal matches. Mismatch tolerances at other positions are known in the art (see, e.g., Edraki et al., 2019. Mol. Cell, 73:1-13).
[0226] For example, Nme guide sequences can be 19, 20, 21, preferably 22, 23, or 24 nucleotides in length such that, in some embodiments, the Nme Cas9 guide sequence comprises at least 22, 23, or 24 contiguous nucleotides of a sequence provided in the Table 2A. In some embodiments, the guide sequence and the target sequence may be 100% complementary or identical. In other embodiments, the guide sequence and the target sequence may contain at least one mismatch, i.e., one nucleotide that is not identical or not complementary, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1-2, preferably no more than 1 mismatch, where the total length of the target sequence is 19, 20, 21, 22, preferably 23, or 24, nucleotides, or more. In some embodiments, the guide sequence and the target region may contain 1-2 mismatches where the guide sequence comprises at least 24 nucleotides, or more. In some embodiments, the guide sequence and the target sequence may contain 1-2 mismatches where the guide sequence comprises 24 nucleotides. That is, the guide sequence and the target sequence may form a duplex region having 24 base pairs, or more. In certain embodiments, the duplex region may include 1-2 mismatches such that guide sequence and target sequence are not fully complementary. Mismatch positions are known in the art, for example, PAM distalmismatches tend to be better tolerated than PAM proximal matches. Mismatch tolerances at other positions are known in the art (see, e.g., Edraki et al., 2019. Mol. Cell, 73:1-13).
[0227] For example, the Spy Cas9 guide sequence can be 16-, 17-, preferably 18-, 19-, or 20-nucleotides in length, such that, in some embodiments, the Spy Cas9 guide sequence comprises 16, 17, 18, 19, or 20 contiguous nucleotides of a guide sequence provided in Table 3A-3B, or a reverse complement thereof. In some embodiments, the guide sequence is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence in a genome is at least 80%, 85%, preferably 90%, or 95%, or is 100%. For example, in some embodiments, the guide sequence comprises a sequence that is at least 80%, 85%, preferably 90%, or 95%, or is 100% identical or complementary to 20 contiguous nucleotides of its corresponding target sequence. In other embodiments, the guide sequence and its corresponding target sequence may contain at least one mismatch, i.e., one nucleotide that is not identical or not complementary, depending on the reference sequence. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches within the duplex formed between the guide and the target sequence, where the total length of the target sequence is 16, 17, 18, 19, 20 nucleotides, or more. In some embodiments, the guide sequence and the target sequence may contain 1-4 mismatches where the guide sequence comprises at least 20 nucleotides. In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches where the guide sequence comprises 20 nucleotides. That is, the guide sequence and the target region may form a duplex region having 16, 17, 18, 19, 20 base pairs, or more. In certain embodiments, the duplex region may include 1, 2, 3, or 4 mismatches such that guide strand and target sequence are not fully complementary. For example, a guide strand and target sequence may be complementary over a 20 nucleotide region, including 2 mismatches, such that the guide sequence and target sequence are 90% complementary providing a duplex region of 18 base pairs out of 20. More tolerated mismatch positions are known in the art, for example, PAM distal mismatches tend to be better tolerated than PAM proximal matches. Mismatch tolerances at other positions are known in the art (see, e.g., Sternberg et al., 2015, Nature:527:110-113).
[0228] Target sequences for RNA-guided DNA binding agents, as defined by the guide sequence of a guide RNA, may be present on either the positive or negative strand. Tables and other disclosures provided herein may recite genomic coordinates or position within a nucleotide sequence as a target sequence. It is understood that the guide can be complementary to either the positive or negative strand of the DNA as defined by thegenomic coordinates or position within a nucleotide sequence. The sequence to which the guide is complementary depends on the presence of an appropriate PAM for the RNA guided DNA binding protein on the opposite strand. Thus, in some embodiments, when the guide sequence binds the reverse complement of a target sequence, i.e., the guide sequence is identical to certain nucleotides of the sense (positive) strand of the target sequence, when the PAM is present in the sense strand, except for the substitution of U for T in the guide sequence.
[0229] As used herein, an “RNA-guided DNA binding agent” means a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the presence of a PAM and the sequence of the guide RNA. Exemplary RNA-guided DNA binding agents include Cas cleavases / nickases and inactivated forms thereof (“dCas DNA binding agents”). “Cas nuclease” or “Cas9 protein”, as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents. The dCas DNA binding agent may be a dead nuclease comprising non-functional nuclease domains (RuvC or HNH domain). In some embodiments the Cas cleavase or Cas nickase encompasses a dCas DNA binding agent modified to permit DNA cleavage, e.g. via fusion with a FokI domain. Cas cleavases / nickases and dCas DNA binding agents include a Csm or Cmr complex of a type III CRISPR system, the CaslO, Csml, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases.
[0230] As used herein, a “Class 2 Cas nuclease” is a single-chain polypeptide with RNA- guided DNA binding activity. Class 2 Cas nucleases include Class 2 Cas cleavases / nickases (e.g., H840A or D10A variants of Spy Cas9 and D16A and H588A of Nme Cas9, e.g., Nme2Cas9), which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpfl, C2cl, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(l.l) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpfl protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like nuclease domain. Cpfl sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables SI and S3. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).
[0231] Several Cas9 orthologs have been obtained from N. meningitidis (Esvelt et ah, NAT. METHODS, vol. 10, 2013, 1116 - 1121; Hou et al., PNAS, vol. 110, 2013, pages 15644 - 15649) (NmelCas9, Nme2Cas9, and Nme3Cas9). The Nme2Cas9 ortholog functions efficiently in mammalian cells, recognizes an N4CC PAM, and can be used for in vivo editing with cognate gRNAs (Ran et al., NATURE, vol. 520, 2015, pages 186 - 191; Kim et al., NAT. COMMUN., vol. 8, 2017, pages 14500). Nme2Cas9 can be specific and selective, e.g. capable of low off-target editing (Lee et al., MOL. THER., vol. 24, 2016, pages 645 - 654; Kim et al., 2017). See also e.g., WO / 2020081568 (e.g., pages 28 and 42), describing an Nme2Cas9 D16A nickase, the contents of which are hereby incorporated by reference in its entirety. Throughout, “NmeCas9” or “NmeCas9” is generic and encompasses any type of NmeCas9, including, NmelCas9, Nme2Cas9, and Nme3Cas9.
[0232] Exemplary nucleotide and polypeptide sequences of Cas9 molecules are provided below. Methods for identifying alternate nucleotide sequences encoding Cas9 polypeptide sequences, including alternate naturally occurring variants, are known in the art. Sequences with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to any of the Cas9 nucleic acid sequences, or nucleic acid sequences encoding the amino acid sequences provided herein are also contemplated. In certain embodiments, the nucleotide sequence encoding the Cas9 amino acid sequence is not a naturally occurring Cas9 nucleotide sequence. Sequences with at least 95%, 96%, 97%, 98%, or 99% identity to any of the Cas9 amino acid sequences provided herein are also contemplated. In certain embodiments, the Cas9 amino acid sequence is not a naturally occurring Cas9 sequence.
[0233] Exemplary open reading frames and amino acid sequences for Cas9 (SEQ ID NO: 802-810, 813, 814, 816-819, 832-834, 853-857 ) and uracil glycosylase inhibitors (SEQ ID NO: 823-826, 859, 860) are provided in Table 10.
[0234] As used herein, the term “editor” refers to an agent comprising a polypeptide that is capable of making a modification within a DNA sequence. In some embodiments, the editor is a cleavase, such as a Cas9 cleavase. In some embodiments, the editor is capable of deaminating a base within a DNA molecule, and it may be called a base editor. In some embodiments, the editor is capable of deaminating a cytosine (C) in DNA. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to a cytidine deaminase. In some embodiments, the editor is a fusion protein comprising an RNA- guided nickase fused to an APOBEC3A deaminase (A3A). In some embodiments, the editor comprises a Cas9 nickase fused to an APOBEC3A deaminase (A3A). In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to a cytidinedeaminase and a UGI. In some embodiments, the editor lacks a UGI. Exemplary editors used herein may be described in WO2022125968 published June 16, 2022, the contents of which are incorporated by reference. Exemplary editors may be a single polypeptide comprising a H. sapiens APOBEC3A linked to N. meningitidis -D16A Cas9 nickase by an XTEN linker. An mRNA encoding the same is provided herein (e.g., SEQ ID NO: 801) or Exemplary editors may be a single polypeptide comprising a single polypeptide comprising a H. sapiens APOBEC3A linked to S. pyogenes-DlOA Cas9 nickase by an XTEN linker. An mRNA encoding the same is provided herein (e.g., SEQ ID NO: 811).
[0235] As used herein, a “cytidine deaminase” means a polypeptide or complex of polypeptides that is capable of cytidine deaminase activity, that is catalyzing the hydrolytic deamination of cytidine or deoxycytidine, typically resulting in uridine or deoxyuridine. Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and in particular, enzymes of the APOBEC family (APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminase (AID or AICDA) and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol. 22:367-77, (2005); Conticello, Genome Biol. 9:229, (2008); Muramatsu et al., J. Biol. Chem. 274: 18470-6, (1999); and Carrington et al., Cells 9:1690 (2020)).
[0236] As used herein, the term “APOBEC3” refers to a APOBEC3 protein, such as an APOBEC3 protein expressed by any of the seven genes (A3A-A3H) of the human APOBEC3 locus. The APOBEC3 may have catalytic DNA or RNA editing activity. An amino acid sequence of APOBEC3A has been described (UniPROT accession ID: p31941) and is included herein as SEQ ID NO: 850. In some embodiments, the APOBEC3 protein is a human APOBEC3 protein or a wild-type protein. Variants include proteins having a sequence that differs from wild-type APOBEC3 protein by one or several mutations (i.e. substitutions, deletions, insertions), such as one or several single point substitutions. For instance, a shortened APOBEC3 sequence could be used, e.g. by deleting several N-term or C-term amino acids, preferably one to four amino acids at the C-terminus of the sequence. As used herein, the term “variant” refers to allelic variants, splicing variants, and natural or artificial mutants, which are homologous to an APOBEC3 reference sequence. The variant is “functional” in that it shows a catalytic activity of DNA or RNA editing. In some embodiments, an APOBEC3 (such as a human APOBEC3A) has a wild-type amino acid position 57 (as numbered in the wild-type sequence). In some embodiments, an APOBEC3 (such as a human APOBEC3A) has an asparagine at amino acid position 57 (as numbered in the wild-type sequence).
[0237] As used herein, a “nickase” is an enzyme that creates a single-strand break (also known as a “nick”) in double strand DNA, i.e., cuts one strand but not the other of the DNA double helix. As used herein, an “RNA-guided DNA nickase” means a polypeptide or complex of polypeptides having DNA nickase activity, wherein the DNA nickase activity is sequence-specific and depends on the sequence of the RNA. Exemplary RNA-guided DNA nickases include Cas nickases. Cas nickases include nickase forms of a Csm or Cmr complex of a type III CRISPR system, the Cas 10, Csml, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases. Class 2 Cas nickases include variants in which only one of the two catalytic domains is inactivated, which have RNA-guided DNA nickase activity. Class 2 Cas nickases include polypeptides in which either the HNH or RuvC catalytic domain is inactivated, for example, Cas9 for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9 or D16A variant of NmeCas9). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain or RuvC or RuvC-like domains for N. meningitidis include Nme2Cas9 D16A (HNH nickase) and Nme2Cas9 H588A (RuvC nickase), Cpfl, C2cl, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(l.l) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpfl protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like protein domain. Cpfl sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables SI and S3. “Cas9” encompasses S. pyogenes (Spy) Cas9, the variants of Cas9 listed herein, and equivalents thereof. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).
[0238] As used herein, the term “fusion protein” refers to a hybrid polypeptide which comprises polypeptides from at least two different proteins or sources. One polypeptide may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxyterminal (C- terminal) protein thus forming an “amino-terminal fusion protein” or a “carboxy-terminal fusion protein,” respectively. Any of the proteins provided herein may be produced by any method known in the art. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference.
[0239] The term “linker,” as used herein, refers to a chemical group or a molecule linking two adjacent molecules or moieties. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein) such as a 16-amino acid residue “XTEN” linker, or a variant thereof (See, e.g., the Examples; and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 901), SGSETPGTSESA (SEQ ID NO: 902), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 903).
[0240] As used herein, the term “uracil glycosylase inhibitor”, “uracil-DNA glycosylase inhibitor”, or “UGI” refers to a protein that is capable of inhibiting a uracil-DNA glycosylase (UDG) base-excision repair enzyme (e.g., UniPROT ID: P14739; SEQ ID NO: 859).
[0241] As used herein, “open reading frame” or “ORF’ of a gene refers to a sequence consisting of a series of codons that specify the amino acid sequence of the protein that the gene codes for. The ORF begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon, e.g., TAA, TAG or TGA in DNA or UAA, UAG, or UGA in RNA.
[0242] As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to a guide RNA together with an RNA-guided DNA binding agent, such as a Cas nuclease, e.g., a Cas cleavase, Cas nickase, or dCas DNA binding agent (e.g., Cas9). In some embodiments, the guide RNA guides the RNA-guided DNA binding agent such as Cas9 to a target sequence, and the guide RNA hybridizes with and the agent binds to the target sequence; in cases where the agent is a cleavase or nickase, binding can be followed by cleaving or nicking.
[0243] As used herein, a first sequence is considered to “comprise a sequence with at least X% identity to” a second sequence if an alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence in its entirety are matched by the first sequence. For example, the sequence AAGA comprises a sequence with 100% identity to the sequence AAG because an alignment would give 100% identity in that there are matches to all three positions of the second sequence. The differences between RNA and DNA (generally the exchange of uridine for thymidine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity among polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine,both of which have guanosine or modified guanosine as a complement). Thus, for example, the sequence 5’-AXG where X is any modified uridine, such as pseudouridine, N1 -methyl pseudouridine, or 5 -methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5’-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well-known in the art. One skilled in the art will understand what choice of algorithm and parameter settings are appropriate for a given pair of sequences to be aligned; for sequences of generally similar length and expected identity >50% for amino acids or >75% for nucleotides, the Needleman- Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server is generally appropriate.
[0244] “mRNA” is used herein to refer to a polynucleotide and comprises an open reading frame that can be translated into a polypeptide (z.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs). mRNA can comprise a phosphate-sugar backbone including ribose residues or analogs thereof, e.g., 2’-methoxy ribose residues. In some embodiments, the sugars of an mRNA phosphate-sugar backbone consist essentially of ribose residues, 2’-methoxy ribose residues, or a combination thereof.
[0245] As used herein, “indel” refers to an insertion or deletion mutation consisting of a number of nucleotides that are either inserted, deleted, or inserted and deleted, e.g. at the site of double-stranded breaks (DSBs), in a target nucleic acid. As used herein, when indel formation results in an insertion, the insertion is a random insertion at the site of a DSB and is not generally directed by or based on a template sequence.
[0246] As used herein, “reduced or eliminated” expression of a protein on a cell refers to a partial or complete loss of expression of the protein relative to an unmodified cell. In some embodiments, the surface expression of a protein on a cell is measured by flow cytometry and has “reduced” or “eliminated” surface expression relative to an unmodified cell as evidenced by a reduction in fluorescence signal upon staining with the same antibody against the protein. A cell that has “reduced” or “eliminated” surface expression of a protein by flow cytometry relative to an unmodified cell may be referred to as “negative” for expression of that protein as evidenced by a fluorescence signal similar to a cell stained with an isotype control antibody. The “reduction” or “elimination” of protein expression can be measured by other known techniques in the field with appropriate controls known to those skilled in the art.
[0247] As used herein, “knockdown” refers to a decrease in expression of a particular gene product (e.g., protein, mRNA, or both), e.g., as compared to expression of an unedited targetsequence. Knockdown of a protein can be measured by detecting total cellular amount of the protein from a sample, such as a tissue, fluid, or cell population of interest. It can also be measured by measuring a surrogate, marker, or activity for the protein. Methods for measuring knockdown of mRNA are known and include analyzing mRNA isolated from a sample of interest. In some embodiments, “knockdown” may refer to some loss of expression of a particular gene product, for example a decrease in the amount of mRNA transcribed or a decrease in the amount of protein expressed by a cell or population of cells (including in vivo populations such as those found in tissues).
[0248] As used herein, “knockout” or “KO” refers to a loss of expression from a particular gene or of a particular protein in a cell. Knockout can result in a decrease in expression below the level of detection of the assay. Knockout can be measured either by detecting total cellular amount of a protein in a cell, a tissue or a population of cells.
[0249] As used herein, a “target sequence” or “genomic target sequence” refers to a sequence of nucleic acid in a target gene that has complementarity to the guide sequence of the gRNA. The interaction of the target sequence and the guide sequence directs an RNA- guided DNA binding agent to bind, and potentially nick or cleave (depending on the activity of the agent), within the target sequence.
[0250] As used herein, the term “subject” is intended to include living organisms in which an immune response can be elicited, including e.g., mammals, primates, humans.
[0251] As used herein, “treatment” refers to any administration or application of a therapeutic for disease or disorder in a subject, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including recurrence of the symptom.
[0252] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention is described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims and included embodiments.
[0253] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to specific compositions or process steps, as such may vary. It should be noted that, as used in this specification and the appended claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.Thus, for example, reference to “a conjugate” includes a plurality of conjugates and reference to “a cell” includes a plurality of cells (e.g., a population of cells) and the like.
[0254] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement.
[0255] Also, the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings. Unless specifically noted in the specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of’ or “consisting essentially of’ the recited components; embodiments in the specification that recite “consisting of’ various components are also contemplated as “comprising” or “consisting essentially of’ the recited components; and embodiments in the specification that recite “consisting essentially of’ various components are also contemplated as “consisting of’ or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims).
[0256] The term “or” is used in an inclusive sense, i.e., equivalent to “and / or,” unless the context clearly indicates otherwise.
[0257] The term “about”, when used before a list, modifies each member of the list. The term “about” is understood to encompass tolerated variation or error within the art, e.g., 2 standard deviations from the mean, or the sensitivity of the method used to take a measurement. When “about” is present before the first value of a series, it can be understood to modify each value in the series.
[0258] Ranges are understood to include the numbers at the end of the range and all logical values therebetween. For example, 5-10 nucleotides is understood as 5, 6, 7, 8, 9, or 10 nucleotides, whereas 5-10% is understood to contain 5% and all possible values through 10%.
[0259] At least 17 nucleotides of a 20 nucleotide sequence is understood to include 17, 18, 19, or 20 nucleotides of the sequence provided, thereby providing an upper limit even if one is not specifically provided as it would be clearly understood. Similarly, up to 3 nucleotides would be understood to encompass 0, 1, 2, or 3 nucleotides, providing a lower limit even if one is not specifically provided. When “at least”, “up to”, or other similar language modifies a number, it can be understood to modify each number in the series.
[0260] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex region of “no more than 2 nucleotide base pairs” has a 2, 1, or 0 nucleotide base pairs. When “no more than” or “less than” is present before a series of numbers or a range, it is understood that each of the numbers in the series or range is modified.
[0261] As used herein, ranges include both the upper and lower limit.
[0262] In the event of a conflict between a sequence in the application and an indicated accession number or position in an accession number, the sequence in the application predominates.
[0263] As used herein, it is understood that when the maximum amount of a value is represented by 100% (e.g., 100% inhibition or 100% encapsulation) that the value is limited by the method of detection. For example, 100% inhibition is understood as inhibition to a level below the level of detection of the assay, and 100% encapsulation is understood as no material intended for encapsulation can be detected outside the vesicles.
[0264] The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined in this specification or any other express content of this specification, this specification controls. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.Genetically Modified Cells1. Engineered Cell Compositions
[0265] The present disclosure provides engineered cell compositions which have reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in the CD70 gene.
[0266] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in the CD70 gene, wherein the genetic modification is within the genomic coordinates chrl9:586028-6591018. In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to anunmodified cell, comprising a genetic modification in the CD70 gene, wherein the genetic modification comprises at least one nucleotide within the genomic coordinates chrl9:6586002-6591015. In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in the CD70 gene, wherein the genetic modification is within the genomic coordinates chrl9:586028-6591018.
[0267] In some embodiments, for each given range of genomic coordinates, a range may encompass + / - 10 nucleotides on either end of the specified coordinates. For example, if chrl9:6590121-6590145 is given, in some embodiments the genomic target sequence or genetic modification may fall within chrl9:6590121-6590145. In some embodiments, for each given range of genomic coordinates, the range may encompass + / - 5 nucleotides on either end of the range.
[0268] In some embodiments, a given range of genomic coordinates may comprise a target sequence on both strands of the DNA (z.e., the plus (+) strand and the minus (-) strand).
[0269] Genetic modifications in the CD70 gene are described further herein. In some embodiments, a genetic modification in the CD70 gene comprises any one or more of an insertion, deletion, substitution, or deamination of at least one nucleotide in a target sequence.
[0270] The engineered cells described herein may comprise a genetic modification in any CD70 allele of the CD70 gene. The CD70 gene is located in chromosome 19.
[0271] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in a CD70 gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within any one of the genomic coordinates listed in Table 2 A and 3 A.
[0272] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in a CD70 gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within any one of the genomic coordinates listed in Table 2A and 3A, wherein the genetic modification comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates.
[0273] In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 1 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 2 contiguous nucleotides within thegenomic coordinates. In some embodiments, the genetic modification comprises at least 3 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 4 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 6 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 7 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 8 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 9 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 10 contiguous nucleotides within the genomic coordinates.
[0274] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in a CD70 gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within any one of the genomic coordinates listed in Table 2 A and 3 A, wherein the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
[0275] In some embodiments, an engineered cell is provided wherein the CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least 5 contiguous nucleotides within any one of the genomic coordinates listed in Table 2A and 3A. In some embodiments, the CD70 genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent, such as an S. pyogenes Cas9, an N. meningitidis Cas9, or a base editor that comprises an S. pyogenes or N. meningitidis Cas9 nickase.
[0276] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in a CD70 gene, wherein the genetic modification is within the genomic coordinates chosen from: chrl9:6590121-6590145; chrl9:6586002-6586026; chrl9:6586003-6586027; chrl9:6586013-6586037; chrl9:6586357-6586381; chrl9:6586365-6586389; chrl9:6586376-6586400; chrl9:6590988-6591012;chrl9:6590991-6591015; chrl9:6590862-6590886; chrl9:6586396-6586420; chr 19:6586372-6586396; chr 19:6586371-6586395; chr 19:6586360-6586384; chrl9:6586355-6586379; chrl9:6586268-6586292; chrl9:6586259-6586283; chrl9:6586256-6586280; chrl9:6586142-6586166; chrl9:6586141-6586165; chrl9:6586135-6586159; chrl9:6586128-6586152; chrl9:6586127-6586151; chrl9:6586126-6586150; chrl9:6586121-6586145; chrl9:6586120-6586144; chrl9:6586096-6586120; chrl9:6586055-6586079; chrl9:6586029-6586053; chrl9:6586023-6586047; chrl9:6586312-6586336; chrl9:6586151-6586175; chrl9:6586145-6586169; chrl9:6586100-6586124; chrl9:6586030-6586054; chrl9:6586028-6586052; chrl9:6586395-6586419; and chrl9:6586394-6586418. In some embodiments, an engineered cell is provided wherein the CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chrl9:6590121-6590145; chrl9:6586002-6586026; chrl9:6586003-6586027; chrl9:6586013-6586037; chrl9:6586357-6586381; chrl9:6586365-6586389; chrl9:6586376-6586400; chrl9:6590988-6591012; chrl9:6590991-6591015; chrl9:6590862-6590886; chrl9:6586396-6586420; chrl9:6586372-6586396; chrl9:6586371-6586395; chrl9:6586360-6586384; chrl9:6586355-6586379; chrl9:6586268-6586292; chrl9:6586259-6586283; chrl9:6586256-6586280; chrl9:6586142-6586166; chrl9:6586141-6586165; chrl9:6586135-6586159; chrl9:6586128-6586152; chrl9:6586127-6586151; chrl9:6586126-6586150; chrl9:6586121-6586145; chrl9:6586120-6586144; chrl9:6586096-6586120; chrl9:6586055-6586079; chrl9:6586029-6586053; chrl9:6586023-6586047; chrl9:6586312-6586336; chr 19:6586151-6586175; chr 19:6586145-6586169; chrl9:6586100-6586124; chrl9:6586030-6586054; chrl9:6586028-6586052; chrl9:6586395-6586419; and chrl9:6586394-6586418. In some embodiments, the genetic modification is within the genomic coordinates chosen from: chrl9:6590121-6590145 andchrl9:6586268-6586292. In some embodiments, the CD70 genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent, such as an AmeCas9.
[0277] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising agenetic modification in a CD70 gene, wherein the genetic modification is within the genomic coordinates chosen from chrl9:6590998-6591018; chrl9:6590995-6591015; chrl9:6590992- 6591012; chrl9:6590991-6591011; chrl9:6590987-6591007; chrl9:6590986-6591006; chrl9:6590985-6591005; chrl9:6590977-6590997; chrl9:6590972-6590992; chrl9:6590966-6590986; chrl9:6590958-6590978; chrl9:6590957-6590977; chrl9:6590945-6590965; chrl9:6590944-6590964; chrl9:6590940-6590960; chrl9:6590939-6590959; chrl9:6590935-6590955; chrl9:6590926-6590946; chrl9:6590920-6590940; chrl9:6590919-6590939; chrl9:6590914-6590934; chrl9:6590908-6590928; chrl9:6590907-6590927; chrl9:6590899-6590919; chrl9:6590875-6590895; chrl9:6590866-6590886; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6586374-6586394; chrl9:6586368-6586388; chrl9:6586288-6586308; chrl9:6586285-6586305; chrl9:6586276-6586296; chrl9:6586267-6586287; chrl9:6586199-6586219; chrl9:6586172-6586192; chrl9:6586138-6586158; chrl9:6586099-6586119; and chrl9:6586050-6586070. In some embodiments, an engineered cell is provided wherein the CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chrl9:6590998-6591018; chrl9:6590995-6591015; chrl9:6590992-6591012; chrl9:6590991-6591011; chrl9:6590987-6591007; chrl9:6590986-6591006; chrl9:6590985-6591005; chrl9:6590977-6590997; chrl9:6590972-6590992; chrl9:6590966-6590986; chrl9:6590958-6590978; chrl9:6590957-6590977; chrl9:6590945-6590965; chrl9:6590944-6590964; chrl9:6590940-6590960; chrl9:6590939-6590959; chrl9:6590935-6590955; chrl9:6590926-6590946; chrl9:6590920-6590940; chrl9:6590919-6590939; chrl9:6590914-6590934; chrl9:6590908-6590928; chrl9:6590907-6590927; chrl9:6590899-6590919; chrl9:6590875-6590895; chrl9:6590866-6590886; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6586374-6586394; chrl9:6586368-6586388; chrl9:6586288-6586308; chrl9:6586285-6586305; chrl9:6586276-6586296; chrl9:6586267-6586287; chrl9:6586199-6586219; chrl9:6586172-6586192; chrl9:6586138-6586158; chrl9:6586099-6586119; and chrl9:6586050-6586070. In some embodiments, the genetic modification is within the genomic coordinates chosen from: chrl9:6590998-6591018; chrl9:6590991-6591011; chrl9:6590939-6590959; chrl9:6590972-6590992; chrl9:6590940-6590960; and chrl9:6590907-6590927. In some embodiments, the CD70 genomic target sequence comprises at least 10 contiguousnucleotides within the genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent, such as an S. pyogenes Cas9.
[0278] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in a CD70 gene, wherein the genetic modification is within the genomic coordinates chosen from chrl9:6590875-6590895; chrl9:6590844-6590864; chrl9:6590843- 6590863; chrl9:6590835-6590855; chrl9:6590104-6590124; chrl9:6590096-6590116; chrl9:6590095-6590115; chrl9:6590094-6590114; chrl9:6590093-6590113; chrl9:6590087-6590107; chrl9:6590084-6590104; chrl9:6590083-6590103; chrl9:6590078-6590098; chrl9:6586368-6586388; chrl9:6586299-6586319; chrl9:6586267-6586287; chrl9:6590842-6590862; chrl9:6590139-6590159; chrl9:6590138-6590158; chrl9:6590135-6590155; chrl9:6590079-6590099; chrl9:6590077-6590097; chrl9:6586412-6586432; chrl9:6586404-6586424; chrl9:6586403-6586423; chrl9:6586396-6586416; chrl9:6586396-6586416; chrl9:6586395-6586415; chrl9:6586388-6586408; chrl9:6586380-6586400; chrl9:6586379-6586399; chrl9:6586375-6586395; chrl9:6586369-6586389; chrl9:6586367-6586387; chrl9:6586360-6586380; chrl9:6586359-6586379; chrl9:6586120-6586140; and chrl9:6586028-6586048. In some embodiments, an engineered cell is provided wherein the CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chrl9:6590875-6590895; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6590835-6590855; chrl9:6590104-6590124; chrl9:6590096-6590116; chrl9:6590095-6590115; chrl9:6590094-6590114; chrl9:6590093-6590113; chrl9:6590087-6590107; chrl9:6590084-6590104; chrl9:6590083-6590103; chrl9:6590078-6590098; chrl9:6586368-6586388; chr 19:6586299-6586319; chr 19:6586267-6586287; chrl9:6590842-6590862; chrl9:6590139-6590159; chrl9:6590138-6590158; chrl9:6590135-6590155; chr 19:6590079-6590099; chr 19:6590077 -6590097; chrl9:6586412-6586432; chrl9:6586404-6586424; chrl9:6586403-6586423; chrl9:6586396-6586416; chrl9:6586396-6586416; chrl9:6586395-6586415; chrl9:6586388-6586408; chrl9:6586380-6586400; chrl9:6586379-6586399; chrl9:6586375-6586395; chr 19:6586369-6586389; chr 19:6586367-6586387;chrl9:6586360-6586380; chrl9:6586359-6586379; chrl9:6586120-6586140; and chrl9:6586028-6586048. In some embodiments, the genetic modification is within the genomic coordinates chosen from: chrl9:6590875-6590895; chrl9:6586396-6586416; chrl9:6586388-6586408; chrl9:6586379-6586399; chrl9:6586369-6586389; and chrl9:6586120-6586140. In some embodiments, the CD70 genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent, such as a base editor comprising a cytidine deaminase and an S. pyogenes Cas9 nickase.
[0279] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in a CD70 gene, wherein the genetic modification is within the genomic coordinates chosen from chrl9:6590998-6591018; chrl9:6590991-6591011; chrl9:6590939- 6590959; chrl9:6590972-6590992; chrl9:6590940-6590960; and chrl9:6590907-6590927. In some embodiments, an engineered cell is provided wherein the CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from chrl9:6590998-6591018; chrl9:6590991-6591011; chrl9:6590939-6590959; chrl9:6590972-6590992; chrl9:6590940-6590960; and chrl9:6590907-6590927.
[0280] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in a CD70 gene, wherein the genetic modification is within the genomic coordinates chosen from chrl9:6590875-6590895; chrl9:6590844-6590864; chrl9:6590843- 6590863; chrl9:6586368-6586388; and chrl9:6586267-658628. In some embodiments, an engineered cell is provided wherein the CD70 expression is reduced or eliminated by a gene editing system that binds to a CD70 genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from chrl9:6590875- 6590895; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6586368-6586388; and chrl9:6586267-658628.
[0281] In some embodiments, the CD70 genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CD70 genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
[0282] In some embodiments, the CD70 genomic target sequence comprises at least 20, 21, 22, 23, or 24 contiguous nucleotides within the genomic coordinates.
[0283] In some embodiments, the CD70 genomic target sequence comprises at least 17, 18, 19, or 20, contiguous nucleotides within the genomic coordinates.
[0284] In some embodiments, the gene editing system comprises a transcription activatorlike effector nuclease (TALEN). In some embodiments, the gene editing system comprises a zinc finger nuclease. In some embodiments, the gene editing system comprises a CRISPR / Cas system, such as a class 2 system. In some embodiments, the gene editing system comprises an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA- guided DNA binding agent.
[0285] Exemplary RNA-guided DNA binding agents are shown in Table 1 below.Table 1. Exemplary RNA-guided DNA binding agents.*Exemplary base editor based on deaminase- SpyCas9 nickase or deaminase-NmeCas9 nickase. As is apparent, the base editor specificity, including PAM, will vary with its nickase.
[0286] In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA-guided DNA binding agent comprises a Cas9 protein. In some embodiments, the RNA-guided DNA binding agent is selected from one of: S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g. an Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpfl, Acidaminococcus sp. Cpfl, Lachnospiraceae bacterium Cpfl, C- to-T base editor, A-to-G base editor, Casl2a, Mad7 nuclease, ARCUS nucleases, and CasX. In some embodiments, the RNA-guided DNA binding agent comprises a polypeptide selected from one of: S. pyogenes Cas9, Neisseria meningitidis Cas9, e.g. an Nme2Cas9, S. thermophilus Cas9, S. aureus Cas9, Francisella novicida Cpfl, Acidaminococcus sp. Cpfl, Lachnospiraceae bacterium Cpfl, C-to-T base editor, A-to-G base editor, Casl2a, and CasX.
[0287] In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA-guided DNA binding agent is N. meningitidis Cas9, e.g. Nme2Cas9.
[0288] In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA-guided DNA binding agent is S. thermophilus Cas9. In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA- guided DNA binding agent is S. aureus Cas9. In some embodiments, the RNA-guided DNA- binding agent or nucleic acid encoding the RNA-guided DNA binding agent is Cpfl from F. novicida. In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA-guided DNA binding agent is Cpfl from Acidaminococcus sp. In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA- guided DNA binding agent is Cpfl from Lachnospiraceae bacterium ND2006. In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA- guided DNA binding agent is Casl2a. In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA-guided DNA binding agent is CasX.
[0289] In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA-guided DNA binding agent is a C to T base editor. In some embodiments, the RNA-guided DNA-binding agent or nucleic acid encoding the RNA-guided DNA binding agent is a A to G base editor. In some embodiments, the base editor comprises a deaminase and an RNA-guided nickase. In some embodiments, the RNA-guided DNA-binding agent ornucleic acid encoding the RNA-guided DNA binding agent comprises a APOBEC3A deaminase (A3 A) and an RNA-guided nickase. In some embodiments, the RNA-guided nickase is a SpyCas9 nickase. In some embodiments, the RNA-guided nickase comprises an NmeCas9 nickase.
[0290] In any of the above embodiments, the genome editing system comprises an RNA- guided DNA binding agent, or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9. In some embodiments, the RNA-guided DNA binding agent is an S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent is a base editor. In some embodiments the base editor comprises a C to T deaminase and an RNA-guided nickase such as an S. pyogenes Cas9 nickase. In some embodiments the base editor comprises a A to G deaminase and an RNA-guided nickase such as an S. pyogenes Cas9 nickase.
[0291] In any of the above embodiments, the gene editing system comprises an RNA- guided DNA binding agent, or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9. In some embodiments, the RNA-guided DNA binding agent is an N. meningitidis or Nme2 Cas9. In some embodiments, the RNA-guided DNA binding agent is a base editor. In some embodiments the base editor comprises a C to T deaminase and an RNA-guided nickase such as an N. meningitidis or Nme2 Cas9 nickase. In some embodiments the base editor comprises a A to G deaminase and an RNA-guided nickase such as an N. meningitidis or Nme2 Cas9 nickase.
[0292] In some embodiments, the gene editing system further comprises a uracil glycosylase inhibitor (UGI), and the UGI and the base editor are comprised in a single polypeptide. In some embodiments, the gene editing system comprises a UGI, and the UGI and the base editor are comprised in different polypeptides. In some embodiments, the base editor comprises a cytidine deaminase and an RNA-guided nickase. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in a single polypeptide. In some embodiments, the cytidine deaminase, the RNA-guided nickase, and the UGI are comprised in different polypeptides. In some embodiments, the cytidine deaminase and the RNA-guided nickase are comprised in a single polypeptide, and wherein the UGI is comprised in a different polypeptide.
[0293] The engineered cell may be any of the exemplary cell types disclosed herein.
[0294] In some embodiments, the disclosure provides a pharmaceutical composition comprising any one of the engineered cells disclosed herein. In some embodiments, thepharmaceutical composition comprises a population of any one of the engineered cells disclosed herein. In some embodiments, the population of engineered cells is at least 40%, 45%, 50%, 55%, 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% CD70 negative as measured by flow cytometry. In some embodiments, at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the population of cells comprises the genetic modification in the CD70 gene, as measured by next-generation sequencing (NGS).Methods and Compositions for Reducing or Eliminating Surface Expression of CD70
[0295] The present disclosure provides methods and compositions for reducing or eliminating surface expression of CD70 protein relative to an unmodified cell by genetically modifying the CD70 gene. The resultant genetically modified cell may also be referred to herein as an engineered cell. In some embodiments, an already-genetically modified (or engineered) cell may be the starting cell for further genetic modification using the methods or compositions provided herein. In some embodiments, the cell is an allogeneic cell. In some embodiments, a cell with reduced or eliminated surface expression of CD70 protein is useful for immunotherapy. In some embodiments, a cell with reduced or eliminated surface expression of CD70 protein is useful for adoptive cell transfer therapies. In some embodiments, editing of the CD70 gene is combined with additional genetic modifications to yield a cell that is desirable for allogeneic transplant purposes.
[0296] In some embodiments, the methods comprise reducing surface expression of CD70 protein in a cell relative to an unmodified cell, comprising contacting a cell with composition comprising (a) a guide RNA comprising (i) a guide sequence selected from SEQ ID NOs: 1- 38; or (ii) at least 19, 20, 21, 22, 23, preferably 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-38; or (iii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-38; or (iv) a guide sequence that binds a target site comprising a genomic region listed in Table 2 A; or (v) a guide sequence that is complementary to at least 19, 20, 21, 22, 23, preferably 24, or 25 contiguous nucleotides of a genomic region listed in Table 2 A; or (vi) a guide sequence that is at least 95%, 90%, 85%, identical to a sequence selected from (v); and optionally (b) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
[0297] In some embodiments, the methods comprise reducing surface expression of CD70 protein in a cell relative to an unmodified cell, comprising contacting a cell with composition comprising (a) a guide RNA comprising (i) a guide sequence selected from SEQ ID NOs:101-169; or (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 101-169; or (iii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 101-169; or (iv) a guide sequence that binds a target site comprising a genomic region listed in Table 3A; or (v) a guide sequence that is complementary to at least 17, 18, 19, or 20 contiguous nucleotides of a genomic region listed in Table 3A; or (vi) a guide sequence that is at least 95%, 90%, 85%, identical to a sequence selected from (v); and optionally (b) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
[0298] In some embodiments, the methods further comprise contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein.
[0299] In some embodiments the RNA-guided DNA binding agent is N. meningitidis Cas9, e.g., Nme2Cas9. In some embodiments, the guide RNA is a Nme Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the guide RNA is a S. pyogenes Cas9 guide RNA.
[0300] In some embodiments, the RNA-guided DNA binding agent comprises a deaminase domain.
[0301] In some embodiments the RNA-guided DNA binding agent is a C to T base editor. In some embodiments the RNA-guided DNA binding agent is a A to G base editor. In some embodiments, the base editor comprises a deaminase and an RNA-guided nickase. In some embodiments the RNA-guided DNA binding agent comprises a APOBEC3A deaminase (A3 A) and an RNA-guided nickase. In some embodiments, the RNA-guided nickase is a SpyCas9 nickase. In some embodiments, the RNA-guided nickase comprises an NmeCas9 nickase.
[0302] In some embodiments, the surface expression of CD70 protein (i.e., engineered cell) is thereby reduced or eliminated.
[0303] In some embodiments, the methods comprise making an engineered human cell, which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising contacting a cell with composition comprising (a) a guide RNA comprising (a) a guide RNA comprising (i) a guide sequence selected from SEQ ID NOs: 1- 38; or (ii) at least 19, 20, 21, 22, 23, preferably 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-38; or (iii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-38; or (iv) a guide sequence that binds a target site comprising a genomic region listed in Table 2 A; or (v) a guide sequencethat is complementary to at least 19, 20, 21, 22, 23, preferably 24, or 25 contiguous nucleotides of a genomic region listed in Table 2 A; or (vi) a guide sequence that is at least 95%, 90%, 85%, identical to a sequence selected from (v); and optionally (b) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the methods further comprise contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA- guided DNA binding agent is NmeCas9. In some embodiments, the guide RNA is a Nme guide RNA. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase domain. In some embodiments the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3 A) and an RNA-guided nickase.
[0304] In some embodiments, the methods comprise making an engineered human cell, which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising contacting a cell with composition comprising (a) a guide RNA comprising (i) a guide sequence selected from SEQ ID NOs: 101-169; or (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 101-169; or (iii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 101-169; or (iv) a guide sequence that binds a target site comprising a genomic region listed in Table 3A; or (v) a guide sequence that is complementary to at least 17, 18, 19, or 20 contiguous nucleotides of a genomic region listed in Table 3A; or (vi) a guide sequence that is at least 95%, 90%, 85%, identical to a sequence selected from (v); and optionally (b) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the methods further comprise contacting the cell with an RNA- guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.. In some embodiments, the RNA-guided DNA binding agent is SpyCas9. In some embodiments, the guide RNA is a Spy guide RNA. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase domain. In some embodiments the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3 A) and an RNA-guided nickase.
[0305] In some embodiments, the composition further comprises a uracil glycosylase inhibitor (UGI). In some embodiments, the composition comprises an RNA-guided DNA binding agent that the RNA-guided DNA binding agent generates a cytosine (C) to thymine (T) conversion with the CD70 genomic target sequence. In some embodiments, thecomposition comprises an RNA-guided DNA binding agent that generates an adenosine (A) to guanine (G) conversion with the CD70 genomic target sequence.
[0306] In some embodiments, the surface expression of CD70 protein (z.e., engineered cell) is thereby reduced or eliminated.
[0307] In some embodiments, an engineered cell produced by the methods described herein is provided. In some embodiments, the compositions disclosed herein further comprise a pharmaceutically acceptable carrier. In some embodiments, a cell produced by the compositions disclosed herein comprising a pharmaceutically acceptable carrier is provided. In some embodiments, compositions comprising the cells disclosed herein are provided.2. CD70 guide RNAs
[0308] The methods and compositions provided herein disclose guide RNAs useful for reducing or eliminating the surface expression of CD70 protein. In some embodiments, such guide RNAs direct an RNA-guided DNA binding agent to a CD70 genomic target sequence and may be referred to herein as “CD70 guide RNA.” In some embodiments, the CD70 guide RNA directs an RNA-guided DNA binding agent to a human CD70 genomic target sequence. In some embodiments, the CD70 guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-38 and 101-169. In some embodiments, the CD70 guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-38.
[0309] In some embodiments, a composition is provided comprising a guide RNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
[0310] In some embodiments, a composition is provided comprising a single-guide RNA (sgRNA) comprising a guide sequence selected from SEQ ID NOs: 1-38 and 101-169. In some embodiments, a composition is provided comprising CD70 sgRNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
[0311] In some embodiments, a composition is provided comprising a CD70 dual- guide RNA (dgRNA) comprising a guide sequence selected from SEQ ID NOs: 1-38 and 101-169. In some embodiments, a composition is provided comprising an CD70 dgRNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
[0312] In some embodiments, the CD70 gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 1-38 and 101-169. Exemplary CD70 target and guide sequences areshown below in Tables 2A (SEQ ID NO: 1-38) and Table 3A (SEQ ID NOs: 101-169). The guide sequence disclosed in this Table may be unmodified, modified with the exemplary modification pattern shown in the Table, or modified with a different modification pattern disclosed herein or available in the art.Table 2A. Exemplary CD70 Nme guide RNA genomic coordinates and guide sequencesTable 2B. Exemplary full and modified Nme guide RNAsTable 3A. Exemplary CD70 Spy guide RNA target coordinates and guide sequencesTable 3B. Exemplary full and modified Spy guide RNAs
[0313] In some embodiments, the CD70 gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 1-38 and 101-169. In some embodiments, the CD70 gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 1-38.
[0314] In some embodiments, the CD70 guide RNA comprises SEQ ID NO: 1. In some embodiments, the CD70 guide RNA comprises a sequence of any one of the guide RNA sequences as shown in Table 2B.
[0315] In some embodiments, the CD70 gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 1-38. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-38 In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-38. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-38.
[0316] In some embodiments, the genetic modification is within genomic coordinates targeted by a guide RNA comprising the guide sequence of SEQ ID NO: 1 or 16.
[0317] In some embodiments, the CD70 guide RNA comprises a guide sequence that comprises at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listedin Table 2A. As used herein, at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate means, for example, at least 10 contiguous nucleotides within the genomic coordinates wherein the genomic coordinates include 10 nucleotides in the 5’ direction and 10 nucleotides in the 3’ direction from the ranges listed in Table 2A. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence that comprises 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2A. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from a sequence that is 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence that comprises 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2A. In some embodiments, the CD70 guide RNA comprises a guide sequence that comprises at least 20 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2A.
[0318] In some embodiments, the CD70 gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 101-139. In some embodiments, the CD70 gRNA comprises a guide sequence selected from any one of SEQ ID NOs: 125, 127, 128, 134, and 140-169. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 101-169. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 95%, 90%, or 85%identical to a sequence selected from SEQ ID NOs: 101-169. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 95% identical to a sequence selected from SEQ ID NOs: 101-169. In some embodiments, the guide RNA comprises a sequence of any one of the guide RNA sequences as shown in Table 3B.
[0319] In some embodiments, the guide RNA comprises a guide sequence of any one of SEQ ID NOs: 101, 104, 109, 115, 116, and 123. In some embodiments, the guide RNA comprises a guide sequence of any one of SEQ ID NOs: 125, 157, 160, 162, 164, and 168.
[0320] In some embodiments, the CD70 guide RNA comprises a guide sequence that comprises at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 3A. As used herein, at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate means, for example, at least 10 contiguous nucleotides within the genomic coordinates wherein the genomic coordinates include 10 nucleotides in the 5’ direction and 10 nucleotides in the 3’ direction from the ranges listed in Table 3A. For example, a CD70 guide RNA may comprise 10 contiguous nucleotides within the genomic coordinates: chrl9:6590998-6591018; chrl9:6590991-6591011; chrl9:6590939-6590959;chrl9:6590972-6590992; chrl9:6590940-6590960; and chrl9:6590907-6590927, including the boundary nucleotides of these ranges. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence that comprises 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 3A. In some embodiments, the CD70 guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from a sequence that is 17, 18, 19, or 20 contiguous nucleotides of a sequence that comprises 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 3A.
[0321] In some embodiments, the Table 3A guide RNA comprises a guide sequence that comprises at least 15 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 3A. In some embodiments, the CD70 guide RNA comprises a guide sequence that comprises at least 20 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 3A.
[0322] Additional embodiments of CD70 guide RNAs are provided herein, including e.g., exemplary modifications to the guide RNA.3. Genetic modifications to CD70
[0323] In some embodiments, the methods and compositions disclosed herein genetically modify at least one nucleotide in the CD70 gene in a cell. Genetic modifications encompass the population of modifications that results from contact with a gene editing system (e.g., the population of edits that result from Cas9 and a CD70 guide RNA, or the population of edits that result from the base editor and an CD70 guide RNA).
[0324] In some embodiments, the genetic modification is within the genomic coordinates chrl9:586028-6591018. In some embodiments, the genetic modification comprises at least one nucleotide within the genomic coordinates chrl9:586028-6591018.
[0325] In some embodiments, the genetic modification is within any one of the genomic coordinates listed in Table 2A and 3A. In some embodiments, the genetic modification comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides within any one of the genomic coordinates listed in Table 2A and 3 A.
[0326] In some embodiments, the genetic modification comprises at least one nucleotide within the genomic coordinates chosen from: chrl9:6590121-6590145; chrl9:6586002- 6586026; chrl9:6586003-6586027; chrl9:6586013-6586037; chrl9:6586357-6586381; chrl9:6586365-6586389; chrl9:6586376-6586400; chrl9:6590988-6591012; chrl9:6590991-6591015; chrl9:6590862-6590886; chrl9:6586396-6586420;chrl9:6586372-6586396; chrl9:6586371-6586395; chrl9:6586360-6586384; chrl9:6586355-6586379; chrl9:6586268-6586292; chrl9:6586259-6586283; chrl9:6586256-6586280; chrl9:6586142-6586166; chrl9:6586141-6586165; chrl9:6586135-6586159; chrl9:6586128-6586152; chrl9:6586127-6586151; chrl9:6586126-6586150; chrl9:6586121-6586145; chrl9:6586120-6586144; chrl9:6586096-6586120; chrl9:6586055-6586079; chrl9:6586029-6586053; chrl9:6586023-6586047; chrl9:6586312-6586336; chrl9:6586151-6586175; chrl9:6586145-6586169; chrl9:6586100-6586124; chrl9:6586030-6586054; chrl9:6586028-6586052; chrl9:6586395-6586419; and chrl9:6586394-6586418. In some embodiments, the genetic modification comprises at least one nucleotide within the genomic coordinates chosen from: chrl9:6590121-6590145 and chrl9:6586268-6586292.
[0327] In some embodiments, the genetic modification comprises at least one nucleotide within the genomic coordinates chosen from: chrl9:6590998-6591018; chr 19:6590995- 6591015; chrl9:6590992-6591012; chrl9:6590991-6591011; chrl9:6590987-6591007; chrl9:6590986-6591006; chrl9:6590985-6591005; chrl9:6590977-6590997; chrl9:6590972-6590992; chrl9:6590966-6590986; chrl9:6590958-6590978; chrl9:6590957-6590977; chrl9:6590945-6590965; chrl9:6590944-6590964; chrl9:6590940-6590960; chrl9:6590939-6590959; chrl9:6590935-6590955; chrl9:6590926-6590946; chrl9:6590920-6590940; chrl9:6590919-6590939; chrl9:6590914-6590934; chrl9:6590908-6590928; chrl9:6590907-6590927; chrl9:6590899-6590919; chrl9:6590875-6590895; chrl9:6590866-6590886; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6586374-6586394; chrl9:6586368-6586388; chrl9:6586288-6586308; chrl9:6586285-6586305; chrl9:6586276-6586296; chrl9:6586267-6586287; chrl9:6586199-6586219; chrl9:6586172-6586192; chrl9:6586138-6586158; chrl9:6586099-6586119; and chrl9:6586050-6586070.
[0328] In some embodiments, the genetic modification comprises at least one nucleotide within the genomic coordinates chosen from: chr 19:6590875-6590895; chrl9:6590844- 6590864; chrl9:6590843-6590863; chrl9:6590835-6590855; chrl9:6590104-6590124; chrl9:6590096-6590116; chrl9:6590095-6590115; chrl9:6590094-6590114; chrl9:6590093-6590113; chrl9:6590087-6590107; chrl9:6590084-6590104; chrl9:6590083-6590103; chrl9:6590078-6590098; chrl9:6586368-6586388; chrl9:6586299-6586319; chrl9:6586267-6586287; chrl9:6590842-6590862; chrl9:6590139-6590159; chrl9:6590138-6590158; chrl9:6590135-6590155;chrl9:6590079-6590099; chrl9:6590077-6590097; chrl9:6586412-6586432; chrl9:6586404-6586424; chrl9:6586403-6586423; chrl9:6586396-6586416; chrl9:6586396-6586416; chrl9:6586395-6586415; chrl9:6586388-6586408; chrl9:6586380-6586400; chrl9:6586379-6586399; chrl9:6586375-6586395; chrl9:6586369-6586389; chrl9:6586367-6586387; chrl9:6586360-6586380; chrl9:6586359-6586379; chrl9:6586120-6586140; and chrl9:6586028-6586048.
[0329] In some embodiments, the genetic modification comprises at least one nucleotide within the genomic coordinates chosen from: chrl9:6590998-6591018; chrl9:6590991- 6591011; chrl9:6590939-6590959; chrl9:6590972-6590992; chrl9:6590940-6590960; and chrl9:6590907-6590927.
[0330] In some embodiments, the genetic modification comprises at least one nucleotide within the genomic coordinates chosen from: chr 19:6590875-6590895; chrl9:6590844- 6590864; chrl9:6590843-6590863; chrl9:6586368-6586388; and chrl9:6586267-658628.
[0331] In some embodiments, the modification to CD70 comprises any one or more of an insertion, deletion, substitution, or deamination of at least one nucleotide in a target sequence. In some embodiments, the modification to CD70 comprises an insertion of 1, 2, 3, 4 or 5 or more nucleotides in a target sequence. In some embodiments, the modification to CD70 comprises a deletion of 1, 2, 3, 4 or 5 or more nucleotides in a target sequence. In other embodiments, the modification to CD70 comprises an insertion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or 25 or more nucleotides in a target sequence. In other embodiments, the modification to CD70 comprises a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or 25 or more nucleotides in a target sequence. In some embodiments, the modification to CD70 comprises an indel, which is generally defined in the art as an insertion or deletion of less than 1000 base pairs (bp). In some embodiments, the modification to CD70 comprises an indel which results in a frameshift mutation in a target sequence. In some embodiments, the modification to CD70 comprises a substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or 25 or more nucleotides in a target sequence. In some embodiments, the modification to CD70 comprises one or more of an insertion, deletion, or substitution of nucleotides resulting from the incorporation of a template nucleic acid. In some embodiments, the modification to CD70 comprises an insertion of a donor nucleic acid in a target sequence. In some embodiments, the modification to CD70 is not transient.
[0332] In some embodiments, the genetic modification results in a change in the nucleic acid sequence that prevents translation of a full-length protein having an amino acid sequence of the full-length protein prior to genetic modification.
[0333] In some embodiments, the genetic modification results in a change in the nucleic acid sequence that results in a premature stop codon in a coding sequence of the full-length protein. In some embodiments, the genetic modification results in a change in the nucleic acid sequence that results in a change in splicing of a pre-mRNA from the genomic locus. In some embodiments, the inhibition results in reduced cell surface expression of a protein from the gene comprising a genetic modification.4. Efficacy of guide RNAs
[0334] The efficacy of a CD70 guide RNA may be determined by techniques available in the art that assess the editing efficiency of a guide RNA, and the surface expression of CD70 protein. In some embodiments, the reduction or elimination of surface expression of CD70 protein may be determined by comparison to an unmodified cell (or “relative to an unmodified cell”). An engineered cell or cell population may also be compared to a population of unmodified cells.
[0335] An “unmodified cell” (or “unmodified cells”) refers to a control cell (or cells) of the same type of cell in an experiment or test, wherein the “unmodified” control cell has not been contacted with a CD70 guide. Therefore, an unmodified cell (or cells) may be a cell that has not been contacted with a guide RNA, or a cell that has been contacted with a guide RNA that does not target CD70.
[0336] In some embodiments, the efficacy of a CD70 guide RNA is determined by measuring levels of surface expression of CD70 protein. In some embodiments, CD70 protein levels are measured by flow cytometry (e.g., with an antibody against CD70). Surface expression of CD70 protein may be measured by flow cytometry as commonly known in the art. One skilled in the art will be familiar with techniques for measuring surface expression of protein such as CD70 protein, by flow cytometry. An exemplary measurement of levels of surface expression of CD70 protein by flow cytometry is discussed in Examples 1-6. In some embodiments, the population of cells is enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% CD70 negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is not enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% CD70 negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 65% CD70 negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 70% CD70 negative as measured byflow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 80% CD70 negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 90% CD70 negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 100% CD70 negative as measured by flow cytometry relative to a population of unmodified cells.Methods and Compositions for Additional Genetic Modifications
[0337] In some embodiments, multiplex gene editing may be performed in a cell. In some embodiments, the methods comprise reducing or eliminating surface expression of CD70 protein comprising genetically modifying the CD70 gene comprising contacting the cell with a composition comprising a CD70 guide RNA disclosed herein; and optionally an RNA- guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent, the method further comprising contacting with one or more compositions selected from: (a) a guide RNA that directs an RNA-guided DNA binding agent to the TGFBR2 gene; (b) a guide RNA that directs an RNA-guided DNA binding agent to a locus in the genome of the cell other than CD70; and (c) a donor nucleic acid for insertion in the genome of the cell.
[0338] In some embodiments, an engineered cell which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell is provided, that further has reduced or eliminated surface expression of one or more of MHC class II protein, MHC-I protein, TRAC, or TRBC. Such methods and compositions for reduced or eliminated surface expression of one or more of MHC class II protein, MHC-I protein, TRAC, or TRBC are further described in e.g., International Publication Nos. WO 2020 / 081613, WO 2022 / 125982, WO 2022 / 140586, and WO 2022 / 140587, and International Application Nos.PCT / US2023 / 068498 and PCT / US2023 / 068499, the contents of each of which are hereby incorporated in their entireties. For example, further detailed description of the guide RNAs for reducing or eliminating the expression of TRBC and / or TRAC proteins and for genetic modifications of TRBC and / or TRAC are provided in International Publication No.WO 2020 / 081613, the entire contents of which are incorporated herein by reference. For example, further detailed description of the guide RNAs for reducing or eliminating the expression of HLA-A and / or CIITA proteins and for genetic modifications of HLA-A and / or OITA are provided in International Publication No. WO 2022 / 125982, the entire contents of which are incorporated herein by reference. For example, further detailed description of the guide RNAs for reducing or eliminating the expression of HLA-A protein and for geneticmodifications of HLA-A are provided in International Publication No. WO 2022 / 140586, the entire contents of which are incorporated herein by reference. For example, further detailed description of the guide RNAs for reducing or eliminating the expression of HLA-A and / or OITA proteins and for genetic modifications of HLA-A and / or OITA are provided in International Publication No. WO 2022 / 140587, the entire contents of which are incorporated herein by reference. For example, further detailed description of the guide RNAs for reducing or eliminating the expression of HLA-A and / or HLA-B proteins and for genetic modifications of HLA-A and / or HLA-B are provided in International Application No. PCT / US2023 / 068498, the entire contents of which are incorporated herein by reference. For example, further detailed description of the guide RNAs for reducing or eliminating the expression of HLA-A, TRAC, TRBC, and / or CIITA proteins and for genetic modifications of HLA-A, TRAC, TRBC, and / or CIITA are provided in International Application No. PCT / US2023 / 068499, the entire contents of which are incorporated herein by reference.
[0339] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in the CD70 gene, wherein the genetic modification comprises at least one nucleotide within any one of the genomic coordinates shown in Tables 2 A and 3 A, and wherein the engineered cell further comprises a genetic modification in one or more of CIITA, HLA-A, HLA-B, TRAC, or TRBC gene.
[0340] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in the CD70 gene, wherein the genetic modification comprises at least one nucleotide within any one of the genomic coordinates shown in Tables 2 A and 3 A, and wherein the engineered cell further comprises a genetic modification in the TGFBR2 gene. In some embodiments, the genetic modification in the TGFBR2 gene is within the genomic coordinates chr3:30674205-30674229. In some embodiments, the genetic modification in the TGFBR2 gene comprises at least one nucleotide within the genomic coordinates targeted by a TGFBR2 guide RNA comprising a guide sequence of SEQ ID NO: 301.
[0341] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in the CD70 gene, wherein the genetic modification comprises at least one nucleotide within any one of the genomic coordinates shown in Tables 2 A and 3 A, and wherein the engineered cell further comprises a genetic modification in one or more of TGFBR2, CIITA, HLA-A, HLA-B, TRAC, or TRBC gene.
[0342] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification in the CD70 gene, wherein the genetic modification comprises at least one nucleotide within any one of the genomic coordinates shown in Tables 2 A and 3 A, and wherein the engineered cell further comprises a genetic modification in one or more of TGFBR2, CIITA, HLA-A, HLA-B, or TRAC gene.
[0343] In some embodiments, the methods and compositions comprise reducing or eliminating surface expression of CD70 protein by genetically modifying CD70 with a gene editing system, and inserting an exogenous nucleic acid encoding a targeting receptor, or other polypeptide (expressed on the cell surface or secreted) into the cell by genetic modification.
[0344] In some embodiments, an engineered cell is provided which has reduced or eliminated surface expression CD70 protein relative to an unmodified cell, comprising a genetic modification in the CD70 gene, wherein the genetic modification comprises at least one nucleotide within any one of the genomic coordinates shown in Tables 2 A and 3 A, and wherein the engineered cell further comprises an exogenous nucleic acid. In some embodiments, the engineered cell comprises an exogenous nucleic acid encoding a targeting receptor that is expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a CAR or a universal CAR. In some embodiments, the targeting receptor is an anti-CD70 CAR. In some embodiments, the targeting receptor is a TCR. In some embodiments, the targeting receptor is a WT1 TCR. In some embodiments, the targeting receptor is a ligand for the receptor. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain) and a subunit of a TCR. In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a B cell receptor (BCR).
[0345] In some embodiments, the engineered cell further comprises an exogenous nucleic acid encoding a polypeptide that is secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the secreted polypeptide is an antibody. In some embodiments, the secreted polypeptide is an enzyme. In some embodiments, the exogenous nucleic acid encodes an antibody encodes a cytokine. In some embodiments, the exogenousnucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.
[0346] In some embodiments, an engineered cell which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell is provided, that further has reduced or eliminated surface expression of MHC class II protein. In some embodiments, the engineered cell has a genetic modification in a gene that reduces or eliminates surface expression of MHC class II protein.
[0347] In some embodiments, methods for reducing or eliminating surface expression of CD70 by genetically modifying CD70 as disclosed herein are provided, wherein the methods and compositions further provide for reducing or eliminating surface expression of MHC class II protein relative to an unmodified cell. In some embodiments, MHC class II protein expression is reduced or eliminated by contacting the cell with a OITA guide RNA.
[0348] MHC class II expression is impacted by a variety of proteins. In some embodiments, MHC class II protein expression is reduced or eliminated by genetically modifying a gene selected from: CIITA, HLA-DR, HLA-DQ, HLA-DP, RFX5, RFXB / ANK, RFXAP, CREB, NF-YA, NF-YB, and NF-YC. In some embodiments, MHC class II protein expression is reduced or eliminated by genetically modifying the CIITA gene.
[0349] In some embodiments, the engineered cell has a genetic modification in the CIITA gene. In some embodiments, the engineered cell has a genetic modification in the HLA-DR gene. In some embodiments, the engineered cell has a genetic modification in the HLA-DQ gene. In some embodiments, the engineered cell has a genetic modification in the HLA-DP gene. In some embodiments, the engineered cell has a genetic modification in the RFX gene. In some embodiments, the engineered cell has a genetic modification in the CREB gene. In some embodiments, the engineered cell has a genetic modification in the Nuclear Factor (NF)-gamma gene.
[0350] In some embodiments, methods are provided for making an engineered cell which has reduced or eliminated expression of CD70 protein relative to an unmodified cell, further comprising reducing or eliminating the surface expression of MHC class II protein in the cell relative to an unmodified cell. In some embodiments, the methods comprise contacting the cell with a CIITA guide RNA.
[0351] In some embodiments, an engineered cell which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell is provided, that further has reduced or eliminated surface expression of TRAC protein. In some embodiments, an engineered cell which has reduced or eliminated surface expression of CD70 protein relativeto an unmodified cell is provided, that further has reduced or eliminated surface expression of TRBC protein.
[0352] In some embodiments, an engineered cell which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell is provided, that further has reduced or eliminated surface expression of HLA-A protein. In some embodiments, an engineered cell which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell is provided, that further has reduced or eliminated surface expression of HLA-B protein.
[0353] In some embodiments, the engineered cells further comprise a genetic modification in one or more of the HLA-A, HLA-B, TRAC, TRBC, or OITA genes. In some embodiments, the genetic modification in the HLA-A gene is within the HLA-A target genomic coordinates shown in Tables 10A-10B (e.g., chr6:29942891-29942915, chr6:29942609-29942633, or chr6:29942864-29942884). In some embodiments, the genetic modification in the HLA-B gene is within the HLA-B target genomic coordinates shown in Tables 10A-10B (e.g., chr6:31355222-31355246, chr6:31355221-31355245, or chr6:31355205-31355229). In some embodiments, the genetic modification in the TRAC gene is within the TRAC target genomic coordinates shown in Tables 10A-10B (e.g., chr 14:22547524- 22547544, chrl4:22550574-22550598, or chrl4:22550544-22550568). In some embodiments, the genetic modification in the OITA gene is within the CIITA target genomic coordinates shown in Tables 10A-10B (e.g., chrl6: 10906643-10906667, chrl6: 10907504-10907528, or chrl6:10906853-10906873). In some embodiments, the genetic modification in the TRBC gene is within the TRBC target genomic coordinates shown in Tables 10A-10B (e.g., chr7: 142792690- 142792714 or chr7 :142792047 - 142792067).
[0354] In some embodiments, the genetic modification in the TGFBR2 gene is within the TGFBR2 target genomic coordinates shown in Tables 10A-10B (such as chr3: 30674205- 30674229; chr3:30671674-30671698; chr3:30674167-30674191; chr3:30671941-30671961; or chr3:30671739-30671759).
[0355] In some embodiments, the engineered cells further comprise a genetic modification in one or more of the HLA-A, HLA-B, TRAC, TRBC, or CIITA genes. In some embodiments, the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates targeted by an HLA-A guide RNA comprising a guide sequence of SEQ ID NO: 403 or 404. In some embodiments, the genetic modification in the HLA-B gene comprises at least one nucleotide within the genomic coordinates targeted by anHLA-B guide RNA comprising a guide sequence of SEQ ID NO: 406, 405 or 407. In some embodiments, the genetic modification in the TRAC gene comprises at least one nucleotide within the genomic coordinates targeted by a TRAC guide RNA comprising a guide sequence of SEQ ID NO: 413, 408, or 409. In some embodiments, the genetic modification in the OITA gene comprises at least one nucleotide within the genomic coordinates targeted by a OITA guide RNA comprising a guide sequence of SEQ ID NO: 402 or 401. In some embodiments, the genetic modification in the TRBC comprises at least one nucleotide within the genomic coordinates targeted by a TRBC guide RNA comprising a guide sequence of SEQ ID NO: 410 or 414.
[0356] In some embodiments, the genetic modification in the TGFBR2 gene comprises at least one nucleotide within the genomic coordinates targeted by a TGFBR2 guide RNA comprising a guide sequence of SEQ ID NO: 301 or 302.
[0357] In some embodiments, in any of the methods and compositions disclosed herein, the HLA-A guide RNA is an HLA-A guide RNA that comprises a guide sequence disclosed in Tables 10A-10B, such as a guide sequence selected from SEQ ID NOs: 403, 404, and 412. In some embodiments, in any of the methods and compositions disclosed herein, the HLA-B guide RNA is an HLA-B guide RNA that that comprises a guide sequence disclosed in Tables 10A-10B, such as a guide sequence selected from SEQ ID NOs: 405-407. In some embodiments, in any of the methods and compositions disclosed herein, the TRAC guide RNA is a TRAC guide RNA that comprises a guide sequence disclosed in Tables 10A-10B, such as a guide sequence selected from SEQ ID NOs: 413, 408, and 409. In some embodiments, in any of the methods and compositions disclosed herein, the CIITA guide RNA is a CIITA guide RNA that that comprises a guide sequence disclosed in Tables 10A- 10B, such as a guide sequence selected from SEQ ID NOs: 402, 401, and 411. In some embodiments, in any of the methods and compositions disclosed herein, the TRBC guide RNA is a TRBC guide RNA that that comprises a guide sequence disclosed in Tables 10A- 10B, such as a guide sequence selected from SEQ ID NOs: 410 and 414.
[0358] In some embodiments, in any of the methods and compositions disclosed herein, the TGFBR2 guide RNA is a TGFBR2 guide RNA that that comprises a guide sequence disclosed in Tables 10A-10B, such as a guide sequence selected from SEQ ID NOs: 301, 302, 303, 371, and 372.
[0359] In some embodiments, in any of the methods and compositions disclosed herein, the HLA-A guide RNA disclosed herein is a single guide RNA comprising the sequence disclosed in Tables 10A-10B targeting HLA-A. In some embodiments, in any of the methodsand compositions disclosed herein, the HLA-B guide RNA disclosed herein is a single guide RNA comprising the sequence disclosed in Tables 10A-10B targeting HLA-B. In some embodiments, in any of the methods and compositions disclosed herein, the CIITA guide RNA disclosed herein is a single guide RNA comprising the sequence disclosed in Tables 10A-10B targeting CIITA. In some embodiments, in any of the methods and compositions disclosed herein, the TRAC guide RNA disclosed herein is a single guide RNA comprising the sequence disclosed in Tables 10A-10B targeting TRAC. In some embodiments, in any of the methods and compositions disclosed herein, the TRBC guide RNA disclosed herein is a single guide RNA comprising the sequence disclosed in Tables 10A-10B targeting TRBC. In some embodiments, in any of the methods and compositions disclosed herein, the TGFBR2 guide RNA disclosed herein is a single guide RNA comprising the sequence disclosed in Tables 10A-10B targeting TGFBR2.
[0360] In some embodiments, the guide RNA disclosed herein comprises a single guide RNA that comprises a guide sequence disclosed in Table 10A and is modified according to a pattern selected from SEQ ID NOs: 710-732, wherein the N’s are collectively the guide sequence. In some embodiments, the guide RNA disclosed herein comprises a single guide RNA that comprises a guide sequence disclosed in Table 10B and is modified according to a pattern selected from SEQ ID NOs: 620, 641, 658, and 669, wherein the N’s are collectively the guide sequence.
[0361] In some embodiments, an engineered cell is provided which has a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, a genetic modification in the CIITA gene, and a genetic modification in the CD70 gene, wherein the genetic modification in the HLA-A gene is within the genomic coordinates chr6:29942891-29942915; wherein the genetic modification in the HLA-B gene is within the genomic coordinates chr6:31355222-31355246; wherein the genetic modification in the TRAC gene is within the genomic coordinates chrl4:22547524- 22547544; wherein the genetic modification in the CIITA gene is within the genomic coordinates chrl6: 10906643-10906667; and wherein the genetic modification in the CD70 gene is within the genomic coordinates chr 19:6590121-6590145.
[0362] In some embodiments, the engineered cell provided herein is produced by a genomic editing system comprising, or the compositions provided herein comprises, one or more of a HLA-A guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 403, a HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100%identity to SEQ ID NO: 406, a OITA guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 402, a CD70 guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 1, and a TRAC guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 413.
[0363] In some embodiments, the engineered cell provided herein is produced by a genomic editing system comprising a gRNA that targets the HLA-A locus comprising a guide sequence of SEQ ID NO: 403, a gRNA that targets the HLA-B locus comprising a guide sequence of SEQ ID NO: 406, a gRNA that targets the CIITA locus comprising a guide sequence of SEQ ID NO: 402, a gRNA that targets the CD70 locus comprising a guide sequence of SEQ ID NO: 1, and a gRNA that targets the TRAC locus comprising a guide sequence of SEQ ID NO: 413.
[0364] In some embodiments, the engineered cell provided herein is produced by a genomic editing system comprising, or the compositions provided herein comprises, one or more of a gRNA that targets the HLA-A locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 446, a gRNA that targets the HLA-B locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 452, a gRNA that targets the CIITA locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 444, and a gRNA that targets the CD70 locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 52, and a gRNA that targets the TRAC locus a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 464.
[0365] In some embodiments, the engineered cell provided herein is produced by a genomic editing system comprising a guide RNA comprising the sequence of SEQ ID NO: 446, a gRNA comprising the sequence of SEQ ID NO: 452, a gRNA comprising the sequence of SEQ ID NO: 444, a gRNA comprising the sequence of SEQ ID NO: 52, and a gRNA comprising the sequence of SEQ ID NO: 464.
[0366] In some embodiments, an engineered cell is provided which has a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, a genetic modification in the TGFBR2 gene, and / or a genetic modification in the CD70 gene, wherein the genetic modification in the HLA-A gene is within the genomic coordinates chr6:29942891-29942915; wherein the genetic modificationin the HLA-B gene is within the genomic coordinates chr6:31355222-31355246; wherein the genetic modification in the TRAC gene is within the genomic coordinates chrl4:22547524- 22547544; wherein the genetic modification in the CIITA gene is within the genomic coordinates chrl6: 10906643-10906667; wherein the genetic modification in the TGFBR2 gene is within the genomic coordinates chr3:30674205-30674229; and wherein the genetic modification in the CD70 gene is within the genomic coordinates chrl9:6590121-6590145.
[0367] In some embodiments, the engineered cell provided herein is produced by a genomic editing system comprising, or the compositions provided herein comprises, one or more of a HL A- A guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 403, a HLA-B guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 406, a CIITA guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 402, a TGFBR2 guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 301, a CD70 guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 1, and a TRAC guide RNA comprising a guide sequence having at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 413.
[0368] In some embodiments, the engineered cell provided herein is produced by a genomic editing system comprising, or the compositions provided herein comprises, a gRNA that targets the HLA-A locus comprising a guide sequence of SEQ ID NO: 403, a gRNA that targets the HLA-B locus comprising a guide sequence of SEQ ID NO: 406, a gRNA that targets the CIITA locus comprising a guide sequence of SEQ ID NO: 402, a gRNA that targets the TGFBR2 locus comprising a guide sequence of SEQ ID NO: 301, and a gRNA that targets the CD70 locus comprising a guide sequence of SEQ ID NO: 1, and a gRNA that targets the TRAC locus comprising a guide sequence of SEQ ID NO: 413.
[0369] In some embodiments, the engineered cell provided herein is produced by a genomic editing system comprising, or the compositions provided herein comprises, one or more of a gRNA that targets the HLA-A locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 446, a gRNA that targets the HLA-B locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 452, a gRNA that targets the CIITA locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 444, a gRNA that targets the TGFBR2 locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%,98%, 99% or 100% identity to SEQ ID NO: 342, and a gRNA that targets the CD70 locus comprising a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 52, and a gRNA that targets the TRAC locus a sequence at least 90%, 93%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 464.
[0370] In some embodiments, the engineered cell provided herein is produced by a genomic editing system comprising, or the compositions provided herein comprises, a guide RNA comprising the sequence of SEQ ID NO: 446, a gRNA comprising the sequence of SEQ ID NO: 452, a gRNA comprising the sequence of SEQ ID NO: 444, a gRNA comprising the sequence of SEQ ID NO: 342, and a gRNA comprising the sequence of SEQ ID NO: 52, and a gRNA comprising the sequence of SEQ ID NO: 464.
[0371] In some embodiments, in any of the engineered cells provided herein, the engineered cell comprises a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, and a genetic modification in the OITA gene. In some embodiments, the engineered cell comprises a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, a genetic modification in the OITA gene, and a genetic modification in the TGFBR2 gene.
[0372] In some embodiments, the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chr 14:22547524-22547544; and iv. a genetic modification in the OITA gene within the genomic coordinates chrl6: 10906643-10906667. In some embodiments, the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chrl4:22547524-22547544; iv. a genetic modification in the OITA gene within the genomic coordinates chrl6:10906643-10906667; and v. a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229. In some embodiments, the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chrl4:22547524-22547544; iv. a genetic modification in the CIITA gene within the genomic coordinateschrl6:10906643-10906667; v. a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229; and vi. a genetic modification in the CD70 gene within the genomic coordinates chrl9:6590121-6590145.
[0373] In some embodiments, provided herein is an engineered human cell comprising a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891- 29942915, a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246, a genetic modification in the OITA gene within the genomic coordinates chrl6: 10906643-10906667, a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229, a genetic modification in the TRAC gene within the genomic coordinates chrl4:22547524-22547544, and a genetic modification in the CD70 gene within the genomic coordinates chrl9:6590121-6590145.Exogenous nucleic acids knock in
[0374] In some embodiments, the present disclosure provides methods and compositions for reducing or eliminating surface expression of CD70 protein by genetically modifying CD70 as disclosed herein, wherein the methods and compositions further provide for expression of a protein encoded by an exogenous nucleic acid (e.g., an antibody, chimeric antigen receptor (CAR), T cell receptor (TCR), cytokine or cytokine receptor, chemokine or chemokine receptor, enzyme, fusion protein, or other type of cell surface bound or soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a protein that is expressed on the cell surface. For example, in some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the cell surface (described further herein). In some embodiments, the genetically modified cell may function as a “cell factory” for the expression of a secreted polypeptide encoded by an exogenous nucleic acid, including e.g., as a source for continuous production of a polypeptide in vivo (as described further herein). In some embodiments, the cell is an allogeneic cell.
[0375] In some embodiments, the methods comprise reducing surface expression of CD70 protein comprising genetically modifying the CD70 gene comprising contacting the cell with a composition comprising a CD70 guide RNA disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid.
[0376] In some embodiments, the methods comprise reducing or eliminating surface expression of CD70 protein, comprising genetically modifying the cell with one or more compositions comprising a CD70 guide RNA as disclosed herein, an exogenous nucleic acidencoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
[0377] In some embodiments, the methods comprise reducing or eliminating surface expression of CD70 protein and MHC class II protein, comprising genetically modifying the cell with one or more compositions comprising a CD70 guide RNA as disclosed herein, a OITA guide RNA, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA- guided DNA binding agent.
[0378] In some embodiments, the exogenous nucleic acid encodes a polypeptide that is expressed on the surface of the cell. In some embodiments, the exogenous nucleic acid encodes a soluble polypeptide. As used herein, “soluble” polypeptide refers to a polypeptide that is secreted by the cell. In some embodiments, the soluble polypeptide is a therapeutic polypeptide. In some embodiments, the soluble polypeptide is an antibody. In some embodiments, the soluble polypeptide is an enzyme. In some embodiments, the soluble polypeptide is a cytokine. In some embodiments, the soluble polypeptide is a chemokine. In some embodiments, the soluble polypeptide is a fusion protein.
[0379] In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an antibody fragment (e.g., Fab, Fab2). In some embodiments, the exogenous nucleic acid encodes is a full-length antibody. In some embodiments, the exogenous nucleic acid encodes is a single-chain antibody (e.g., scFv). In some embodiments, the antibody is an IgG, IgM, IgD, IgA, or IgE. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgGl antibody. In some embodiments, the antibody is an IgG4 antibody. In some embodiments, the heavy chain constant region contains mutations known to reduce effector functions. In some embodiments, the heavy chain constant region contains mutations known to enhance effector functions. In some embodiments, the antibody is a bispecific antibody. In some embodiments, the antibody is a single-domain antibody (e.g., VH domain-only antibody).
[0380] In some embodiments, the exogenous nucleic acid encodes a neutralizing antibody. A neutralizing antibody neutralizes the activity of its target antigen. In some embodiments, the antibody is a neutralizing antibody against a virus antigen. In some embodiments, the antibody neutralizes a target viral antigen, blocking the ability of the virus to infect a cell. In some embodiments, a cell-based neutralization assay may be used to measure the neutralizing activity of an antibody. The particular cells and readout will depend on the target antigen of the neutralizing antibody. The half maximal effective concentration (ECso) of the antibodycan be measured in a cell -based neutralization assay, wherein a lower EC50 is indicative of more potent neutralizing antibody.
[0381] In some embodiments, the exogenous nucleic acid encodes an antibody that binds to an antigen associated with a disease or disorder (see e.g., diseases and disorders described in Section XI).
[0382] In some embodiments, the exogenous nucleic acid encodes a polypeptide that is expressed on the surface of the cell (i.e., a cell surface bound protein). In some embodiments, the exogenous nucleic acid encodes a targeting receptor. A “targeting receptor” is a receptor present on the surface of a cell, e.g., a T cell, to permit binding of the cell to a target site, e.g., a specific cell or tissue in an organism. In some embodiments, the targeting receptor is a CAR. In some embodiments, the targeting receptor is a universal CAR (UniCAR). In some embodiments, the targeting receptor is a proliferation-inducing ligand (APRIL). In some embodiments, the targeting receptor is a TCR. In some embodiments, the targeting receptor is a TRuC. In some embodiments, the targeting receptor is a B cell receptor (BCR) (e.g., expressed on a B cell). In some embodiments, the targeting receptor is chemokine receptor. In some embodiments, the targeting receptor is a cytokine receptor.
[0383] In some embodiments, targeting receptors include a chimeric antigen receptor (CAR), a T-cell receptor (TCR), and a receptor for a cell surface molecule operably linked through at least a transmembrane domain in an internal signaling domain capable of activating a T cell upon binding of the extracellular receptor portion. In some embodiments, a CAR refers to an extracellular antigen recognition domain, e.g., an scFv, VHH, nanobody; operably linked to an intracellular signaling domain, which activates the T cell when an antigen is bound. CARs are composed of four regions: an antigen recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T-cell signaling domain. Such receptors are well known in the art (see, e.g., W02020092057, WO2019191114, WO2019147805, WO2018208837). A universal CAR (UniCAR) for recognizing various antigens (see, e.g., EP 2 990 416 Al) and a reversed universal CAR (RevCAR) that promotes binding of an immune cell to a target cell through an adaptor molecule (see, e.g., WO2019238722) are also contemplated. CARs can be targeted to any antigen to which an antibody can be developed and are typically directed to molecules displayed on the surface of a cell or tissue to be targeted. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR (e.g., a TRuC). (See Baeuerle et al. Nature Communications 2087 (2019).)
[0384] In some embodiments, the exogenous nucleic acid encodes a TCR. In some embodiments, the exogenous nucleic acid encodes a genetically modified TCR. In some embodiments, the exogenous nucleic acid encodes is a genetically modified TCR with specificity for a polypeptide expressed by cancer cells. In some embodiments, the exogenous nucleic acid encodes a targeting receptor specific for Wilms’ tumor gene (WT1) antigen. In some embodiments, the exogenous nucleic acid encodes the WT1 -specific TCR (see e.g., W02020 / 081613A1).
[0385] In some embodiments, an exogenous nucleic acid is inserted into the genome of the target cell. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by homologous recombination (HR). In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by blunt end insertion. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by non-homologous end joining. In some embodiments, the exogenous nucleic acid is integrated into a safe harbor locus in the genome of the cell. In some embodiments, the exogenous nucleic acid is integrated into one of the TRAC locus, B2M locus, AAVS1 locus, or CIITA locus. In some embodiments, the lipid nucleic acid assembly composition is a lipid nanoparticle (LNP).
[0386] In some embodiments, the methods produce a composition comprising an engineered cell having reduced or eliminated surface expression of CD70 protein and comprising an exogenous nucleic acid. In some embodiments, the methods produce a composition comprising an engineered cell having reduced or eliminated surface expression of CD70 protein and that secretes or expresses a polypeptide encoded by an exogenous nucleic acid integrated into the genome of the cell. In some embodiments, the methods produce a composition comprising an engineered cell having reduced or eliminated surface expression of CD70 protein, or reduced or eliminated CD70 levels in the cell nucleus, and having reduced or eliminated surface expression of one or more additional protein expression (e.g., HLA-A, HLA-B, CIITA, TRAC, or TRBC), and secreting or expressing a polypeptide encoded by an exogenous nucleic acid integrated into the genome of the cell.
[0387] In some embodiments, the present disclosure provides methods for reducing or eliminating surface expression of CD70 protein by genetically modifying CD70 as disclosed herein, wherein the methods further provide for reducing expression of one or more additional target genes (e.g., HLA-A, HLA-B, CIITA, TRAC, or TRBC). In someembodiments, the additional genetic modifications provide further advantages for use of the genetically modified cells for adoptive cell transfer applications.
[0388] In some embodiments, the methods comprise reducing or eliminating surface expression of CD70 protein, comprising genetically modifying the cell with one or more compositions comprising a CD70 guide RNA as disclosed herein, a CIITA guide RNA, an exogenous nucleic acid encoding polypeptide (e.g., a targeting receptor), a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing or eliminating expression of the other gene, and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent. In some embodiments, the additional target gene is TRAC. In some embodiments, the additional target gene is TRBC.Exemplary Genome Editing Systems
[0389] Various suitable gene editing systems may be used to make the engineered cells disclosed herein, including but not limited to the CRISPR / Cas system; zinc finger nuclease (ZFN) system; and the transcription activator-like effector nuclease (TALEN) system. Generally, the gene editing systems involve the use of engineered cleavage systems to induce a double strand break (DSB) or a nick (e.g., a single strand break, or SSB) in a target DNA sequence. Cleavage or nicking can occur through the use of specific nucleases such as engineered ZFN, TALENs, or using the CRISPR / Cas system with an engineered guide RNA to guide specific cleavage or nicking of a target DNA sequence. Further, targeted nucleases are being developed based on the Argonaute system (e.g., from T. thermophilus, known as ‘TtAgo’, see Swarts et al (2014) Nature 507(7491): 258-261), which also may have the potential for uses in gene editing and gene therapy.
[0390] In some embodiments, the gene editing system is a TALEN system. Transcription activator-like effector nucleases (TALEN) are restriction enzymes that can be engineered to cut specific sequences of DNA. They are made by fusing a TAL effector DNA-binding domain to a DNA cleavage domain (a nuclease which cuts DNA strands). Transcription activator-like effectors (TALEs) can be engineered to bind to a desired DNA sequence, to promote DNA cleavage at specific locations (see, e.g., Boch, 2011, Nature Biotech). The restriction enzymes can be introduced into cells, for use in gene editing or for gene editing in situ, a technique known as gene editing with engineered nucleases. Such methods and compositions for use therein are known in the art. See, e.g., WO2019147805,W02014040370, WO2018073393, the contents of which are hereby incorporated in their entireties.
[0391] In some embodiments, the gene editing system is a zinc-finger system. Zinc-finger nucleases (ZFNs) are artificial restriction enzymes generated by fusing a zinc finger DNA- binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target specific desired DNA sequences to enable zinc-finger nucleases to target unique sequences within complex genomes. The non-specific cleavage domain from the type Ils restriction endonuclease FokI is typically used as the cleavage domain in ZFNs. Cleavage is repaired by endogenous DNA repair machinery, allowing ZFN to precisely alter the genomes of higher organisms. Such methods and compositions for use therein are known in the art. See, e.g., WO2011091324, the contents of which are hereby incorporated in their entireties.
[0392] In some embodiments, the gene editing system is a CRISPR / Cas system, including e.g., a CRISPR guide RNA comprising a guide sequence and a RNA-guided DNA binding agent, and described further herein. In some embodiments the gene editing system comprises a base editor comprising a deaminase and an RNA-guided nickase. In some embodiments the gene editing system comprises a base editor comprising a cytidine deaminase and an RNA- guided nickase. In some embodiments, the gene editing system comprises a DNA polymerase. Further description of the gene editing system methods and compositions for use therein are known in the art. See e.g., W02019 / 067910, WO2021 / 188840A1,WO2019 / 051097, and PCT / US 2021 / 062922 filed December 10, 2021, and US Provisional Application No. 63 / 275,425 filed November 3, 2021, the contents of each of which are hereby incorporated in their entireties. Exemplary nucleotide and polypeptide sequences for the gene editing system disclosed herein are provided below in Table 10. Methods for identifying alternate nucleotide sequences encoding polypeptide sequences provided herein, including alternate naturally occurring variants, are known in the art. Sequences with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to any of the nucleic acid sequences, or nucleic acid sequences encoding the amino acid sequences provided herein are also contemplated.VI. CRISPR Guide RNA
[0393] Provided herein are guide sequences useful for modifying a target sequence, e.g., using a guide RNA comprising a disclosed guide sequence with an RNA-guided DNA binding agent (e.g., a CRISPR / Cas system).
[0394] In some aspects, provided herein is a guide RNA comprising: A. a guide sequence comprising a sequence at least 80%, 85%, preferably 90%, or 95% identical to or complementary to at least 20 contiguous nucleotides of any one of the guide sequences of Tables 3A-3B.
[0395] In some embodiments, the guide RNAs provided herein further comprise one or more of: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein 1. at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl- 10, or Hl-4 and Hl-9, and the hairpin 1 region optionally lacks a. any one or two of Hl-5 through Hl-8, b. one, two, or three of the following pairs of nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl-10, and Hl-4 and Hl-9, or c. 1-8 nucleotides of hairpin 1 region; or 2. the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides; and a. one or more of positions Hl-1, Hl-2, or Hl-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) or b. one or more of positions Hl-6 through Hl-10 is substituted relative to Exemplary SpyCas9 sgRNA-l(SEQ ID NO: 601); or 3. the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, Hl-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or B. a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or C. a substitution relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) at any one or more of LS6, LS7, US3, US 10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or D. an Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US 1 -US 12 in the upper stem region.
[0396] In some embodiments, the guide RNA lacks 6 nucleotides in shortened hairpin 1.
[0397] In some embodiments, the guide RNA lacks 8 nucleotides in shortened hairpin 1.
[0398] In some embodiments, H-l and H-3 are deleted.
[0399] In some embodiments, the guide RNA further comprises a 3’ tail.
[0400] In some embodiments, the 3’ tail is 1-4 nucleotides in length, optionally 1 nucleotide in length.
[0401] In some embodiments, the guide RNA comprises an upper stem region comprising a modification to any one or more of US1-US12 in the upper stem region.
[0402] In some embodiments, the guide RNAs described herein comprise a nucleotide sequence selected from the sequences in Table 3A.
[0403] In some embodiments, the guide RNA comprises a modified nucleotide sequence selected from the modified Spy guide scaffold sequences in Table 4, wherein the modified nucleotide sequence is 3’ of the guide sequence.
[0404] In some embodiments, the guide RNAs described herein are modified according to the pattern of a nucleotide sequence selected from the modified Spy guide RNA sequences in Table 5A-5B.
[0405] In some embodiments, the guide comprises a nucleotide sequence selected from the unmodified Spy guide RNA Sequences in Table 4B, wherein the N20’s are collectively a guide sequence described herein.
[0406] In some embodiments, each nucleotide of the unmodified Spy guide RNA Sequences in Table 5B is any natural or non-natural nucleotide.
[0407] In some embodiments, the guide RNA is modified according to a pattern selected from the modification patterns in Table 5B, wherein the (mN*)3N17 refers to the guide sequence described herein in which the first three nucleotides comprises a 2’-0-Me modification and a phosphorothioate linkage.
[0408] In some embodiments, the guide RNAs described herein comprise a sequence or modification pattern set forth in Table 4A-5B.
[0409] Guide sequences targeted to sites adjacent to an appropriate PAM, e.g., a Spy Cas9 PAM, e.g., may further comprise additional nucleotides, which can be referred to as a scaffold sequence or a conserved portion, to form a crRNA or a crRNA joined to a trRNA to form a sgRNA e.g., with the following exemplary nucleotide sequence following the guide sequence at its 3’ end (Table 4A). The #mer refers to the length of the crRNA or the sgRNA when a 20 nucleotide guide sequence is included 5’ to the scaffold sequence provided in Table 4A.
[0410] In some aspects, provided is a guide RNA (gRNA) comprising a guide region and a conserved region, wherein: A. the guide region comprises a nucleic acid sequence comprising a sequence at least 80%, 85%, preferably 90%, or 95% identical to or complementary to 24 contiguous nucleotides of any one of the guide sequences of Tables 2A-2B.
[0411] In some embodiments, the conserved region comprises one or more of: (a) a shortened repeat / anti-repeat region, wherein the shortened repeat / anti-repeat region lacks 2- 24 nucleotides relative to SEQ ID NO: 700, wherein (i) one or more of nucleotides 37-48 and 53-64 is deleted relative to SEQ ID NO: 700 and optionally one or more of nucleotides 37-64is substituted relative to SEQ ID NO: 700; and (ii) nucleotide 36 is linked to nucleotide 65 by at least 2 nucleotides; or (b) a shortened hairpin 1 region, wherein the shortened hairpin 1 lacks 2-10 nucleotides, optionally 2-8 nucleotides relative to SEQ ID NO: 700 wherein (i) one or more of nucleotides 82-86 and 91-95 is deleted relative to SEQ ID NO: 700 and optionally one or more of positions 82-96 is substituted relative to SEQ ID NO: 700; and (ii) nucleotide 81 is linked to nucleotide 96 by at least 4 nucleotides; or (c) a shortened hairpin 2 region, wherein the shortened hairpin 2 lacks 2-18 nucleotides, optionally 2-16 nucleotides relative to SEQ ID NO: 700, wherein (i) one or more of nucleotides 113-121 and 126-134 is deleted relative to SEQ ID NO: 700 and optionally one or more of nucleotides 113-134 is substituted relative to SEQ ID NO: 700; and (ii) nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; wherein one or both nucleotides 144-145 are optionally deleted relative to SEQ ID NO: 700; optionally, wherein at least 10 nucleotides are modified nucleotides.
[0412] In some embodiments, the conserved region comprises a nucleotide sequence selected from Table 6A-7B.
[0413] In some embodiments, the guide RNA comprises at least one end modification.
[0414] In some embodiments, the modification comprises a 5’ end modification.
[0415] In some embodiments, the modification comprises a 3’ end modification.
[0416] In some embodiments, the guide RNA comprises a modification in a hairpin region.
[0417] In some embodiments, the modification in a hairpin region is also an end modification.
[0418] In some embodiments, the modification comprises a 2’-O-methyl (2’-0-Me) modified nucleotide.
[0419] In some embodiments, the modification comprises a phosphorothioate (PS) bond between nucleotides.
[0420] In some embodiments, the modification comprises a 2’-O-methyl (2’-0-Me) modified nucleotide with a phosphorothioate (PS) bond to a 3’ adjacent nucleotide.
[0421] In some embodiments, the modification comprises a 2 ’-fluor (2’F) modified nucleotide.
[0422] In some embodiments, the 5’ end modification comprises a 2’-O-methyl (2’-0-Me) modified nucleotide with a phosphorothioate (PS) bond to a 3’ adjacent nucleotide at nucleotides 1-3 of the 5’ end of the guide sequence.
[0423] In some embodiments, the conserved region comprises a modified nucleotide sequence selected from the modified conserved region Nme guide RNA motifs in Table 6, and wherein the conserved region is 3’ of the guide region.
[0424] In some embodiments, the guide RNA comprises a nucleotide sequence selected from any one of the guide sequences of Tables 2A-2B.
[0425] In some embodiments, each nucleotide is any natural or non-natural nucleotide.
[0426] In some embodiments, the guide RNA is modified according to a pattern selected from SEQ ID NOs: 710-732, wherein the N’s are collectively the guide sequence described herein, wherein N, A, C, G, and U are ribonucleotides (2’ -OH), wherein “m” indicates a 2’- O-Me modification, “f” indicates a 2’ -fluoro modification, and a indicates a phosphorothioate linkage between nucleotides.
[0427] In some aspects, provided herein is a composition comprising a guide RNA described herein.Table 4A: Exemplary Unmodified Spy Scaffold Sequences
[0428] In some embodiments, the guide RNA comprises a nucleotide sequence selected from the unmodified Spy guide RNA Sequences in Table 4B, wherein the N2o’s are collectively any one of the guide sequences of Tables 3A-3B. In some embodiments, eachnucleotide of the unmodified Spy guide RNA Sequences in Table 4B is any natural or nonnatural nucleotide.Table 4B: Exemplary Unmodified Spy Guide RNA SequencesWherein the Ns collectively are a guide sequence provided herein.
[0429] In the case of a sgRNA, the guide sequences may be integrated into the following modified guide scaffold motifs (Table 5A). The #mer refers to the length of the sgRNA when a 20 nucleotide guide sequence, either a modified or unmodified sequence, is included 5’ to the scaffold sequence provided in Table 5A:Table 5A: Exemplary Modified Spy Guide Scaffold Sequenceswherein “m” indicates a 2’-0-Me modification, “f” indicates a 2’-fluoro modification, a indicates a phosphorothioate linkage between nucleotides, and no modification in the context of a modified sequence indicates an RNA (2 ’-OH) and phosphodiesterase linkage.
[0430] A guide sequence is present on the 5’ end of the conserved portion of the guide RNA. In certain embodiments, the guide sequence is 20-25, preferably 22-24 nucleotides in length. In certain embodiments, the guide sequence comprises one or more chemical modifications, for example modifications at one or more of nucleotides 1, 2, and 3, optionallyall of nucleotides 1, 2, and 3 at the 5’ end of the guide RNA. In certain embodiments, the modification comprises a 2’-0-Me modification.
[0431] In certain embodiments, the guide sequence is a chemically modified sequence. In certain embodiments, the chemically modified guide sequence is (mN*)3(N)i3-i7. In certain embodiments, the guide sequence is (mN*)3(N)i7, i.e., mN*mN*mN*NNNNNNNNNNNNNNNNN. In certain embodiments, each N of the (N)i3-i7 or the (N)i7 is unmodified. In certain embodiments, the each N in the (N)i3-i7 or the (N)i7 is independently modified, e.g., independently modified with a 2’-O-methyl modification.
[0432] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, where N is any natural or non-natural nucleotide, and wherein the totality of the N’s comprise any one of the guide sequences disclosed in Tables 3A-3B. In some embodiments, the modified sgRNA comprises a sequence shown in Table 5B.Table 5B: Exemplary Modified Spy Guide RNA Sequenceswherein “m” indicates a 2’-0-Me modification, “f” indicates a 2’-fluoro modification, and a indicates a phosphorothioate linkage between nucleotides, and no modification in the context of a modified sequence indicates an RNA (2’-OH), wherein the totality of N’s comprise a guide sequence comprising a sequence at least 85%, preferably 90% or 95% identical to or complementary to at least 17, 18, 19, or 20 contiguous nucleotides of any of the guide sequences disclosed herein in Tables 3A-3B, where the N’s are replaced with any of the guide sequences disclosed herein in Tables 3A-3B. In certain embodiments, when the totality of N’s comprise a guide sequence, within N17, each N of the N17 may be independently modified, e.g., modified with a 2’-0Me modification.
[0433] In the case of a sgRNA, the guide sequences may further comprise a SpyCas9 sgRNA scaffold sequence. An example of a SpyCas9 sgRNA scaffold sequence is shown in the Table 8A below (SEQ ID NO: 601: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU AAGGCUAGUC CGUUAUCAACUUGAAAAAGU GGCACCGAGUCGGUGC - “Exemplary SpyCas9 sgRNA- 1”), included at the 3’ end of the guide sequence, and provided with the domains as shown in the table below. LS is lower stem. B is bulge. US is upper stem. Hl and H2 are hairpin 1 and hairpin 2, respectively. Collectively Hl and H2 are referred to as the hairpin region. A model of the structure containing both a guide sequence and a scaffold sequence is provided in Figure 10A of WO2019237069, which is incorporated herein by reference.
[0434] The nucleotide sequence of Exemplary SpyCas9 sgRNA- 1 may serve as a template sequence for specific chemical modifications, sequence substitutions and truncations.
[0435] In certain embodiments, the gRNA is an sgRNA or a dgRNA, for example, and it optionally comprises a chemical modification. In some embodiments, the modified sgRNA comprises a guide sequence and a SpyCas9 sgRNA sequence, e.g., Exemplary SpyCas9 sgRNA- 1. A gRNA, such as an sgRNA, may include modifications on the 5’ end of the guide sequence or on the 3’ end of the SpyCas9 sgRNA sequence, such as, e.g., Exemplary SpyCas9 sgRNA-1 at one or more of the terminal nucleotides, e.g., at 1, 2, 3, or 4 of the nucleotides at the 3’ end or at the 5’ end. In certain embodiments, the modified nucleotide isselected from a 2’-O-methyl (2’-OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O- moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, and a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0Me modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage. In certain embodiments, the modified nucleotide includes a 2’-0Me modified nucleotide and a PS linkage.
[0436] In certain embodiments, using SEQ ID NO: 601 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGC “Exemplary SpyCas9 sgRNA-1,” see WO2019237069, the contents of which are incorporated herein by reference). The portions of the Exemplary SpyCas9 sgRNA-1 and position numbering scheme are set forth in Table 11 below.
[0437] As an example, the Exemplary SpyCas9 sgRNA-1 further includes one or more of: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein1. at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl-10, or Hl-4 and Hl-9, and the hairpin 1 region optionally lacks a. any one or two of Hl -5 through Hl -8, b. one, two, or three of the following pairs of nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl-10, and Hl-4 and Hl-9, or c. 1-8 nucleotides of hairpin 1 region; or2. the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides; and a. one or more of positions Hl-1, Hl-2, or Hl-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) or b. one or more of positions Hl-6 through Hl-10 is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or3. the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, Hl-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); orB. a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); orC. a substitution relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; orD. an Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region, wherein1. the modified nucleotide is optionally selected from a 2’-O-methyl (2’- OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic modified nucleotide, or is a combination thereof; or2. the modified nucleotide optionally includes a 2’-0Me modified nucleotide.
[0438] Guide sequences targeted to sites adjacent to an appropriate PAM, e.g., an NmeCas9 PAM, e.g., as shown in Table 2A may further comprise additional nucleotides to form a crRNA or a crRNA joined to a trRNA to form a sgRNA e.g., with the exemplary nucleotide sequence following the guide sequence at its 3’ end as provided in Tables 6A-7B. The portions of the Exemplary NmeCas9 sgRNA and position numbering scheme, including both a guide sequence and a scaffold sequence, are set forth in Table 8B below.
[0439] In certain embodiments, using SEQ ID NO: 700 (“Exemplary NmeCas9 sgRNA- 1”), as an example, the Exemplary NmeCas9 sgRNA-1 includes:A. A guide RNA (gRNA) comprising a guide region and a conserved region, the conserved region comprising one or more of:(a) a shortened repeat / anti-repeat region, wherein the shortened repeat / anti- repeat region lacks 2-24 nucleotides, wherein(i) one or more of nucleotides 37-48 and 53-64 is deleted and optionally one or more of nucleotides 37-64 is substituted relative to SEQ ID NO: 700; and(ii) nucleotide 36 is linked to nucleotide 65 by at least 2 nucleotides; or(b) a shortened hairpin 1 region, wherein the shortened hairpin 1 lacks 2-10, optionally 2-8 nucleotides, wherein(i) one or more of nucleotides 82-86 and 91-95 is deleted and optionally one or more of positions 82-96 is substituted relative to SEQ ID NO: 700; and(ii) nucleotide 81 is linked to nucleotide 96 by at least 4 nucleotides; or(c) a shortened hairpin 2 region, wherein the shortened hairpin 2 lacks 2-18, optionally 2-16 nucleotides, wherein(i) one or more of nucleotides 113-121 and 126-134 is deleted and optionally one or more of nucleotides 113-134 is substituted relative to SEQ ID NO: 700; and(ii) nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; wherein one or both nucleotides 144-145 are optionally deleted relative toSEQ ID NO: 700; wherein, optionally, at least 10 nucleotides are modified nucleotides.
[0440] Exemplary unmodified conserved nucleotide sequences, also referred to as scaffold sequences, are shown in Table 6A. The #mer refers to the length of the sgRNA when a 24 nucleotide guide sequence is included 5’ to the scaffold sequence provided in Table 6 A.Table 6A: Exemplary Unmodified Nme Guide RNA Conserved Region Nucleotide Sequences
[0441] In some embodiments, the guide RNA comprises a nucleotide sequence selected from the unmodified Nme guide RNA Sequences in Tables 2A-2B, wherein the N20-2s’s are collectively any one of the guide sequences disclosed in Tables 2A-2B. In someembodiments, each nucleotide of the unmodified Spy guide RNA Sequences in Table 6B is any natural or non-natural nucleotide.Table 6B: Exemplary Unmodified Nme Guide RNA Nucleotide Sequences
[0442] In the case of a sgRNA, modified guide sequences may be integrated into one of the following exemplary modified conserved portion motifs (Table 7 A). The #mer refers to the length of the sgRNA when a 24 nucleotide guide sequence, either a modified or unmodified sequence, is included 5’ to the scaffold sequence provided in Table 6A or 7A:Table 7A: Exemplary Modified Nme Guide RNA Conserved Regionswherein “m” indicates a 2’-0-Me modification, and a indicates a phosphorothioate linkage between nucleotides, and no modification in the context of a modified sequence indicates an RNA (2’-OH) and a phosphorothioate linkage.
[0443] A guide sequence is present on the 5’ end of the conserved portion of the guide RNA. In certain embodiments, the guide sequence is 20-25, preferably 22-24 nucleotides in length. In certain embodiments, the guide sequence comprises one or more chemical modifications, for example modifications at one or more of nucleotides 1, 2, and 3, optionallyall of nucleotides 1, 2, and 3 at the 5’ end of the guide RNA. In certain embodiments, the modification comprises a 2’-0-Me modification.
[0444] In certain embodiments, the modification comprises a 2’-0-Me modification and a phosphorothioate linkage to the 3’ nucleotide, e.g., (mN*)3(N)i?-22, preferably (mN*)3(N)2i, wherein each of the nucleotides in the (N) 21 portion is independently modified or unmodified.
[0445] In certain embodiment, the totality of N’s comprise a GUIDE sequence comprising: (A) a sequence at least 80%, 85%, preferably at least 90%, or 95% identical, or 100% identical to or complementary to 24 contiguous nucleotides of. . ..a target site provided in Table 2A. For example, where the N’s are replaced with any of the guide sequences disclosed herein in Table 2A. In certain embodiments, when the totality of N’s comprise a guide sequence, within (N)20-25, each N of the (N) 20-25 may be independently modified, e.g., modified with a 2’-0Me modification, optionally further with a PS modification, particularly at 1, 2, or 3 terminal nucleotides. In certain embodiments, the (N)20-25 has the following sequence and modification patternmN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNN.
[0446] In some embodiments, the sgRNA comprises any of the modification patterns shown herein, where N is any natural or non-natural nucleotide, and wherein the totality of the N’s comprise a guide sequence disclosed in Tables 2A-2B. In some embodiments, the modified sgRNA comprises a sequence shown in Table 7B.Table 7B: Exemplary Modified Nme Guide RNA sequenceswherein “m” indicates a 2’-0-Me modification, and a indicates a phosphorothioate linkage between nucleotides, and no modification in the context of a modified sequence indicates an RNA (2’-OH) and a phosphorothioate linkage.
[0447] In certain embodiments, Exemplary SpyCas9 sgRNA-1, Exemplary NmeCas9 sgRNA-1, or an sgRNA, such as an sgRNA comprising an Exemplary SpyCas9 sgRNA-1, further includes a 3’ tail, e.g., a 3’ tail of 1, 2, 3, 4, or more nucleotides. In certain embodiments, the tail includes one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from a 2’-O-methyl (2’-0Me) modified nucleotide, a 2’- O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide,a 2’ deoxy (2’H-) modified nucleotide, an abasic nucleotide, a locked nucleic acid (LN A) nucleotide, an unlocked nucleic acid (UNA) nucleotide, a phosphorothioate (PS) linkage between nucleotides, and a terminal inverted abasic modified nucleotide; or is a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0Me modified nucleotide. In certain embodiments, the modified nucleotide includes a PS linkage between nucleotides. In certain embodiments, the modified nucleotide includes a 2’-0Me modified nucleotide and a PS linkage between nucleotides.
[0448] In certain embodiments, the hairpin region includes one or more modified nucleotides. In certain embodiments, the modified nucleotide is selected from a 2’-O-methyl (2’-0Me) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic modified nucleotide; or is a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0Me modified nucleotide.
[0449] In certain embodiments, the upper stem region includes one or more modified nucleotides. In certain embodiments, the modified nucleotide selected from a 2’-O-methyl (2’-0Me) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic modified nucleotide; or is a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0Me modified nucleotide.
[0450] In certain embodiments, the Exemplary SpyCas9 sgRNA-1 or the Exemplary NmeCas9 sgRNA-1 comprises one or more YA dinucleotides, wherein Y is a pyrimidine, wherein the YA dinucleotide includes a modified nucleotide. In certain embodiments, the modified nucleotide selected from a 2’-O-methyl (2’-0Me) modified nucleotide, a 2’-O-(2- methoxy ethyl) (2’-O-moe) modified nucleotide, a 2 ’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic modified nucleotide, or is a combination thereof. In certain embodiments, the modified nucleotide includes a 2’-0Me modified nucleotide.
[0451] In certain embodiments, the Exemplary SpyCas9 sgRNA-1 or the Exemplary NmeCas9 sgRNA-1 comprises one or more YA dinucleotides, wherein Y is a pyrimidine, wherein the YA dinucleotide includes a sequence substituted nucleotide, wherein the pyrimidine is substituted for a purine. In certain embodiments, when the pyrimidine forms a Watson-Crick base pair in the single guide, the Watson-Crick based nucleotide of the sequence substituted pyrimidine nucleotide is substituted to maintain Watson-Crick base pairing.Attorney Docket No. 01155-0058-00PCTTable 8A. Exemplary spyCas9 sgRNA-1 (SEQ ID NO: 601)Attorney Docket No. 01155-0058-00PCTTable 8B. Exemplary NmeCas9 sgRNA(SEQ ID NO: 700)Linker containing gRNAs
[0452] In certain embodiments, the gRNA comprises one or more internal linkers. As used herein, “internal linker” describes a non-nucleotide segment joining two nucleotides within a guide RNA. If the gRNA contains a spacer region, the internal linker is located outside of the spacer region (e.g., in the scaffold or conserved region of the gRNA). For Type V guides, it is understood that the last hairpin is the only hairpin in the structure, i.e., the repeat-anti-repeat region. The length of an internal linker may be dependent on, for example, the number of nucleotides replaced by the linker and the position of the linker in the gRNA. Internal linkers and their use in the context of gRNA are provided in WO2022261292.
[0453] gRNAs disclosed herein may comprise an internal linker. In general, any internal linker compatible with the function of the gRNA may be used. It may be desirable for the linker to have a degree of flexibility. In some embodiments, the internal linker comprises at least two, three, four, five, six, or more on-pathway single bonds. A bond is on-pathway if it is part of the shortest path of bonds between the two nucleotides whose 5’ and 3’ positions are connected to the linker.
[0454] As used herein the length of the internal linker can be defined by its bridging length. The “bridging length” of an internal linker as used herein refers to the distance or number of atoms in the shortest chain of atoms on the pathway from the first atom of the linker (bound to a 3’ substituent, such as an oxygen or phosphate, of the preceding nucleotide to the last atom of the linker (bound to a 5’ substituent, such as an oxygen or phosphate) of the following nucleotide) (e.g., from ~ to # in the structure of Formula (I) described below). Approximate predicted bridging lengths for various linkers are provided in a table below.
[0455] Exemplary predicted linker lengths by number of atoms, number of ethylene glycol units, approximate linker length in Angstroms on the assumption that an ethylene glycol monomer is about 3.7 Angstroms, and suitable location for substitution of at least the entire loop portion of a hairpin structure are provided in the table 8 below. Substitution of two nucleotides requires a linker length of at least about 11 Angstroms. Substitution of at least 3 nucleotides requires a linker length of at least about 16 Angstroms.Table 9A
[0456] In some embodiments, the internal linker comprises a structure of formula (I):—L0-L1-L2-#(I) wherein:~ indicates a bond to a 3’ substituent of the preceding nucleotide;# indicates a bond to a 5’ substituent of the following nucleotide;L0 is null or Ci -3 aliphatic;LI is — [E1-(R1)]m-, whereeach R1is independently a C1-5 aliphatic group, optionally substituted with 1 or 2 E2, each E1and E2are independently a hydrogen bond acceptor, or are each independently chosen from cyclic hydrocarbons, and heterocyclic hydrocarbons, and each m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; andL2 is null, C1-3 aliphatic, or is a hydrogen bond acceptor.
[0457] In some embodiments, LI comprises one or more -CH2CH2O-,-CH2OCH2-, or -OCH2CH2- units (“ethylene glycol subunits”). In some embodiments, the number of -CH2CH2O-, -CH2OCH2-, or -OCH2CH2- units is in the range of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.
[0458] In some embodiments, m is 1, 2, 3, 4 or 5. In some embodiments, m is 1, 2, or 3. In some embodiments, m is 6, 7, 8, 9, or 10.
[0459] In some embodiments, L0 is null. In some embodiments, L0 is -CH2- or -CH2CH2-.
[0460] In some embodiments, L2 is null. In some embodiments, L2 is -O-, -S-, or C1-3 aliphatic. In some embodiments, L2 is -O-. In some embodiments, L2 is -S-. In some embodiments, L2 is -CH2- or -CH2CH2-.
[0461] In the tables herein, LI and L2, are optionally, C9 and C18, respectively as follows:
[0462] In certain embodiments, the internal linker has a bridging length of about 3-30 atoms, optionally 12-21 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In certain embodiments, the internal linker has a bridging length of about 6-18 atoms,optionally about 6-12 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In certain embodiments, the internal linker substitutes for 2-12 nucleotides.
[0463] In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 601 or SEQ ID NO: 700, including modifications disclosed elsewhere herein. Table 9B shows various embodiments of the gRNA structures and species with possible number of internal linkers and positions.Table 9B.
[0464] In certain embodiments, the internal linker is in a repeat-anti-repeat region of the gRNA. In certain embodiments, the internal linker substitutes for at least 4 nucleotides of the repeat- anti-repeat region of the gRNA. In certain embodiments, the internal linker substitutes for the loop in the repeat-anti-repeat region of a Spy Cas9 gRNA, corresponding to nucleotides 13-16 in SEQ ID NO: 601. In certain embodiments, the internal linker substitutes for the loop in the repeat-anti-repeat region of an Nme Cas9 gRNA, corresponding to nucleotides 49-52 in SEQ ID NO: 700.
[0465] In certain embodiments, the internal linker substitutes for 2, 3, or 4 nucleotides of the nexus region of the gRNA. In certain embodiments, the internal linker substitutes for the loop in the nexus region of a Spy Cas9 gRNA corresponding to nucleotides 33-36 of SEQ ID NO: 601.
[0466] In certain embodiments, the internal linker is in a hairpin region of the gRNA. In certain embodiments, the internal linker substitutes for at least 4 nucleotides of the hairpin region of the gRNA. In certain embodiments, the internal linker substitutes for the loop in the hairpin 1 region of a Spy Cas9 gRNA, corresponding to nucleotides 53-56 in SEQ ID NO: 601. In certain embodiments, the internal linker substitutes for the loop in the hairpin 1 region of an Nme Cas9 gRNA, corresponding to nucleotides 87-90 in SEQ ID NO: 700. In certain embodiments, the internal linker substitutes for at least 4 nucleotides the loop in the hairpin 2 region of an Nme Cas9 gRNA, corresponding to nucleotides 122-125 in SEQ ID NO: 700. In certain embodiments, the internal linker substitutes for the loop in the hairpin 1 region of an Nme Cas9 gRNA, corresponding to nucleotides 87-90 in SEQ ID NO: 700 and for at least 4 nucleotides the loop in the hairpin 2 region of an Nme Cas9 gRNA, corresponding to nucleotides 122-125 in SEQ ID NO: 700.Table 9C. Exemplary SpyCas9 guide RNAs comprising linkersNucleotide modifications in modified sequences are indicated in Table 9C as follows: wherein “m” indicates a 2’-0-Me modification, a indicates a phosphorothioate linkage between nucleotides, and within the individually indicated nucleotides, no modification indicates an RNA (2’-OH) with a phosphodiesterase backbone.Table 9D. Exemplary NmeCas9 guide RNAs comprising linkersNucleotide modifications in modified sequences are indicated in Table 9D as follows: wherein “m” indicates a 2’-0-Me modification, a indicates a phosphorothioate linkage between nucleotides, and within the individually indicated nucleotides, no modification indicates an RNA (2’-OH) with a phosphodiesterase backbone. Even in the context of a modified sequence, each nucleotide of (N)20-25 is optionally independently modified. In certain examples, at least the first three nucleotides are modified, e.g., (mN*)3(N)17-22.
[0467] In some embodiments, a composition comprising one or more guide RNAs comprising a guide sequence of any one listed in Tables 3A-3B is provided. In some embodiments, a composition comprising one or more guide RNAs comprising a guide sequence of any one in Tables 3A-3B is provided, wherein the nucleotides of SEQ ID: 617 follow the guide sequence at its 3’ end. In some embodiments, the one or more guide RNAs comprising a guide sequence of any one in Tables A-3B , wherein the nucleotides of SEQ ID NO: 617 follow the guide sequence at its 3’ end, is modified according to the modification pattern of any one of the sequences shown in Table 5A (e.g., SEQ ID NO: 641). In some embodiments, the one or more guide RNAs comprising a guide sequence of any one in Tables 3A-3B , wherein the nucleotides of SEQ ID NO: 600 follow the guide sequence at its 3’ end, is modified according to the modification pattern of any one of the sequences shown in Table 5B (e.g., SEQ ID NO: 658).
[0468] In some embodiments, an sgRNA comprising the guide sequence of any one listed in Tables A-3B and any conserved portion of an sgRNA shown in Tables 5A-5B, optionally having a modification pattern of any of an sgRNA shown in Tables 5B, optionally whereinthe sgRNA comprises a 5’ and 3’ end modification (if not already shown in the construct of Table 5B) is provided.
[0469] In some embodiments, the sgRNA comprises any of the modification patterns shown above in Table 5B, where N is any natural or non-natural nucleotide, and wherein the totality of the N’s comprise a guide sequence as described herein in Table 3A. Table 5B does not depict the guide sequence portion of the sgRNA. The modifications remain as shown in Table 5B despite the substitution of N’s for the nucleotides of a guide sequence. That is, although the nucleotides of the guide replace the “N’s”, the nucleotides are modified as shown in Table 5B.
[0470] In some embodiments, a composition comprising one or more guide RNAs comprising a guide sequence of any one in Tables 2A-2B is provided. In some embodiments, a composition comprising one or more guide RNAs comprising a guide sequence of any one in Tables 2A-2B is provided, wherein the nucleotides of SEQ ID: 706 follow the guide sequence at its 3’ end. In some embodiments, the one or more guide RNAs comprising a guide sequence of any one in Tables 2A-2B , wherein the nucleotides of SEQ ID NO: 706 follow the guide sequence at its 3’ end, is modified according to the modification pattern of any one of SEQ ID NOs: 710-715. In some embodiments, the one or more guide RNAs comprising a guide sequence of any one in Tables 2A-2B , wherein the nucleotides of SEQ ID NO: 706 follow the guide sequence at its 3’ end, is modified according to the modification pattern of any one of the sequences shown in Table 7A (e.g., SEQ ID NOs: 712 or 713). In some embodiments, the one or more guide RNAs comprising a guide sequence of any one in Tables 2A-2B , wherein the nucleotides of SEQ ID NO: 706 follow the guide sequence at its 3’ end, is modified according to the modification pattern of SEQ ID NOs: 713.
[0471] In some embodiments, an sgRNA comprising the guide sequence of any one listed in Tables 2A-2B and any conserved portion of an sgRNA shown in Tables 7A-7B, optionally having a modification pattern of any of an sgRNA shown in Tables 7B, optionally wherein the sgRNA comprises a 5’ and 3’ end modification (if not already shown in the construct of Table 7B) is provided.
[0472] In some embodiments, the sgRNA comprises any of the modification patterns shown below in Table 7B, where N is any natural or non-natural nucleotide, and wherein the totality of the N’s comprise a guide sequence as described herein in Table 2A. Table 7B does not depict the guide sequence portion of the sgRNA. The modifications remain as shown in Table 7B despite the substitution of N’s for the nucleotides of a guide sequence. That is,although the nucleotides of the guide replace the “N’s”, the nucleotides are modified as shown in Table 7B.
[0473] In some embodiments, a composition comprising one or more guide RNAs comprising a guide sequence of any one in Tables 2A-2B is provided. In one aspect, a composition comprising one or more gRNAs is provided, comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of any one in Tables 2A-2B.
[0474] In other embodiments, a composition is provided that comprises at least one, e.g., at least two gRNA’s comprising guide sequences selected from any two or more of the guide sequences shown in any one in Tables 2A-2B. In some embodiments, the composition comprises at least two gRNA’s that each comprise a guide sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the guide sequences shown in any one in Tables 2A-2B.
[0475] In some embodiments, the guide RNA compositions of the present disclosure are designed to recognize (e.g., hybridize to) a target sequence. For example, the target sequence may be recognized and cleaved by a provided Cas cleavase comprising a guide RNA. In some embodiments, an RNA-guided DNA binding agent, such as a Cas cleavase, may be directed by a guide RNA to a target sequence, where the guide sequence of the guide RNA hybridizes with the target sequence and the RNA-guided DNA binding agent, such as a Cas cleavase, cleaves the target sequence.
[0476] In some embodiments, the selection of the one or more guide RNAs is determined based on target sequences within the target gene. In some embodiments, the compositions comprising one or more guide sequences comprise a guide sequence that is complementary to the corresponding genomic region shown in Tables 2A-2B, according to coordinates from human reference genome hg38. Guide sequences of further embodiments may be complementary to sequences in the close vicinity of the genomic coordinate listed in any of the Tables 2A-2B within the target gene. For example, guide sequences of further embodiments may be complementary to sequences that comprise 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Tables 2A-2B. Without being bound by any particular theory, modifications (e.g., frameshift mutations resulting from indels occurring as a result of a nuclease-mediated DSB) in certain regions of the target gene may be less tolerable than mutations in other regions, thus the location of a DSB is an important factor in the amount or type of protein knockdown that may result. In some embodiments, a gRNAcomplementary or having complementarity to a target sequence within the target gene used to direct an RNA-guided DNA binding agent to a particular location in the target gene.
[0477] In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the target gene. In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human target gene.
[0478] In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between a guide sequence of a guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches where the guide sequence is 20 nucleotides.VII. RNA-guided DNA binding agent
[0479] In some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas nuclease as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease, is provided, used, or administered.
[0480] In some embodiments, the composition further comprises an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
[0481] In some embodiments, the nucleic acid encoding the RNA-guided DNA binding agent comprises an mRNA comprising an open reading frame (ORF) encoding the RNA- guided DNA binding agent.
[0482] In some embodiments, the RNA-guided DNA binding agent is a nuclease.
[0483] In some embodiments, the RNA-guided DNA binding agent is a Cas9 nuclease.
[0484] In some embodiments, the Cas9 is S. pyogenes Cas9.
[0485] In some embodiments, the S. pyogenes Cas9 comprises an amino acid sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 853-857 or an ORFencoding a .S'. pyogenes Cas9 having at least 90% identity to a sequence selected from SEQ ID NOs: 853-857. In some embodiments, the S. pyogenes Cas9 comprises an amino acid sequence having at least 90% identity to SEQ ID NO: 853 or an ORF encoding a S. pyogenes Cas9 having at least 90% identity to SEQ ID NO: 853.
[0486] In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity to SEQ ID NOs: 813, 814, 816-819. In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity to SEQ ID NO: 813.
[0487] In some embodiments, the Cas9 is Nme Cas9.
[0488] In some embodiments, Nme Cas9 comprises an amino acid sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 832-834 or an ORF encoding an Nme Cas9 having at least 90% identity to a sequence selected from SEQ ID NOs: 832-834. In some embodiments, Nme Cas9 comprises an amino acid sequence having at least 90% identity to SEQ ID NO: 832 or an ORF encoding an Nme Cas9 having at least 90% identity to SEQ ID NO: 832.
[0489] In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity to a sequence selected from SEQ ID NOs: 802-810. In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity to SEQ ID NO: 802.
[0490] In some embodiments, the nuclease has double stranded endonuclease activity.
[0491] In some embodiments, the nuclease has nickase activity.
[0492] In some embodiments, the nuclease is catalytically inactive.
[0493] In some embodiments, the nuclease further comprises a heterologous functional domain.
[0494] In some embodiments, the nuclease is a nickase and the heterologous functional domain is a deaminase.
[0495] In some embodiments, the deaminase is a cytidine deaminase or an adenine deaminase.
[0496] In some embodiments, the deaminase is a cytidine deaminase.
[0497] In some embodiments, the deaminase is an apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.
[0498] In some embodiments, the nuclease and the deaminase comprise an amino acid sequence having at least 90% identity to a sequence to SEQ ID NO: 831, 835-838, 851, 852, or 858 or an ORF encoding an amino acid sequence having at least 90% identity to SEQ ID NO: 831, 835-838, 851, 852, or 858.
[0499] In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity to SEQ ID NOs: 801, 804, 811, 812, or 815.
[0500] In some embodiments, the composition described herein further comprises a uracil glycosylase inhibitor (UGI) or nucleic acid encoding a UGI, wherein the nuclease polypeptide does not comprise a UGI or the nucleic acid encoding the polypeptide does not encode a UGI.
[0501] In some embodiments, the UGI comprises an amino acid sequence having at least 90% identity to SEQ ID NO: 859 or 860 or an ORF encoding an amino acid sequence having at least 90% identity to SEQ ID NO: 859 or 860.
[0502] In some embodiments, the ORF encoding the amino acid sequence has at least 85% identity to a sequence selected from SEQ ID NOs: 723-726, optionally SEQ ID NO: 823.
[0503] In some embodiments, the ORF is a modified ORF.
[0504] RNA-guided DNA binding agents described herein encompass .S / n as9 and modified and variants thereof.
[0505] RNA-guided DNA binding agents described herein encompass Neisseria meningitidis Cas9 (NmeCas9) and modified and variants thereof. In some embodiments, the NmeCas9 is Nme2 Cas9. In some embodiments, the NmeCas9 is Nmel Cas9. In some embodiments, the NmeCas9 is Nme3 Cas9.
[0506] Modified versions having one catalytic domain, either RuvC or HNH, that is inactive are termed “nickases.” Nickases cut only one strand on the target DNA, thus creating a single-strand break. A single-strand break may also be known as a “nick.” In some embodiments, the compositions and methods comprise nickases. In some embodiments, the compositions and methods comprise a nickase RNA-guided DNA binding agent, such as a nickase Cas, e.g., a nickase Cas9, that induces a nick rather than a double strand break in the target DNA.
[0507] In some embodiments, the NmeCas9 nuclease may be modified to contain only one functional nuclease domain. For example, the RNA-guided DNA binding agent may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity.
[0508] In some embodiments, a NmeCas9 nickase having a RuvC domain with reduced activity is used. In some embodiments, a NmeCas9 nickase having an inactive RuvC domain is used. In some embodiments, a NmeCas9 nickase having an HNH domain with reduced activity is used. In some embodiments, a NmeCas9 nickase having an inactive HNH domain is used.I l l
[0509] In some embodiments, the nuclease is modified to induce a point mutation or base change, e.g., through deamination.
[0510] In some embodiments, the Cas protein comprises a fusion protein comprising a Cas nuclease (e.g., NmeCas9), which is a nickase or is catalytically inactive, linked to a heterologous functional domain. In some embodiments, the Cas protein comprises a fusion protein comprising a catalytically inactive Cas nuclease (e.g., NmeCas9) linked to a heterologous functional domain (see, e.g., WO2014152432). In some embodiments, the catalytically inactive Cas9 is from the N. meningitidis Cas9. In some embodiments, the catalytically inactive Cas comprises mutations that inactivate the Cas.
[0511] In some embodiments, the heterologous functional domain is a domain that modifies gene expression, histones, or DNA. In some embodiments, the heterologous functional domain is a transcriptional activation domain or a transcriptional repressor domain. In some embodiments, the nuclease is a catalytically inactive Cas nuclease, such as dCas9.
[0512] In some embodiments, the heterologous functional domain is a deaminase, such as a cytidine deaminase or an adenine deaminase. In certain embodiments, the heterologous functional domain is a C to T base converter (cytidine deaminase), such as an apolipoprotein B mRNA editing enzyme (APOB EC) deaminase. A heterologous functional domain such as a deaminase may be part of a fusion protein with a Cas nuclease having nickase activity or a Cas nuclease that is catalytically inactive discussed further below.
[0513] The RNA-guided DNA binding agent disclosed herein may further comprise a baseediting domain, such as a deaminase domain, that introduces a specific modification into a target nucleic acid.
[0514] In some embodiments, a nucleic acid is provided that comprises an open reading frame encoding a polypeptide comprising a cytidine deaminase (e.g., A3 A), a C-terminal NmeCas9 nickase, and a first nuclear localization signal (NLS), wherein the polypeptide does not comprise a uracil glycosylase inhibitor (UGI).
[0515] In some embodiments, a second NLS is N-terminal to the NmeCas9 nickase. In some embodiments, the deaminase is N-terminal to an NLS (i.e., the first NLS or the second NLS). In some embodiments, the deaminase is N-terminal to all NLS in the polypeptide. In some embodiments, the deaminase is N-terminal to all NLS in the polypeptide, wherein the polypeptide does not comprise a uracil glycosylase inhibitor (UGI).
[0516] In some embodiments, the polynucleotide is DNA or RNA. In some embodiments, the polynucleotide is mRNA. In some embodiments, a polypeptide encoded by the mRNA is provided.
[0517] In some embodiments, the polypeptide comprising A3A and an RNA-guided nickase does not comprise a uracil glycosylase inhibitor (UGI).
[0518] In some embodiments, a composition is provided comprising a first polypeptide, or an mRNA encoding a first polypeptide, comprising a cytidine deaminase, which is optionally an APOBEC3A deaminase (A3A); a C-terminal NmeCas9 nickase; a first nuclear localization signal (NLS); and, optionally, a second NLS; wherein the first NLS and, when present, the second NLS are located to N-terminal to the sequence encoding the NmeCas9 nickase, wherein the first polypeptide does not comprise a uracil glycosylase inhibitor (UGI); and a second polypeptide, or an mRNA encoding a second polypeptide, comprising a uracil glycosylase inhibitor (UGI), wherein the second polypeptide is different from the first polypeptide.
[0519] In some embodiments, methods of modifying a target gene are provided comprising administering the compositions described herein. In some embodiments, the method comprises delivering to a cell a first nucleic acid comprising a first open reading frame encoding a first polypeptide comprising a cytidine deaminase, which is optionally an APOBEC3A deaminase (A3A); a C-terminal NmeCas9 nickase; a first nuclear localization signal (NLS); and, optionally, a second NLS; wherein the first NLS and, when present, the second NLS are located to N-terminal to the sequence encoding the NmeCas9 nickase, wherein the first polypeptide does not comprise a uracil glycosylase inhibitor (UGI), and a second nucleic acid comprising a second open reading frame encoding a uracil glycosylase inhibitor (UGI), wherein the second nucleic acid is different from the first nucleic acid.
[0520] In some embodiments, the methods comprise delivering to a cell a polypeptide comprising a deaminase, which is optionally an APOBEC3A deaminase (A3 A); a C-terminal NmeCas9 nickase; a first nuclear localization signal (NLS); and a second NLS; wherein the first NLS and the second NLS are located to N-terminal to the sequence encoding the NmeCas9 nickase, wherein the first polypeptide does not comprise a uracil glycosylase inhibitor (UGI), or a nucleic acid encoding the polypeptide, and delivering to the cell a uracil glycosylase inhibitor (UGI), or a nucleic acid encoding the UGI.
[0521] In some embodiments, a molar ratio of the mRNA encoding UGI to the mRNA encoding the APOBEC3A deaminase (A3 A) and an RNA-guided nickase is from about 1:35 to from about 30:1. In some embodiments, the molar ratio of the mRNA encoding UGI to the mRNA encoding the APOBEC3A deaminase (A3 A) and an RNA-guided nickase is not about 1:1.
[0522] Similarly, in some embodiments, the molar ratio discussed above for the mRNA encoding the UGI protein to the mRNA encoding the APOBEC3A deaminase (A3A) and an RNA-guided nickase are similar if delivering protein.
[0523] In some embodiments, the composition described herein further comprises at least one gRNA. In some embodiments, the composition described herein further comprises two gRNAs. In some embodiments, a composition is provided that comprises an mRNA described herein and at least one gRNA, e.g., two gRNAs. In some embodiments, the gRNA is a single guide RNA (sgRNA). In some embodiments, the gRNA is a dual guide RNA (dgRNA).
[0524] In some embodiments, the composition is capable of effecting genome editing upon administration to the subject.Cytidine deaminase; APOBEC3A Deaminase
[0525] Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and in particular, enzymes of the APOBEC family (APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminase (AID or AICDA) and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol. 22:367-77, 2005;Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol. Chem. 274: 18470-6, 1999); and Carrington et al., Cells 9:1690 (2020)).
[0526] In some embodiments, the cytidine deaminase disclosed herein is an enzyme of APOBEC family. In some embodiments, the cytidine deaminase disclosed herein is an enzyme of APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups. In some embodiments, the cytidine deaminase disclosed herein is an enzyme of APOBEC3 subgroup. In some embodiments, the cytidine deaminase disclosed herein is an APOBEC3A deaminase (A3 A). In some embodiments, the deaminase comprises an APOBEC3A deaminase.
[0527] In some embodiments, an APOBEC3A deaminase (A3A) disclosed herein is a human A3A. In some embodiments, an APOBEC3A deaminase (A3 A) disclosed herein is a human A3A. In some embodiments, the A3A is a wild-type A3A.
[0528] In some embodiment, the A3A is an A3A variant. A3A variants share homology to wild-type A3A, or a fragment thereof. In some embodiments, a A3A variant has at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity to a wild type A3A. In some embodiments, the A3A variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25,26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid changes compared to a wild type A3A. In some embodiments, the A3A variant comprises a fragment of an A3A, such that the fragment has at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity to the corresponding fragment of a wild-type A3A.
[0529] In some embodiments, an A3A variant is a protein having a sequence that differs from a wild-type A3A protein by one or several mutations, such as substitutions, deletions, insertions, one or several single point substitutions. In some embodiments, a shortened A3A sequence could be used, e.g. by deleting N-terminal, C-terminal, or internal amino acids. In some embodiments, a shortened A3A sequence is used where one to four amino acids at the C-terminus of the sequence is deleted. In some embodiments, an APOBEC3A (such as a human APOBEC3A) has a wild-type amino acid position 57 (as numbered in the wild-type sequence). In some embodiments, an APOBEC3A (such as a human APOBEC3A) has an asparagine at amino acid position 57 (as numbered in the wild-type sequence).
[0530] In some embodiments, the wild-type A3 A is a human A3 A (UniPROT accession ID: p31941, SEQ ID NO: 850).
[0531] In some embodiments, the A3 A disclosed herein comprises an amino acid sequence having at least 80% identity to SEQ ID NO: 850. In some embodiments, the level of identity is at least 85%, at least 87%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the A3A comprises an amino acid sequence having at least 87% identity to SEQ ID NO: 850. In some embodiments, the A3A comprises an amino acid sequence with at least 90% identity to SEQ ID NO: 850. In some embodiments, the A3A comprises an amino acid sequence with at least 95% identity to SEQ ID NO: 850. In some embodiments, the A3A comprises an amino acid sequence with at least 98% identity to SEQ ID NO: 850. In some embodiments, the A3A comprises an amino acid sequence with at least 99% identity to A3A ID NO: 850. In some embodiments, the A3A comprises the amino acid sequence of SEQ ID NO: 850.
[0532] In some embodiments, the cytidine deaminase disclosed herein comprises an amino acid sequence having at least 80% identity to SEQ ID NO: 850. 1
[0533] n some embodiments, any of the foregoing levels of identity is at least 90%, at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the UGI comprises an amino acid sequence with at least 90% identity to SEQ ID NO: 859 or 860. In someembodiments, the UGI comprises an amino acid sequence with at least 95% identity to SEQ ID NO: 859 or 860. In some embodiments, the UGI comprises an amino acid sequence with at least 98% identity to SEQ ID NO: 859 or 860. In some embodiments, the UGI comprises an amino acid sequence with at least 99% identity to SEQ ID NO: 859 or 860. In some embodiments, the UGI comprises the amino acid sequence of SEQ ID NO: 859 or 860.Linkers
[0534] In some embodiments, the polypeptide comprising the deaminase and the RNA- guided nickase described herein further comprises a linker that connects the deaminase and the RNA-guided nickase. In some embodiments, the linker is a peptide linker. In some embodiments, the nucleic acid encoding the polypeptide comprising the deaminase and the RNA-guided nickase further comprises a sequence encoding the peptide linker. In some embodiments, mRNAs encoding the deaminase-linker-RNA-guided nickase fusion protein are provided.
[0535] In some embodiments, the peptide linker is any stretch of amino acids having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, or more amino acids.
[0536] In some embodiments, the peptide linker is the 16 residue “XTEN” linker, or a variant thereof (See, e.g., the Examples; and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 901), SGSETPGTSESA (SEQ ID NO: 902), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 903).
[0537] In some embodiments, the peptide linker comprises a (GGGGS)n (SEQ ID NO: 931), a (G)n, an (EAAAK)n(SEQ ID NO: 932), a (GGS)n, an SGSETPGTSESATPES (SEQ ID NO: 901) motif (see, e.g., Guilinger J P, Thompson D B, Liu D R. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 2014; 32(6): 577-82; the entire contents are incorporated herein by reference), or an (XP)n motif, or a combination of any of these, wherein n is independently an integer between 1 and 30. See, W02015089406, e.g., paragraph
[0012] , the entire content of which is incorporated herein by reference.
[0538] In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NOs: 901-991.VIII. Modified gRNAs and mRNAs
[0539] In some embodiments, the gRNA is chemically modified. A gRNA comprising one or more modified nucleosides or nucleotides is called a “modified” gRNA or “chemically modified” gRNA, to describe the presence of one or more non-naturally or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues. In some embodiments, a modified gRNA is synthesized with a non-canonical nucleoside or nucleotide, is here called “modified.” Modified nucleosides and nucleotides can include one or more of: (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); and (iv) modification of the 3' end or 5' end of the oligonucleotide to provide exonuclease stability, e.g., with 2’ 0-me, 2’ halide, or 2’ deoxy substituted ribose; or inverted abasic terminal nucleotide, or replacement of phosphodiester with phosphorothioate.
[0540] Chemical modifications such as those listed above can be combined to provide modified gRNAs or mRNAs comprising nucleosides and nucleotides (collectively “residues”) that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase. In certain embodiments, up to 15% of the phosphate groups of a gRNA molecule are replaced with phosphorothioate groups. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 5' end of the RNA. In some embodiments, modified gRNAs comprise at least one modified residue at or near the 3' end of the RNA.
[0541] In some embodiments, the gRNA comprises one, two, three or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, 10%, 15%, preferably at least 20%, 25%, 30%, 35%, 40%, 45%, or 50%) of the positions in a modified gRNA are modified nucleosides or nucleotides. In some embodiments, at least 5% of the positions in the modified guide RNA are modified nucleotides or nucleosides. In some embodiments, at least 10% of the positions in the modified guide RNA are modified nucleotides or nucleosides. In some embodiments at least 15% of the positions in the modified gRNA are modified nucleotides or nucleosides. In some embodiments preferably at least 20% of the positions in the modified gRNA are modified nucleotides or nucleosides. In some embodiments, no more than 65% ofthe positions in the modified gRNA are modified nucleotides. In some embodiments, no more than 55% of the positions in the modified gRNA are modified nucleotides. In some embodiments, no more than 50% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 10-70% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-70% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-50% of the positions in the modified gRNA are modified nucleotides and the nuclease is a Spy Cas9 nuclease. In some embodiments, range 30-70% of the positions in the modified gRNA are modified nucleotides and the nuclease is an Nme Cas9 nuclease.
[0542] Unmodified nucleic acids can be prone to degradation by, e.g., intracellular nucleases or those found in serum. For example, nucleases can hydrolyze nucleic acid phosphodiester bonds. Accordingly, in one aspect the gRNAs described herein can contain one or more modified nucleosides or nucleotides, e.g., to introduce stability toward intracellular or serum-based nucleases. In some embodiments, the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into a population of cells, both in vivo and ex vivo. The term “innate immune response” includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, which involves the induction of cytokine expression and release, particularly the interferons, and cell death.
[0543] In some embodiments of a backbone modification, the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent. Further, the modified residue, e.g., modified residue present in a modified nucleic acid, can include the replacement of an unmodified phosphate moiety with a modified phosphate group as described herein. In some embodiments, the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.
[0544] Examples of modified phosphate groups include, phosphorothioate, borano phosphate esters, methyl phosphonates, phosphoroamidates, phosphodithioate, alkyl or aryl phosphonates and phosphotriesters. The phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral. The stereogenic phosphorous atom can possess either the “R” configuration (herein Rp) or the “S” configuration (herein Sp). The backbone can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridgedphosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). The replacement can occur at either linking oxygen or at both of the linking oxygens.
[0545] The phosphate group can be replaced by non-phosphorus containing connectors in certain backbone modifications, e.g., an amide linkage. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties which can replace the phosphate group can include, without limitation, e.g., methyl phosphonate, carboxymethyl, carbamate, amide, thioether. Further examples of moieties which can replace the phosphate group can include, without limitation, e.g., ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino.
[0546] Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. Such modifications may comprise backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone. Examples can include, without limitation, the morpholino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates.
[0547] The modified nucleosides and modified nucleotides can include one or more modifications to the sugar group, i.e. at sugar modification. For example, the 2' hydroxyl group (OH) can be modified, e.g. replaced with a number of different “oxy” or “deoxy” substituents. In some embodiments, modifications to the 2' hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2'- alkoxide ion.
[0548] Examples of 2' hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein “R” can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar); polyethyleneglycols (PEG), O(CH2CH2O)nCH2CH2OR wherein R can be, e.g., H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20). In some embodiments, the 2' hydroxyl group modification can be 2'-0-Me. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, which replaces the 2' hydroxyl group with a fluoride. In some embodiments, the 2' hydroxyl group modification can include “locked” nucleic acids (LNA) in which the 2' hydroxyl can be connected, e.g., by a Ci-6 alkylene or Ci-6 heteroalkylenebridge, to the 4' carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges; 0-amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH2)n-amino, (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl group modification can include "unlocked" nucleic acids (UNA) in which the ribose ring lacks the C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification can include the methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative). 2' modifications can include hydrogen (z.e. deoxyribose sugars); halo (e.g., bromo, chloro, fluoro, or iodo); amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH2CH2NH)nCH2CH2- amino (wherein amino can be, e.g., as described herein), -NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted with e.g., an amino as described herein.
[0549] The sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a modified nucleic acid can include nucleotides containing e.g., arabinose, as the sugar. The modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. The modified nucleic acids can also include one or more sugars that are in the L form, e.g. L- nucleosides. As used herein, a single abasic sugar is not understood to result in a discontinuity of a duplex.
[0550] In certain embodiments, 2’ modifications, include, for example, modifications include 2’-0Me, 2’-F, 2’-H, optionally 2’-0-Me.
[0551] The modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a nucleobase. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, and a pyrimidine analog. In some embodiments, the nucleobase can include, for example, naturally-occurring and synthetic derivatives of a base.
[0552] In embodiments employing a dual guide RNA, each of the crRNA and the tracr RNA can contain modifications. Such modifications may be at one or both ends of the crRNA or tracr RNA. In embodiments comprising an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or internal nucleosides may be modified, or the sgRNA may be chemically modified throughout. Certain embodiments comprise a 5' end modification. Certain embodiments comprise a 3' end modification. Certain embodiments comprise a 5’ end modification and a 3’ end modification.
[0553] In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in US20170114334, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2017 / 136794, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the modification patterns disclosed in W02018 / 107028, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2019 / 237069, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2021 / 119275, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2023081687A1, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the guide RNAs disclosed herein comprise one of the structures / modification patterns disclosed in WO2022261292, the contents of which are hereby incorporated by reference in their entirety.
[0554] The terms “mA,” “mC,” “mU,” or “mG” may be used to denote a nucleotide that has been modified with 2’-0-Me. The terms “fA,” “fC,” “fU,” or “fG” may be used to denote a nucleotide that has been substituted with 2’-F. A “*” may be used to depict a PS modification.
[0555] The terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a PS bond.
[0556] The terms “mA*,” “mC*,” “mU*,” or “mG*” may be used to denote a nucleotide that has been substituted with 2’-0-Me and that is linked to the next (e.g., 3’) nucleotide with a PS bond.
[0557] Any of the modifications described below may be present in the gRNAs and mRNAs described herein.
[0558] In the context of chemically modified sequences, “A,” “C,” “G,” “N,” and “U” denote an RNA nucleotide, i.e., 2’-OH with a phosphodiesterase linkage to the 3’ nucleotide.
[0559] The terms “mA,” “mC,” “mU,” or “mG” are used to denote an adenine, cytosine, uridine, or guanidine nucleotide, respectively, that has been modified with 2’-0-Me.
[0560] Modification with 2’-O-methyl can be depicted as follows:
[0561] Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution. For example, 2’-fluoro (2’-F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability.
[0562] In this application, the terms “fA,” “fC,” “fU,” or “fG” are used to denote a nucleotide that has been substituted with 2’-F.
[0563] Substitution of 2’-F can be depicted as follows:Natural composition of RNA 2'F substitution
[0564] Phosphorothioate (PS) linkage or bond refers to a bond where a sulfur is substituted for one non-bridging phosphate oxygen in a phosphodiester linkage, for example in the bonds between nucleotides bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.
[0565] A is used to denote a PS modification. In this application, the terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a PS bond.
[0566] In this application, the terms “mA*,” “mC*,” “mU*,” or “mG*” are used to denote a nucleotide that has been substituted with 2’-0-Me and that is linked to the next (e.g., 3’) nucleotide with a PS bond.
[0567] The diagram below shows the substitution of S- into a non-bridging phosphate oxygen, generating a PS bond in lieu of a phosphodiester bond:Natural phosphodiester Modified phosphorothioate linkage of RNA (PS) bond
[0568] Abasic nucleotides refer to those which lack nitrogenous bases. The diagram below depicts an oligonucleotide with an abasic (also known as apurinic) site that lacks a base. As used herein, the presence of a single abasic site is not considered to disrupt a duplex, e.g., a duplex formed between the guide sequence of a guide RNA and a target site in the genome:
[0569] Inverted bases refer to those with linkages that are inverted from the normal 5’ to 3’ linkage (i.e., either a 5’ to 5’ linkage or a 3’ to 3’ linkage). Such inverted bases can only be present as a terminal nucleotide. In chemical synthesis methods performed 3’ to 5’, inverted bases do not have 5’ hydroxy available to grow the chain. For example:Normal oligonucleotide Inverted oligonucleotide linkage linkage
[0570] An abasic nucleotide can be attached with an inverted linkage. For example, an abasic nucleotide may be attached to the terminal 5’ nucleotide via a 5’ to 5’ linkage, or an abasic nucleotide may be attached to the terminal 3’ nucleotide via a 3’ to 3’ linkage. An inverted abasic nucleotide at either the terminal 5’ or 3’ nucleotide may also be called an inverted abasic end cap.
[0571] In some embodiments, one or more of the first three, four, or five nucleotides at the 5' terminus, and one or more of the last three, four, or five nucleotides at the 3' terminus are modified. In some embodiments, the modification is a 2’-0-Me, 2’-F, inverted abasic nucleotide, PS bond, or other nucleotide modification well known in the art to increase stability or performance.
[0572] In some embodiments, the first four nucleotides at the 5' terminus, and the last four nucleotides at the 3' terminus are linked with phosphorothioate (PS) bonds.
[0573] In some embodiments, the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus comprise a 2'-O-methyl (2'-0-Me) modified nucleotide. In some embodiments, the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus comprise a 2'-fluoro (2'-F) modified nucleotide. In some embodiments, the first three nucleotides at the 5' terminus, and the last three nucleotides at the 3' terminus comprise an inverted abasic nucleotide.
[0574] In some embodiments, the Spy guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern shown in Table 4, for examplemN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCG GmU*mG*mC*mU (SEQ ID NO: 669); ormN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmU mAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAm AmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 658) where each A, C, G, U, and N is an RNA nucleotide, 2’-OH and phosphodiester linkage to the 3’ nucleotide, m indicates a 2'-O-methyl (2'-0-Me) modified nucleotide, and * indicates a phosphorothioate linkage between nucleotides , and where the totality of the N’s comprise a guide sequence that directs a nuclease to a target sequence, e.g., the target sequence that is complementary to a guide sequence. In certain embodiments, the guide sequence comprises a guide sequence of shown in Tables 3A-3B.
[0575] In some embodiments, the Nme guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern shown in Table 7A-7B, for example mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmC UCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAU*AAGmGmCCmGmUmCmGmA mAmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU* mU (SEQ ID NO: 731); or mN*mN*mN*mNmNNNmNmNNmNNmNNNNNmNNNNmNNNmGUUGmUmAmGmC UCCCmUmGmAmAmAmCmCGUUmGmCUAmCAAUAAGmGmCCmGmUmCmGmAm AmAmGmAmUGUGCmCGmCAAmCGCUCUmGmCCmUmUmCmUGGCAUCG*mU*m U (SEQ ID NO: 732);
[0576] where each A, C, G, U, and N is an RNA nucleotide, 2’-OH and phosphodiester linkage to the 3’ nucleotide, m indicates a 2'-O-methyl (2'-0-Me) modified nucleotide, and * indicates a phosphorothioate linkage between nucleotides, and where the totality of the N’s comprise a guide sequence that directs a nuclease to a target sequence in a target gene. In certain embodiments, the guide sequence comprises a guide sequence shown in Tables 2A- 2B.
[0577] As noted above, in some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA- guided DNA binding agent, such as a Cas nuclease, e.g. Cas9 nuclease, as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease, e.g. Cas9 nuclease, is provided, used, or administered.In some embodiments, the ORF encoding an RNA-guided DNA nuclease is a “modified RNA-guided DNA binding agent ORF” or simply a “modified ORF,” which is used as shorthand to indicate that the ORF is modified.
[0578] In some embodiments, the mRNA or modified ORF may comprise a modified uridine at least at one, a plurality of, or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5’ position, e.g., with a halogen, methyl, or ethyl. In some embodiments, the modified uridine is a pseudouridine modified at the 1 position, e.g., with a halogen, methyl, or ethyl. The modified uridine can be, for example, pseudouridine, Nl-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is Nl-methyl- pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and Nl-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of Nl-methyl pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and Nl-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5- methoxyuridine.
[0579] In some embodiments, an mRNA disclosed herein comprises a 5’ cap, such as a CapO, Capl, or Cap2. A 5’ cap is generally a 7-methylguanine ribonucleotide (which may be further modified, as discussed below e.g. with respect to ARC A) linked through a 5’- triphosphate to the 5’ position of the first nucleotide of the 5’-to-3’ chain of the mRNA, i.e., the first cap-proximal nucleotide. In CapO, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’ -hydroxyl. In Capl, the riboses of the first and second transcribed nucleotides of the mRNA comprise a 2 ’-methoxy and a 2 ’-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33): 12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(l l):E2106-E2115. Most endogenous higher eukaryotic mRNAs, including mammalian mRNAs such as human mRNAs, comprise Capl or Cap2. CapO and other cap structures differing from Capl and Cap2 may be immunogenic in mammals, such as humans, due to recognition as “non-self” by components of the innate immune system such as IFIT-1 and IFIT-5, which can result inelevated cytokine levels including type I interferon. Components of the innate immune system such as IFIT-1 and IFIT-5 may also compete with eIF4E for binding of an mRNA with a cap other than Capl or Cap2, potentially inhibiting translation of the mRNA.
[0580] A cap can be included co-transcriptionally. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific Cat. No. AM8045) is a cap analog comprising a 7- methylguanine 3 ’ -metho xy-5’ -triphosphate linked to the 5’ position of a guanine ribonucleotide which can be incorporated in vitro into a transcript at initiation. ARCA results in a CapO cap in which the 2’ position of the first cap-proximal nucleotide is hydroxyl. See, e.g., Stepinski et al., (2001) “Synthesis and properties of mRNAs containing the novel ‘antireverse’ cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG,” RNA 7: 1486-1495. The ARCA structure is shown below.
[0581] CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies Cat. No. N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies Cat. No.N-7133) can be used to provide a Capl structure co-transcriptionally. 3’-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as Cat. Nos. N-7413 and N-7433, respectively, or CleanCap™ AU: TriLink Biotechnologies as Cat. Nos. N-7114. The CleanCap™ AG structure is shown below.
[0582] Alternatively, a cap can be added to an RNA post-transcriptionally. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Cat. No.M2080S) and has RNA triphosphatase and guanylyltransferase activities, provided by its DIsubunit, and guanine methyltransferase, provided by its D12 subunit. As such, it can add a 7- methylguanine to an RNA, so as to give CapO, in the presence of S -adenosyl methionine and GTP. See, e.g., Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479.
[0583] In some embodiments, the mRNA further comprises a poly-adenylated (poly- A) tail. In some embodiments, the poly-A tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, optionally up to 300 adenines. In some embodiments, the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. In some embodiments, the poly-A tail includes non-adenine nucleotides, i.e., is an interrupted poly-A tail. In certain embodiments, the poly- A tail is interrupted by a non-adenine nucleotide about every 40, 50, 60, 70, 80, or 90 nucleotides. In certain embodiments, the poly-A tail is interrupted by a non-adenine nucleotide about every 50 nucleotides.IX. Ribonucleoprotein complex
[0584] In some embodiments, a composition is encompassed comprising one or more sgRNAs comprising one or more guide sequences from Table 2 A or 3 A or one or more sgRNAs from Table 2B or 3B and an RNA-guided DNA binding agent, e.g., a nuclease, such as a Cas nuclease, such as Cas9. In some embodiments, the RNA-guided DNA-binding agent has cleavase activity, which can also be referred to as double-strand endonuclease activity. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nuclease.Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, Neisseria meningitidis, and other prokaryotes as known in the art , and modified (e.g., engineered or mutant) versions thereof.
[0585] In some embodiments, the Cas nuclease is the Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is the Cas9 nuclease from Neisseria meningitidis.
[0586] In some embodiments, the gRNA together with an RNA-guided DNA binding agent is called a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA binding agent is a Cas nuclease. In some embodiments, the gRNA together with a Cas nuclease is called a Cas RNP. In some embodiments, the RNP comprises Type-I, Type-II, or Type-Ill components. In some embodiments, the Cas nuclease is the Cas9 protein from the Type-II CRISPR / Cas system. In some embodiment, the gRNA together with Cas9 is called a Cas9 RNP.
[0587] Wild type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises more than one RuvC domain or more than one HNH domain. In some embodiments, the Cas9 protein is a wild type Cas9. In each of the composition, use, and method embodiments, the Cas induces a double strand break in target DNA.
[0588] In some embodiments, chimeric Cas nucleases are used, where one domain or region of the protein is replaced by a portion of a different protein. In some embodiments, a Cas nuclease domain may be replaced with a domain from a different nuclease such as Fokl . In some embodiments, a Cas nuclease may be a modified nuclease.
[0589] In other embodiments, the Cas nuclease may be from a Type-I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of the Cascade complex of a Type-I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from a Type-Ill CRISPR / Cas system. In some embodiments, the Cas nuclease may have an RNA cleavage activity.
[0590] In some embodiments, the RNA-guided DNA-binding agent has single-strand nickase activity, i.e., can cut one DNA strand to produce a single-strand break, also known as a “nick.” In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nickase. A nickase is an enzyme that creates a nick in dsDNA, i.e., cuts one strand but not the other of the DNA double helix. In some embodiments, a Cas nickase is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which an endonucleolytic active site is inactivated, e.g., by one or more alterations (e.g., point mutations) in a catalytic domain. See, e.g., US Pat. No. 8,889,356 for discussion of Cas nickases and exemplary catalytic domain alterations. In some embodiments, a Cas nickase such as a Cas9 nickase has an inactivated RuvC or HNH domain.
[0591] In some embodiments, the RNA-guided DNA-binding agent is modified to contain only one functional nuclease domain. For example, the agent protein may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, a nickase is used having a RuvC domain with reduced activity. In some embodiments, a nickase is used having an inactive RuvC domain. In some embodiments, a nickase is used having an HNH domain with reduced activity. In some embodiments, a nickase is used having an inactive HNH domain.
[0592] In some embodiments, a conserved amino acid within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity. In some embodiments, a Casnuclease may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3): 759-771. In some embodiments, the Cas nuclease may comprise an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015).
[0593] In some embodiments, the polypeptide comprises, from N to C terminus, an optional NLS, a cytidine deaminase (e.g., APOBEC3A), an optional linker, and an Nme Cas9 nickase with an amino acid substitution in the HNH or HNH-like nuclease domain, e.g., a D16A NmeCas9 nickase. In some embodiments, the polypeptide comprises, from N to C terminus, an optional NLS, a cytidine deaminase (e.g., APOBEC3A), an optional linker, and an Nme Cas9 nickase with an amino acid substitution in the HNH or HNH-like nuclease domain, e.g., a D16A Nme2Cas9 nickase. In some embodiments, the polypeptide comprises, from N to C terminus, first and second NLSs, a cytidine deaminase (e.g., APOBEC3A), an optional linker, and an Nme Cas9 nickase with an amino acid substitution in the HNH or HNH-like nuclease domain, e.g., a D16A NmeCas9 nickase. In some embodiments, the polypeptide comprises, from N to C terminus, first and second NLSs, a cytidine deaminase (e.g., APOBEC3A), an optional linker, and an Nme Cas9 nickase with an amino acid substitution in the HNH or HNH-like nuclease domain, e.g., a D16A Nme2Cas9 nickase. In some embodiments, the polypeptide comprises, from N to C terminus, A first NLS, a cytidine deaminase (e.g., APOBEC3A), a second NLS, an optional linker, and an Nme Cas9 nickase with an amino acid substitution in the HNH or HNH-like nuclease domain, e.g., a D16A NmeCas9 nickase. In some embodiments, the polypeptide comprises, from N to C terminus, A first NLS, a cytidine deaminase (e.g., APOBEC3A), a second NLS, an optional linker, and an Nme Cas9 nickase with an amino acid substitution in the HNH or HNH-like nuclease domain, e.g., a D16A Nme2Cas9 nickase.
[0594] In some embodiments, an mRNA encoding a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to a target sequence and introduce a DSB by generating a nick on opposite strands of the target sequence (i.e., double nicking). In some embodiments, use of double nicking may improve specificity and reduce off-target effects. In some embodiments, a nickase is used together with two separate guide RNAs targeting opposite strands of DNA to produce a double nick inthe target DNA. In some embodiments, a nickase is used together with two separate guide RNAs that are selected to be in close proximity to produce a double nick in the target DNA.
[0595] In some embodiments, the RNA-guided DNA-binding agent lacks cleavase and nickase activity. In some embodiments, the RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide. A dCas polypeptide has DNA-binding activity while essentially lacking catalytic (cleavase / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA-binding agent lacking cleavase and nickase activity or the dCas DNA-binding polypeptide is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which its endonucleolytic active sites are inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domains. See, e.g., US 20140186958; US 20150166980; and US 20190338308.
[0596] In some embodiments, the RNA-guided DNA-binding agent comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).
[0597] In some embodiments, the heterologous functional domain may facilitate transport of the RNA-guided DNA-binding agent into the nucleus of a cell. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA-binding agent may be fused with 1-5 NLS(s). In some embodiments, the RNA-guided DNA-binding agent may be fused with 2, 3, or 4 NLS(s). In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLS(s). In some embodiments, the RNA-guided DNA-binding agent may be fused with one NLS. Where one NLS is used, the NLS may be linked at the N-terminus or the C-terminus of the RNA-guided DNA-binding agent sequence. In some embodiments, the NLS is not linked to the C-terminus. It may also be inserted within the RNA-guided DNA binding agent sequence. In certain circumstances, at least the two NLSs are the same (e.g., two SV40 NLSs). In certain embodiments, at least two different NLSs are present the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA-binding agent is fused to two SV40 NLS sequences linked at the carboxy terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs, one linked at the N-terminus and one at the C-terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with 3 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with no NLS.
[0598] In some embodiments, the NLS may be SV40 NLS. Exemplary SV40 NLS sequence may be SV40 NLS, PKKKRKV (SEQ ID NO: 916) or PKKKRRV (SEQ ID NO: 928). In some embodiments, the NLS may be a bipartite sequence, such as the NLS ofnucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 929). In some embodiments, the NLS sequence may comprise LAAKRSRTT (SEQ ID NO: 917), QAAKRSRTT (SEQ ID NO: 918), PAPAKRERTT (SEQ ID NO: 919), QAAKRPRTT (SEQ ID NO: 920), RAAKRPRTT (SEQ ID NO: 921), AAAKRSWSMAA (SEQ ID NO: 922), AAAKRVWSMAF (SEQ ID NO: 923), AAAKRSWSMAF (SEQ ID NO: 924), AAAKRKYFAA (SEQ ID NO: 925), RAAKRKAFAA (SEQ ID NO: 926), or RAAKRKYFAV (SEQ ID NO: 927). The NLS may be a snurportin-1 importin- (IBB domain, e.g. an SPNl-impP sequence. See Huber et al., 2002, J. Cell Bio., 156, 467-479. In a specific embodiment, a single PKKKRKV (SEQ ID NO: 916). In some embodiments, the first and second NLS are independently selected from an SV40 NLS, a nucleoplasmin NLS, a bipartite NLS, a c-myc like NLS, and an NLS comprising the sequence KTRAD (SEQ ID NO: 1023). In certain embodiments, the first and second NLSs may be the same (e.g., two SV40 NLSs). In certain embodiments, the first and second NLSs may be different.
[0599] In some embodiments, the first NLS is a SV40NLS and the second NLS is a nucleoplasmin NLS.
[0600] In some embodiments, the SV40 NLS comprises a sequence of PKKKRKVE (SEQ ID NO: 1002) or KKKRKVE (SEQ ID NO: 1003). In some embodiments, the nucleoplasmin NLS comprises a sequence of KRPAATKKAGQAKKKK (SEQ ID NO: 929). In some embodiments, the bipartite NLS comprises a sequence of KRTADGS EFES PKKKRKVE (SEQ ID NO: 1004). In some embodiments, the c-myc like NLS comprises a sequence of PAAKKKKLD (SEQ ID NO: 1005).
[0601] One or more linkers are optionally included at the fusion site of the NLS to the nuclease, or between NLS when more than one is present.
[0602] In some embodiments, one or more NLS(s) according to any of the foregoing embodiments are present in the RNA-guided DNA-binding agent in combination with one or more additional heterologous functional domains. One or more linkers are optionally included at the fusion site.
[0603] In some embodiments, the heterologous functional domain may be capable of modifying the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the half-life of the RNA-guided DNA binding agent may be increased. In some embodiments, the half-life of the RNA-guided DNA-binding agent may be reduced. In some embodiments, the heterologous functional domain may be capable of increasing the stability of the RNA-guided DNA-binding agent. In some embodiments, the heterologous functionaldomain may be capable of reducing the stability of the RNA-guided DNA-binding agent. In some embodiments, the heterologous functional domain may act as a signal peptide for protein degradation. In some embodiments, the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain may comprise a PEST sequence. In some embodiments, the RNA-guided DNA-binding agent may be modified by addition of ubiquitin or a polyubiquitin chain. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronal- precursor-cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rubl in S. cerevisiae), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane- anchored UBE (MUB), ubiquitin fold- modifier- 1 (UFM1), and ubiquitin-like protein-5 (UBL5).
[0604] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreenl ), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire,), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFPl, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira- Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato) or any other suitable fluorescent protein. In other embodiments, the marker domain may be a purification tag or an epitope tag. Non-limiting exemplary tags include glutathione-S -transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, SI, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S -transferase (GST), horseradish peroxidase (HRP),chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent proteins.
[0605] In further embodiments, the heterologous functional domain may be an effector domain. When the RNA-guided DNA-binding agent is directed to its target sequence, e.g., when a Cas nuclease is directed to a target sequence by a gRNA, the effector domain may modify or affect the target sequence. In some embodiments, the effector domain may be chosen from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcriptional activation domain, and a transcriptional repressor domain. In some embodiments, the heterologous functional domain is a nuclease, such as a FokI nuclease. See, e.g., US Pat. No. 9,023,649. In some embodiments, the heterologous functional domain is a transcriptional activator or repressor. See, e.g., Qi et al., “Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression,” Cell 152:1173-83 (2013); Perez-Pinera et al., “RNA-guided gene activation by CRISPR-Cas9-based transcription factors,” Nat. Methods 10:973-6 (2013);Mali et al., “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering,” Nat. Biotechnol. 31:833-8 (2013); Gilbert et al., “CRIS PR-mediated modular RNA-guided regulation of transcription in eukaryotes,” Cell 154:442-51 (2013). As such, the RNA-guided DNA-binding agent essentially becomes a transcription ...
Claims
We claim:
1. An engineered cell, comprising a genetic modification within genomic coordinates chrl9:6586002-6591015.
2. An engineered cell, which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising a genetic modification within genomic coordinates chr 19 : 6586002-6591015.
3. The engineered cell of claim 1 or 2, wherein the genetic modification is within the genomic coordinates targeted by a CD70 guide RNA comprising a guide sequence of any one of SEQ ID NOs: 1-38.
4. The engineered cell of any one of claims 1-3, which has reduced or eliminated surface expression of CD70 relative to an unmodified cell, comprising a genetic modification within any one of the genomic coordinates listed in Table 2 A.
5. The engineered cell of any one of claims 1-4, wherein the genetic modification is within genomic coordinates chosen from: chrl9:6590121-6590145; chrl9:6586002-6586026; chrl9:6586003-6586027; chrl9:6586013-6586037; chrl9:6586357-6586381; chrl9:6586365-6586389; chrl9:6586376-6586400; chrl9:6590988-6591012; chrl9:6590991-6591015; chrl9:6590862-6590886; chrl9:6586396-6586420; chrl9:6586372-6586396; chrl9:6586371-6586395; chrl9:6586360-6586384; chrl9:6586355-6586379; chrl9:6586268-6586292; chrl9:6586259-6586283; chrl9:6586256-6586280; chrl9:6586142-6586166; chrl9:6586141-6586165; chrl9:6586135-6586159; chrl9:6586128-6586152; chrl9:6586127-6586151; chrl9:6586126-6586150; chrl9:6586121-6586145; chrl9:6586120-6586144; chrl9:6586096-6586120; chrl9:6586055-6586079; chrl9:6586029-6586053; chrl9:6586023-6586047; chrl9:6586312-6586336; chr 19:6586151-6586175; chr 19:6586145-6586169; chrl9:6586100-6586124; chrl9:6586030-6586054; chrl9:6586028-6586052; chrl9:6586395-6586419; and chrl9:6586394-6586418.
6. The engineered cell of any one of claims 1-5, wherein the genetic modification is within the genomic coordinates chosen from: chrl9:6590121-6590145 and chrl9:6586268- 6586292.
7. The engineered cell of any one of claims 1-6, wherein the genetic modification is within genomic coordinates targeted by a guide RNA comprising a guide sequence of SEQ ID NO: 1 or 16.
8. The engineered cell of claim 1 or 2, wherein the genetic modification is within the genomic coordinates targeted by a guide RNA comprising a guide sequence of any one of SEQ ID NOs: 101-169.
9. The engineered cell of any one of claims 1, 2, and 8, which has reduced or eliminated surface expression of CD70 relative to an unmodified cell, comprising a genetic modification within any one of the genomic coordinates listed in Table 3 A.
10. The engineered cell of any one of claims 1, 2, 8, and 9, wherein the genetic modification is within genomic coordinates chosen from:(a) chrl9:6590998-6591018; chrl9:6590995-6591015; chrl9:6590992-6591012; chrl9:6590991-6591011; chrl9:6590987-6591007; chrl9:6590986-6591006; chrl9:6590985-6591005; chrl9:6590977-6590997; chrl9:6590972-6590992; chrl9:6590966-6590986; chrl9:6590958-6590978; chrl9:6590957-6590977; chrl9:6590945-6590965; chrl9:6590944-6590964; chrl9:6590940-6590960; chrl9:6590939-6590959; chrl9:6590935-6590955; chrl9:6590926-6590946; chrl9:6590920-6590940; chrl9:6590919-6590939; chrl9:6590914-6590934; chrl9:6590908-6590928; chrl9:6590907-6590927; chrl9:6590899-6590919; chrl9:6590875-6590895; chrl9:6590866-6590886; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6586374-6586394; chrl9:6586368-6586388; chrl9:6586288-6586308; chrl9:6586285-6586305; chrl9:6586276-6586296; chrl9:6586267-6586287; chrl9:6586199-6586219; chrl9:6586172-6586192; chrl9:6586138-6586158; chrl9:6586099-6586119; and chrl9:6586050-6586070; and(b) chrl9:6590875-6590895; chrl9:6590844-6590864; chrl9:6590843-6590863; chrl9:6590835-6590855; chrl9:6590104-6590124; chrl9:6590096-6590116; chrl9:6590095-6590115; chrl9:6590094-6590114; chrl9:6590093-6590113; chrl9:6590087-6590107; chrl9:6590084-6590104; chrl9:6590083-6590103; chrl9:6590078-6590098; chrl9:6586368-6586388; chrl9:6586299-6586319; chrl9:6586267-6586287; chrl9:6590842-6590862; chrl9:6590139-6590159; chrl9:6590138-6590158; chrl9:6590135-6590155; chrl9:6590079-6590099; chrl9:6590077-6590097; chrl9:6586412-6586432; chrl9:6586404-6586424; chrl9:6586403-6586423; chrl9:6586396-6586416; chrl9:6586396-6586416; chrl9:6586395-6586415; chrl9:6586388-6586408; chrl9:6586380-6586400; chrl9:6586379-6586399; chrl9:6586375-6586395; chrl9:6586369-6586389; chrl9:6586367-6586387; chrl9:6586360-6586380; chrl9:6586359-6586379; chrl9:6586120-6586140; and chrl9:6586028-6586048.
11. The engineered cell of any one of claims 1, 2, and 8-10, wherein the genetic modification is within genomic coordinates targeted by a guide RNA comprising a guide sequence of any one of SEQ ID NOs: 101, 104, 109, 115, 116, and 123.
12. The engineered cell of any one of claims 1, 2, and 8-11, wherein the genetic modification is within the genomic coordinates chosen from: chrl9:6590998-6591018; chrl9:6590991-6591011; chrl9:6590939-6590959; chrl9:6590972-6590992; chrl9:6590940-6590960; and chrl9:6590907-6590927.
13. The engineered cell of any one of claims 1, 2, and 8-10, wherein the genetic modification is within genomic coordinates targeted by a guide RNA comprising a guide sequence of any one of SEQ ID NOs: 125, 157, 160, 162, 164, and 168.
14. The engineered cell of any one of claims 1, 2, 8-10, and 13, wherein the genetic modification is within the genomic coordinates chosen from: chrl9:6590875-6590895; chrl9:6586396-6586416; chrl9:6586388-6586408; chrl9:6586379-6586399; chrl9:6586369-6586389; and chrl9:6586120-6586140.
15. A composition comprising a guide RNA and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 1-38; b. a guide sequence that is at least 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-38; c. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from SEQ ID NOs: 1-38; d. a sequence that comprises 10 contiguous nucleotides ±10 nucleotides of a genomic coordinate listed in Table 2 A; e. at least 20, 21, 22, 23, or 24, contiguous nucleotides of a sequence from (d); or f. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from (d).
16. A composition comprising a guide RNA and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 101-169; b. a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 101-169;c. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from SEQ ID NOs: 101-169; d. a sequence that comprises 10 contiguous nucleotides ±10 nucleotides of a genomic coordinate listed in Table 3A; e. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (d); or f. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from (d).
17. The composition of claim 15 or 16, for use in altering a DNA sequence within the CD70 gene in a cell.
18. A pharmaceutical composition comprising, or use of, the composition of claim 15 or 16 for inducing a double stranded break or a single stranded break within the CD70 gene in a cell, modifying the nucleic acid sequence of the CD70 gene in a cell, or reducing expression of the CD70 gene in a cell.
19. A method of making an engineered human cell, which has reduced or eliminated surface expression of CD70 protein relative to an unmodified cell, comprising contacting a cell with the composition of claim 15 or 16.
20. A method of reducing surface expression of CD70 protein in a cell relative to an unmodified cell, comprising contacting a cell with a composition comprising a guide RNA and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA- guided DNA binding agent, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 1-38; b. a guide sequence that is at least 20, 21, 22, 23, 24, or 25 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-38; c. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from SEQ ID NOs: 1-38; d. a sequence that comprises 10 contiguous nucleotides ±10 nucleotides of a genomic coordinate listed in Table 2 A; e. at least 20, 21, 22, 23, or 24, or 25 contiguous nucleotides of a sequence from (d); or f. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from (d).
21. The composition, use, or method of any one of claims 15 and 17-20, wherein the guide RNA comprises a guide sequence of SEQ ID NO: 1 or 16.
22. A method of reducing surface expression of CD70 protein in a cell relative to an unmodified cell, comprising contacting a cell with a composition comprising a guide RNA and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA- guided DNA binding agent, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 101-169; b. a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 101-169; c. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from SEQ ID NOs: 101-169; d. a sequence that comprises 10 contiguous nucleotides ±10 nucleotides of a genomic coordinate listed in Table 3A; e. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (d); or f. a guide sequence that is at least 85%, 90%, or 95% identical to a sequence selected from (d).
23. The composition, use, or method of any one of claims 16-19 and 22, wherein the guide RNA comprises a guide sequence of any one of SEQ ID NO: 101, 104, 109, 115, 116, and 123.
24. The composition, use, or method of any one of claims 15-23, wherein the RNA- guided DNA binding agent is a cleavase.
25. The composition, use, or method of any one of claims 16-19, 22, and 24, wherein the guide RNA comprises a guide sequence of any one of SEQ ID NO: 125, 157, 160, 162, 164, and 168.
26. The composition, use, or method of any one of claims 15-25, wherein the RNA- guided DNA binding agent is a base editor.
27. A population of cells comprising the engineered cell of any one of claims 1-14 or comprising the engineered cell produced by use of the composition of any one of claims 15- 18, 21, and 23-26, or the method of any one of claims 19-26.
28. A pharmaceutical composition comprising (a) the engineered cell of any one of claims 1-14 or the engineered cell produced by the composition or method of any one of claims 15- 26; or (b) the population of cells of claim 27.
29. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-28, wherein the genetic modification comprises an insertion, a deletion, or a substitution.
30. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-29, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates.
31. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-30, wherein the cells are engineered with a genomic editing system.
32. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 3-31, wherein the guide RNA is a dual guide RNA (dgRNA) or a single guide RNA (sgRNA).
33. The engineered cell, population of cells, pharmaceutical composition, or method of claim 32, wherein the sgRNA is a Spy sgRNA.
34. The engineered cell, population of cells, pharmaceutical composition, or method of claim 33, wherein the Spy sgRNA further comprises one or more of:A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein1. at least one of the following pairs of nucleotides are substituted in hairpin 1 with Watson-Crick pairing nucleotides: Hl-1 and Hl-12, Hl-2 and Hl-11, Hl-3 and Hl-10, or Hl-4 and Hl-9, and the hairpin 1 region optionally lacks a. any one or two of Hl -5 through Hl -8, b. one, two, or three of the following pairs of nucleotides: Hl-1 and Hl- 12, Hl-2 and Hl-11, Hl-3 and Hl-10, and Hl-4 and Hl-9, or c. 1-8 nucleotides of hairpin 1 region; or2. the shortened hairpin 1 region lacks 4-8 nucleotides, preferably 4-6 nucleotides; and a. one or more of positions Hl-1, Hl-2, or Hl-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) or b. one or more of positions Hl-6 through Hl-10 is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); or3. the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, Hl-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); orB. a shortened upper stem region, wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601); orC. a substitution relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) at any one or more of LS6, LS7, US3, US 10, B3, N7, N15, N17, H2-2 and H2- 14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; orD. an Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 601) with an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region.
35. The engineered cell, population of cells, pharmaceutical composition, or method of claim 34, wherein the guide RNA lacks 6 or 8 nucleotides in shortened hairpin 1 , and / or wherein H-l and H-3 are deleted, and / or wherein the guide RNA further comprises a 3’ tail, wherein the 3’ tail is 1-4 nucleotides in length, optionally 1 nucleotide in length, and / or wherein the guide RNA comprises an upper stem region comprising a modification to any one or more of US 1 -US 12 in the upper stem region.
36. The engineered cell, population of cells, pharmaceutical composition, or method of claim 32 or 33, wherein the sgRNA comprises a nucleotide sequence selected from the sequences in Tables 4A-5B, or wherein the guide RNA comprises a modified nucleotide sequence selected from the modified Spy guide scaffold sequences in Table 5A, wherein the modified nucleotide sequence is 3’ of the guide sequence, optionally wherein the guide RNA is modified according to the pattern of a nucleotide sequence selected from the modified Spy guide RNA sequences in Table 5B.
37. The engineered cell, population of cells, pharmaceutical composition, or method of claim 32 or 33, comprising a sequence or modification pattern selected from SEQ ID NOs: 620, 630-641, and 658-669.
38. The engineered cell, population of cells, pharmaceutical composition, or method of claim 32, wherein the sgRNA is a Nme sgRNA that comprises a guide region and a conserved region.
39. The engineered cell, population of cells, pharmaceutical composition, or method of claim 38, wherein the conserved region comprises one or more of:(a) a shortened repeat / anti-repeat region, wherein the shortened repeat / anti- repeat region lacks 2-24 nucleotides relative to SEQ ID NO: 700, wherein(i) one or more of nucleotides 37-48 and 53-64 is deleted relative to SEQ ID NO: 700 and optionally one or more of nucleotides 37-64 is substituted relative to SEQ ID NO: 700; and(ii) nucleotide 36 is linked to nucleotide 65 by at least 2 nucleotides; or(b) a shortened hairpin 1 region, wherein the shortened hairpin 1 lacks 2-10 nucleotides, optionally 2-8 nucleotides relative to SEQ ID NO: 700 wherein(i) one or more of nucleotides 82-86 and 91-95 is deleted relative to SEQ ID NO: 700 and optionally one or more of positions 82-96 is substituted relative to SEQ ID NO: 700; and(ii) nucleotide 81 is linked to nucleotide 96 by at least 4 nucleotides; or(c) a shortened hairpin 2 region, wherein the shortened hairpin 2 lacks 2-18 nucleotides, optionally 2-16 nucleotides relative to SEQ ID NO: 700, wherein(i) one or more of nucleotides 113-121 and 126-134 is deleted relative to SEQ ID NO: 700 and optionally one or more of nucleotides 113-134 is substituted relative to SEQ ID NO: 700; and(ii) nucleotide 112 is linked to nucleotide 135 by at least 4 nucleotides; wherein one or both nucleotides 144-145 are optionally deleted relative toSEQ ID NO: 700; optionally, wherein at least 10 nucleotides are modified nucleotides.
40. The engineered cell, population of cells, pharmaceutical composition, or method of claim 38 or 39, wherein the conserved region comprises a modified nucleotide sequence selected from the modified conserved region Nme guide RNA motifs in Table 6, and wherein the conserved region is 3’ of the guide region.
41. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 38-40, wherein the guide RNA comprises a nucleotide sequence selected from any one of SEQ ID NOs: 700-706, 1018, 1019, and 720-732 or any other modified sequence shown in Tables 7A-7B, wherein the N’s represent the guide sequence of any one of SEQ ID NOs: 1-38.
42. The engineered cell, population of cells, pharmaceutical composition, or method of claim 41, wherein each nucleotide is any natural or non-natural nucleotide and / or wherein the guide RNA is modified according to a pattern selected from SEQ ID NOs: 720-732, wherein the N’s are collectively the guide sequence of any one of SEQ ID NO: 1-38, N, A, C, G, and U are ribonucleotides (2’-OH), “m” indicates a 2’-0-Me modification, “f” indicates a 2’- fluoro modification, and a indicates a phosphorothioate linkage between nucleotides.
43. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 3-42, wherein the guide RNA comprises at least one end modification, optionally wherein the modification comprises a 5 ’ end modification and / or wherein the modification comprises a 3’ end modification.
44. The engineered cell, population of cells, pharmaceutical composition, or method of claim 43, wherein the guide RNA comprises a modification in a hairpin region, optionally wherein the modification in a hairpin region is also an end modification.
45. The engineered cell, population of cells, pharmaceutical composition, or method of claim 43 or 44, wherein the modification comprises a 2’-O-methyl (2’-0-Me) modified nucleotide, and / or wherein the modification comprises a phosphorothioate (PS) bond between nucleotides, and / or wherein the modification comprises a 2’-O-methyl (2’-0-Me) modified nucleotide with a phosphorothioate (PS) bond to a 3’ adjacent nucleotide, and / or wherein the modification comprises a 2’-fluor (2’F) modified nucleotide, and / or wherein the 5’ end modification comprises a 2’-O-methyl (2’-0-Me) modified nucleotide with a phosphorothioate (PS) bond to a 3’ adjacent nucleotide at nucleotides 1-3 of the 5’ end of the guide sequence.
46. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 3-45, wherein the guide RNA is associated with a lipid nanoparticle (LNP), optionally wherein the LNP comprises a cationic lipid, a helper lipid, a neutral lipid, a stealth lipid, or a combination of two or more thereof.
47. The engineered cell, population of cells, pharmaceutical composition, or method of claim 46, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3- ((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate, and / or wherein the helper lipid is cholesterol, and / or wherein the neutral lipid is l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and / or wherein the stealth lipid is l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000 (PEG2k-DMG), and / or wherein the LNP comprises (9Z,12Z)-3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z, 12Z)-octadeca-9, 12-dienoate, DSPC, cholesterol, and PEG2k-DMG.
48. A pharmaceutical composition comprising the engineered cell of any one of claims 1- 47.
49. A population of cells comprising the engineered cell of any one of claims 1-47.
50. A pharmaceutical composition comprising a population of cells, wherein the population of cells comprises a plurality of the engineered cell of any one of claims 1-47,optionally wherein the pharmaceutical composition further comprises a pharmaceutical excipient.
51. A method of administering the engineered cell, population of cells, or pharmaceutical composition of any one of claims 1-50 to a subject in need thereof, to a subject as an adoptive cell transfer (ACT) therapy, or to a subject as an immunotherapy.
52. An engineered cell, population of cells, or pharmaceutical composition of any one of claims 1-50, for use as an ACT therapy.
53. A method of treating a disease or disorder comprising administering the engineered cell, population of cells, or pharmaceutical composition of any one of claims 1-50 to a subject in need thereof.
54. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-53, wherein the engineered cell has reduced surface expression of CD70 protein relative to an unmodified cell.
55. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-54, wherein the cell comprises an exogenous nucleic acid encoding a targeting receptor that is expressed on the surface of the engineered cell, optionally wherein the targeting receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR).
56. The engineered cell, population of cells, pharmaceutical composition, or method of cell of claim 55, wherein the targeting receptor is a WT1 TCR or an anti-CD70 CAR.
57. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-56, wherein the engineered cell further comprises a genetic modification in the TGFBR2 gene, optionally wherein the genetic modification in the TGFBR2 gene is within the genomic coordinates chr3:30674205-30674229, and optionally wherein the genetic modification in the TGFBR2 gene comprises at least one nucleotide within the genomic coordinates targeted by a TGFBR2 guide RNA comprising a guide sequence of SEQ ID NO: 301.
58. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-57, wherein the engineered cell further comprises a genetic modification in one or more of CIITA, HLA-A, HLA-B, TRAC, or TGFBR2 gene, and / or wherein the engineered cell further has reduced surface expression of one or more of MHC class II, HLA- A, HLA-B, TRAC, or TGFBR2 relative to an unmodified cell.
59. The engineered cell, population of cells, pharmaceutical composition, or method of claim 58, wherein the engineered cell comprises:i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891-29942915 or chr6:29942609-29942633; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246, chr6:31355221-31355245, or chr6: 31355205-31355229; iii. a genetic modification in the TRAC gene within the genomic coordinates chrl4:22547524-22547544, chrl4:22550574-22550598, or chrl4:22550544- 22550568; iv. a genetic modification in the OITA gene within the genomic coordinates chrl6: 10906643-10906667 or chrl6: 10907504-10907528; or v. a combination of two or more of (i)-(iv).
60. The engineered cell, population of cells, pharmaceutical composition, or method of claim 58 or 59, wherein the engineered cell comprises at least one genetic modification (i) within the genomic coordinates targeted by a HLA-A guide RNA comprising a guide sequence of SEQ ID NO: 403 or 404; (ii) within the genomic coordinates targeted by a HLA- B guide RNA comprising a guide sequence of SEQ ID NO: 406, 405, or 407; (iii) within the genomic coordinates targeted by an TRAC guide RNA comprising a guide sequence of SEQ ID NO: 413, 408, or 409; (iv) within the genomic coordinates targeted by a OITA guide RNA comprising a guide sequence of SEQ ID NO: 402 or 401; or (v) a combination of two or more of (i)-(iv).
61. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 58-60, wherein the engineered cell comprises a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229 or chr3: 30671941- 30671961.
62. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 58-61, wherein the engineered cell comprises at least one genetic modification within the genomic coordinates targeted by a TGFBR2 guide RNA comprising a guide sequence of SEQ ID NO: 301 or 302.
63. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 58-62, wherein the engineered cell comprises a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRAC gene, and a genetic modification in the CIITA gene.
64. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 58-63, wherein the engineered cell comprises a genetic modification in the HLA-A gene, a genetic modification in the HLA-B gene, a genetic modification in the TRACgene, a genetic modification in the CIITA gene, and a genetic modification in the TGFBR2 gene.
65. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 58-64, wherein the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891- 29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222- 31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chr 14:22547524-22547544; and iv. a genetic modification in the CIITA gene within the genomic coordinates chrl6: 10906643-10906667.
66. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 58-65, wherein the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891- 29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222- 31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chr 14:22547524-22547544; iv. a genetic modification in the CIITA gene within the genomic coordinates chrl6: 10906643-10906667; and v. a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229.
67. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 58-66, wherein the engineered cell comprises: i. a genetic modification in the HLA-A gene within the genomic coordinates chr6:29942891- 29942915; ii. a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222- 31355246; iii. a genetic modification in the TRAC gene within the genomic coordinates chr 14:22547524-22547544; iv. a genetic modification in the CIITA gene within the genomic coordinates chr!6: 10906643-10906667;v. a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205-30674229; and vi. a genetic modification in the CD70 gene within the genomic coordinates chrl9:6590121- 6590145.
68. An engineered human cell comprising a genetic modification in the HL A- A gene within the genomic coordinates chr6:29942891-29942915, a genetic modification in the HLA-B gene within the genomic coordinates chr6:31355222-31355246, a genetic modification in the OITA gene within the genomic coordinates chrl6: 10906643-10906667, a genetic modification in the TGFBR2 gene within the genomic coordinates chr3:30674205- 30674229, a genetic modification in the TRAC gene within the genomic coordinates chrl4:22547524-22547544, and a genetic modification in the CD70 gene within the genomic coordinates chr 19:6590121-6590145.
69. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-68, wherein the engineered cell is an immune cell, optionally wherein the engineered cell is a lymphocyte.
70. The engineered cell, population of cells, pharmaceutical composition, or method of claim 69, wherein the engineered cell is a T cell, optionally wherein the cell is a CD4+ T cell or a CD8+T cell, and / or wherein the cell is a memory T cell, and / or wherein the cell is a stem-cell memory T cell (Tscm).
71. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-70, wherein the cell is an allogeneic cell.
72. The engineered cell, population of cells, pharmaceutical composition, or method of any one of claims 1-71, for use in administering to a subject as an adoptive cell transfer (ACT) therapy, for use in treating a subject with cancer, for use in treating a subject with an infectious disease, or for use in treating a subject with an autoimmune disease.
73. The population of cells or the pharmaceutical composition of any one of claims 27-72, wherein the population of cells is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% CD70 negative as measured by flow cytometry.
74. The population of cells or pharmaceutical composition of any one of claims 27-73, wherein at least 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the population of cells comprises the genetic modification in the CD70 gene, as measured by nextgeneration sequencing (NGS).