Products and methods for inhibiting the expression of dynamin 1 variants

Abstract

Provided is an RNA interference-based method and product for inhibiting the expression of pathogenic dynamin 1 variants. A delivery vehicle such as recombinant adeno-associated virus delivers DNA encoding RNA that inhibits the expression of dynamin 1 variants. This method treats, for example, developmental and epileptic encephalopathies.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Patent Application No. 17 / 231,963, filed April 15, 2021, which is incorporated by reference in its entirety.

[0002] U.S. Government Statement of Interests This invention was made with Government support under Grants R37 NS031348 and F31 NS111808 awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0003] Incorporation by Reference of Electronically Submitted Materials This application contains a sequence listing in computer readable form, which is incorporated by reference in its entirety as a separate part of this disclosure and is identified as follows: ASCII text file named "56694_SeqListing.txt" created on April 14, 2022, with a file size of 18,950 bytes.

[0004] Provided is an RNA interference-based method and product for inhibiting the expression of pathogenic dynamin 1 variants. A delivery vehicle such as a recombinant adeno-associated virus delivers DNA encoding an RNA that inhibits the expression of dynamin 1 variants. The method treats developmental and epileptic encephalopathies. [Background technology]

[0005] DNM1 encodes dynamin 1, a critical presynaptically localized multimeric brain-specific GTPase that mediates endocytosis. Individuals with pathogenic DNM1 variants suffer from two of the most severe developmental and epileptic encephalopathy (DEE) syndromes, Lennox-Gastaut syndrome and infantile spasms. Identification of affected individuals is likely to increase now that DNM1 is included in screening panels for severe pediatric epilepsy. Children with DNM1 mutations suffer from an intractable condition that manifests as early-onset seizures, global developmental delay, profound intellectual disability, lack of language, hypotonia, dystonia, and spasticity. Affected individuals, as with many DEEs, respond poorly to antiepileptic drugs, and over 80% of patients remain seizure-prone.

[0006] Prior to the identification of pathogenic human variants, the first direct association between DNM1 and severe epilepsy was a spontaneous missense mutation in the mouse orthologue, termed "fitful" (gene symbol: Dnm1 Ftfl ) [1]. The mutations occur in mutually exclusive alternative exons in the mid-domain of Dnm1 that define Dnm1a, which, together with Dnm1b, comprises the two functionally semi-redundant isoforms of Dnm1. Peptides encoded by these highly conserved exons form part of an assembly domain important for oligomerization of dynamin monomers into endocytic ring structures [2] and Boumil, supra, 1].

[0007] Dnm1 Ftfl / + Heterozygous mice exhibit only mild spontaneous and manipulation-induced seizures from 2–3 months of age and have a normal life span, whereas Dnm1 Ftfl / FtflHomozygotes display a DEE-like phenotype with severe ataxia, developmental delay, and fully penetrant lethal seizures by the end of the third postnatal week. Dnm1b is expressed primarily during pregnancy and expression decreases during early postnatal development, whereas Dnm1a expression increases during early postnatal development, peaks during the second postnatal week, and becomes the predominant isoform in adulthood. However, isoform-specific homozygous knockout mice of either Dnm1a or Dnm1b (Dnm1 Δa / Δa or Dnm1 Δb / Δb ) and Dnm1 Ftfl There is no evidence of seizures or other obvious phenotypic features associated with the Dnm1 allele [3 and 4]. These and other in vivo and in vitro studies have demonstrated that Dnm1 Ftfl These results suggest that, as modeled or predicted for all DNM1 pathogenic variants, it exerts a dominant-negative effect on protein function [5, Asinof (2016), supra, and von Spiczak, supra, 2].

[0008] Treatment of DEE is currently limited to treating symptoms, primarily through the use of antiepileptic drugs. The drugs do not address the underlying genetic defect and therefore are not expected to halt or slow the progression of the disease, and may result in a loss of efficacy when administered long-term.

[0009] Thus, there is a need in the art for products and methods for the treatment of DEE. [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Boumil et al.,PLoS Genet.,6:e1001046(2010) [Non-Patent Document 2] von Spiczak et al., Neurology, 89:385-394(2017) [Non-Patent Document 3] Asinof et al.,PLoS Genet.,11:e1005347(2015) [Non-Patent Document 4] Asinofet al.,Neurobiol.Dis.,95:1-11(2016) [Non-Patent Document 5] Dhindsa et al.,Neurol.Genet.,1:e4(2015) Summary of the Invention

[0011] The disclosure herein provides a method for specifically inducing the silencing of harmful DNM1 isoforms by RNA interference (RNAi) using a vector expressing an artificial inhibitory RNA targeting DMN1 mRNA. Contemplated artificial DMN1 inhibitory RNAs include, but are not limited to, small interfering RNA (siRNA) (also referred to as short interfering RNA, small inhibitory RNA, or short inhibitory RNA), short hairpin RNA (shRNA), and miRNA shuttle (artificial miRNA) that inhibit the expression of pathogenic DNM1 isoforms. The artificial inhibitory RNA is referred to herein as miDNM1. miDNM1 is a small regulatory sequence that acts post-transcriptionally, for example, by targeting the coding region or 3'UTR of DNM1 mRNA in a reverse-complementary manner, thereby reducing the mRNA and protein levels of DNM1. The use of the method and product is indicated, for example, in the prevention or treatment of DEE.

[0012] Polynucleotides encoding one or more of the DNM1 inhibitory RNAs and RNAs are provided. Exemplary DNM1 inhibitory RNAs provided include DNM1 inhibitory RNAs. Ftfl Other exemplary inhibitory RNAs provided target the human DNM1a and DNM1b isoforms, which differ in the alternatively spliced ​​DNM1 exon 10, designated 10a and 10b.

[0013] The following exemplary miRNAs and sequences are provided herein:

[0014] [Table 1]

[0015] [Table 2-1]

[0016] [Table 2-2]

[0017] [Table 3-1]

[0018] [Table 3-2]

[0019] [Table 3-3]

[0020] The present disclosure provides a nucleic acid comprising an RNA-encoding template DNA sequence that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:1-17.

[0021] Exemplary miDNM1s include a full-length sequence set forth in any one of SEQ ID NOs: 18-34, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in any one of SEQ ID NOs: 18-34. The corresponding final processed antisense guide strand sequence is set forth in SEQ ID NOs: 35-51, respectively, or a variant thereof that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to a sequence set forth in any one of SEQ ID NOs: 35-51. The processed antisense guide strand is the strand of the mature miRNA duplex that ultimately becomes the RNA component of the RNA-induced silencing complex responsible for sequence-specific gene silencing.

[0022] miDNM1 is exon 10a of the human DNM1 gene (SEQ ID NO:52). Human DNM1 exon 10a (5' to 3') (SEQ ID NO:52) GACGGGCCTCTTCACACCTGACCTCGCTTTTGAAGCCACAGTGAAAAAGCAGGTGCAGAAGCTCAAAGAGCCCAGTATCAAGTGTGTGGATATGGTAGTCAGTGAGCTCACAGCCACCATCAGAAAGTGTAGCGAAAAG or exon 10b Human DNM1 exon 10b (5' to 3') (SEQ ID NO:53) AACGGGGCTGTTTACCCCAGACATGGCCTTTGAGACCATTGTGAAAAAGCAGGTGAAGAAGATCCGAGAACCGTGTCTCAAGTGTGTGGACATGGTTATCTCGGAGCTAATCAGCACCGTTAGACAGTGCACCAAGAAG and exon 10a (SEQ ID NO: 54) of the mouse DNM1 gene, respectively. Mouse Dnm1 exon 10a (5' to 3') (SEQ ID NO:54) GACGGGCCTCTTCACACCTGACCTCGCTTTTGAAGCCACAGTGAAAAAGCAGGTGCAGAAGCTCAAAGAGCCCAGTATCAAGTGTGTGGACATGGTAGTCAGTGAACTCACGTCCACCATCAGAAAGTGTAGTGAAAA or exon 10b (SEQ ID NO:55) Mouse Dnm1 exon 10b (5' to 3') (SEQ ID NO:55) AACGGGGCTCTTTACCCCAGACATGGCCTTTGAAACCATTGTGAAAAAGCAGGTGAAGAAGATTCGAGAGCCGTGTCTCAAGTGTGTGGACATGGTTATCTCGGAGCTAATCAGCACGGTTAGACAGTGCACCAAGAAG For example, miDNM1 can specifically bind to an mRNA segment that is complementary to a sequence within nucleotides 115 to 136 of SEQ ID NO:52.

[0023] Delivery of DNA encoding miDNM1 can be achieved using a delivery vehicle that delivers DNA to cells. For example, recombinant AAV (rAAV) vectors can be used to deliver DNA encoding miDNM1. Other vectors (e.g., other viral vectors such as lentivirus, adenovirus, retrovirus, equine associated virus, alphavirus, poxvirus, herpes virus, poliovirus, Sindbis virus, and vaccinia virus) can be used to deliver polynucleotides encoding miDNM1. Thus, one or more viral vectors encoding miDNM1 are also provided. When the viral vector is rAAV, the rAAV lacks the rep and cap genes of AAV. The rAAV can be a self-complementary (sc) AAV. As another example, non-viral vectors such as lipid nanoparticles can be used for delivery.

[0024] Provided herein are rAAVs each encoding a miDNM1. Also provided are rAAVs encoding one or more miDNM1. An rAAV (having a single-stranded genome, scAAV) encoding one or more miDNM1 may encode 1, 2, 3, 4, 5, 6, 7, or 8 miDNM1. An scAAV encoding one or more miDNM1 may encode 1, 2, 3, or 4 miDNM1.

[0025] Compositions comprising the nucleic acids or viral vectors described herein are provided. Further provided is a method of preventing or inhibiting expression of the DNM1 gene in a cell, comprising contacting the cell with a delivery vehicle (e.g., rAAV) encoding miDNM1, where the delivery vehicle is rAAV, the rAAV lacks the rep and cap genes. In the method, expression of the duplicated and / or mutated DNM1 allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent. In the method, expression of the wild-type DNM1 allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent.

[0026] Still further provided is a method of delivering DNA encoding miDNM1 to a subject in need thereof, comprising administering to the subject a delivery vehicle (e.g., rAAV) comprising DNA encoding miDNM1, where when the delivery vehicle is rAAV, the rAAV lacks the rep and cap genes. Another method of delivering DNA encoding miDNM1 to a subject in need thereof comprises administering to the subject a delivery vehicle (e.g., rAAV) comprising DNA encoding one or more miDNM1, where when the delivery vehicle is rAAV, the rAAV lacks the rep and cap genes.

[0027] Also provided are methods of preventing or treating DEE, comprising administering a delivery vehicle (e.g., rAAV) comprising DNA encoding miDNM1, where when the delivery vehicle is rAAV, the rAAV lacks the rep and cap genes. Other methods of preventing or treating DEE comprise administering a delivery vehicle (e.g., rAAV) comprising DNA encoding one or more miDNM1, where when the delivery vehicle is rAAV, the rAAV lacks the rep and cap genes. These methods result in restoration of at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent or more of normal DNM1 expression in an unaffected subject.

[0028] The present disclosure provides a delivery vehicle that is a viral vector comprising the nucleic acid described herein and / or any one or more combinations thereof. The provided viral vectors include, but are not limited to, adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or synthetic virus. The viral vector can be AAV. The AAV lacks rep and cap genes. The AAV can be recombinant AAV (rAAV) or self-complementary recombinant AAV (scAAV). The AAV can be, for example, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, or AAV rh.74. The AAV can be AAV-9. The AAV can be a pseudotyped AAV, for example, AAV2 / 8 or AAV2 / 9.

[0029] The present disclosure provides a composition comprising a nucleic acid described herein and a pharma- ceutically acceptable carrier.The present disclosure provides a composition comprising a viral vector comprising a nucleic acid described herein and / or any one or more combinations thereof and a pharma- ceutically acceptable carrier.

[0030] The present disclosure provides a composition comprising a delivery vehicle capable of delivering a nucleic acid encoding miDNM1 to a cell, wherein miDNM1 is bound to a segment of an mRNA encoded by a human DNM1 gene, the segment either encoding or not encoding a sequence comprising a mutation associated with DEE, the segment being conserved relative to a wild-type mouse DNM1 gene, and optionally a pharma- ceutically acceptable carrier. The human DNM1 gene exon 10a may comprise the sequence of SEQ ID NO: 52, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. Mouse DNM1 gene exon 10a can comprise the sequence of SEQ ID NO:54, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. miDNM1 specifically binds to an mRNA segment that is complementary to a sequence within nucleotides 115-136 of SEQ ID NO:52 (e.g., the nucleotides to which miDNM1a-4 binds), for example. Human DNM1 gene exon 10b may comprise the sequence of SEQ ID NO: 53 or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. Mouse DNM1 gene exon 10b may comprise the sequence of SEQ ID NO: 55 or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0031] The present disclosure provides a delivery vehicle in the composition that is a viral vector. The viral vector in the composition can be, for example, an adeno-associated virus (AAV), an adenovirus, a lentivirus, a retrovirus, a poxvirus, a baculovirus, a herpes simplex virus, a vaccinia virus, or a synthetic virus. The viral vector can be an AAV. The AAV lacks rep and cap genes. The AAV can be a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). The AAV can be or have a capsid serotype selected from AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. The AAV can be or have a capsid serotype of AAV-9. The AAV can be a pseudotyped AAV, such as AAV2 / 8 or AAV2 / 9.

[0032] The disclosure provides methods for delivering to a neuron containing a duplicated and / or mutated DNM1 gene: (a) a nucleic acid comprising a template nucleic acid encoding miDNM1 comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a polynucleotide sequence set forth in any one of SEQ ID NOs: 1-17, a nucleic acid encoding a full-length miDNM1 sequence set forth in any one of SEQ ID NOs: 9-16, or a nucleic acid encoding a full-length miDNM1 sequence set forth in any one of SEQ ID NOs: 18-34. 5%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity or variants thereof, including at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 35-51; (b) a vector comprising any one or more of the nucleic acids described herein; or (c) a composition comprising any one or more of the nucleic acids or vectors described herein.

[0033] The present disclosure relates to a method of treating a subject suffering from a duplicated and / or mutated DNM1 gene, the method comprising administering to the subject (a) a nucleic acid comprising a template nucleic acid encoding miDNM1 comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a polynucleotide sequence set forth in any one of SEQ ID NOs: 1-17, a nucleic acid encoding a full-length miDNM1 sequence set forth in any one of SEQ ID NOs: 9-16, or a nucleic acid encoding a full-length miDNM1 sequence set forth in any one of SEQ ID NOs: 18-34, or a variant thereof comprising 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity, or a nucleic acid encoding a processed antisense guide strand of miDNM1 comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 35-51; (b) a vector comprising any one or more of the nucleic acids described herein; or (c) a composition comprising any one or more of the nucleic acids or vectors described herein.

[0034] The present disclosure contemplates that the subject suffers from DEE and is treated by the method herein.The present disclosure also contemplates the treatment of a subject at risk of DEE due to a mutation in DNM1 gene.The subject can be a mammal.The subject can be a human subject.

[0035] The present disclosure also provides the use of at least one nucleic acid described herein, at least one viral vector described herein, or a composition described herein in the manufacture of a medicament for treating a subject suffering from a pathogenic DNM1 gene variant, or in the treatment thereof.

[0036] The present disclosure also provides the use of at least one nucleic acid described herein, at least one viral vector described herein, or a composition described herein in the manufacture of a medicament for treating DEE in a subject in need thereof, or in the treatment thereof.

[0037] Other features and advantages of the present disclosure will be apparent from the following drawing description and detailed description. It should be understood, however, that the drawings, detailed description, and examples, while indicating embodiments of the disclosed subject matter, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent from them.

[0038] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the U.S. Patent and Trademark Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0039] [Figure 1] An example of an artificial miRNA shuttle sequence showing folding and processing sites is shown. The mature guide strand is underlined. The grey arrowhead indicates the Drosha cleavage site and the black arrowhead indicates the Dicer cleavage site. The shaded sequences at the extreme 5' and 3' ends are restriction sites in the template DNA used to clone the miRNA shuttle in front of the U6 promoter. [Diagram 2]Figures 2A-D show that scAAV9-miDnm1a selectively inhibits Dnm1a. A) In vitro knockdown efficacy of Dnm1a by four different miRNA constructs. miDnm1a-4 was the most effective with 95% knockdown. B) Experimental and control constructs delivered via ICV injection at PND0. Black boxes indicate viral inverted terminal repeats and pA indicates the SV40 polyadenylation signal. C) Validation of in vivo Dnm1a knockdown efficacy by scAAV9-miDnm1a (n=8) compared to scAAV9-eGFP control (n=6) showed a significant reduction of Dnm1a, but not Dnm1b, in whole brain extracts from mice treated with scAAV9-miDnm1a (p<0.0001, ns, two-way ANOVA with Sidak's correction for multiple comparisons, respectively). D) Extensive viral transduction in both Dnm1Ftfl / Ftfl and Dnm1+ / +scAAV9-miDnm1a treated mice 30 days after ICV injection. Images were taken at 10x magnification. Data reported as mean ± SEM. Scale bar for whole brain represents 500 μm, scale bar for region of interest (ROI) represents 20 μm. [Diagram 3]Figures 3A-D show that scAAV9-miDnm1a treatment of C57BL / 6J mice improves survival, growth, and seizure outcome. A) Experimental design with ICV injection administered at PND0, developmental phenotyping performed between PND4-PND11, survival, seizure, and growth measurements assessed from PND4-PND30 (study endpoint), and cellular phenotyping performed at PND18 and PND30. B) Treatment with miDnm1a resulted in 75% survival until PND30 of Dnm1Ftfl / Ftfl mice (n=25) compared to control-injected mice (eGFP or saline, n=27) that were 100% lethal before PND20 (p<0.0001, log-rank Mantel-Cox test). Treated Dnm1Ftfl / Ftfl mice differed from treated Dnm1+ / + (n=24) or control-injected Dnm1+ / + (n=19) mice (p=0.0239, p=0.0097, respectively, log-rank Mantel-Cox test). C) Treated and control-injected Dnm1Ftfl / Ftfl mice were significantly smaller as early as PND8, whereas miDnm1a-treated Dnm1Ftfl / Ftfl showed improved growth starting at PND12. Repeated measures ANOVAs were performed including genotype treatment effects (combining the two control treatments, eGFP and saline), as well as other independent variables including sex, virus dose, and litter size, up until PND18, when control-injected Dnm1Ftfl / Ftfl mice exited the study. In treated Dnm1Ftfl / Ftfl vs. control injected Dnm1Ftfl / Ftfl, the effect of treatment was highly significant (p=3.3×10−13) despite a significant effect of litter size (p=1.4×10−7), but no significant effect of virus dose or sex. The difference in growth at the PND30 study endpoint between treated Dnm1Ftfl / Ftfl and treated wild type was significant (p=0.004) with a modest effect of litter size (p=0.048). Using a similar analysis, treated wild type mice also showed growth retardation (p=0.004) compared to control wild type, with modest effects of sex (p=0.01) and litter size (p=0.033).D) Both miDnm1a-treated and control-injected Dnm1Ftfl / Ftfl mice exhibited seizure-like behavior, but control-injected Dnm1Ftfl / Ftfl mice had significantly more seizures at PND14 and PND18. Seizure behavior in treated mice decreased over time. See Table 1 for sample numbers and analysis. Data reported as mean ± SEM. See also Figure 4A-C. [Figure 4] Figures 4A-C show that miDnm1a improves survival in a dose-dependent manner (related to C57BL / 6J strain background pilot experiment, Figures 2A-C). A) Experimental design for the pilot study. Three miDnm1a doses were administered neonatally and survival and growth were examined. B) Survival curves of treated Dnm1Ftfl / Ftfl mice are significantly different from untreated Dnm1Ftfl / Ftfl mice only for the 1.85x1011 (n=10) and 3.2x1011 (n=6) doses (p=0.0001, p=0.01, respectively, log-rank Mantel-Cox test). C) For these doses, treated Dnm1Ftfl / Ftfl mice show improved growth compared to untreated mice (p=0.003, repeated measures ANOVA). [Diagram 5]Figures 5A-F show that scAAV9-miDnm1a treatment improves developmental outcomes. A) Treatment significantly improved grip strength at PND11 in Dnm1Ftfl / Ftfl mice (n=30) compared to control-injected (n=28) mice (p=0.0009, least squares regression using rank and normal quantile transformed data), with no effect of litter size, sex, or virus dose. Treated Dnm1Ftfl / Ftfl mice did not differ from treated (n=24) or control-injected (n=19) Dnm1+ / + mice (same test as above with Tukey's HSD post-hoc test, p>0.05). B, C) In an assay for sensorimotor development, control-injected Dnm1Ftfl / Ftfl mice had higher latencies at PND9 and PND11, but not significantly, for easy 90° turns (p>0.05, least squares regression using rank and normal quantile transformed data, Dunnett's post hoc test). However, for difficult 180° turns, control-injected Dnm1Ftfl / Ftfl mice showed significantly higher latencies at PND11 compared to the other three groups (p<0.001, Dunnett's post hoc test). D) Control-injected Dnm1Ftfl / Ftfl mice (n=24) displayed severe ataxia, and importantly, treatment with miDnm1a (n=17) eliminated this phenotype (p=6.9×10-17, log-Poisson test) and restored Dnm1Ftfl / Ftfl motor coordination to the levels of treated (n=16) and control-injected (n=23) Dnm1+ / + mice (p=0.19 mixed-model log-Poisson test). E,F) Using locomotion and speed as proxies for possible hyperactivity, we observed no significant differences between all groups (p>0.05, one-way ANOVA). [Figure 6-1]Figures 6A-D show that miDnm1a treatment reduces gliosis and cell degeneration at PND18 by PND30. A) Control-injected Dnm1Ftfl / Ftfl mice showed significantly increased gliosis specifically in the hippocampal CA1 as identified by the marker GFAP compared to treated Dnm1Ftfl / Ftfl mice (p=0.018). Treated Dnm1Ftfl / Ftfl mice did not differ from treated and control-injected Dnm1+ / + mice at PND18 (p>0.05). B) By PND30, treated Dnm1Ftfl / Ftfl showed significantly more GFAP intensity compared to treated and control-injected Dnm1+ / + mice (p=0.0052 and p=0.0072, respectively). Images (A-B) were taken at 10x magnification and analysis was performed using regular one-way ANOVA followed by Tukey's multiple comparison test. Scale bar for whole hippocampus represents 200 μm, scale bar for region of interest (ROI) represents 20 μm. C, D) FJC labeling at PND18 showed significant cell death in the hippocampus, especially along CA1, in control-injected Dnm1Ftfl / Ftfl mice, unlike treated Dnm1Ftfl / Ftfl mice (p=0.015). Treated Dnm1Ftfl / Ftfl mice did not differ from treated and control-injected Dnm1+ / + mice (p>0.05). By PND30, treated Dnm1Ftfl / Ftfl mice had little evident cell death identified by FJC labeling. However, they did not differ from treated and control injected Dnm1+ / + mice (p>0.05). Images were taken at 10x magnification and the scale bar corresponds to 100 μm. Analyses were performed using the Poisson overdispersion option of the GMLJ module of Jamovi software. Three to five mice were used for these analyses and data are reported as mean ± SEM. See also Figure 7A-B. [Figure 6-2] Same as above. [Figure 7]Figures 7A-B show cell phenotype images (GFAP and FJC, related to two other representative replicate sets, Figures 6A-D) at PND18 and PND30. A) Control injected Dnm1Ftfl / Ftfl mice show an increase in hippocampal GFAP that is absent in treated Dnm1Ftfl / Ftfl mice and Dnm1+ / + controls at PND18. At PND30, treated Dnm1Ftfl / Ftfl mice show a significant increase in GFAP compared to Dnm1+ / + controls. Scale bar corresponds to 200.Lm. B) Control injected Dnm1Ftfl / Ftfl mice show cell death in hippocampal CA1. This phenotype is absent in treated Dnm1Ftfl / Ftfl mice and Dnm1+ / + controls at PND18. However, by PND 30, there is some significant cell death in the CA1 of treated mice compared to Dnm1+ / + controls. Scale bar corresponds to 100.Lm. [Figure 8-1]Figures 8A-D show that miDnm1a treatment improves metabolic cell activity at PND18 by PND30. A) Abnormal NPY expression was observed in the hippocampus and especially CA3 of control-injected Dnm1Ftfl / Ftfl mice at PND18. Treatment with miDnm1a reversed this phenotype (p=0.0012). Treated Dnm1Ftfl / Ftfl mice did not differ from treated and control-injected Dnm1+ / + mice (p>0.05). B) NPY expression was altered between treated Dnm1Ftfl / Ftfl mice at PND30. However, there was a trend toward significance in treated Dnm1Ftfl / Ftfl mice compared to treated Dnm1+ / + mice (p=0.057) and control-injected Dnm1+ / + mice (p=0.074). C) At PND18, c-Fos staining showed increased neuronal activation in the hippocampal CA3 of control-injected Dnm1Ftfl / Ftfl mice, which was significantly decreased in treated Dnm1Ftfl / Ftfl mice (p<0.00001). Treated Dnm1Ftfl / Ftfl mice did not differ from Dnm1+ / + controls (p>0.05). D) By PND30, there was a modest increase in neuronal activation in the hippocampus, especially in the CA3 region, of treated Dnm1Ftfl / Ftfl mice compared to Dnm1+ / + controls, but this increase was not significant (p>0.05). All images (A-D) were taken at 10x magnification. Scale bar for whole hippocampus represents 200 μm, scale bar for ROI represents 20 μm. Analysis was performed using the Poisson overdispersion option in the GMLJ module of Jamovi software. Three to five mice were used in these analyses and data are reported as mean ± SEM, see also Figures 9A-B. [Figure 8-2] Same as above. [Figure 9]9A-B show cell phenotype images (NPY and c-Fos, related to two other representative replicate sets, Fig. 8A-D) at PND18 and PND30. A) Dnm1Ftfl / Ftfl treated mice show a decrease in NPY+ cells in the hippocampus at PND18 and PND30 compared to control injected Dnm1Ftfl / Ftfl mice. By PND30 treated mice begin to show increased NPY in CA3 compared to Dnm1+ / + controls. B) Treated Dnm1Ftfl / Ftfl mice show a decrease in c-Fos compared to control injected Dnm1Ftfl / Ftfl mice at PND18. By PND30 treated mice show a variable increase in hippocampal c-Fos expression compared to Dnm1+ / + mice. Scale bars correspond to 200 μm. [Figure 10] 1 shows the results of a luciferase assay demonstrating that miDNM1-10b-72 silences DNM1 exon 10 sequences that are conserved in human and mouse transcripts. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] Statistical analysis of drawings Statistical analyses were performed using either Prism8 software (GraphPad, Inc) or JMP14 software (JMP, Inc) depending on the study. qPCR data (Figure 2) were analyzed using two-way ANOVA (Prism8). Survival analysis of the pilot study (Figure 3) was analyzed using a log-rank Mantel-Cox test (Prism8) and for the primary study (Figure 4), proportional hazards tests with risk ratios were used to adjust for covariates (JMP14). Growth (Figures 3, 4) was analyzed using repeated measures MANOVA (JMP). Seizure-like behavior (Figure 3) was analyzed using a 2x2 Fisher exact test (JMP14). Grip strength and negative geotaxis (Figure 5) were analyzed using least squares regression after rank and normal quantile transformation of the data (JMP). Ataxia (number of falls and wobble) was analyzed using a log-Poisson test and contrast modeling to compare specific groups (JMP14). IHC quantification was analyzed using the Poisson overdispersion option in the Generalized Analysis of Linear Models module of Jamovi (gamlj). 31 P values ​​were Bonferroni adjusted.

[0041] The products and methods described herein are used in the treatment of diseases associated with pathogenic DNM1 isoforms. Diseases associated with DNM1 include, for example, DEE. DEE includes, but is not limited to, Lennox-Gastout syndrome and infantile spasms.

[0042] At least 20 heterozygous de novo variants identified in 33 patients, mainly in the critical GTPase and mid-domains of DNM1, have been described in the EuroEPINOMICS-RES Consortium, Am. J. Hum. Genet., 100:179 (2017), Asinof (2015), supra, von Spiczak, supra, Brereton et al., Mol. Genet. Genomic Med., 6:294-300 (2018), Kolnikova et al., Seizure, 56:31-33 (2018), and Li et al., Front. Pharmacol., 10:1454, (2019).

[0043] A nucleic acid encoding human DNM1 exon 10a is set forth in SEQ ID NO: 52. A nucleic acid encoding human DNM1 exon 10b is set forth in SEQ ID NO: 53. Various products and methods of the disclosure may target variants of the human DNM1 nucleotide sequence set forth in SEQ ID NO: 52 or 53. The variants may exhibit 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotide sequence set forth in SEQ ID NO: 52 or 53.

[0044] A nucleic acid encoding mouse DNM1 exon 10a is set forth in SEQ ID NO: 54. A nucleic acid encoding mouse DNM1 exon 10b is set forth in SEQ ID NO: 54. Various products and methods of the disclosure may target variants of the nucleotide sequence set forth in SEQ ID NO: 54 or 55. Variants may exhibit 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotide sequence set forth in SEQ ID NO: 54 or 55.

[0045] The present disclosure includes the use of RNA interference to inhibit or interfere with the expression of DNM1 to improve and / or treat subjects with diseases or disorders resulting from overexpression of DNM1. RNA interference (RNAi) is a mechanism of gene regulation in eukaryotic cells and is being considered for the treatment of various diseases. RNAi refers to the post-transcriptional control of gene expression mediated by inhibitory RNA. Inhibitory RNAs are small (21-25 nucleotides), non-coding RNAs that share sequence homology and base pair with cognate messenger RNA (mRNA). The interaction between inhibitory RNA and mRNA induces cellular gene silencing mechanisms to prevent translation of the mRNA. The RNAi pathway is summarized in Duan (Ed.), Muscle Gene Therapy, Chapter 7, Section 7.3, Springer Science+Business Media, LLC (2010).

[0046] As understanding of the natural RNAi pathway advances, researchers have designed artificial inhibitory RNAs for use in regulating the expression of target genes to treat disease. Several classes of small RNAs are known to induce the RNAi process in mammalian cells [Davidson et al., Nat. Rev. Genet., 12:329-40 (2011); Harper, Arch. Neurol., 66:933-938 (2009)]. Artificial inhibitory RNAs are expressed in vivo from plasmid or virus-based vectors, and can achieve long-term gene silencing with a single dose, as long as the vector is present in the target cell nucleus and the driving promoter is active [Davidson et al., Methods Enzymol., 392:145-73, (2005)]. Importantly, this vector expression approach leverages advances already made over decades in the field of muscle gene therapy, but instead of expressing a protein-coding gene, the vector cargo in an RNAi therapy strategy is an artificial inhibitory RNA cassette that targets the disease gene of interest.

[0047] shRNAs are artificial RNA molecules with tight hairpin turns that can be used to silence the expression of target genes via RNA interference (RNAi). shRNAs are an advantageous vehicle for RNAi in that they have a relatively low rate of degradation and turnover, but they require the use of an expression vector. Once the vector transduces the host genome, the shRNA is then transcribed in the nucleus by polymerase I or polymerase III, depending on the promoter selection. The product mimics a primary microRNA (pri-miRNA) and is processed by Drosha. The resulting pre-shRNA is exported from the nucleus by exportin 5. The product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand directs the RISC to the mRNA with the complementary sequence. In case of perfect complementarity, the RISC cleaves the mRNA. In case of imperfect complementarity, the RISC blocks translation of the mRNA. In both of these cases, the shRNA causes the silencing of the target gene.

[0048] The present disclosure includes the production and administration of viral vectors expressing artificial DMN1 inhibitory RNA. Expression of the artificial DMN1 inhibitory RNA is regulated by the use of various promoters. The present disclosure contemplates the use of polymerase III promoters, such as U6 and H1 promoters, or polymerase II promoters.

[0049] The products and methods provided herein may include miRNA shuttles for modifying (e.g., knocking down or inhibiting) the expression of DNM1. Similar to shRNAs, miRNA shuttles are expressed in cells from DNA transgenes. miRNA shuttles typically contain the natural miRNA sequence required to induce correct processing, but the natural mature miRNA duplex in the stem is replaced by a sequence specific to the intended target transcript (e.g., as shown in Figure 1). After expression, the artificial miRNA is cleaved by Drosha and Dicer to release the embedded siRNA-like region. Polymerase III promoters, such as U6 and H1 promoters, as well as polymerase II promoters, are also used to drive the expression of miRNA shuttles.

[0050] The present disclosure provides a sequence encoding miDNM1 for inhibiting expression of the DNM1 gene. The present disclosure provides a nucleic acid encoding miDNM1 comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the full-length miDNM! polynucleotide sequence set forth in any one of SEQ ID NOs: 18-34. The present disclosure provides nucleic acids encoding a processed antisense guide strand of miDNM1 that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence set forth in any one of SEQ ID NOs: 35-51.

[0051] The present disclosure provides a nucleic acid encoding miDNM1 comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a polynucleotide sequence set forth in any one of SEQ ID NOs:1-17.

[0052] Exemplary miDNM1s include polynucleotide sequences set forth in any one or more of SEQ ID NOs: 18-34, or variants thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs: 18-34. The final processed guide strand sequences corresponding to SEQ ID NOs: 18-34 are set forth in SEQ ID NOs: 35-51, respectively. The present disclosure further provides antisense guide strands as shown in Figure ? and contemplates variants of each of these antisense guide strands that are at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical.

[0053] The present disclosure contemplates that polynucleotides encoding one or more copies of these sequences are combined into a single delivery vehicle, such as a vector. Thus, the present disclosure includes vectors that include the nucleic acids of the present disclosure or combinations of the nucleic acids of the present disclosure. Vectors for delivering the nucleic acids disclosed herein are provided, such as adeno-associated viruses (AAV), adenoviruses, retroviruses, lentiviruses, equine-associated viruses, alphaviruses, poxviruses, herpes viruses, herpes simplex viruses, polioviruses, sindbis viruses, vaccinia viruses, or synthetic viruses, such as chimeric viruses, mosaic viruses, or pseudotyped viruses, and / or viruses that contain foreign proteins, synthetic polymers, nanoparticles, or small molecules. An AAV vector is exemplified.

[0054] Adeno-associated virus (AAV) is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb in length, including 145 nucleotide inverted terminal repeats (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077, the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and in Srivastava et al., J. Virol., 45:555-564 {1983), the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829, the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829, the AAV-5 genome is provided in GenBank Accession No. AF085716, the complete genome of AAV-6 is presented in GenBank Accession No. NC_001862, at least portions of the genomes of AAV-7 and AAV-8 are provided in GenBank Accession Nos. AX753246 and AX753249, respectively, and the AAV-9 genome is described in Gao et al. The AAV rh.74 genome is provided in U.S. Pat. No. 9,434,928, which is incorporated herein by reference. The AAV-B1 genome is provided in Choudhury et al., Mol. Ther., 24(7):1247-1257 (2016). The AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006). The AAV-11 genome is provided in Virology, 330(2):375-383 (2004). A portion of the AAV-12 genome is provided in Genbank Accession No. DQ813647. A portion of the AAV-13 genome is provided in Genbank Accession No. EU285562. The sequence of the AAV rh.74 genome is provided in U.S. Pat. No. 9,434,928, which is incorporated herein by reference. The sequence of the AAV-B1 genome is provided in Choudhury et al., Mol. Ther., 24(7):1247-1257 (2016). Cis-acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and integration into host cell chromosomes are contained within the AAV ITRs.Three AAV promoters (named p5, p19, and p40 for their relative map positions) drive expression of two AAV internal open reading frames encoding the rep and cap genes. The two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins possess multiple enzymatic properties that are ultimately involved in the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins (VP1, VP2, and VP3). Alternative splicing and non-consensus translation initiation sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0055] AAV has unique features that make it attractive as a vector for delivering foreign DNA to cells, for example in gene therapy. AAV infection of cells in culture is non-cytotoxic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells, offering the possibility of targeting many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist essentially for the lifetime of those cells as transcriptionally active nuclear episomes (extrachromosomal elements). The AAV proviral genome is infectious as cloned DNA in a plasmid making the construction of recombinant genomes feasible. Moreover, signals that induce AAV replication, genome encapsidation, and integration are contained within the ITRs of the AAV genome, so that part or all of the internal ∼4.3 kb genome (encoding replication and structural capsid proteins, rep-cap) can be replaced with foreign DNA. The rep and cap proteins can be provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. It easily survives the conditions used to inactivate adenovirus (several hours at 56-65 °C), making cryopreservation of AAV less important. AAV can also be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0056] As exemplified herein, the AAV vector lacks the rep and cap genes. The AAV can be a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). The AAV has a capsid serotype that can be derived from AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, AAV rh.74, AAV rh.8, or AAVrh.10.

[0057] Viral vectors include, for example, AAV1 (i.e., AAV containing AAV1 inverted terminal repeats (ITRs) and AAV1 capsid protein), AAV2 (i.e., AAV containing AAV2 ITRs and AAV2 capsid protein), AAV3 (i.e., AAV containing AAV3 ITRs and AAV3 capsid protein), AAV4 (i.e., AAV containing AAV4 ITRs and AAV4 capsid protein), AAV5 (i.e., AAV containing AAV5 ITRs and AAV5 capsid protein), AAV6 (i.e., AAV containing AAV6 ITRs and AAV6 capsid protein), AAV7 (i.e., AAV containing AAV7 ITRs and AAV7 capsid protein), AAV8 (i.e., AAV containing AAV8 ITRs and AAV8 capsid protein), AAV9 (i.e., AAV9 ITRs and AAV9 capsid protein), AAVrh74 (i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid protein), AAVrh.8 (i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid protein), AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid protein), AAV11 (i.e., an AAV containing AAV11 ITRs and AAV11 capsid protein), AAV12 (i.e., an AAV containing AAV12 ITRs and AAV12 capsid protein), or AAV13 (i.e., an AAV containing AAV13 ITRs and AAV13 capsid protein).

[0058] The DNA plasmid of the present disclosure comprises a recombinant AAV (rAAV) genome of the present disclosure. The DNA plasmid is introduced into a cell permissive for infection with an AAV helper virus (e.g., adenovirus, E1 deleted adenovirus, or herpesvirus) to assemble the rAAV genome into an infectious viral particle. Techniques for producing rAAV particles that provide the packaged AAV genome, rep and cap genes, and helper virus functions to a cell are standard in the art. Production of rAAV requires that the following components are present in a single cell (referred to herein as a packaging cell): the rAAV genome, AAV rep and cap genes separated from (i.e., not present in) the rAAV genome, and helper virus functions. The AAV rep gene may be from any AAV serotype from which a recombinant virus may be derived, or may be from an AAV serotype different from the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. The AAV DNA in the IAAV genome can be from any AAV serotype from which a recombinant virus can be derived, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV-rh.74. Other types of rAAV variants, such as rAAVs with capsid mutations, are also included in the present disclosure. See, e.g., Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). As mentioned above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. The use of cognate components is specifically contemplated. The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692, which is incorporated herein by reference in its entirety.

[0059] The AAV vector may be a pseudotyped AAV containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype. The pseudotyped AAV may be AAV2 / 9 (i.e., AAV containing AAV2 ITRs and AAV9 capsid proteins). The pseudotyped AAV may be AAV2 / 8 (i.e., AAV containing AAV2 ITRs and AAV8 capsid proteins). The pseudotyped AAV may be AAV2 / 1 (i.e., AAV containing AAV2 ITRs and AAV1 capsid proteins).

[0060] The AAV vector may contain a recombinant capsid protein, such as a capsid protein containing one or more chimeras of capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh74, AAVrh.8 or AAVrh.10, AAV10, AAV11, AAV12, or AAV13. Other types of rAAV variants are also contemplated, such as rAAVs with capsid variants. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). As mentioned above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0061] The present disclosure provides an AAV for delivering miDNM1, which targets DNM1 mRNA and inhibits DNM1 expression. AAV can be used to deliver miDNM1 under the control of an RNA polymerase III (Pol III)-based promoter. AAV is used to deliver miDNM1 under the control of a U6 promoter. AAV is used to deliver miDNM1 under the control of an H1 promoter. AAV is used to deliver miDNM1 under the control of an RNA polymerase II (Pol II)-based promoter. AAV is used to deliver miDNM1 under the control of a U7 promoter. AAV is used to deliver miDNM1 under the control of a neuron-specific promoter. For example, AAV is used to deliver miDNM1 under the control of a neuron-specific synapsin promoter. AAV is used to deliver miDNM1 under the control of a DNM1 promoter.

[0062] In nature, the U6 promoter controls expression of U6 RNA, a well-characterized small nuclear RNA (snRNA) involved in splicing [Kunkel et al., Nature, 322(6074):73-77(1986); Kunkel et al., Genes Dev. 2(2):196-204(1988); Paule et al., Nuc. Acids Res., 28(6):1283-1298(2000)]. The U6 promoter is used to control vector-based expression in mammalian cells because (1) the promoter is recognized by RNA polymerase III (polyIII) and controls high-level constitutive expression of RNA, and (2) the promoter is active in most mammalian cell types [Paddison et al., Proc. Natl. Acad. Sci. USA, 99(3):1443-1448(2002); Paul et al., Nat. Biotechnol., 20(5):505-518(2002)]. The present disclosure includes the use of both mouse and human U6 promoters.

[0063] The AAV vectors herein lack the rep and cap genes. The AAV can be recombinant AAV, recombinant single-stranded AAV (ssAAV), or recombinant self-complementary AAV (scAAV).

[0064] The rAAV genome of the present disclosure, for example, comprises one or more AAV ITRs flanking one or more miDNM1-encoding polynucleotides. Commercial providers such as Ambion Inc. (Austin, TX), Darmacon Inc. (Lafayette, CO), InvivoGen (San Diego, CA), and Molecular Research Laboratories, LLC (Herndon, VA) make custom inhibitory RNA molecules. In addition, commercially available kits are available for producing custom siRNA molecules, such as the SILENCER™ siRNA Construction Kit (Ambion Inc., Austin, TX) or the psiRNA System (InvivoGen, San Diego, CA).

[0065] The method for generating packaging cells is to create a cell line that stably expresses all the components required for the production of AAV particles. For example, a plasmid (or a plurality of plasmids) containing a rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes separated from the rAAV genome, and a selection marker (e.g., a neomycin resistance gene) is integrated into the genome of the cell. The AAV genome has been introduced into a bacterial plasmid by procedures such as GC tailing [Samulski et al., Proc. Natl. Acad. S6. USA, 79:2077-2081 (1982)], the addition of a synthetic linker containing a restriction endonuclease cleavage site [Laughlin et al., Gene, 23:65-73 (1983)], or direct blunt-end ligation [Senapathy & Carter, J. Biol. Chem., 259:4661-4666 (1984)]. The packaging cell line is then infected with a helper virus, such as adenovirus. The advantage of this method is that the cells are selectable and are suitable for large-scale production of rAAV. Another example of a suitable method uses adenovirus or baculovirus rather than plasmids to introduce the rAAV genome and / or the rep and cap genes into the packaging cells.

[0066] General principles of rAAV production are reviewed in, for example, Carter, Current Opinions in Biotechnology, 1533-1539 (1992), and Muzyczka, Curr. Topics in Microbiol. and Immunol., 158:97-129 (1992). Various approaches have been described in: Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., Mol. Cell. Biol., 7:349 (1988); Samulski et al. al., J. Virol., 63: 3822-3828 (1989), U.S. Pat. No. 5,173,414, WO95 / 13365 and corresponding U.S. Pat. No. 5,658.776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al., Vaccine, 13: 1244-1250 (1995), Paul et al. al., Hum. Gene Ther., 4:609-615 (1993); Clark et al., Gene Ther., 3:1124-1132 (1996); U.S. Patent No. 5,786,211; U.S. Patent No. 5,871,982; U.S. Patent No. 6,258,595; and McCarty, Mol. Ther., 16(10):1648-1656 (2008). The foregoing documents are incorporated herein by reference in their entireties, with particular emphasis on the sections of the documents relating to rAAV production. The production and use of self-complementary rAAV is specifically contemplated and exemplified.

[0067] The present disclosure further provides a packaging cell that produces an AAV vector. The packaging cell can be a stably transformed cancer cell, such as HeLa cell, 293 cell, and PerC.6 cell (synonymous 293 line). In another embodiment, the packaging cell is a cell that is not a transformed cancer cell, such as low passage 293 cell (human fetal kidney cell transformed with adenovirus E1), MRC-5 cell (human fetal fibroblast cell), WI-38 cell (human fetal fibroblast cell), Vero cell (monkey kidney cell), and FRhL-2 cell (fetal rhesus lung cell).

[0068] Thus, provided herein are recombinant AAVs (rAAVs) (i.e., infectious, encapsidated rAAV particles) whose genomes lack AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between the ITRs of the rAAV genome.

[0069] rAAV can be purified by methods standard in the art, such as column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper viruses are known in the art and include, for example, those disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69:427-443 (2002), U.S. Patent No. 6,566,118, and WO 98 / 09657.

[0070] Compositions are provided that include the nucleic acid and viral vectors of the present disclosure. Compositions are provided that include the delivery vehicle (such as rAAV) described herein. Such compositions also include a pharmaceutically acceptable carrier. Compositions can also include other components such as diluents and adjuvants. Acceptable carriers, diluents, and adjuvants are nontoxic to recipients and preferably inert at the dosages and concentrations employed, and include buffers (e.g., phosphates, citrates, or other organic acids), antioxidants (e.g., ascorbic acid), low molecular weight polypeptides, proteins (e.g., serum albumin, gelatin, or immunoglobulins), hydrophilic polymers (e.g., polyvinylpyrrolidone), amino acids (e.g., glycine, glutamine, asparagine, arginine, or lysine), monosaccharides, disaccharides, and other carbohydrates (including glucose, mannose, or dextrins), chelating agents (e.g., EDTA), sugar alcohols (e.g., mannitol or sorbitol), salt-forming counterions (e.g., sodium), and / or nonionic surfactants (e.g., Tween®, Pluronic®, polyethylene glycol (PEG)).

[0071] For CSF delivery, including but not limited to intrathecal delivery, the compositions provided herein can include a pharma- ceutically acceptable aqueous excipient containing a non-ionic hypoosmolar compound or contrast agent, such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, and the aqueous excipient containing the non-ionic hypoosmolar compound can have one or more of the following properties: an osmolality of about 180 mgI / mL, about 322 mOsm / kg water vapor pressure osmometry osmolality of about 273 mOsm / L, an absolute viscosity of about 2.3 cp at 20° C. and about 1.5 cp at 37° C., and a specific gravity of about 1.164 at 37° C. Exemplary compositions include about 20-40% non-ionic hypoosmolar compound, or about 25-35% non-ionic hypoosmolar compound. An exemplary composition is 20 mM Tris (pH 8.0), 1 mM MgCl 2, 200 mM NaCl, 0.001% poloxamer 188, and about 25% to about 35% of a non-ionic low osmolarity compound. Another exemplary composition comprises scAAV formulated in 1× PBS and 0.001% Pluronic F68.

[0072] The titer of the rAAV administered in the methods of the invention will vary depending, for example, on the particular rAAV, the mode of administration, the therapeutic goal, the individual, and the cell type being targeted, and can be determined by methods standard in the art. The titer of the rAAV is approximately 1 x 10 per ml. 6 pieces, about 1×10 7 pieces, about 1×10 8 pieces, about 1×10 9 pieces, about 1×10 10 pieces, about 1×10 11 pieces, about 1×10 12 pieces, about 1×10 13 pieces, about 1×10 14 pieces, about 1×10 16 Dosages may range from about 1×10 to 100000000 or more DNase resistant particles (DRP). Dosages may be expressed in units of viral genomes (vg). Dosages contemplated herein range from about 1×10 7 vg, approx. 1×10 8 vg, approx. 1×10 9 vg, approx. 5×10 9 vg, approx. 6×10 9 vg, approx. 7×10 9 vg, approx. 8×10 9 vg, approx. 9×10 9 vg, approx. 1×10 10 vg, approx. 2×10 10 vg, approx. 3×10 10 vg, approx. 4×10 10 vg, approx. 5×10 10 vg, approx. 1×10 11 vg, approx. 1.1×10 11 vg, approx. 1.2×10 11 vg, approx. 1.3×10 11 vg, approx. 1.2×10 11 vg, approx. 1.3×10 11 vg, approx. 1.4×10 11 vg, approx. 1.5×10 11vg, approx. 1.6×10 11 vg, approx. 1.7×10 11 vg, approx. 1.8×10 11 vg, approx. 1.9×10 11 vg, approx. 2×10 11 vg, approx. 3×10 11 vg, approx. 4×10 11 vg, approx. 5×10 11 vg, approx. 1×10 12 vg, approx. 1×10 13 vg, approx. 1.1×10 13 vg, approx. 1.2×10 13 vg, approx. 1.3×10 13 vg, approx. 1.5×10 13 vg, approx. 2×10 13 vg, approx. 2.5×10 13 vg, approx. 3×10 13 vg, approx. 3.5×10 13 vg, approx. 4×10 13 vg, approx. 4.5×10 13 vg, approx. 5×10 13 vg, approx. 6×10 13 vg, approx. 1×10 14 vg, approx. 2×10 14 vg, approx. 3×10 14 vg, approx. 4×10 14 vg, approx. 5×10 14 vg, approx. 1×10 15 vg, ~approx. 1×10 16 Contains the entire viral genome, or more than 1 x 10 9 vg~approx. 1×10 10 vg, approx. 5×10 9 vg~approx. 5×10 10 vg, approx. 1×10 10 vg~approx. 1×10 11 vg, approx. 1×10 11 vg~approx. 1×10 15 vg, approx. 1×10 12 vg~approx. 1×10 15 vg, approx. 1×10 12 vg~approx. 1×10 14 vg, approx. 1×10 13 vg~approx. 6×10 14 vg, and approximately 6 × 10 13 vg~approx. 1.0×10 14 vg, 2.0×1014 vg, 3.0×10 14 vg, 5.0×10 14 Also contemplated are dosages of about 1×10 based on age group. 13 vg / patient ~ approx. 1×10 15 vg / patient. For example, an intravenously delivered dose can range from 1×10 13 vg / kilogram (kg) body weight ~2×10 14 vg / kg range.

[0073] Methods of transducing a target cell with a delivery vehicle (e.g., rAAV) in vivo or in vitro are contemplated. In vivo methods include administering an effective dose or effective multiple doses of a composition comprising a delivery vehicle (such as rAAV) to a subject (including a human patient) in need thereof. If the dose is administered before the onset of a disorder / disease, the administration is prophylactic. If the dose is administered after the onset of a disorder / disease, the administration is therapeutic. An effective dose is one that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, delays or prevents progression to the disorder / disease state, delays or prevents progression of the disorder / disease state, reduces the extent of the disease, results in remission (partial or complete) of the disease, and / or prolongs survival. An example of a disease contemplated for prevention or treatment by the methods of the present invention is DEE. DEE includes, but is not limited to, Lennox-Gastaut syndrome and infantile spasms. In families known to carry a pathological DNM1 gene variant, the method can be performed prior to the onset of disease. In other patients, the method is performed after diagnosis.

[0074] For intrathecal administration, the subject may be maintained in the Trendelenburg position (head down) after injection of the rAAV (e.g., for about 5, about 10, about 15, or about 20 minutes). For example, the patient may be tilted in the head down position at about 1 degree to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees.

[0075] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the method. Outcome measures are described, for example, in Aimiuwu et al., Mol. Ther., 28(7):1706-1716 (2020). Outcome measures include, but are not limited to, one or more of the following: reduction or elimination of mutant DNM1 mRNA or protein in affected tissues, knockdown of the DNM1 gene, increased survival, increased growth, and reduced seizures. Others include, but are not limited to, improved neurohistology (axon number, axon size, and myelination), improved motor function, improved grip strength, reduced gliosis and neurodegeneration in the brain, and improved metabolic activity.

[0076] In the methods disclosed herein, expression of mutant DNM1 in a subject is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent compared to expression in the subject before treatment.

[0077] Combination therapies are also contemplated by the present invention. Combination, as used herein, includes both simultaneous and sequential treatments. Combination of the methods described herein with standard medical and supportive care is specifically contemplated.

[0078] Administration of an effective dose of the nucleic acid, viral vector, or composition of the present disclosure may be by routes standard in the art, including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraventricular, intrathecal, intraosseous, intraocular, rectal, or intravaginal. An effective dose may be delivered by a combination of routes. For example, an effective dose is delivered intravenously and intramuscularly, or intravenously and intraventricularly, etc. An effective dose may be delivered sequentially or sequentially. An effective dose may be delivered simultaneously. The route of administration and serotype of the AAV components (particularly the AAV ITRs and capsid proteins) of the rAAV of the present invention may be selected and / or adapted by the skilled artisan, taking into account the infectious disease and / or disease state to be treated, and the target cells / tissues expressing the miRNA.

[0079] In particular, the actual administration of the delivery vehicle (such as rAAV) can be accomplished by using any physical method that transports the delivery vehicle (such as rAAV) to the target cells of the subject. Administration includes, but is not limited to, injection into muscle, injection into the bloodstream, and / or direct injection into the nervous system or liver. Simply resuspending rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known limitations on the carriers or other components that may be co-administered with rAAV (although compositions that degrade DNA should be avoided in the usual methods of using rAAV). The capsid protein of rAAV can be modified to target rAAV to a specific target tissue of interest, such as neural cells. See, for example, WO02 / 053703, the disclosure of which is incorporated herein by reference. The pharmaceutical composition can be prepared as an injectable formulation or as a topical formulation that is delivered to muscle by transdermal transport. Numerous formulations for both intramuscular injection and transdermal delivery have already been developed and can be used in the practice of the present invention. The delivery vehicle (e.g., rAAV) can be used with any pharma- ceutically acceptable carrier for ease of administration and handling.

[0080] Dispersions of the delivery vehicle (e.g., rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily available by standard techniques well known to those skilled in the art.

[0081] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include an isotonic agent, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0082] Sterile injectable solutions are prepared by incorporating the required amount of rAAV into a suitable solvent, optionally with various other ingredients listed above, and then sterilizing by filtration.Generally, dispersions are prepared by incorporating sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and other necessary ingredients listed above.In the case of sterile powders for preparing sterile injectable solutions, the preferred method of preparation is vacuum drying and freeze-drying technology, which produces powders of active ingredients plus any additional desired ingredients from their solutions that have been previously sterilized and filtered.

[0083] Transduction of cells, such as neurons, with the rAAV provided herein results in sustained expression of DNM1 miRNA. Thus, the present invention provides methods of administering / delivering rAAV expressing DNM1 miRNA to a subject, preferably a human. These methods include transducing cells and tissues, including but not limited to central nervous system neurons, with one or more rAAVs described herein. Transduction can be performed using gene cassettes that contain cell-specific control elements.

[0084] The term "transduction" refers, for example, to the administration / delivery of miDNM1 to a target cell, either in vivo or in vitro, via a replication-deficient rAAV as described herein, which results in expression of miDNM1 by the target cell.

[0085] As such, methods are provided in which an effective dose (or doses administered essentially simultaneously or at intervals) of the rAAV described herein is administered to a patient in need thereof. EXAMPLES

[0086] Aspects and exemplary embodiments of the present invention are illustrated by the following examples. Example 1 Design and in vitro testing of miDNM1 targeting mouse DNM1 Dnm1 FtflTo knockdown Dnm1a, microRNAs were designed to specifically and efficiently target mouse Dnm1a isoforms that harbor intermittent mutations.

[0087] The artificial miRNA is based on the natural mir-30 and maintains the key structural and sequence elements required for normal miRNA biogenesis, but the mature mir-30 sequence is replaced with 22 nt complementary to the DNM1 gene. See Figure 1 for an exemplary general miRNA shuttle structure.

[0088] As previously described in Wallace et al., Mol. Ther. J. Am. Soc. Gene Ther., 20:1417-1423 (2012), four microRNAs (designated miDnm1a-1 to miDnm1a-4) targeting Dnm1a were designed and cloned into a mir-30-based construct with expression driven by the U6 promoter. The miDNM1 sequence was generally designed according to Boudreau et al., Chapter 2 of Harper (Ed.), RNA Interference Techniques, Neuromethods, Vol. 58, Springer Science+Business Media, LLC (2011). Qualified miRNAs were 22 nt long, with the first four and last four nucleotides being at least 75% GC-rich and AU-rich, respectively. In addition, the 22 nucleotide string was 40% AU-rich. miRNA-specific targeting of Dnm1a exploited the 42-nt difference between Dnm1a and Dnm1b.

[0089] The activity of miRNAs was tested in vitro using a dual luciferase reporter assay. The luciferase assay requires the development of a dual reporter plasmid containing two different luciferase genes, from firefly and Renilla reniformis, respectively. The DNM1 gene sequence is inserted as the 3'UTR of Renilla luciferase, and firefly luciferase serves as an internal control. The U6.miDNM1 plasmid is co-transfected with the dual luciferase plasmid into HEK293 cells. DNM1 gene knockdown is determined by measuring the activity of Renilla luciferase tagged with the DNM1 sequence against the control firefly luciferase activity. miDnm1a-1 showed approximately 84% knockdown, miDnm1a-2 showed approximately 64% knockdown, and miDnm1a-3 showed approximately 80% knockdown. miDnm1a-4 was the most effective at reducing the amount of Dnm1a mRNA (Figure 2A), showing approximately 95% knockdown. The full-length miDnm1a-4 miRNA sequence is as follows:

[0090] [ka]

[0091] The antisense strand of the mature miRNA (underlined) binds to Dnm1a mRNA. Example 2 Production of scAAV9 encoding miDNM1 The miDnm1a-4 template DNA was then cloned into a scAAV9 viral vector (scAAV9-miDnm1a) for in vivo validation (Figure 2B).

[0092] The miDNM1 template sequence was cloned into a scAAV9 construct, commonly referred to as the "scAAV9-NP vector," for in vivo delivery. The scAAV9 also contained a CMV promoter-driven eGFP reporter gene. The scAAV9 contained mutant AAV2 inverted terminal repeats (ITRs) and wild-type AAV2 ITRs that allow packaging of self-complementary AAV genomes. The resulting scAAV9 is referred to as the "scAAV9-NP vector." The non-targeted scAAV is referred to as "AAV9-miRLacZ" (short for the scAAV construct scAAV-NP.U6.miRLacZ.CMV.eGFP).

[0093] ScAAV9 was produced in 293 cells by a transient transfection procedure using a double-stranded AAV2-ITR-based vector carrying a plasmid encoding the Rep2Cap9 sequence together with the adenovirus helper plasmid pHelper (Stratagene, Santa Clara, CA) as previously described [Gao et al., J. Virol., 78:6381-6388 (2004)]. For the experiments, scAAV9 was produced in three separate batches, purified by two cesium chloride density gradient purification steps, dialyzed against PBS, formulated with 0.001% Pluronic-F68 to prevent virus aggregation, and stored at 4°C. All vector preparations were titrated by quantitative PCR using Taq-Man technology. Vector purity was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA). scAAV9 virus was generated and titrated by the Viral Vector Core at the Research Institute at Nationwide Children's Hospital.

[0094] Example 3 In vivo quantification of transduction and Dnm1a knockdown Mice were administered either treatment (scAAV9-miDnm1a) or control (scAAV9-eGFP) AAV via a single bilateral intracerebroventricular (ICV) injection on postnatal day 0 (PND0).

[0095] For ICV delivery of scAAV9-miDnm1a, Dnm1 at PND0 + / + Mice were anesthetized using hypothermia by placing them on a cooled metal block until adequately anesthetized. Injection sites were approximately 2 / 5 the distance from the lambda suture to each eye. All injections were performed at discretion using a dot style 4, 33 gauge needle and a 10 μL or 25 μL Hamilton syringe (Cat. No. 65460-06 and Cat. No. 65460-10). Control scAAV9-eGFP injections were matched to miDnm1a dosage and saline controls were matched to the amount of virus injected.

[0096] Whole brains were isolated from six eGFP-injected and eight miDnm1a-injected mice at PND14. Tissues were snap frozen in 2-methylbutane and stored at -80°C. Samples were homogenized using a dounce and RNA was isolated using TRIzol reagent (ThermoFisher, Waltham, MA, Catalog No. 15596018). RNA was converted to cDNA using the Invitrogen SuperScript III First-Strand Synthesis System (Carlsbad, CA, Catalog No. 18080051). Dnm1a knockdown was assessed using primers 5'-CTCGCTTTTGAAGCCACAGT-3' (SEQ ID NO: 56) and 3'-TTTCTGATGGTGGACGTGAG-5' (SEQ ID NO: 57). Dnm1b expression was assessed using primers 5'-GGCCTTTGAAACCATTGTGA-3' (SEQ ID NO: 58) and 3'-GCACTGTCTAACCGTGCTGA-5' (SEQ ID NO: 59). SYBR™ Select Master Mix (Applied Biosystems, Waltham, Mass., Cat. No. 4472903) was used for qPCR performed using Applied Biosystems-Quant Studio5.

[0097] The results are shown in Figures 2C to 2D. Example 4 Pilot Study To evaluate the efficacy of scAAV9-miDnm1a in extending survival, a pilot study was conducted in the C57BL / 6J (B6J) mouse strain background. Ftfl / Ftfl Mice experience severe, fully penetrant tonic-clonic seizures and comorbid disorders that result in lethality by the third postnatal week, regardless of mouse strain background. 11 B6J-Dnm1 Ftfl / Ftfl Mice were treated with three doses of miDnm1a: 1 × 10 10 , 1.85×10 11 , 3.25×10 11 Treated with vector genome (vg).

[0098] Dnm1 Ftfl / Ftfl Treatment with the mutant extended survival in a dose-dependent manner: 30% (p=0.0001) and 50% (p=0.01) of mice treated with the latter two doses, respectively, survived to PND30 and showed improved growth (p=0.003, Figure 4B-C). 11 The highest dose in vg produced no obvious side effects.

[0099] Example 5 Expanded Research To further evaluate the efficacy of miDnm1a, we investigated the efficacy of (B6J × FVB / NJ)F mice due to their large litter size, animal size, and good maternal care. 2 Hybrid background mice were used. Ftfl / Ftfl and Dnm1 + / + F 2 Hybrids were either treated (scAAV9-miDnm1a) or injected with controls (i.e., scAAV9-eGFP or saline; Figure 3A) on PND0. 2 Mice were cultured at approximately 5.2 x 10 per mouse based on titers obtained. 11 vg~6.0×10 11 vg Mice were observed for survival, seizure activity, and body weight up to PND30, the endpoint chosen for this study (Figure 3A).

[0100] research design Experiments were performed blinded to genotype and treatment and randomized where necessary. Postnatal day (PND) 30 was prospectively chosen as the adult endpoint because pups are typically weaned between PND22 and PND28, marking the end of the developmental period. Live Dnm1 Ftfl / FtflMice were stopped at moribund to comply with facility compliance data collection. For 95% confidence in detecting improvement from inhibition of mutant Dnm1a, at least 12 animals per group (genotype x treatment, sex matched) were required to detect an effect with 80% power. In the primary study, two experiments were performed, representing two virus doses, to evaluate possible dose effects: 2 Run on a hybrid background: approx. 5.2x10 11 vg, approx. 6.0x10 11 vg. Mice were randomly assigned to either miDnm1a treatment or a control condition containing eGFP or saline administration. For simplicity of analysis, the two control conditions were combined as their effects were not different. Therefore, for analyses modeling treated vs. control-injected groups, the two dose experiments and sex (using categorical indicator variables for each) and litter size were combined as covariates. Cellular analysis was performed at PND18, as this is the time point at which almost all untreated or control-injected mice become moribund, and at PND30, the end point of the study. For this study, three representative replicates for cellular characterization of the effects of miDnm1a treatment are shown.

[0101] Animals and genotyping The C57BL / 6J-Dnm1 strain used in these studies Ftfl-flox Mouse (hereafter referred to as B6J-Dnm1 Ftfl The gene was synthesized by Jackson Laboratory's Genetic Engineering Technology core and is referred to as Dnm1 Δ1a / Δ1a We generated the Dnm1 gene in mice and used CRISPR / Cas9 to Ftfl Mutations were introduced. 2 To generate hybrid mice, B6J-Dnm1 Ftfl / + Mice were bred to FVB / NJ females (JAX, Bar Harbor, ME, stock 004624) and F 1Hybrid mice were cross-bred. Mice were genotyped with a PCR protocol designed to detect the presence of loxP sites in the fragment allele. Genotyping primers 5'-CCTCTCTGTCCACTTGTAGCCATT-3' (SEQ ID NO: 60) and 3'-ACTGGGTGATGCTCACTAGAACCT-5' (SEQ ID NO: 61) yield a 321 bp mutant allele and a 215 bp wild-type allele. Mice for this study were 0-30 days old. To identify individual pups, they were tattooed on PND0 according to the AIMS pup tattoo identification system (Budd Lake, NJ) using Ketchum Animal Tattoo Ink (catalog no. 329AA). Mice were also ear-notched on PND10. After weaning on PND21, mice were allowed free access to food and water in their home cages. Pups were never separated from their home cages for more than 10 min at a time. Light was maintained on a 12-h light / dark cycle, and behavioral testing was performed during the light portion of the cycle. All procedures were approved by Columbia University's Institutional Animal Care and Use Committee and were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

[0102] Example 6 Assessment of growth, development, and seizures in treated mice Growth and survival monitoring Mice from Example 5 were weighed every other day from PND4 to PND30. In addition, general health and survival were monitored daily from PND0 to PND30 (study endpoint).

[0103] As shown in previous studies [Boumil, supra], control injected Dnm1 Ftfl / Ftfl Mice began to show growth defects from PND 8 until moribundity or terminal seizure events by PND 18-19 (Figure 3B, C). In contrast, treated Dnm1 Ftfl / FtflMice grew steadily until PND30, but treatment and control injected Dnm1 were started on PND8 and PND18, respectively. + / + Overall, by PND18, control-injected Dnm1 mice were significantly more likely to develop pulmonary edema than control-injected Dnm1 mice (Figure 3C). Ftfl / Ftfl Compared with treated Dnm1 Ftfl / Ftfl There was a significant improvement in growth in the mice (repeated measures ANOVA, p=3.3×10 -13 ). Treated Dnm1 + / + Even in mice, control injected Dnm1 + / + Compared to control mice, germline Dnm1a null mice showed some growth retardation starting at PND8 (p=0.004, Fig. 3C). Germline Dnm1a null mice were previously reported to lack any overt impairment [Asinof (2015), supra; Asinof (2015), supra], whereas treated Dnm1 + / + It is possible that the moderate growth retardation seen in mice after postnatal Dnm1a ablation is characteristic of the treated Dnm1a. + / + The observed growth defects in mice may be due to unpredictable off-target effects of miDnm1a. Nevertheless, these data support the notion that Dnm1 Ftfl / Ftfl Strengthen the efficacy of miDnm1a in improving growth outcomes in mice.

[0104] Seizure quantification To determine the effect of miDnm1a on seizure phenotype, treated and control injected Dnm1 Ftfl / Ftfl Homozygotes were evaluated for overt seizures and seizure-related activity. Each litter of pups was monitored for approximately 5 minutes during weighing. Seizure activity was characterized by wild running, Straub's tail, vertical jumps lasting 10 seconds or more with subsequent facial grooming, continuous forelimb and hindlimb twitching, and tonic-clonic seizures. All seizures within the observation window were counted as one event. Evaluations were performed every other day, starting on PND14 during the weighing session.

[0105] [Table 4]

[0106] Treated and control injected Dnm1 Ftfl / Ftfl Although both sets of mice exhibited seizure behavior, treated mice had fewer events observed overall between PND14 and 18 (Figure 3D, Table 1). By PND18, all control-injected Dnm1 mice had Ftfl / Ftfl The mice were moribund and unable to remain upright. Ftfl / Ftfl Mice exhibited operative seizures between PND14 and 24 (Table 1). After this period, the number and intensity of observed seizures and seizure-like events decreased (Fig. 3D, Table 1). These data suggest that miDnm1a treatment enhances the function of Dnm1. Ftfl / Ftfl This suggests that it reduced seizures and seizure-related activity in mice.

[0107] development Developmental milestones in mouse pups are important readouts of developmental delays. To begin testing, each pup was gently removed from the nest and placed on a clean bench protector. The cage lid was immediately and gently replaced to reduce agitation in the nest. All assessments were completed by an experienced experimenter within 3 min. At the end of the session, the pups were immediately returned to the nest. For all behaviors, mice from both groups (genotype x treatment) were handled daily from PND4-12. They were weighed on all even days (PND4-PND12) and strength and sensorimotor development were assessed on odd days (PND5-PND11). Mice from PND14-PND30 were weighed every other day on even days. The study was performed blinded.

[0108] Vertical Screen Hold To assess strength, mice were placed on a vertical mesh screen and the latency to fall off the screen was recorded. Mice were observed for 30 seconds and allowed two attempts to complete the task. Scores from both trials were averaged. As the average age of rodents to perform this task is PND8, mice were tested on PND9 and PND11.

[0109] Treated Dnm1Ftfl / Ftfl Mice (n=30) were injected with control at PND11 and Dnm1 Ftfl / Ftfl Mice treated with Dnm1 showed improved grip strength compared to control mice (n=28) (p=0.0009, FIG. 5A). Ftfl / Ftfl Mice were treated (n=24) or control-injected (n=19) with Dnm1 on PND9 and PND11. + / + (p>0.05; Figure 5A) and grip strength did not differ.

[0110] Negative geotaxis Possible sensorimotor impairments were assessed using a negative geotaxis assay, which utilizes vestibular cues to challenge the mouse's innate behavior for motor coordination. Mice were placed head-down on a mesh screen set at a 45° angle. The latency for the pups to turn 90° (sideways) and 180° (head-up) from a downward starting position was recorded. Mice were given 30 s to perform the task and were allowed two attempts. Both attempts were averaged for analysis.

[0111] Control injected Dnm1 Ftfl / Ftfl Unlike mice, Dnm1 Ftfl / Ftfl Mice tended to show shorter latencies to turn 90° and 180° at PND11, whereas control injected Dnm1 Ftfl / Ftfl In comparison to mice, only the more difficult 180° rotation was statistically significant (p = 0.0004, Figure 5B,C).

[0112] Open Field To quantify the ataxic phenotype, PND14 pups were observed in an open field using EthoVision XT video tracking software (Noldus). Mice were tested in a 28.5 cm arena with 100 lux illumination. Mice were recorded for 10 min. Videos were then blindly scored by counting the number of times each mouse wobbled or fell during movement over a 10 min window. Mice that moved less than 100 cm were excluded. In addition, the distance traveled and the speed of each mouse were quantified.

[0113] As expected, control injected Dnm1 Ftfl / Ftfl Mice had numerous ataxic events (visibly wobbly gait and falls), whereas miDnm1a treatment did not affect the control injected Dnm1 Ftfl / Ftfl This completely abolished the ataxic phenotype observed in mice (p<0.0001, Figure 5D). Gait was also quantified during this time and no differences were found in either distance or speed traveled between groups (p>0.05, Figure 5E,F).

[0114] These results suggest that miDnm1a treatment reduces the Ftfl / Ftfl The results show that it improved developmental outcomes in mice. summary Treated Dnm1 Ftfl / Ftfl Mice showed increased survival, improved growth, reduced fatal seizures, improved developmental outcome, and absence of ataxia. These data together demonstrate the efficacy of miDnm1a in suppressing or eliminating the most severe intermittent behavioral phenotypes, including seizures, growth, and ataxia, ultimately leading to an overall improvement in their quality of life and survival to the endpoint.

[0115] Example 7 histology Dnm1 for severe seizures and neurodevelopmental disorders Ftfl The striking palliative effect of silencing Dnm1 mRNA prompted investigation into the extent to which the treatment affected the underlying cellular pathology. Gliosis and neuronal cell death are hallmarks of neuronal injury and recurrent seizure activity, and Dnm1 expression may be a signaling pathway that may be underlying the pathology of Dnm1. Ftfl Here, we investigated the presence of gliosis and cell degeneration via immunolabeling with glial fibrillary acidic protein (GFAP) and Fluoro-Jade C (FJC), features that have not been previously investigated in published studies on mouse models.

[0116] At least 3–5 mice from each group (genotype: Dnm1 Ftfl / Ftfl and Dnm1 + / +X-treated mice (miDnm1a and eGFP) were perfused with 4% PFA for immunohistochemical evaluation at PND18. Ftfl / Ftfl miDnm1a mice and Dnm1 + / + Controls were evaluated. All animals were treated in the same way before euthanasia. Brains were dissected from the skull and fixed in 4% PFA overnight at 4°C. Brains were transferred to gradient concentrations of sucrose (15% and 30%) overnight at 4°C. Once saturated, brains were embedded in OCT (Fisher Healthcare Cat. No. 4585) and frozen. Free-floating 40 μm sections were collected using a cryostat (Leica CM3050S). Sections were permeabilized with 0.1% TritonX in PBS for 30 min and blocked with 5% normal goat serum in PBS (blocking buffer) for 1 h at room temperature. Sections were incubated overnight at 4° C. in blocking buffer with either anti-NPY (1:500, ImmunoStar, Hudson, WI Cat. No. 22940), anti-c-Fos (1:250, Abcam, Cambridge, UK Cat. No. ab190289), anti-GFP (1:250, Invitrogen, Carlsbad, CA Cat. No. A11120), or anti-GFAP (1:750, Sigma, Saint Louis, MO Cat. No. M4403). Sections were then washed for 10 min in PBST and incubated for 2 h at room temperature in AlexaFluor secondary 555 (1:1000, Thermo Fisher Scientific, Waltham, MA, Ref. No. A31428 and Ref. No. A32727). Sections were incubated for 5 min in DAPI and then washed with PBS. Sections were finally mounted on slides and coverslipped with Fluoromount-G (Southern Biotech, Birmingham, Ala., Catalog No. 0100-01).

[0117] For FJC labeling, 3–5 PND18 and PND30 mice (genotype x treatment) were euthanized and their brains were dissected and flash frozen. 20 μm thick sections were collected on a cryostat and mounted on gelatin-coated slides (FD NeuroTechnologies, Inc. Columbia, MD, Catalog No. PO101). Sections were post-fixed in 2% PFA and washed in PBS. Slides were air-dried on a 50°C heating block for 20–30 min and subsequently placed in an 80% ethanol solution consisting of 1% NAOH for 5 min. Slides were transferred to 70% ethanol for 2 min, rinsed in deionized water for 2 min, incubated in 0.06% potassium permanganate in deionized water for 10 min, rinsed in deionized water for 2 min, and finally incubated in FJC working solution consisting of 0.0001% FJC in 0.1% acetic acid for 10 min. Finally, the slides were washed three times for 2 min each in deionized water, air-dried completely, and cleared in xylene for at least 1 min before covering them with mounting medium (DPX, Saint Louis, MO, Cat. No. 06522). 30 Slides were imaged using a Zeiss LSM-800 confocal microscope and Zen v2.3. Tile images of the hippocampus at 10x magnification were acquired for each section while keeping the laser and gain settings constant. For the FJC, images were acquired at 10x magnification using an Axio X-Cite Series 120Q epifluorescence microscope. Post-processing of images was performed in Adobe Photoshop. All image processing was kept consistent.

[0118] IHC images were quantified blindly using ImageJ (Fiji, nih.gov). Images were converted to 8-bit and brightness and contrast were kept constant. The cell counter plugin was used to count abnormal NPY and c-Fos positive cells in the entire hippocampal CA3 and FJC positive cells in the hippocampal CA1. GFAP fluorescence intensity was determined using the measurement tool with a region of interest (ROI) in CA1. Measurements were set to include area, minimum and maximum gray values, and integrated density. For fluorescence intensity measurements, background intensity was collected. Relative fluorescence was calculated by first subtracting the background integrated intensity from the integrated intensity of the ROI in CA1 to obtain background corrected intensity. Area was kept constant across all intensity measurements. The corrected intensities of the wild-type control group were then averaged. Each corrected intensity was divided by the average of the corrected intensities of the wild-type controls and multiplied by 100.

[0119] At PND18, control injected Dnm1 Ftfl / Ftfl Mice were treated with Dnm1 Ftfl / Ftfl Compared with Dnm1 mice (p = 0.018), Dnm1 mice showed strong fibrillary gliosis (GFAP) in the hippocampus, especially in the CA1 region, indicating a hippocampus under stress (Figure 6A). In contrast, Dnm1 mice treated with Dnm1 showed strong fibrillary gliosis (GFAP) in the hippocampus, especially in the CA1 region, indicating a hippocampus under stress (Figure 6A). Ftfl / Ftfl Mice did not exhibit gliosis and their hippocampi did not differ from wild-type controls (p>0.05, Fig. 6A, Fig. 7A). Treated Dnm1 mice that survived to the study endpoint at PND30. Ftfl / Ftfl Mice were treated and control injected with Dnm1 + / + Compared to control injected Dnm1 mice, control injected Dnm1 mice showed increased GFAP intensity in the hippocampus (p=0.0059 and p=0.0072, respectively, Fig. 6B and Fig. 7A). Ftfl / Ftfl FJC labeling of mice revealed significant cell degeneration in the hippocampus and Ftfl / Ftfl This cell death phenotype was more prevalent in the CA1 region compared to control-injected Dnm1 mice (p=0.015, Fig. 6C, Fig. 7B). Ftfl / Ftfl There was no difference between mice treated with Dnm1 Ftfl / FtflThe IL-1 expression level was significantly decreased in treated Dnm1 mice by the PND30 endpoint (FIG. 6C). Ftfl / Ftfl Mice showed some cell death, however, in both treated and control injected Dnm1 + / + These results suggest that the expression of Dnm1 in hippocampal neurons was not significantly higher in the rat compared to the control rat (Fig. 6D, Fig. 7B). Ftfl Revealing sensitivity to た In addition, these results suggest that miDnm1a treatment reduces Dnm1 expression at PND18 and PND30. Ftfl / Ftfl The results showed that the compound successfully inhibited or delayed gliosis and cell degeneration in the mouse hippocampus (FIGS. 6A to 6D, 7A to 7B).

[0120] Control injected Dnm1 Ftfl / Ftfl Given the increased gliosis and cell degeneration observed in the hippocampus of mice, the involvement of the hippocampus was further investigated by using a cellular footprint of metabolic activity typically associated with recurrent limbic seizure behavior. Neuropeptide Y (NPY) was investigated because upregulation of NPY in the hippocampus is a known method to demonstrate hyperexcitability in rodent models of epilepsy. At PND18, treated Dnm1 Ftfl / Ftfl Compared with control injected Dnm1 mice Ftfl / Ftfl Abnormal cellular NPY expression was observed in the hippocampal cornu ammonis region, specifically CA3, of mice (p=0.0012, Fig. 8A, Fig. 9A). However, Dnm1 treated Ftfl / Ftfl Mice were treated and control injected with Dnm1 at PND18. + / + The NPY expression in Dnm1 mice was similar to that in Dnm1 mice (p>0.05, Fig. 8A, Fig. 9A). Ftfl / Ftfl Mice were treated and control injected with Dnm1 + / + mice, but still no difference in Ftfl / Ftfl Mice have more abnormal NPY in the CA3 +In addition, immunostaining for c-Fos, an immediate early gene marker of neuronal activity, was performed. + A significant increase in cells was observed, especially in the control injected Dnm1 Ftfl / Ftfl In contrast, this increase in neuronal activity was observed in the CA3 of Dnm1-treated mice at PND18 (Fig. 8C, Fig. 9B). Ftfl / Ftfl In mice treated with Dnm1, the IL-1 expression was decreased (p<0.00001) and persisted until PND30 (Fig. 8C-D, Fig. 9B). Ftfl / Ftfl Mice were treated and control injected with Dnm1 on PND18 or PND30. + / + These results indicate that miDnm1a treatment increased the expression of Dnm1 in mice, but not in mice (p>0.05, Figs. 8C-8D, 9B). Ftfl / Ftfl This suggests that it reduced abnormal cell metabolic activity in the mice.

[0121] Overall, control injected Dnm1 Ftfl / Ftfl Unlike mice, treated with Dnm1 Ftfl / Ftfl Mice showed a reduction in gliosis, cell death, and abnormal neuronal activity at PND18 that persisted and led to survival up to the PND30 endpoint. Together, these results indicate that miDnm1a treatment reduces the risk of Dnm1a-induced neuronal death. Ftfl These results suggest that the cytopathology associated with the mutation was reduced.

[0122] Example 8 Design and in vitro testing of miDNM1 targeting human and mouse DNM1 exon 10b To knockdown human DNM1 or mouse Dnm1, we designed microRNAs that specifically and efficiently target exon 10b from both species. miDNM1-10b-72 miRNA was cloned into a mir-30-based construct by the method described in Example 1. It binds to both human and mouse exon 10b with perfect complementarity. The full-length miDnm1b-72 miRNA sequence is as follows:

[0123] 5'CUCGAGUGAGCGAGUGUCUCAAGUGUGUGGACAUCUGUAAAGCCACAGAUGGGAUGUCCACACACUUGAGACACGUGCCUACUAGA 3' (SEQ ID NO: 29) The mature antisense guide strand sequence is shown in SEQ ID NO:46 (5' to 3').

[0124] The activity of miDNM1-10b-72 was tested in vitro using the dual luciferase reporter assay described in Example 1. miDNM1-10B-72 showed approximately 90% knockdown compared to non-targeting controls (empty U6 plasmid, U6T6 or miLacZ) (Figure 10).

[0125] While the present invention has been described in terms of specific embodiments, it will be understood by those skilled in the art that variations and modifications thereof occur, and therefore only such limitations as appear in the scope of the appended claims should be placed on the invention.

[0126] All documents referenced in this application are incorporated herein by reference in their entirety.

Claims

1. A nucleic acid comprising: (a) a nucleic acid having at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a polynucleotide sequence encoding a dynamin 1 (DNM1) artificial inhibitory RNA as set forth in any one of SEQ ID NOs: 1 to 17; (b) a nucleic acid encoding a DNM1 artificial inhibitory RNA that contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to an artificial inhibitory RNA polynucleotide sequence set forth in any one of SEQ ID NOs: 18-34; or (c) a nucleic acid comprising a nucleic acid encoding a DNM1 antisense guide strand that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence set forth in any one of SEQ ID NOs: 35-51.

2. A viral vector comprising the nucleic acid of claim 1 or any one or more combinations thereof.

3. 3. The viral vector of claim 2, wherein the viral vector is an adeno-associated virus (AAV), an adenovirus, a lentivirus, a retrovirus, a poxvirus, a baculovirus, a herpes simplex virus, a vaccinia virus, or a synthetic virus.

4. The viral vector of claim 3 , wherein the viral vector is an AAV.

5. The viral vector of claim 4 , wherein the AAV lacks the rep and cap genes.

6. The viral vector of claim 4, wherein the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).

7. 5. The viral vector of claim 4, wherein the AAV has a capsid serotype of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, or AAV rh.

74.

8. The viral vector of claim 4, wherein the AAV has a capsid serotype of AAV-9.

9. The viral vector of claim 4 , wherein the AAV is a pseudotyped AAV.

10. The viral vector of claim 9 , wherein the AAV is AAV2 / 8 or AAV2 / 9.

11. The viral vector of claim 4, wherein the expression of the nucleic acid encoding the DNM1 artificial inhibitory RNA is under the control of a U6 promoter.

12. A composition comprising the nucleic acid of claim 1 and a pharma- ceutically acceptable carrier.

13. A composition comprising the viral vector of any one of claims 2 to 11 and a pharma- ceutically acceptable carrier.

14. A composition for use in a method for delivery to a neuron having a dynamin 1 (DNM1) gene, comprising a delivery vehicle capable of delivering a drug to the neuron, a nucleic acid encoding an artificial inhibitory RNA, the artificial inhibitory RNA binding to a segment of messenger RNA (mRNA) encoded by the dynamin 1 (DNM1) gene, and optionally a pharma- ceutically acceptable carrier.

15. The composition of claim 14, wherein the DNM1 gene comprises a human exon sequence of SEQ ID NO: 52 or 53, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of SEQ ID NO: 52 or 53.

16. The composition of claim 14 , wherein the delivery vehicle is a viral vector.

17. 17. The composition of claim 16, wherein the viral vector is an adeno-associated virus (AAV), an adenovirus, a lentivirus, a retrovirus, a poxvirus, a baculovirus, a herpes simplex virus, a vaccinia virus, or a synthetic virus.

18. The composition of claim 17, wherein the viral vector is AAV.

19. The composition of claim 18, wherein the AAV lacks the rep and cap genes.

20. 20. The composition of claim 18, wherein the AAV is a recombinant AAV (rAAV), a recombinant single-stranded AAV (ssAAV), or a self-complementary recombinant AAV (scAAV).

21. 19. The composition of claim 18, wherein the AAV has a capsid serotype selected from the group consisting of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.

74.

22. The composition of claim 18, wherein the AAV has a capsid serotype of AAV-9.

23. The composition of claim 18, wherein the AAV is a pseudotyped AAV.

24. 24. The composition of claim 23, wherein the AAV is AAV2 / 8 or AAV2 / 9.

25. The composition of claim 14, wherein the expression of the nucleic acid encoding the DNM1 artificial inhibitory RNA is under the control of a U6 promoter.

26. 13. The composition of claim 12 for use in a method for delivery to neurons having the dynamin 1 (DNM1) gene.

27. ​​The composition described in claim 13 for use in a method of delivery to neurons having the dynamin 1 (DNM1) gene.

Images