Dietary product devoid of at least two non essential amino acids

Abstract

To provide: a dietary product, a pharmaceutical composition and a method of treating cancer for altering the levels of amino acids in a diet so as to treat cancer and improve existing cancer therapies; biomarkers for identifying patients that will benefit from dietary therapies for treating cancer; and methods and kits using the biomarkers.SOLUTION: The present invention provides: a dietary product comprising a plurality of amino acids, where the dietary product comprises all the essential amino acids and is substantially devoid of at least two non-essential amino acids; methods and uses thereof in treatment of cancer; stratification methods and biomarkers for such applications.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates generally to the field of dietary therapy for treating cancer. More specifically, the present invention The authors propose altering amino acid levels in the diet to treat cancer and improve existing cancer therapies. The present invention also relates to a method for treating cancer that would benefit from dietary therapy. Biomarkers for identifying patients with pulmonary arterial disease and methods and kits using the biomarkers This also applies to. [Background technology]

[0002] Cancer is a disease in which cells grow uncontrollably, growing and dividing beyond the normal limits of cell proliferation. These cells can invade and destroy surrounding tissue. Cells can metastasize, in which case cancer cells travel to other parts of the body through the blood or lymphatic system. It can spread to other areas.

[0003] Cancer treatments may include surgery to remove tissue, radiation therapy to reduce the size of the tumor, or drugs. This may include chemotherapy using drugs or other medicines to treat cancer. Survival rates for cancer vary by type, but are particularly low for cancer that has metastasized. This is mainly because drug / chemotherapeutic treatments often fail and are unable to completely eradicate cancer. Normal non-cancer cells respond poorly to a given dose of a pharmacotherapy / chemotherapeutic drug. These drugs are only tolerated by patients with cancer, and suboptimal doses are used to prevent excessive side effects. Complicating the issue is that cancer cells are more susceptible to drugs than normal cells. Limited selectivity, cancer cells become resistant to pharmacotherapy / chemotherapeutic drugs during treatment Viable cancer cells typically still grow uncontrollably. This means that researchers are developing a new way to treat cancer. This led to a search for the law.

[0004] In recent years, much attention has been paid to cancer metabolism, particularly how cancer cells differ from normal cells and typically cause disease. Attention has focused on whether the disease is related to the rapid uncontrolled cell proliferation that occurs during tumor remodeling. Cancer reprograms its metabolism so that it can generate new cells and adapt to metabolic stress. It is clear that targeting specific metabolic pathway enzymes or Alternatively, chemicals and / or metabolites utilized in the pathway can be targeted. Proteins are important components of cells, and protein synthesis pathways play a key role in the proliferation of cancer cells. That is the key.

[0005] Proteins can be synthesized from amino acids, and in mammals, the known biologically active amino acids There are 20 of these. These can be synthesized in the body (non-essential amino acids), but those that cannot be synthesized are It is an essential component of the diet (essential amino acid). Cancer cells need non-essential amino acids to support their growth. Some cancers are highly dependent on the availability of these nonessential amino acids to support their growth. While other cancers are capable of synthesizing exogenous amino acids de novo, (Jason W. Locasale, Nature Reviews Cancer, 2013, 13, 572-583; R. Po O. Maddocks et al, Nature, 2013, 493, 542-546; C. Labuschagne et al, Cell Rep. 2014, 22, 7(4), 1248-58). non-essential aminos Acid is also involved in protein synthesis and many other anabolic processes necessary for cancer cell growth. Used.

[0006] Cancer dependence on exogenous amino acids can be ameliorated by restricting dietary amino acid levels. By modulating the amount of exogenous amino acids available to the cancer, it can be used to treat cancer. This deficiency of essential components required for the growth and survival of cancer cells may contribute to the progression of cancer. This may have the effect of preventing cancer cell proliferation and inducing cancer cell death. It can be used in combination with other strategies such as radiation therapy and chemotherapy. It is possible. Summary of the Invention [Problem to be solved by the invention]

[0007] Such strategies will identify patients and patient populations who may benefit from such therapies. To identify, improved methods of classifying cancer types will be needed.

[0008] Therefore, improvements in identifying patients and patient populations who would benefit from metabolic targeted therapies are needed. There remains a need for improved methods. [Means for solving the problem]

[0009] In accordance with the present invention, a food composition containing all essential amino acids and substantially no less than two non-essential amino acids is provided. The present invention provides a dietary product that contains a plurality of amino acids that are deficient in niacin. The product may contain at least 9 amino acids.

[0010] At least one of the non-essential amino acids that is substantially absent is glycine, serine, or cysteine. , tyrosine, and arginine.

[0011] The at least two non-essential amino acids that are substantially absent include the following amino acids: glycine The amino acid sequence may include two or more of arginine, serine, cysteine, tyrosine, and arginine. The dietary product substantially: a. Glycine, serine, and cysteine; b. glycine, serine, and arginine; c. glycine, serine, and tyrosine; d. glycine, serine, arginine, and cysteine; e. glycine, serine, tyrosine, and cysteine; f. cysteine ​​and arginine; g. Cysteine ​​and tyrosine; h. cysteine ​​and glycine; i. cysteine, tyrosine, and arginine; or j. May lack glycine, serine, arginine, tyrosine, and cysteine.

[0012] Suitably the dietary product further comprises one or more macronutrients and / or or one or more micronutrients.

[0013] The dietary product further contains less than 25 mg / kg of subject's body weight / day or less than 20 mg / kg of subject's body weight / day. Levels of <18 mg / kg / day or <16 mg / kg / day It may contain thionine.

[0014] The dietary product of the present invention provides essential amino acids ( Formulated to provide at least the recommended daily intake of vitamins and minerals (optionally excluding methionine) It is possible.

[0015] The dietary products of the present invention may be in the form of a solid or a drink.

[0016] The present invention further relates to a method for preparing a dietary supplement according to the present invention, comprising dissolving or dispersing the ingredients in water and spray drying. A process for preparing a tally product is provided.

[0017] In another aspect, the present invention relates to a dietary product of the present invention or a composition produced according to the present invention. and a pharma- ceutical acceptable carrier, excipient, or diluent. A composition is provided.

[0018] Suitably, the pharmaceutical composition of the present invention further comprises a cancer cell proliferation inhibitor, a radiotherapeutic agent, and The therapeutic agent may include a therapeutic agent selected from a chemotherapeutic agent and a therapeutic agent that inhibits OXPHOS and and / or may increase reactive oxygen species and / or decrease antioxidant defenses.

[0019] In a further aspect, the present invention relates to a method for treating cancer comprising administering to a subject the method of the present invention or to a method for treating cancer. or a pharmaceutical composition of the present invention. .

[0020] Cancers include intestinal cancer, colon cancer, liver cancer, lung cancer, osteosarcoma, lymphoma, leukemia, and breast cancer. The compound may be selected from the group consisting of:

[0021] The cancer may be positive for wild-type KRAS.

[0022] Cancer can have deregulated cMyc expression.

[0023] The dietary product may be substantially devoid of serine and / or glycine.

[0024] Cancer may be associated with downregulation of MTAP expression, and optionally, a systemic effect of dietary products. The cysteine ​​levels may be reduced or may be substantially devoid of cysteine.

[0025] Suitably, the dietary product for use in the treatment of cancer comprises a cancer cell growth inhibitor, a radiation Therapeutic agents, chemotherapy agents, inhibitors of amino acid metabolism / turnover / interconversion, non-essential amino acids Acid synthesis inhibitors, amino acid transport inhibitors, enzymes or drugs that promote amino acid degradation, can be used in combination with a therapeutic agent selected from substances that sequester amino acids. .

[0026] Therapeutic agents inhibit OXPHOS and / or increase reactive oxygen species and / or Alternatively, it may lower antioxidant defenses.

[0027] In another aspect, the present invention relates to a dietary product according to the present invention or produced according to the present invention. The dietary product or pharmaceutical composition of the present invention may be used in the manufacture of a drug for the treatment of cancer. The present invention provides for use in the manufacture of a

[0028] Suitably, the cancer may be selected from the group consisting of colon cancer, lymphoma, liver cancer, lung cancer, osteosarcoma, and breast cancer. It can be selected from the group consisting of:

[0029] The cancer may be positive for wild-type KRAS and / or the cancer may be positive for cMyc Deregulated expression and / or downregulated expression of MTAP There is.

[0030] Suitably the dietary product of the present invention contains serine, glycine, or serine and glycine. Syn may be substantially absent.

[0031] Suitably the dietary products of the invention have reduced levels of cysteine ​​or It may be substantially devoid of cysteines.

[0032] Suitably, the dietary product comprises a cancer cell growth inhibitor, a radiotherapeutic agent, and a chemotherapy agent. It may be used in combination with one or more therapeutic agents selected from the group consisting of therapeutic agents.

[0033] Therapeutic agents inhibit OXPHOS and / or increase reactive oxygen species and / or Alternatively, it may lower antioxidant defenses.

[0034] In another aspect, the present invention provides a therapeutically effective amount of a dietary product of the present invention or Administering a dietary product or a pharmaceutical composition of the invention according to The present invention relates to a method of treating cancer in a subject.

[0035] Suitably, the cancer may be from colon cancer, liver cancer, osteosarcoma, lung cancer, lymphoma, and breast cancer. It can be selected from the group consisting of:

[0036] The cancer may be positive for wild-type KRAS and / or down-regulated cMyc expression. may have been lifted.

[0037] The dietary product may be substantially devoid of serine and / or glycine.

[0038] The dietary product contains a compound selected from cancer cell growth inhibitors, radiotherapy drugs, and chemotherapy drugs. The therapeutic agent may be used in combination with one or more therapeutic agents selected from the group consisting of acetaminophen, ...

[0039] Therapeutic agents inhibit OXPHOS and / or increase reactive oxygen species and / or Alternatively, it may lower antioxidant defenses.

[0040] Suitably, in all aspects of the invention, the dietary product is provided as the subject's sole source of nutrition. It can be said that:

[0041] Treatment should be continued for a period of at least 24 hours or until a therapeutic endpoint is observed. Give until you understand.

[0042] The dietary product may be administered 1 to 6 times daily.

[0043] Suitably, at least the recommended daily amounts of essential amino acids are met by the daily dosing regimen. It is possible.

[0044] The present invention further relates to a cancer treatment comprising a diet substantially lacking serine and / or glycine. To identify patients or patient populations who are responsive or sensitive to KRAS and and / or using MTAP as a biomarker.

[0045] Suitably, the cancer treatment may include a diet substantially devoid of serine and glycine.

[0046] Suitably, the cancer treatment further comprises administration of a cancer cell proliferation inhibitor, a radiotherapeutic agent, and / or This may include administration of a therapeutic agent selected from a chemotherapeutic agent.

[0047] In another aspect, the present invention provides a method for treating cancer that is responsive or inhibits cancer cell proliferation and differentiation, comprising administering a diet substantially lacking serine. 23. A method for identifying a subject who is unlikely to be susceptible, comprising: a) determining the level of Kras expression or activity in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of Kras expression or activity in said biological sample from a control sample; or a predetermined reference level of Kras expression or activity, The biological sample is elevated relative to the control sample or relative to the predetermined reference level. The level of Kras expression or activity in the sample indicates non-responsiveness or A method is provided that indicates insensitivity.

[0048] In a further aspect, the present invention provides a method for the detection of cancer responsive to a cancer treatment comprising a diet substantially lacking serine. or a method for identifying a subject likely to be susceptible, comprising: a) determining the level of Kras expression or activity in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of Kras expression or activity in said biological sample from a control sample; or a predetermined reference level of Kras expression or activity, The biological sample is low in comparison to the control sample or to the predetermined reference level. the level of Kras expression or activity in said control sample or A level of Kras expression or activity that is substantially the same as the predetermined reference level is A method is provided for indicating responsiveness or sensitivity to the cancer treatment.

[0049] In another aspect, the present invention relates to a method for treating cancer that may benefit from a cancer treatment comprising a diet substantially lacking serine. 1. A method for identifying a subject, comprising: a) determining the level of Kras expression or activity in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of Kras expression or activity in said biological sample from a control sample; or a predetermined reference level of Kras expression or activity, The biological sample is low in comparison to the control sample or to the predetermined reference level. the level of Kras expression or activity in said control sample or A level of Kras expression or activity that is substantially the same as the predetermined reference level is The present invention provides a method for determining whether a patient may benefit from a cancer treatment.

[0050] In a further aspect, the present invention provides a method for the preparation of a polypeptide comprising: i) substantially devoid of serine; and / or ii) and and / or ii) respond to or inhibit a cancer treatment that includes a diet containing restricted levels of cysteine. 23. A method for identifying a subject likely to be susceptible, comprising: a) detecting the expression or activity of MTAP in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of expression or activity of MTAP in said biological sample from a control sample; or a predetermined reference level of MTAP expression or activity, The biological sample is low in comparison to the control sample or to the predetermined reference level. the level of expression or activity of MTAP in said control sample or said A level of expression or activity of MTAP that is substantially the same as the predetermined reference level is A method is provided for indicating responsiveness or sensitivity to the cancer treatment.

[0051] In another aspect, the present invention provides a method for the preparation of a polypeptide comprising: i) substantially devoid of serine; and / or ii) substantially devoid of cysteine. A method for identifying a subject who may benefit from a cancer treatment comprising a restricted level diet. : a) detecting the expression or activity of MTAP in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of expression or activity of MTAP in said biological sample from a control sample; or a predetermined reference level of MTAP expression or activity, The biological sample is low in comparison to the control sample or to the predetermined reference level. the level of expression or activity of MTAP in said control sample or said A level of expression or activity of MTAP that is substantially the same as the predetermined reference level is The present invention provides a method for determining whether a patient may benefit from said cancer treatment. In the same manner, the biological sample can be a cancer cell or a cancer tissue. In all aspects, the control sample may be a normal cell or tissue sample. The normal cell or tissue sample contains the same cell type or tissue as the cancer cell or tissue. It may be of woven type.

[0052] In a further aspect, the present invention provides a method of treating a subject with cancer, comprising: a) determining whether the level of Kras expression or activity in a biological sample isolated from said subject is , whether they represent a response or sensitivity to cancer treatments involving a diet substantially lacking serine. determining; b) determining whether the level of Kras expression or activity in said biological sample is associated with said cancer treatment; administering to said subject said cancer treatment if said subject exhibits a responsiveness or susceptibility to said cancer. The present invention provides a method, including:

[0053] In a further aspect, the present invention provides a method of treating a subject with cancer, comprising: a) determining whether the level of expression or activity of MTAP in a biological sample isolated from said subject is , comprising a diet that is i) substantially devoid of serine and / or ii) restricted in cysteine, determining whether the patient exhibits responsiveness or susceptibility to a cancer treatment; b) determining whether the level of MTAP expression or activity in said biological sample is associated with said cancer treatment; administering to said subject said cancer treatment if said subject exhibits a responsiveness or susceptibility to said cancer. The present invention provides a method, including:

[0054] Suitably, the cancer treatment may comprise a diet substantially devoid of serine and glycine.

[0055] Suitably, the cancer treatment further comprises administration of a cancer cell proliferation inhibitor, a radiotherapeutic agent, and / or The method may include administration of a therapeutic agent selected from a chemotherapy agent or a chemotherapeutic agent.

[0056] The level of Kras expression or activity in a biological sample isolated from a subject is determined by determining whether the serine A study was conducted to determine whether a patient exhibits responsiveness or sensitivity to cancer treatment including a diet substantially lacking The steps are: a) determining the level of Kras expression or activity in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of Kras expression or activity in said biological sample from a control sample; or comparing the level of Kras expression or activity to a predetermined reference level. , the biological sample being higher compared to a control sample or compared to a predefined reference level The level of Kras expression or activity may be indicative of non-responsiveness or non-responsiveness of said subject to said cancer treatment. represents insensitivity, low compared to a control sample or compared to a predefined reference level; The level of Kras expression or activity in the biological sample or a control sample is also or a level of Kras expression or activity that is substantially the same as a predetermined reference level, It indicates the subject's responsiveness or sensitivity to the cancer treatment.

[0057] The level of expression or activity of MTAP in a biological sample isolated from a subject is determined to be: i) a serine / erythropoietin-binding protein; and / or ii) a diet substantially devoid of cysteine. The step of determining whether the patient exhibits a responsiveness or susceptibility to the a) detecting the expression or activity of MTAP in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of expression or activity of MTAP in said biological sample from a control sample; or comparing the level of Kras expression or activity to a predetermined reference level. , The biological sample is low compared to a control sample or compared to a predetermined reference level. The expression or activity level of MTAP in the sample, or in a control sample or a predefined reference level A level of MTAP expression or activity that is substantially the same as the level of MTAP expression or activity in response to said cancer treatment. The present invention indicates a high responsiveness or sensitivity of said subject to the treatment.

[0058] In another embodiment, the present invention includes a diet substantially lacking serine and / or glycine, 1. A kit for use in identifying a subject who would benefit from a treatment comprising: a.An agent that seeks expression or activity of Kras; b. A kit comprising:

[0059] Suitably, the kit may further comprise an agent which determines the expression or activity of MTAP.

[0060] The kit may further comprise a detection method for detecting a level of a compound that is higher than a control sample or higher than a predetermined reference level. The level of Kras expression or activity in a biological sample may be used to determine whether a subject is responsive to a cancer treatment. It represents the response or insensitivity of a given sample compared to a control sample or compared to a predefined reference level. The level of Kras expression or activity in the biological sample is low compared to that in the control sample. a level of Kras expression or activity substantially equal to a predetermined reference level or may include instructions that the test is indicative of the subject's responsiveness or susceptibility to said cancer treatment.

[0061] In another aspect, the present invention provides a method for the preparation of a nucleic acid molecule comprising: i) substantially lacking serine and / or glycine; and / or ii) subjects who would benefit from a cancer treatment comprising a cysteine-restricted diet. A kit for use in identifying: a. an agent that seeks MTAP expression or activity; b. A kit is provided comprising:

[0062] The kit further comprises a step of detecting a level of a serotonin level that is lower than a control sample or lower than a predetermined reference level. The level of expression or activity of MTAP in a biological sample or a control sample or A level of expression or activity of MTAP that is substantially the same as or equal to a predetermined reference level is The antibody may include instructions that the antibody indicates the subject's responsiveness or susceptibility to the cancer treatment.

[0063] Embodiments of the invention are further described below with reference to the accompanying drawings. [Brief description of the drawings]

[0064] [Figure 1]Figure 1a. PDAC Kras G12D / + p53+ / -: Mice were placed on diets at ~60 days of age and used until clinical endpoint (PDAC-associated survival). Survival was calculated from diet change (not birth). P values ​​were calculated using Mantel-Cox test. Figure 1b. PDAC Kras G12D / + p53R172H / +: Mice were placed on diets at ~60 days of age and used until clinical endpoint (PDAC-associated survival). Survival was calculated from diet change (not birth). P values ​​were calculated using Mantel-Cox test. Figure 1c. Mice were injected with 100 μL of 100 μM 1 3C3 15N1 Serine via the tail vein and left for 2 hours. Sacrificed tissues were frozen, homogenized in metabolite extraction buffer, and quantified by LCMS. P values ​​were calculated using paired T-test. Figure 1d. Kras-inducible cell lines (iKRAS1, iKRAS3, and AK196) were grown in complete medium with (KRAS-on) or without (KRAS-off) doxycycline. mRNA expression of serine synthesis pathway enzymes was analyzed by qRT-PCR. Error bars = SEM. Fig. 1e. Three Kras-inducible cell lines (iKRAS1, iKRAS3, and AK196) were grown for 3 days and protein expression was analyzed by Western blot. Figure 1c shows the relative Kras-on / Kras-off variation in SSP and Phospho-ERK1 protein expression (measured by LiCor infrared quantification) averaged across iKRAS1, iKRAS3, and AK196 cells; quantification bands are shown in the Western blot. Error bars = STDEV. Fig. 1f. Kras-inducible cell lines were grown in medium containing or lacking serine and glycine (+SG / -SG) and counted after 48 and 96 hours. Error bars = SEM. [Diagram 2]Figure 2a. APCmin / APCmin KRAS organoids were grown with or without serine and glycine for 24-48 hours. Figure 2b. APCmin / APCmin KRAS organoids were grown without serine and glycine for 5 days and then plated in medium containing serine and glycine and grown for an additional 24-72 hours. Figure 2c. qRT-PCR of mRNA extracted from APCmin / APCmin KRAS organoids grown with or without serine and glycine. Figure 2d. APCmin / APCmin KRAS organoids were grown in the presence of 13C6-glucose for 5 hours and metabolites were extracted and analyzed by LCMS. P values ​​calculated using unpaired T-test. Error bars=STDEV. [Figure 3a] Figure 1. Effect of a serine / glycine free diet on serum amino acid levels in two pancreatic cancer mouse models, as measured by mass spectrometry of serum samples. Statistical comparisons are detailed in the figure. Pdx1cre;KRasG12D / +;p53+ / - mice were fed normal chow until 60 days of age, then transitioned to a control diet containing serine and glycine (Ctr) or a matching diet lacking serine and glycine (-SG) until clinical endpoint. Serum isolated from terminal bleeds was analyzed by LCMS. Relative amounts of metabolites are shown (x-axis = peak area). Error bars = STDEV. P values ​​were calculated by T-test (unpaired, two-tailed) for each amino acid. P values ​​less than 0.05 are indicated. [Figure 3b] Figure 1. Effect of a serine / glycine free diet on serum amino acid levels in two pancreatic cancer mouse models as measured by mass spectrometry of serum samples. Statistical comparisons are detailed in the figure. 60-day-old Pdx1cre;KRasG12D / +;p53R172H / + mice were fed a control diet or a SG-free diet (-SG) until clinical endpoint. Serum isolated from terminal bleeds was analyzed by LCMS. Relative amounts of metabolites are shown (x-axis = peak area). Error bars = STDEV. P values ​​were calculated by T-test (unpaired, two-tailed) for each amino acid. P values ​​less than 0.05 are shown. [Figure 4]Figure 4a. Growth rate of tumors formed from HCT116 cells (human colon cancer, p53wt or null). Tumors grew rapidly in mice fed a control diet, whereas tumor growth was significantly attenuated in a serine- and glycine-free diet (-SG). Figure 4b. Survival rate of mice from the experiment shown in Figure 4a. A serine-free diet significantly improved survival time of mice. [Diagram 5] 1 shows the effect of serine depletion on the growth inhibitory effect of anti-cancer drugs using HCT116, DLD1 and SW480 cell lines, showing an increased anti-proliferative effect when a significant proportion of chemotherapy is given simultaneously with serine and glycine depletion. [Figure 6] Figure 1 shows the effect of a serine and glycine restricted diet on amino acid levels in serum samples from mice. C57B16 mice were fed a control diet containing all 20 amino acids or a diet lacking serine and glycine but containing all other 18 amino acids. Serum samples were analyzed by LCMS and the relative amounts of all non-essential amino acids are shown. With the diet, reduced levels of serine, glycine, and cysteine ​​are seen. [Figure 7] FIG. 1 shows cysteine ​​uptake from cell culture medium in multiple cell lines (A549, HCT116, SW480, RKO, MCF7, MDA MB231, and MDA MB468), demonstrating that cancer cell lines avidly consume exogenous cysteine. [Figure 8] Figure 1. Effect of cysteine ​​depletion in multiple cell lines (HCT116, HepG2, MDA MB231, RKO, and U2OS). Basal medium = all amino acids added except serine, glycine, and cysteine. S = 0.8 mM serine, G = 0.4 mM glycine, C = 0.4 mM cysteine. Medium is changed every 24 hours. [Figure 9]Figure 1 shows the effect of combined and separate depletion of cysteine ​​with serine and glycine on cell number in three cell lines (HCT116, SW480, and DLD1). Cells were plated in media with different concentrations of serine, glycine, and cysteine ​​(but enriched in all other amino acids) and counted after 48 hours. [Figure 10] Diagram showing the interdependent mechanisms of serine and cysteine. Homocysteine ​​excretion works in two ways; 1. it keeps serine-derived one-carbons from being used for remethylation, so that the serine-derived one-carbon pool is used instead for nucleotide (DNA, RNA) synthesis, and 2. it prevents the serine pool from being depleted by eliminating the need for serine to make cysteine. However, homocysteine ​​excretion means that cysteine ​​is no longer synthesized de novo, and therefore cysteine ​​must come from outside the cancer cell. To meet the high anabolic demand for nucleotide and glutathione (GSH) synthesis, cancer cells need to import exogenous serine and cysteine. [Figure 11] FIG. 1 shows an overview of whole body and tumor metabolism. [Figure 12] Figure 1 shows the effect of depriving non-essential amino acids in addition to serine and glycine on the proliferation of HCT116 and RKO cells. Modulation of other amino acids improves the anti-cancer effect of a serine- and glycine-free diet. a. Serine and glycine deprivation alone reduces proliferation rate. In addition to depriving serine and glycine, depriving certain other non-essential amino acids (aspartate, glutamate, prophosphate, and asparagine) has a minor but additional effect on cell proliferation at day 2. b. Serine and glycine deprivation alone reduces proliferation rate. Furthermore, depriving tyrosine, arginine, or cysteine ​​individually has a greater anti-proliferative effect. [Figure 13]Figure 1 shows the effect of different combinations of serine, glycine, cysteine, arginine, and tyrosine depletion on cell proliferation and cell death (as shown by % change in cell number) of HCT116 cells over 4 days. Cell proliferation in complete medium (control) was +1400%. Depletion of tyrosine only; tyrosine, serine, and glycine; arginine only; and arginine, serine, and glycine all resulted in growth inhibition. Depletion of cysteine ​​only; cysteine, serine, and glycine; and serine, glycine, cysteine, and arginine resulted in growth inhibition and cell death. [Figure 14] Figure 1 shows that the expression of serine synthesis pathway enzymes is a determinant of sensitivity to serine starvation. Tumors with increased expression or activity of serine synthesis pathway enzymes (PHGDH, PSAT1, PSPH) are less sensitive to serine starvation. The activity of serine synthesis pathway can be enhanced by multiple mechanisms in cancer, including gene copy number amplification, transcriptional activation (e.g., by oncogenic Kras), or by epigenetic means, or it can be enhanced by other mechanisms, such as allosteric activation. [Figure 15] Figure 1 shows measurements of cysteine ​​precursor / homocysteine ​​dimer efflux in four cell lines (SW480, DLD1, HCT116, and RKO) cultured for 48 hours in complete medium. Homocysteine ​​is a precursor for de novo synthesis of cysteine, but it was effluxed from cancer cells and the homodimer, homocystine, was detected. [Figure 16] Figure 1 shows measurements of cysteine ​​precursor / homocysteine ​​dimer efflux in two cell lines (HCT116 and RKO) under conditions of serine starvation and serine and glycine starvation. homoC-cys = homocysteine ​​+ cysteine ​​dimer. Homocystine = homocysteine ​​+ homocysteine ​​dimer. [Figure 17]Figure 1 shows measurements of cysteine ​​precursor / homocysteine ​​dimer efflux in two cell lines (A549 and MDA MB231) under conditions of serine starvation and serine and glycine starvation. homoC-cys = homocysteine ​​+ cysteine ​​dimer. Homocystine = homocysteine ​​+ homocysteine ​​dimer. [Figure 18] Figure 2: Serine- and glycine-free diet is an effective therapeutic intervention against GEMM lymphoma and intestinal cancer. a. Eμ-Myc mice were fed normal chow until 60 days of age and then transitioned to a control diet (containing serine and glycine) or a matching diet lacking serine and glycine (no Ser, no Gly) until clinical endpoint (lymphoma-related survival). Survival was calculated from diet change (not birth). P-value calculated using Mantel-Cox test. b. APCMin / + mice were fed normal chow until 80 days of age and then transitioned to a control diet (containing serine and glycine) or a matching diet lacking serine and glycine (no Ser, no Gly) until clinical endpoint (intestinal tumor-related survival). Survival was calculated from diet change (not birth). P-value calculated using Mantel-Cox test. c. Serum from Eμ-Myc and d. APC Min / + cohorts were analyzed by LCMS and the relative abundance (by metabolite peak area) is shown. Error bars = STDEV, P values ​​were calculated by T-test (unpaired, two-tailed, * = P < 0.0005). See Figure 21 for relative quantification of total amino acids. e. Serum concentrations of serine and glycine in APC Min / + cohorts were determined using 6-point calibration curves with 13C15N-serine and glycine diluted in serum. Error bars = STDEV. f. 7-10 week old Lgr5-creER APC fl / fl mice were introduced and diet changed 7 weeks after the first tamoxifen treatment and continued until clinical endpoint (intestinal tumor-related survival). Survival is calculated from the first tamoxifen treatment. P values ​​were calculated using Mantel-Cox test. [Figure 19]Figure 22: Manipulation of antioxidant response enhances diet-induced anticancer effects. a. Eμ-Myc mice aged 60 days were fed either a control diet or a serine and glycine free diet (no Ser, no Gly) with 100 mg / kg / day phenformin (Phen.) by oral gavage and cared for until clinical endpoint. Lymphoma-related survival was calculated from diet change rather than birth. b. APCMin / + mice aged 80 days were transitioned to a control diet or a serine and glycine free diet (no Ser, no Gly) and given 200 mg / kg / day metformin (Metf.) in drinking water 4 days later. Intestinal tumor-related survival was calculated from diet change rather than birth. P values ​​calculated using Mantel-Cox test. See Figure 22a for full comparison of survival curves. c. Tumor burden data for diet alone compared to metformin + diet. Postmortem tumor counts were performed in the small intestine (SI) of APCMin / + mice. P values ​​were calculated by T-test (unpaired, two-tailed). See Fig. 22c for tumor area data. Food-only data were replicated in (a) and (b) above. d. VillincreER; intestinal tumor organoids from APfl / fl mice were grown + / -SG, + / - metformin at the indicated concentrations for 2 days. Relative changes in organoid diameter are plotted (vs. '- drug'). Data are the mean of 4 independent experiments, error bars = SEM. P values ​​were calculated by T-test (unpaired, two-tailed, with correction for multiple comparisons). e. APfl / fl organoids were grown + / -SG + / - metformin for 2 days, then fixed and immunostained for the lipid peroxidation product malondialdehyde (MDA). Data are the mean of 3 independent experiments, error bars = SEM. P values ​​were calculated by T-test (unpaired, two-tailed, with correction for multiple comparisons). f. Eμ-Myc mice were bred with Tigar- / - mice and cohorts placed on diet at ~60 days of age were utilized until clinical endpoint (lymphoma-related survival). Survival was calculated from diet change (not birth). P values ​​were calculated using the Mantel-Cox test. [Figure 20]Figure 1 shows the effect of a serine- and glycine-free diet on tumor burden in APCmin / + mice. APCmin / + mice were fed normal chow until 80 days of age and then transitioned to a control diet (containing serine and glycine) or a matching diet lacking serine and glycine (no Ser, no Gly; -SG) until the clinical endpoint (intestinal tumor-related survival). Postmortem tumor measurements were performed on intestinal tumors at the time of diet change (day 80) or at the clinical endpoint. P values ​​were calculated by T-test (unpaired, two-tailed, with correction for multiple comparisons). [Figure 21] Figure 1. Effect of serine and glycine free diet on serum amino acids. a. Eμ-myc and b. APCmin / + mice were fed normal chow until ∼60 and ∼80 days of age, respectively, and then transitioned to a control diet containing serine and glycine (Ctr) or a matching diet lacking serine and glycine (-SG) until clinical endpoint. Serum isolated from terminal bleeds was analyzed by LCMS. Relative amounts of metabolites are shown (x-axis = peak area). Error bars = STDEV. P values ​​were calculated by T-test (unpaired). [Figure 22] Figure 2: Metformin treatment did not enhance the anti-cancer effect of a serine- and glycine-free diet in APCmin / + mice. Mice aged ∼80 days were transitioned to a serine- and glycine-free diet (no Ser, no Gly) (a) or control diet (b) and given metformin (Metf.) at 200 mg / kg / day in drinking water 4 days later. Intestinal tumor-related survival was calculated from diet change rather than birth. P values ​​calculated by Mantel-Cox. c. Comparison of tumor burden data for diet alone with metformin + diet. Postmortem tumor area measurements were performed in the small intestine (SI) of APCmin / + mice. P values ​​calculated by T-test (unpaired, two-tailed). Data for "diet alone" are replicated from Figure 20. [Figure 23]Figure 1 shows that metformin levels in vivo had little effect on whole body metabolism and were too low to enhance the anti-cancer effects of a serine- and glycine-free diet. a. APCmin / + mice were transitioned to a control diet or a serine- and glycine-free diet (-SG) and then given metformin 200 mg / kg / day in drinking water. Serum isolated from terminal bleeds was analyzed by LCMS. Error bars = STDEV. b. Tissue samples from metformin-treated mice were analyzed by LCMS. NC = normal colon, NSI = normal small intestine, TC = tumor colon, TSI = tumor small intestine. Error bars = STDEV. c. Metformin concentrations in serum vs. tumor are plotted for mice with matching serum and tumor (SI or colon) tissue samples available (Ctr diet n = 7, -SG diet n = 6). Metformin concentrations were determined in all samples using a 6-point calibration curve and the appropriate biological matrix (tissue / serum). d. Serum from metformin-treated APCmin / + mice was analyzed for glucose and lactate levels using an Agilent 2100 Bioanalyser. e. Human colon cancer cells DLD1 and SW480 expressing truncated APC were grown without serine and glycine (no Ser, no Gly) or with low serine and glycine (10 μM) with varying concentrations of metformin for 3 days, after which cell numbers were counted. Data are the average of triplicate wells, error bars=STDEV. [Figure 24] Figure 1 shows S-plots of unbiased metabolomic analysis (OPLS-DA; orthogonal partial least squares discriminant analysis) for Eμ-myc tumor tissue (tumor-bearing spleen) (Ctr n=20, -SG n=13). Detected metabolites showing the largest decrease due to diet are serine and glycine. Decreased levels of carnitine- and choline-related metabolites were also observed. Increased levels of phosphatidylcholine (PC) metabolites and alanine and threonine were also seen. SG deficiency is known to affect glycolysis and OXPHOS (which may explain the changes in carnitine and alanine levels), as well as one-carbon metabolism (which may explain the changes in choline-related metabolites). [Diagram 25]Figure 1. Effect of -SG diet on Eu-myc tumor cells. a. Lymphoma cells were isolated from Eμ-myc mice and grown in culture. Cells were injected subcutaneously (5x10^5 / flank) into nude mice and allowed to form tumors. Once tumors (Ctr n=4, -SG n=4) were visible and measurable, mice were transitioned to control (Ctr) or serine- and glycine-free diet (-SG). Mice were sacrificed and tumors were excised at a single time-course endpoint (day 6 of dietary restriction). Mean tumor volume (shown as percentage of starting tumor volume, error bars=STDEV. b, To assess cell number per subcutaneous Eμ-myc tumor, two separate cell counts (using H&E stained cross sections) were performed per tumor and averaged, and the mean of the averages is shown. Error bars=SEM. P values ​​were calculated by T-test (unpaired, one-tailed). c, Total subcutaneous Eμ-myc tumor tissue sections (Ctr n=3, -SG n=4) were immunostained for cleaved caspase 3 (CC3) and BrdU. Image analysis of non-necrotic areas of all tumors allowed quantitative assessment of % cleaved caspase 3 positive cells per tumor and % BrdU positive cells per tumor. Data are means, error bars=STDEV. d. Transverse sections of Eμ-myc tumors (as described in a-c above) were stained with H&E. Scale bar for each image is 4 mm, illustrative necrotic areas are marked with arrows. Additional tumor tissue sections (marked with *) are included for comparison with tumors that developed after diet change (these three tumors were measurable 2 days after diet change and were present for 4 days of diet feeding prior to endpoint). e Necrosis was quantified by image analysis of necrotic and non-necrotic surface area on H&E stained sections shown in (d). Error bars = STDEV, P values ​​were calculated by T-test (unpaired, one-tailed, Ctr, N = 5; -SG, n = 6). f, 80-day-old APCmin / + mice were placed on a control diet (Ctr, n = 3) or a serine- and glycine-free diet (-SG, n = 3). At a single time-course endpoint (day 14 of the diet), mice were sacrificed and the small intestine was removed for histological analysis. Tissue sections were immunostained for cleaved caspase 3 and BrdU. Image analysis of the whole small intestine allowed quantitative assessment of cell number per adenoma, % CC3-positive cells per adenoma, and % BrdU-positive cells.Data are the mean of all adenomas identified in each small intestinal section, error bars = SEM, P values ​​were calculated by T-test (unpaired, one-tailed). For all analyses (af), P values ​​less than 0.1 are shown. [Figure 26] Figure 1 shows the expression of SSP enzymes in tumor tissues from PDAC and Eμ-myc models. Protein lysates of PDAC tumors and tumor-bearing spleens from Eμ-Myc mice fed a control or SG-free diet were analyzed for SSP enzyme expression by Western blot and quantified using a Li-Cor scanner. The relative expression (relative to control diet) of SSP enzymes is shown. Error bars = STDEV. Each tissue sample was taken from a different mouse and the number of mice / tumor is indicated above the bars. [Figure 27] FIG. 1 shows that a -SG diet led to decreased serine and glycine levels and reduced the GSH / GSSG ratio in Eu-myc tumors, but not glycine and the GSH / GSSG ratio in PDAC tumors. Pancreatic tumors from Pdx1cre;KRasG12D / +;p53+ / - mice and tumor-bearing spleens from Eμ-myc mice were analyzed for serine, glycine, GSH (reduced glutathione) and GSSG (oxidized glutathione) by LCMS. P values ​​calculated by T-test, unpaired, two-tailed. Error bars=STDEV. [Figure 28] Figure 2 shows that tumor organoids expressing Kras were more resistant to serine and glycine deprivation. VillincreER;APfl / fl and VillincreER;APfl / fl;KRasG12D / + intestinal tumor organoids (derived from n=3 mice per genotype) were grown without serine and glycine for 5 days, then lysed and seeded in complete growth medium. Organoid diameters were measured daily in complete (recovery) medium. Data are the average of organoids from 3 mice from a single experiment. Error bars=SEM. [Figure 29]Glycine- and serine-deficient diets reduce the growth of pre-formed xenograft tumors in vivo and reduce intratumoral serine and glycine levels, which translate to slower cancer cell growth in vitro. a. HCT116 cells were injected bilaterally (3x10^6 in each flank) and allowed to form tumors. Once tumors were visible and measurable by calipers, mice were transitioned to a control diet (Ctr) or a serine- and glycine-free diet (-SG). Tumors were measured three times a week and average weekly tumor volumes are plotted. Error bars = SEM. P values ​​calculated by T-test (unpaired, one-tailed), b. HCT116 tumors (harvested at clinical endpoint) were analyzed for absolute serine and glycine concentrations by LCMS (1-3 pieces of each tumor were analyzed). Data are means and bars are STDEV. P values ​​calculated by T-test (unpaired, one-tailed). c. HCT116 cells were grown in vitro (24-well plates) with serine and glycine intratumoral concentrations indicated in "b". Media was changed every 24 hours and cell counts were performed on the indicated days. Data are the mean of 12 replicate wells per condition from independent experiments, error bars = STDEV. d. HCT116 cells were grown in vitro (24-well plates, 12 replicate wells per condition) with serine and glycine intratumoral concentrations indicated in "b". Media was changed every 24 hours and cell counts were performed after 4 days. Data are the mean of 3 independent experiments, error bars = SEM. P values ​​were calculated by T-test (unpaired, one-tailed). [Diagram 30]Figure 1: Kras-expressing cells obtain serine and glycine by de novo serine and glycine synthesis rather than increased micropinocytosis. Macropinocytosis in iKRas cells was assessed using a TMR-labeled dextran uptake assay. Cells were first grown + / - doxycycline for 48 hours, then plated + / - doxycycline, + / - SG for 40 hours (last 16 hours without FBS) and then fed TMR dextran / FBS for 30 minutes in matching medium. Error bars and lines indicate mean and STDEV. [Diagram 31] Figure 31a. Daunorubicin complements serine and glycine deficiency. VillincreER;APfl / fl mice were grown for 2 days with + / -serine and glycine at the indicated concentrations, + / -daunorubicin. The relative change in organoid diameter (relative to '-drug') is plotted. Data are the mean of 3 independent experiments, error bars = SEM. b. VillincreER;APCfl / fl organoids were grown for 2 days with + / -serine and glycine, + / -daunorubicin, then fixed and stained for malondialdehyde (MDA). Data are the mean of 3 independent experiments, error bars = SEM. P values ​​calculated by T-test (unpaired, two-tailed, with correction for multiple comparisons). [Diagram 32] FIG. 1 is a simplified schematic showing de novo cysteine ​​and polyamine synthesis in humans, with metabolites shown in regular text and enzymes in boxes. [Diagram 33]Figure 1 shows that MTA efflux (an indicator of MTAP deficiency / inactivation) correlates with increased sensitivity to cysteine ​​depletion. a. Pancreatic cancer cell lines were grown in 24-well plates in formulated medium (based on RPMI medium) lacking cysteine ​​but containing all 19 other essential amino acids and non-essential amino acids. Cell numbers were counted using a CASY TT cell counter. After 3 days, methylthioadenosine (MTA) levels in the cell culture medium were measured by analyzing a sample of the medium by liquid chromatography-mass spectrometry. b. Colon cancer and breast cancer cell lines were grown in 24-well plates in formulated medium (based on RPMI) lacking cysteine ​​but containing all 19 other essential amino acids and non-essential amino acids for 3 days. Cell numbers were counted using a CASY TT cell counter. After 24 hours, methylthioadenosine (MTA) levels in the cell culture medium were measured by analyzing a sample of the medium by liquid chromatography-mass spectrometry. R2 = correlation coefficient calculated by MS Excel (Log trend line used). [Diagram 34] Figure 1 shows that the synthesis rates of MTA and spermidine in MDA-MB-231 cells are higher, and a large amount of methionine is diverted to the polyamine pathway in these cells. In contrast, in HCT116 and SW480 cells, less methionine is diverted to the polyamine pathway, and more methionine reaches homocysteine / cystathionine, which can be converted to cysteine. This helps explain the better survival rate of HCT116 and SW480 cells upon cysteine ​​starvation. SW480 and MDA-MB-231 (M231) cells were grown for 2 days in a formulated medium (based on RPMI, lacking carbon-12-methionine, supplemented with carbon-13 labeled methionine, and containing all other 19 essential and non-essential amino acids). Cell lysates were analyzed by liquid chromatography-mass spectrometry. The most abundant isotopic isomer is shown. MTA = methylthioadenosine, Met = methionine, Hc = homocysteine, SAM = S-adenosylmethionine. M+x = mass plus x units. [Diagram 35] FIG. 1 shows that HCT116 and SW480 cells are able to regenerate MTA to methionine, whereas MDA-MB-231 cells (which excrete MTA) are unable to do so. Metabolic tracing with carbon-13 labeled methionine shows that SW480 and HCT116 cells, unlike MDA-MB-231 cells, are able to regenerate (via MTA) the methionine used in the polyamine pathway, which we denote as "m+1" methionine. HCT116, SW480, and MDA-MB-231 (M231) cells were grown for 2 days in formulated medium (based on RPMI medium lacking carbon-12 methionine, supplemented with carbon-13 labeled methionine, containing all 19 other essential amino acids and non-essential amino acids). Cell lysates were analyzed by liquid chromatography-mass spectrometry. Major methionine isotopic isomers are shown. [Diagram 36] FIG. 1 shows that MDA-MB-231 (M231) cells excrete a greater amount of MTA compared to HCT116 and SW480 cells and continue to excrete MTA even upon cysteine ​​starvation. HCT116, SW480, and MDA-MB-231 (M231) cells were grown for 2 days in formulated medium (based on RPMI medium) lacking carbon-12 methionine, supplemented with carbon-13 labeled methionine, and containing all 19 other essential amino acids and nonessential amino acids, with or without cysteine. Metabolite extracts were prepared from medium samples (taken at specific time points) and analyzed by liquid chromatography-mass spectrometry. MTA=methylthioadenosine. M+x=mass plus x units cysteine. Data are not available for MDA-MB-231 cells at 48 hours upon cysteine ​​starvation, as no viable cells remained by that time point. [Figure 37]Figure 1: Knocking out MTAP gene expression leads to induction of MTA excretion. HCT116 cells were transfected with CRISPR / Cas9 and targeting sequences for MTAP (Seq1 and 2) or with a non-targeting control sequence (NTC). Several clones were isolated from each sequence and grown for 4 days in complete medium. Protein lysates were analyzed for MTAP expression by Western blot. Media samples were analyzed for MTA content by liquid-chromatography mass spectrometry. [Figure 38] Figure 1 shows that HCT116 excretes homocysteine ​​(the upstream precursor of cysteine) but can reuptake homocysteine ​​upon cysteine ​​starvation. HCT116 cells are still sensitive to cysteine ​​starvation, but not as sensitive as MDA-MB-231 (M231) cells. HCT116, SW480, and MDA-MB-231 (M231) cells were grown for 2 days in formulated medium (based on RPMI medium) lacking carbon-12 methionine, supplemented with carbon-13 labeled methionine, and containing all 19 other essential amino acids and nonessential amino acids, with or without cysteine. Metabolite extracts were prepared from medium samples (taken at specific time points) and analyzed by liquid chromatography-mass spectrometry. HC=homocysteine. M+x=mass plus x units cysteine. There are no data for MDA-MB-231 cells at 48 hours of cysteine ​​starvation, as no viable cells remained by that time point. [Figure 39]Figure 1 shows that cells can be rescued from cysteine ​​deficiency by homocysteine ​​supplementation. This demonstrates that de novo cysteine ​​synthesis is feasible when the enzymes CTH and CBS are expressed and active, and precursor supply is sufficient. This data supports the idea that precursor scarcity (rather than or in addition to incomplete / insufficient CTH and CBS enzyme expression) contributes to susceptibility to cysteine ​​deficiency. Colon and breast cancer cell lines were grown in 24-well plates. A basal medium (based on RPMI medium) was formulated that lacks cysteine ​​but contains all other 19 essential amino acids and non-essential amino acids. This basal medium was supplemented with the defined components: cysteine ​​0.4 mM (+Cys), homocysteine ​​0.2 mM and 0.8 mM (HC) and grown for 3 days. Data are averages of triplicate cells. Error bars = STDEV. [Diagram 40] Figure 1: Inhibition of AMD1, an enzyme that diverts methionine-derived SAM into the polyamine synthesis pathway, protects cells from acute sensitivity to cysteine ​​deprivation (i.e., cell death). MDA-MB-231 cells were first seeded in complete (DMEM) medium in 24-well plates. After 24 h, cells were treated with the AMD1 inhibitor saldomozide (20 μM) for 16 h or left untreated (Ctr). Cells were then washed with PBS and fed with medium lacking cysteine ​​but containing all other 19 amino acids. Images (a) were captured using a light microscope and cell counts (b) were performed using a CASY TT cell counter. Data are the average of triplicate wells. Error bars = STDEV. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0065] The inventors have surprisingly found that a diet substantially lacking at least two non-essential amino acids Without wishing to be bound by theory, it has been discovered that these compounds may be useful in the treatment of cancer or proliferative disorders. By essentially removing amino acids that are unwanted but necessary for the proliferation and growth of tumor cells. Remodeling the metabolism to provide a substantially deficient source of amino acids diverts resources. , which can reduce the amount of amino acids available for rapid proliferation, thereby contributing to the development of cancer. They slow or even inhibit cell proliferation or cause cancer cell death.

[0066] Suitably, the present invention relates to a method for supplementing the normal diet of a subject suffering from cancer with at least two non-essential amino acids. This may involve partial or complete replacement of a prescription diet that is substantially devoid of amino acids. The diet of the eel may be supplemented with the dietary products described herein or may be supplemented with the dietary products described herein simultaneously or successively. This could potentially be achieved by two or more dietary supplements that can be administered simultaneously. Such diets are essentially devoid of two or more non-essential amino acids, making them the most commonly used diets today. This can be further supplemented by using available ingredients and making appropriate food choices. do.

[0067] Dietary Products In a first aspect of the invention, a method for producing a glycerol-containing glycerol comprising the steps of: To provide a dietary product containing multiple amino acids that are qualitatively lacking.

[0068] "Essential amino acids" include methionine, leucine, phenylalanine, isoleucine, Valine, lysine, threonine, histidine, and tryptophan are meant.

[0069] "Dietary product" means a dietary supplement that contains one or more essential amino acids or their salts or elastases. 2. A composition comprising the compound for use in or in combination with food. The supplement is then consumed to provide a subject consuming the supplement with a desired level of an amino acid or salt thereof or refers to compositions that provide esters. Nutritional ingredients in these products include: vitamins, Minerals, herbs or other botanicals, amino acids, as well as enzymes, organ tissues, glands, and In some embodiments, the dietary product may include substances such as omega-3 fatty acids and metabolites. It is the sole source of exogenous amino acids consumed by the subject as part of the diet. In this embodiment, the dietary product can substantially or simply replace the diet of a subject. That is, in some embodiments, the dietary product may be intended to be completely It can be used as a replacement meal.

[0070] Advantageously, the consumption of normal sources of amino acids, such as proteins, can be reduced by the dietary supplements of the present invention. Substituting this product would result in a diet that is essentially deficient in at least two non-essential amino acids. This may provide therapeutic benefit to cancer subjects.

[0071] As used herein, in accordance with all aspects of the present invention, the term "subject" preferably refers to a human, Livestock or livestock, domestic animals or pets, as well as non-human primates, dogs, and mice This refers to mammals, including animals commonly used for clinical research, including the mammals of the present invention. The subject may be a human.

[0072] Suitably the dietary product may contain at least 9 amino acids. The dietary product comprises at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18 amino acids Suitably the dietary product may comprise, for example, 9 to 18 amino acids, or 12-18 amino acids, or 12-17 amino acids, or 13-17 amino acids It may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,

[0073] Suitably, the at least two substantially absent amino acids include the following amino acids: glycine Contains two or more of the following amino acids: tyrosine, serine, cysteine, tyrosine, proline, and arginine. or This dietary product contains the following amino acids: Glycine, Serine, Cysteine, Tyrosine , proline, arginine, alanine, aspartic acid, glutamic acid, glutamine, and and asparagine, at least three, or at least four, or at least five, or or at least 6, or at least 7. Suitably the dietary product can lack seven amino acids, in which case the dietary product contains serine and glycine. and the following amino acids: cysteine, tyrosine, proline, arginine, alanine, aspartate It lacks five of the amino acids arginine, glutamic acid, glutamine, and asparagine. The dietary product is substantially devoid of cysteine ​​or contains limited levels of cysteine. may include.

[0074] In this context, "consisting essentially of" means that the dietary product is a dietary supplement of the present invention. This means that we cannot lack any amino acids that have a significant impact on our dietary products. A "significant effect" is defined as: a) a significant effect on cancer specificity as opposed to healthy cells; b) a significant effect on the inhibition of cell proliferation; c) a significant effect on the toxicity of cancer cells; or d) significant treatment that can be measured as any combination of a)-c). In some embodiments, this refers to a dietary product having a particular amino acid. to dietary products that do not have a particular amino acid, and the lack of the amino acid has a significant effect. The amount of the protein can be measured by determining whether or not the protein has a specific function.

[0075] 1. Method to measure the effect of amino acid deprivation on cell growth in vitro: Cells were plated in duplicate in complete medium in 24-well cell culture plates at 1x10 per well. The cells were seeded at a density of 4-1x10^5 and allowed to adhere overnight. After overnight, the adherent cells were 5-20% confluent. The cells were washed once with PBS and incubated with a control solution containing all amino acids. The medium is specifically formulated to contain or lack a particular amino acid / amino acids. The medium was replaced with fresh matching medium every 24 hours. After the first medium change, the cells are cultured at multiple time points (e.g., day 1, day 2, day 3, day 4, day On days 1 and 5), plates are used for cell counting. Three wells (i.e., triplicates) should be used and the average calculated. Alternatively, cells can be fixed, stained with DAPI, and analyzed using a TT cell counter. Counting was performed using a tta scanner. The cell numbers at different time points are compared. Significant effects due to changes in the amino acid composition of the medium A change in cell number is considered to be greater than 5% compared to the control culture. Statistically significant (P<0.01) when comparing at least three independent experiments using an appropriate T-test. 0.05 corresponds to a significant effect).

[0076] 2. Cancer cell proliferation / in vivo using mouse xenograft / allograft / orthotopic models Methods for determining the effect of dietary amino acid composition on tumor growth and survival in ivo Select appropriate cancer cell lines that form tumors when implanted subcutaneously in the flank of nude mice (e.g., HCT116), and an appropriate number of cells to form a tumor (e.g., 3x1 0^6) was injected subcutaneously into the flank of the mice. Mice injected into both flanks or a single flank At least 10 mice should be used per group. The diet was specifically formulated to lack a specific amino acid or amino acids from the normal solid diet. A control group should be fed a diet containing all amino acids. Tumor length and width were measured at least twice weekly until death. Calculate the tumor volume using the method described above. Reach a predefined maximum tumor volume (as permitted by local ethics). Mice should be allowed to survive to the clinical endpoint and then culled. The mean tumor volumes at each measurement time point should be compared before the first mice are killed / culled. Significant effects on tumor volume will be assessed by appropriate T-tests. P<0.05 indicates significance. Significant changes in survival were assessed using the Mantel-Cox (log-rank) statistic. The results are calculated using the ANOVA test, where P<0.05 corresponds to a significant effect.

[0077] Alternatively, mice can be injected with transplanted cells, followed by feeding on normal chow, once measurable tumors have developed. These assays can be performed even if experimental diets are only assigned once tumors are detected. In this case, the tumor volume can be either the absolute volume or the fraction of the starting tumor volume at the time of diet change. Comparisons can be made as percentages.

[0078] Alternatively, allograft or orthotopic models can be used in the same manner as above. It is possible.

[0079] 3. Using genetically engineered mouse models (GEMMs) to study cancer cell proliferation / in vivo US201002233633A1 - Method for determining the effect of dietary amino acid composition on tumor growth and survival in mice - Google Patents An appropriate GEMM should be selected (e.g., APC min / +または Eμ-myc Mice should be fed normal chow until diet change. early stage (as soon as carcinogenesis is initiated), but not based on clinical endpoints The time should be before the occurrence of death related to the tumor (tumor-related survival). For example, APC min / + Mau The ages of mice of a particular age are 80 days for Eμ-myc mice and 60 days for Eμ-myc mice. In a study in which the solid diet was specifically formulated to lack a specific amino acid / amino acids A control group fed a diet containing all amino acids should also be included. If possible, tumor growth should be measured (e.g., by tumor measurement or, e.g., by tumor (by biomarker analysis such as fluorescent signals from fluorescent protein markers in the The patients should reach a clinical endpoint (tumor-related survival). Tumor burden should also be assessed (e.g., by counting / weighing / measuring tumors). The mean tumor volume at each measurement point before death / culling should be compared. Significant effects will be assessed by appropriate T-tests, with P<0.05 corresponding to a significant effect. Significant changes in survival were identified using the Mantel-Cox (log-rank) statistical test. Calculation was performed. P<0.05 corresponds to a significant effect. For the endpoint tumor burden, Significant effects on dose were assessed by appropriate T-tests. P<0.05 represented a significant effect. do.

[0080] Alternatively, the diet can be changed at an early age, e.g., 10 days / 20 days / 40 days. The same results as described in (3) above are measured and compared.

[0081] Suitably, the dietary product may be substantially devoid of serine. Cancer cells contain large amounts of They can immediately utilize exogenous serine to support rapid proliferation. In this case, cancer cells are forced to divert glycolytic intermediates through the serine synthesis pathway. Advantageously, this may result in reduced proliferation and / or decreased cell viability.

[0082] Suitably the dietary product may be substantially devoid of glycine, as serine is It is used in the synthesis of glycine, which reduces blood levels of both glycine and serine. Advantageously, the present invention provides a method for the treatment of malaria, comprising the steps of: It was shown that this can be effective.

[0083] Suitably, the dietary product may be substantially devoid of cysteine. Notably, many cancer cell lines (e.g., lung, colon, and breast) express exogenous cysteines. Surprisingly, a diet that was virtually devoid of cysteine ​​caused cells to consume it voraciously. It inhibits proliferation and can induce cancer cell death, as shown, for example, in colon cell lines. Suitably, the diet is substantially devoid of cysteine ​​or has limited cysteine ​​levels. The tally product may be particularly effective for subjects in whom MTAP expression is downregulated. .

[0084] Suitably, the dietary product may be substantially devoid of tyrosine. Notably, tyrosine restriction, alone or in combination with other non-essential amino acids, has been shown to be associated with increased risk of cancer. It has been discovered that it can reduce cell proliferation.

[0085] Suitably the dietary product substantially comprises: a. Glycine, serine, and cysteine; b. glycine, serine, and arginine; c. glycine, serine, and tyrosine; d. glycine, serine, arginine, and cysteine; e. glycine, serine, tyrosine, and cysteine; f. cysteine ​​and arginine; g. Cysteine ​​and tyrosine; h. cysteine ​​and glycine; i. cysteine, tyrosine, and arginine; or j. Lacking glycine, serine, arginine, tyrosine, and cysteine.

[0086] Advantageously, the present invention surprisingly demonstrates that such a combination inhibits cell proliferation. and / or have been shown to be particularly effective at inducing cancer cell death.

[0087] In one embodiment, the dietary product is essentially composed of glycine, serine, and cysteine. The present invention relates to a method for treating colorectal cancer, for example, in which the CT116 and RKO, etc.), liver cancer (HepG2), osteosarcoma (U2OS), and breast cancer (MDA MB231), The results showed that the compound was effective in suppressing and increasing cancer cell death.

[0088] In one embodiment, the dietary product is essentially composed of glycine, serine, and arginine. The present invention relates to a method for the preparation of a colon cell line (e.g., RKO and and HCT116), inhibiting cancer cell proliferation and / or increasing cancer cell death It was shown to be effective.

[0089] In one embodiment, the dietary product is essentially composed of glycine, serine, and tyrosine. The present invention relates to a method for the production and / or storage of a medicament for the treatment of colon cell lines, such as colon cancer cells. and HCT116), inhibiting cancer cell proliferation and / or increasing cancer cell death. It was shown to be effective.

[0090] In one embodiment, the dietary product consists essentially of glycine, serine, arginine, and Surprisingly, this combination induced cell death in colon cell lines. It has been shown to be particularly effective in inducing

[0091] In one embodiment, the dietary composition comprises essentially the following: glycine, serine, arginine, thiamine It may lack leucine and cysteine.

[0092] Suitably in all embodiments the dietary product comprises methionine, glutamine and Advantageously, the leucine and Glutamine.

[0093] The dietary product further contains less than 25 mg / kg of subject's body weight / day or less than 20 mg / kg of subject's body weight / day. At levels of less than 18 mg / kg / day or less than 16 mg / kg / day It may contain methionine.

[0094] The dietary products of the present invention, unless otherwise specified herein, contain an average daily total protein Formulated to provide at least the recommended daily intake of essential amino acids based on consumption This can be done.

[0095] The Institute of Medicine's recommended daily intakes of essential amino acids are based on average daily total protein consumption. Based on this, histidine is 18 mg / g protein consumption; isoleucine is 25 mg / g protein consumption. ;Leucine 55mg / g protein, Lysine 51mg / g protein, Methionine and Cysteine 25 mg / g protein combined tein; 25 mg / g protein combined phenylalanine and tyrosine 47mg / g protein, 27mg / g threonine, 7mg / g tryptophan 32 mg / g protein, and valine 32 mg / g protein. In the dietary product of the present invention, tyrosine and Provides certain levels of phenylalanine and methionine when the host is deficient in phenylalanine and / or cysteine Dietary products are formulated to provide a small amount of protein based on average daily protein consumption. Methionine in an amount of at least 25 mg / g protein and at least 47 mg / g protein The dosage may be adjusted to provide a dosage of 100 g of phenylalanine.

[0096] Specifically, cysteine-restricted dietary products are recommended for those who consume less than 100 mg of protein per day. Provides smaller amounts formulated to provide less than the recommended daily intake of cysteine ​​based on For example, cysteine-restricted dietary products contain 20 mg / protein. Provides less than 15mg protein / g protein or less than 10mg protein / g protein It can be something that.

[0097] Suitably the dietary product comprises: Can be formulated to limit acid levels, e.g., combinations of non-essential amino acids Daily values ​​are expressed as the recommended daily intake of total non-essential amino acids per gram of protein consumed. Compared to at least one, or at least two, or at least three, or at least four or at least five, or at least six, or at least seven non-essential amino acids. It can be equated to a qualitatively deficient diet.

[0098] The Institute of Medicine recommends that protein, for example, be consumed in amounts of 0.1 mg per kilogram of body weight per day for adults. This dietary product is recommended to be consumed at a rate of 0.8 grams per day. The recommended consumption is formulated to provide at least 0.8 grams of protein per kg of body weight. It can be combined.

[0099] Suitably, the dietary products of the present invention are formulated to provide the above recommended levels. For example, one or more amino acids may be added to a diet based on average total daily protein consumption. Based on the above, the government will provide at least two, three, four, five, or six times the average daily intake. can be incorporated into the dietary product.

[0100] Suitably the amino acids present in the dietary products of the present invention may be in the free form, prodrug form or The amino acid may be in the form of an N-terminal amino acid, a salt, or an amino acid ester. Amino acids with terminal or C-terminal modifications, as well as homopolymeric and homodimeric forms , heteropolymeric and heterodimeric forms are also contemplated.

[0101] Suitably, the dietary product may be formulated to be administered 1 to 8 times daily. Preferably, the dietary product is administered 1 to 4 times a day. Accordingly, the dietary product may be provided in a suitable unit dosage form. It can be blended into.

[0102] The dietary products of the present invention may further comprise one or more macronutrients and / or micronutrients. It may contain micronutrients.

[0103] For macronutrient guidance and suggested daily recommendations, see the Dietary Reference Intakes for Energy, Carbohydrate, Fiber, Fat, Fatty Acids, cholesterol, protein and amino acids released by the Institute of Medicine in September 2002. This can be done.

[0104] A non-exhaustive list of macronutrients that can be added to dietary products includes: Hydrates, fiber, and lipids (e.g., n-6 polyunsaturated fatty acids, n-3 polyunsaturated fatty acids) , saturated fatty acids, trans fatty acids, and cholesterol).

[0105] A non-comprehensive list of micronutrients includes vitamin A, vitamin C, vitamin D, and vitamin E. , Vitamin K, Thiamin, Riboflavin, Niacin, Vitamin B6, Folic Acid, Vitamin B 12. Pantothenic acid, biotin, choline, calcium, chromium, copper, fluoride, iodine Iron, magnesium, molybdenum, phosphorus, selenium, zinc, potassium, sodium, and chloride. Suitably, the dietary product is Intakes: RDA and AI for Vitamins and Elements", NAS. IOM. Food and Nutrition Bo As detailed in the ARD, these should be provided in acceptable or recommended daily intakes. It can be blended into.

[0106] The diet contains an imbalanced amino acid composition that is generally deficient in two or more non-essential amino acids; Optionally, an excess of one or more other amino acids is supplemented. For example, substantially Deficiency of a particular amino acid occurs when the amino acid is at least 10, 15, or 2 times less abundant than the average abundance of the other amino acid. 1 / 20, 1 / 30, 1 / 45, 1 / 50, 1 / 100, or 1 / 1000 1. Foods that are low in protein but rich in other nutrients, such as fruits, Vegetables, and certain nuts, are recommended by nutritionists to ensure that the amino acid intake ratio of the diet is not exceeded. This diet can be consumed alone or in combination with other foods, ensuring that the proportions are maintained. is intended to be consumed in combination with anti-cancer medications.

[0107] In some embodiments, the dietary products of the present invention may be combined to form the dietary The product is a combination of two or more dietary supplements. These dietary supplements include: The combined average diet provided by the dietary supplement provides the dietary product of the present invention. The two compounds may be administered simultaneously or sequentially to the subject, such that they are incorporated into the subject's diet. It may be advantageous to add diversity to the

[0108] Dietary products are available in the form of powders, gels, solutions, suspensions, pastes, solids, liquids, concentrates and reconstituted forms. Available in reconstituted powders, shakes, concentrates, pills, bars, tablets, capsules or ready to use Dietary products can also be provided in the form of dietary supplements. However, tablets, pills, capsules, liquids, aerosols, injectables, or other medicinal When in the form of an acceptable formulation, it is considered possible to make it into a pharmaceutical composition. Preferably, the dietary product may be a beverage. Suitably, the beverage may be consumed in amounts of up to 100g per day. It can be administered 2 to 6 times.

[0109] Suitably the dietary product cannot be a naturally occurring food.

[0110] Suitably, the dietary product may contain additional compounds for certain amino acids. Preferably, such additional compounds would facilitate de novo synthesis of the substantially missing amino acid. I can't help it.

[0111] As used herein, "substantially devoid" in relation to an amino acid means that the amino acid is completely absent. "Contains no or very little (e.g., trace amounts)."

[0112] Optionally, administration will be by the intravenous route. Optionally, parenteral administration will be rapid. It may be provided by administration or by injection.

[0113] Suitably the dietary product comprises: a) Tube-fed enteral nutrition products (e.g., nasogastric, which may be administered via an NG tube) Nutritional products; nasojejunal nutritional products that can be administered via NJ tube; or PEG (peg) )tube feeding products, etc.); b) (by central arterial administration, e.g., via a dedicated lumen of a venous catheter) (i) parenteral nutrition products; c) It may be an IV infusion product.

[0114] Suitably, administration may be by tube-fed enteral nutrition.

[0115] In one embodiment, the diet or dietary product of the present invention is administered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, at least 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks for 12, 24, 25, or 26 weeks, or until a therapeutic endpoint is observed, e.g. For example, the administration is for a period of time until tumor shrinkage is observed.

[0116] The present invention further relates to a method for producing the damul of the present invention, comprising dissolving or dispersing an amino acid in water and spray-drying the same. To provide a process for preparation of an yetiary product.

[0117] Suitably the amino acids may be mixed with additional ingredients such as macronutrients and micronutrients. Binders, emulsifiers, or other ingredients suitable for human or animal consumption may be added as desired. It is possible to do so.

[0118] Pharmaceutical Compositions In another aspect, the present invention relates to a dietary product of the present invention or a composition produced according to the present invention. A pharmaceutical composition comprising a dietary product and a pharma- ceutically acceptable carrier, excipient, or diluent. The composition is provided.

[0119] Conventional procedures for the selection and preparation of suitable pharmaceutical formulations are described, for example, in "Pharmaceuticals - The Science of Dosage Form Designs", ME Aulton, Churchill Livingstone, 1988 It is described in.

[0120] The compositions of the present invention may be administered in the form of tablets, lozenges, hard capsules, soft capsules, water, or the like. In the form of aqueous or oily suspensions, emulsions, dispersible powders or granules, syrups, or elixirs, It may be in a form suitable for oral use (as a xylose).

[0121] The compositions of the invention can be formulated according to conventional procedures using conventional pharmaceutical excipients that are well known in the art. Thus, compositions intended for oral use can be obtained by, for example, may contain multiple coloring agents, sweeteners, flavoring agents, and / or preservatives.

[0122] Suitably the pharmaceutical composition is adapted to provide a therapeutically effective amount of the dietary product of the invention. It is mixed with seaweed.

[0123] An effective amount for use in treating a disease is an amount sufficient to symptomatically alleviate the symptoms of a disease in warm-blooded animals, particularly humans. The dose is sufficient to alleviate or slow the progression of the disease.

[0124] The term "therapeutically effective amount" refers to an amount that, when administered, is sufficient to treat the illness, disorder, or disease being treated. A compound or compound sufficient to prevent or attenuate to some extent the onset of one or more symptoms The term "therapeutically effective amount" also encompasses the amount of a therapeutically effective amount of a compound or composition. Cell, tissue, organ, system, animal or human biological or Also encompasses the amount of a compound or composition sufficient to elicit a medical response. An appropriate "effective" amount in any case will be determined by one of ordinary skill in the art using routine experimentation. The specific dosage levels and frequency of administration for any particular patient may vary. It is possible to determine the activity, bioavailability, metabolic stability, and other properties of the specific compound utilized. The compound's rate of excretion and duration of action; the method and time of administration of the compound; the patient's age, physical condition, Various factors, including the weight, health, sex and diet of the animal; as well as the severity of the particular disease being treated. It will be understood that this will depend on the child.

[0125] The terms "treat," "treating," and "treatment" refer to a condition, disorder, or disease. or alleviates one or more symptoms associated with that disease, disorder, or condition. or inhibiting the disease, disorder, or illness itself, and In some embodiments, the terms "treat," "treating," and "eradicate" are used interchangeably. and "treatment" means the treatment of a disease, disorder, or illness, or symptoms associated therewith, or the cause thereof. administering to a subject a compound, pharmaceutical composition, or medicament for the purpose of mitigating, inhibiting, or preventing the cause of the disease This refers to administering a targeted dosage form.

[0126] Suitably, the pharmaceutical composition of the present invention further comprises a compound selected from the group consisting of a cancer cell proliferation inhibitor, a radiotherapeutic agent, a chemotherapeutic agent, and a medicament for treating cancer. Therapeutic agents, inhibitors of amino acid metabolism / turnover / interconversion, inhibitors of non-essential amino acid biosynthesis an agent, an amino acid transport inhibitor, an enzyme or drug that promotes amino acid decomposition, or an amino acid The therapeutic agent may include a therapeutic agent selected from substances that inhibit OXPHOS and and / or may increase reactive oxygen species and / or decrease antioxidant defenses.

[0127] Cancer and Proliferative Disorders In one aspect, the present invention relates to a compound of the present invention or a process of the present invention for use in medicine. There is thus provided a resulting dietary product or pharmaceutical composition according to the invention.

[0128] For example, the present invention relates to a method for treating cancer, comprising administering to a subject a compound of the present invention or a process of the present invention thereto. or a pharmaceutical composition according to the invention.

[0129] In another aspect, the present invention relates to a method for the manufacture of a medicament for use in the treatment of cancer, comprising administering to said patient a compound of the present invention or or a dietary product produced according to the invention or a pharmaceutical composition according to the invention. This provides:

[0130] In a further aspect, the present invention provides a method for administering a therapeutically effective amount of a dietary product to a subject. The present invention provides a method for treating cancer in a subject, comprising the step of:

[0131] In all aspects, exemplary cancers include, but are not limited to, adrenal cortical carcinoma, AIDS AIDS-related cancer, AIDS-related lymphoma, anal cancer, anorectal cancer, anal canal cancer, appendix cancer, small intestine cancer Childhood cerebellar astrocytoma, childhood cerebral astrocytoma, basal cell carcinoma, skin cancer (non-melanoma), biliary tract cancer, Extrahepatic bile duct cancer, Intrahepatic bile duct cancer, Bladder cancer, Bladder cancer, Bone and joint cancer, Osteosarcoma and malignant Fibrous histiocytoma, brain cancer, brain tumor, brain stem glioma, cerebellar astrocytoma, cerebral astrocytoma / malignant Gliomas, gliomas, medulloblastomas, supratentorial primitive neuroectodermal tumors, visual pathways and hypothalamic Glioma of the cervix, breast cancer, bronchial adenoma / carcinoid, carcinoid tumor, digestive system, nervous system cancer, nervous system lymphoma, central nervous system cancer, central nervous system lymphoma, cervical cancer, childhood cancer , chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorder, colon cancer, colorectal cancer, Cutaneous T-cell lymphoma, lymphoid neoplasms, mycosis fungoides, Sézary syndrome, endometrial cancer, Esophageal cancer, extracranial germ cell tumors, extragonadal germ cell tumors, extrahepatic bile duct cancer, eye cancer, intraocular melanoma , retinoblastoma, gallbladder cancer, gastric cancer, digestive system carcinoid tumors, gastrointestinal stromal tumors ( GIST), Germ Cell Tumors, Ovarian Germ Cell Tumors, Gestational Trophoblastic Tumors, Head and Neck Cancer, hepatocellular (liver) cancer, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, eye cancer, Islet cell tumor (endocrine pancreas), Kaposi's sarcoma, renal cell carcinoma, renal cell cancer, laryngeal cancer, acute Lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, hairy cell leukemia, lip and oral cavity cancer, liver cancer, lung cancer, non-small cell lung cancer, small cell lung cancer, AI DS-related lymphoma, non-Hodgkin's lymphoma, primary central nervous system lymphoma, Waldenström melanoma; intraocular (eye) melanoma; Merkel cell carcinoma; mesothelioma, mesothelioma, metastatic squamous cell carcinoma of the neck, oral cancer, tongue cancer, multiple endocrine gland cancer, fungal Mycosis fungoides, myelodysplastic syndromes, myelodysplastic / myeloproliferative disorders, chronic myeloid leukemia, acute bone marrow disease Myeloid leukemia, multiple myeloma, chronic myelogenous disorder, nasopharyngeal carcinoma, neuroblastoma, oral Cancer, oral cancer, oropharyngeal cancer, ovarian cancer, ovarian epithelial cancer, ovarian low malignant tumor, pancreatic cancer, Islet cell pancreatic cancer, paranasal sinus and nasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, brown cell tumors, pineoblastomas and supratentorial primitive neuroectodermal tumors, pituitary tumors, plasma cell neoplasms / multiple myeloma, pleuropulmonary blastoma, prostate cancer, rectal cancer, renal pelvis and ureter, transitional cell carcinoma, retina Blastocytoma, rhabdomyosarcoma, salivary gland cancer, Ewing sarcoma family tumors, Kaposi sarcoma, soft tissue Tissue tumor, uterine cancer, uterine sarcoma, skin cancer (non-melanoma), skin cancer (melanoma), Merkel cell follicular skin cancer, small intestine cancer, soft tissue tumors, squamous cell carcinoma, gastric cancer, supratentorial primitive neuroectoderm Lobar tumors, testicular cancer, laryngeal cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, renal pelvis and Transitional cell carcinoma of the ureter and other urinary tract, gestational trophoblastic neoplasia, urethral cancer, intrauterine cancer These include uterine cancer, uterine sarcoma, uterine cancer, vaginal cancer, vulvar cancer, and Wilms tumor. In some embodiments, the cancer is selected from the group consisting of colorectal cancer, liver cancer, osteosarcoma, lymphoma, and The cancer is selected from the group consisting of breast cancer and lymphoma.

[0132] The cancer may be positive for wild-type KRAS.

[0133] Cancer can have deregulated cMyc expression.

[0134] The cancer may be a tumor in which expression of MTAP is deregulated. The tumor may be a solid tumor or a blood tumor. It may be a liquid malignancy.

[0135] Exemplary solid tumors include, but are not limited to, malignant mesothelioma, lung cancer, non-small cell lung cancer, and ovarian cancer. Lung cancer (NSCLC), adenocarcinoma, squamous cell carcinoma, glioma, pancreatic tumor, pancreatic cancer, ampullary cancer, biliary tract cancer, bile duct cancer, soft tissue sarcoma, esophageal cancer, endometrial cancer, chondrosarcoma, osteosarcoma, gastrosarcoma Tumors and chordoma, primary malignant melanoma, metastatic melanoma, and primary breast cancer Some examples include:

[0136] Exemplary hematological malignancies include, but are not limited to, diffuse large cell lymphoma. lymphoma, low-grade lymphoma, B-lineage acute lymphoblastic leukemia, mantle cell lymphoma, T-cell acute Leukemia, adult T-cell leukemia, and T-cell derived lymphoma. Lymphoma is optional. These may eventually lead to cancer.

[0137] Suitably, the dietary product of the present invention is adapted to inhibit abnormal or otherwise unwanted cell proliferation. The present invention may be useful in treating diseases or disorders in which proliferation can cause debilitating disorders.

[0138] The dietary product may be substantially devoid of cysteine. Suitably, the dietary product is substantially devoid of cysteine. A diet that is deficient in cysteine ​​leads to increased risk of lung, colon, and breast cancer. Suitably, a diet substantially devoid of cysteine ​​may be useful in cancers in which MT It may be useful in cancers where AP expression is downregulated.

[0139] The dietary product may be substantially devoid of serine and / or glycine. reported that diets substantially lacking serine and / or glycine reduce lung, colon and breast cancer , lymphoma, colon cancer, liver cancer, osteosarcoma, and breast cancer. or cancers that voraciously consume glycine.

[0140] The dietary product may be substantially devoid of arginine and / or tyrosine. Indeed, a diet substantially devoid of arginine may be beneficial in cancers such as colon cancer. .

[0141] Combination therapy The dietary product or pharmaceutical composition of the present invention may be used alone to provide a therapeutic effect. Suitably, the dietary product or pharmaceutical composition of the invention may also comprise one or more It may also be used in combination with multiple additional chemotherapy agents and / or radiation therapy. Cut.

[0142] Such chemotherapy may include one or more of the following categories of anti-cancer drugs: (i) Antiproliferative / Antineoplastic Agents, such as alkylating agents, and combinations thereof (e.g., cyclosporine, platin, oxaliplatin, carboplatin, cyclophosphamide, nitrogen mass Tard, uracil mustard, bendamustine, melphalan, chlorambucil, chlor Methine, busulfan, temozolomide, nitrosoureas, ifosfamide, melphalan , pipobroman, triethylenemelamine, triethylenethiophosphoramide, carmusti antimetabolites (e.g., gemcitabine, lomustine, streptozocin, and dacarbazine); Tabine and antifolates, e.g., fluoropyrimidines such as 5-fluorouracil and tegafur Myzine, raltitrexed, methotrexate, pemetrexed, cytosine arabinoside , floxuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fluoxetine phosphate darabine, pentostatin, gemcitabine, and hydroxyurea); antibiotics (e.g., anthracyclines such as adriamycin, bleomycin, doxorubicin, Rubicin, Daunomycin (registered trademark), Epirubicin, Idarubicin, Mitomycin C, dactinomycin, and mithramycin); antimitotic agents (e.g., vincristine, Vinca alkaloids such as vintine, vinblastine, vindesine, and vinorelbine; taxoid and polo kinase inhibitors such as Taxol and Taxotere; proteasome inhibitors; inhibitors, such as carfilzomib and bortezomib; interferon therapy; and and topoisomerase inhibitors (e.g., epipodophyllotoxins such as etoposide and teniposide). Cin, amsacrine, topotecan, irinotecan, mitoxantrone, and campto bleomycin, dactinomycin, daunorubicin, doxorubicin, epinephrine Rubicin, Idarubicin, ara-C, Paclitaxel (Taxol™), nab Paclitaxel, docetaxel, mithramycin, deoxycoformycin, mycobacterium tomycin C, L-asparaginase, interferon (especially IFN-α), etoposide decitabine, teniposide, DNA demethylating agents (e.g., azacytidine or decitabine); and histone deacetylase (HDAC) inhibitors (e.g., vorinostat, MS-2 75, Panobinostat, Romidepsin, Valproic acid, Mocetinostat (MGCD01 03) and pracinostat SB939); (ii) Cytostatic agents such as antiestrogens (e.g., tamoxifen, fulvest) ranto, toremifene, raloxifene, droloxifene and iodoxyfene), Antiandrogens (e.g., bicalutamide, flutamide, nilutamide, and cysteine ​​acetate) rotetrone), LHRH antagonists or LHRH agonists (e.g., goserelin, leuprorelin, progesterone (e.g., megestrol acetate), aromatase Zeta inhibitors (e.g., anastrozole, letrozole, borazole, and exemestane) as 5*-reductase inhibitors, such as finasteride; and navelbecamide. , CPT-II, anastrozole, letrozole, capecitabine, reloxafam, Cyclophosphamide, ifosfamide, and droloxafine; (iii) anti-invasive agents, such as dasatinib and bosutinib (SKI-606), and , Metalloprotease inhibitors, urokinase-type plasminogen activator receptor function inhibitors of, or heparanase antibodies; (iv) Growth factor function inhibitors: For example, such inhibitors include growth factor antibodies and Growth factor receptor antibodies, such as the anti-erbB2 antibody trastuzumab (Herceptin ( panitumumab, an anti-EGFR antibody; cetuximab, an anti-erbB1 antibody; and phosphoinositide kinase inhibitors, such as epidermal growth factor family inhibitors (e.g., gefitinib , Erlotinib, 6-acrylamido-N-(3-chloro-4-fluorophenyl)-7 -(3-Morpholinopropoxy)-quinazolin-4-amine (CI1033), Afaty EGFR family chemotherapy agents such as nivolumab, vandetanib, osimertinib, and rociletinib tyrosine kinase inhibitors such as lapatinib), erbB2 tyrosine kinase inhibitors, and and antibodies against costimulatory molecules such as CTLA-4, 4-IBB and PD-1, or Antibodies against cytokines (IL-10, TGF-β); hepatocyte growth factor family inhibitors ;Insulin growth factor family inhibitor;Protein regulator of cellular apoptosis Modulators (e.g., Bcl-2 inhibitors); imatinib and / or nilotinib ( Platelet-derived growth factor family inhibitors such as AMN107; serine / threonine kinase inhibitors Ras / Raf signaling inhibitors, such as farnesyl transferase inhibitors agents, sorafenib, tipifarnib and lonafarnib), MEK and / or AK Inhibitors of cell signaling mediated by T kinase, c-kit inhibitors, abl kinase inhibitors , PI3 kinase inhibitor, Plt3 kinase inhibitor, CSF-1R kinase inhibitor, IG F receptor, kinase inhibitors; Aurora kinase inhibitors, and CDK2 and / or Cyclin-dependent kinase inhibitors, such as CDK4 inhibitors; CCR2, CCR4 or CC R6 antagonists; and WO 2006043090 and WO 200907 7766, 2011092469, or 2015075483. RAF kinase inhibitors such as (v) Angiogenesis inhibitors such as agents that inhibit the function of vascular endothelial growth factor [e.g., anti-vascular epidermal growth factor antibody bevacizumab (Avastin®); thalidomide; lenalidomide and, for example, VEGF receptor tyrosine kinase inhibitors, such as bandetanidine. , vatalanib, sunitinib, axitinib, and pazopanib; (vi) Abnormal genes, such as abnormal p53 or abnormal BRCA1 or BRCA2 gene therapy, including replacement approaches; (vii) For example, alemtuzumab, rituximab, ibritumomab tiuxetan (Zev Immunotherapies, including antibody therapies such as IFN-α (Farin®) and ofatumumab; Interferons such as interferon α, interleukins such as IL-2 (aldesleukin) interleukin inhibitors, e.g. IRAK4 inhibitors; HPV vaccines, e.g. Dasil, Cervarix, Oncophage and Sipuleucel-T (Provenge® Cancer vaccines, including prophylactic and therapeutic vaccines such as ;gp100; dendritic cell-based vaccines; vaccines (e.g., Ad.p53DC, etc.); toll-like receptor modulators, For example, TLR-7 or TLR-9 agonists; PD-1, PD-L1, PD-L2 and and CTL4-A modulators (e.g., nivolumab), antibodies, and vaccines; other I DO inhibitors (e.g., indoximod, etc.); anti-PD-1 monoclonal antibodies (e.g., MK-3475 and nivolumab); anti-PDL1 monoclonal antibodies (e.g., ME DI-4736 and RG-7446); anti-PDL2 monoclonal antibodies; and Anti-CTLA-4 antibodies (e.g., ipilimumab); and (viii) Cytotoxic agents, such as fludarabine (Fludara), cladribine, pentose Statins (Nipent™); (ix) targeted therapy, e.g., PI3K inhibitors, e.g., idelalisib and perifosine; Also known as inhibitor of apoptosis (IAP) antagonists (IAP antagonists) These drugs are SMAC (second mitochondrial caspase activator) analogues. It inhibits IAPs, such as XIAP, cIAP1, and cIAP2, to protect cells. Specific SMAC analogs include Biri napant (TLR32711, TetraLogic Pharmaceuticals), LCL161 (Nova rtis), AEG40730 (Aegera Therapeutics), SM-164 (University of Michigan), LBW242 (Novartis), ML101 (Sanford-Burnham Medical Research Institute ), AT-406 (Ascenta Therapeutics / University of Michigan), GDC-0917 (Genent ech), AEG35156 (Aegera Therapeutic), and HGS1029 (HUMAN Genome e Sciences); as well as agents that target the ubiquitin proteasome system (UPS), e.g. For example, bortezomib, carfilzomib, marizomib (NPI-0052), and ML N9708 is included; and (xii) A chimeric antigen receptor, an anticancer vaccine, and an arginase inhibitor.

[0143] Suitably, the compositions of the invention are in combination with one or more therapeutic enzymes that provide amino acid depletion. Such therapeutic enzymes may be associated with the compositions of the present invention. For example, a therapeutic enzyme such as arginase may be added to a composition that is substantially devoid of arginine. The element can be used.

[0144] Additionally or alternatively, the compositions of the invention may be used to inhibit de novo synthesis of amino acids. It can be used in combination with one or more compounds of interest. The product can be correlated with the composition of the invention. For example, a composition substantially devoid of serine can be Compounds that inhibit the de novo synthesis of, for example, PHGDH inhibitors, PSAT1 inhibitors, and PSPH inhibitors, etc. can be used.

[0145] The therapeutic agent used in the method can be a single agent or a combination of agents. Suitable combinations would include agents with different mechanisms of action.

[0146] That is, when the term "combination" is used, this refers to simultaneous, separate, or sequential It is to be understood that "combination" refers to simultaneous administration. In one aspect of the invention, "combination" refers to simultaneous administration. In another aspect of the invention, "combination" refers to separate administration. In this embodiment, "combination" refers to sequential administration. When the administration is sequential or separate, the second component is The delay in administering the combination should not result in a loss of efficacy of the combination.

[0147] The term "administered in combination with" and grammatical equivalents thereof are used herein. In this case, it is meant to encompass the administration of selected therapeutic agents to a single patient, and may involve administration of the same or different agents. The present invention may include treatment regimens in which the compounds are administered by different routes of administration or at the same or different times. In some embodiments, the compounds described herein are co-administered with other agents. These terms refer to the administration of two or more drugs to an animal resulting in the development of both drugs and / or These terms include the simultaneous presence of the metabolites in the animal. The compositions may be administered simultaneously, at different times in separate compositions, and / or both agents may be administered separately. This includes administration in a composition in which

[0148] The agents disclosed herein can be administered by any route, including intradermal, subcutaneous, oral, intraarterial, or intravenous. It can be administered by any route.

[0149] In some embodiments using combination treatments, the dietary product or medicament of the present invention The amount of the composition and the amount of the other pharma- ceutical active agent, when combined, is sufficient to treat the target disorder in the patient. In this context, a combined amount is defined as an amount that is therapeutically effective to treat the In some cases, reducing or completely alleviating the symptoms or other harmful effects of a disorder; reverse, halt entirely, or slow the progression of the disorder; or A "therapeutically effective amount" is one that is sufficient to reduce the risk of the disorder worsening. Typically, such amounts can be determined by one of skill in the art, e.g., as described herein for the compounds of the invention. The dosage ranges described above and approved or otherwise applicable for other pharmacologic active compounds may be used. Dosage ranges listed can be started and determined.

[0150] According to a further aspect of the invention, there is provided a method for treating cancer comprising administering to a subject a compound as defined above. The present invention provides a dietary product or pharmaceutical composition and an additional anti-cancer agent as defined above. .

[0151] In accordance with a further aspect of the present invention, a therapeutically effective amount of the dietary product or medicinal product of the present invention is The pharmaceutical composition is administered to a subject simultaneously, sequentially, or separately with an additional anticancer agent as defined above. The present invention provides a method for treating a human or animal subject suffering from cancer, comprising administering to said subject a therapeutically effective amount of a compound that inhibits cancer.

[0152] According to a further aspect of the invention, in the treatment of cancer, a compound according to the invention is provided which is administered in combination with an additional anti-cancer agent as defined above. Simultaneous, sequential or separate use of the dietary product or pharmaceutical composition of the present invention to provide.

[0153] The dietary product or pharmaceutical composition of the present invention may also be used in combination with radiation therapy. Suitable radiation therapy treatments include, for example, X-ray therapy, proton therapy, or Radiation therapy also includes radioactive nuclide drugs, such as 131 The use of I, 32P, 90Y, 89Sr, 153Sm, or 223Ra may be included. Such radionuclide therapy is well known and commercially available.

[0154] According to a further aspect of the invention, there is provided a method for treating cancer in combination with radiation therapy, comprising administering to said patient a therapeutically effective amount of the compound of the invention. or a pharma- ceutical product or pharmaceutical composition thereof as defined above. Provide salt.

[0155] In accordance with a further aspect of the present invention, therapeutic administration may be performed simultaneously, sequentially or separately with radiation therapy. a dietary product or pharmaceutical composition of the present invention, or a pharma- ceutical acceptable salt thereof, in an amount effective for A method for treating a human or animal subject suffering from cancer comprising administering to the subject a salt obtained by the method according to any one of claims 1 to 6, to provide.

[0156] Suitably, the present invention surprisingly provides a method for treating a patient suffering from atopic dermatitis comprising administering to said patient at least one chemotherapeutic agent or radiation therapy. The combination of a diet substantially lacking at least one amino acid in combination with We found that the effects can exceed additive.

[0157] Suitably, in some embodiments, the present invention provides a method for treating a pulmonary edema by administering at least one chemotherapeutic agent or radiation. Synergistic combinations of the dietary products or pharmaceutical compositions of the present invention in combination with a therapeutic regimen It can be provided.

[0158] In one embodiment, the dietary product or pharmaceutical composition of the invention comprises an HDAC inhibitor, M A compound selected from the group consisting of a TOR inhibitor, a tyrosine kinase inhibitor, and a proteasome inhibitor. The therapeutic agent may be combined with one or more chemotherapeutic agents of choice.

[0159] HDAC inhibitors Suitably, the chemotherapeutic agent is one or more histone deacetylase (HDAC) inhibitors. HDAC inhibitors can be used as inhibitors of cell proliferation, differentiation, and transcription. HDAC inhibitors (HDACIs) also induce cytotoxicity and apoptosis. Enhances the cytotoxic effects of therapeutic agents used in the treatment of cancer, including chemotherapeutic agents.

[0160] The term "HDAC" refers to a class of proteins that remove acetyl groups from proteins, e.g., the N-terminal lysine of histones. HDAC refers to a family of enzymes that remove the ε-amino group from amino acid residues. AC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, The HDACs can be human HDACs, including HDAC9, HDAC10, and HDAC11. HDACs can also be derived from protozoan or fungal sources.

[0161] HDAC inhibitors (HDACIs) typically consist of three ligands similar to the structure of acetyl-lysine. These three structural elements are essential for the formation of zinc in the active site. The zinc-binding group (M) is responsible for chelating the zinc, and the hydrophobic group (C) binds the active site to the outer enzyme surface. The linker region (L) binds to the channel and the capping region (C) interacts with residues on the outer enzyme surface. It is a capping group.

[0162] Examples of HDAC inhibitors include: SAHA, romidepsin, valproic acid, PCI-247 81, ITF-2357, MS275, panobinostat, belinostat, vorinostat These include MGCD0103, MGCD0103, and EVP-0334.

[0163] The present invention surprisingly provides a method for treating HDAC inhibitors, such as romidepsin and vorinostat. can function synergistically with the dietary product or pharmaceutical composition of the present invention.

[0164] Suitably, the dietary product or pharmaceutical composition of the present invention comprises a compound which is useful for the treatment of It may be used in combination with an HDAC inhibitor for any indication for which it is used. DAC inhibitors have been approved or are in clinical trials for at least the following: Follicular lymphoma, multiple myeloma, renal cell carcinoma, Hodgkin's lymphoma, follicular lymphoma, leukemia, acute Myeloid leukemia, melanoma, non-small cell lung cancer, solid tumors, prostate cancer, diffuse large B cell Treatment of follicular lymphoma, and mesothelioma is currently underway. The main agents are sirolimus and / or vorinostat.

[0165] mTOR inhibitors Suitably, the chemotherapeutic agent comprises one or more mammalian target of rapamycin (mTOR) inhibitors. The phrase "mTOR inhibitor" as used herein includes but is not limited to: but not all of them target / inhibit the activity of members of the mTOR kinase family Inhibitors of mTOR activity include, for example, compounds, proteins, or antibodies. Rapamycin of the formula: [ka] And, for example, 40-O-substituted rapamycin derivatives, e.g. 40-O-alkyl-rapamycin derivatives, e.g. 40-O-hydroxyalkyl-rapamycin rapamycin derivatives, such as 40-O-(2-hydroxy)-ethyl-rapamycin ( Everolimus), etc. 32-Deoxo-rapamycin derivatives and 32-hydroxy-rapamycin derivatives, e.g. For example, 32-deoxorapamycin. 16-O-substituted rapamycin derivatives, such as 16-pent-2-ynyloxy-32- Deoxorapamycin, 16-pent-2-ynyloxy-32(S or R)-dihydropyridine Doro-rapamycin, 16-pent-2-ynyloxy-32(S or R)-dihydrazine 40-O-(2-hydroxyethyl)-rapamycin, Rapamycin derivatives in which the oxygen group is acylated at position 40, e.g., 40-[3-hydroxyphenyl]pyridine hydroxy-2-(hydroxymethyl)-2-methylpropanoate]-rapamycin ( (also known as CCl779), rapamycin substituted at position 40 with heterocyclyl isine derivatives, such as 40-epi-(tetrazolyl)-rapamycin (ABT578 Also known as For example, the so-called rapalogs, such as 40-O-phospho-containing rapamycin derivatives, e.g., AP2 40-O-dimethylphosphinyl-rapamycin, including 3573, and 40-O-alkoxy-alkyl-rapamycin derivatives, such as 40-O-(2-ethoxy)-rapamycin derivatives. biolimus, including oxy-ethyl-rapamycin (everolimus); s A9), as well as compounds disclosed under the names TAFA-93, AP23464, AP23 675, or the compound disclosed under the name AP23841.

[0166] The present invention surprisingly provides a method for treating mTOR inhibitors such as temsirolimus and everolimus. can function synergistically with the dietary product or pharmaceutical composition of the present invention.

[0167] Suitably, the dietary product or pharmaceutical composition of the present invention comprises a compound which is useful for the treatment of It can be used in combination with an mTOR inhibitor for any indication for which it is used. TOR inhibitors have been approved or are in clinical trials for at least the following: leukemia, colon and breast cancer, malignant melanoma and ependymoblastoma; US skin cancer, central nervous system Nervous system tumors; ongoing in renal cell carcinoma, mantle cell lymphoma, breast and pancreatic endocrine Preferably, the mTOR inhibitor is temsirolimus and / or everolimus. .

[0168] Tyrosine Kinase Inhibitors Suitably, the chemotherapeutic agent may be one or more tyrosine kinase inhibitors. Tyrosine kinases function in cell signaling, including cell proliferation, differentiation, and migration. Regulation of cell proliferation, metabolism, and programmed death are examples of cellular responses mediated by tyrosine kinases. The tyrosine kinase inhibitors of the formula (I) are known to be useful in the treatment of cancer, and in one embodiment In the present invention, any known tyrosine kinase inhibitor can be used. may include commercially available inhibitors as well as inhibitors in development.

[0169] Small molecule inhibitors, such as curcumin, difluorinated curcumin (DCF), [3-{5- [4-(cyclopentyloxy)-2-hydroxybenzoyl]-2-[(3-hydroxy 1,2-Benzisoxazol-6-yl)methoxy]phenyl}propionic acid (T5224, Roche), nordihydroguaiaretic acid (NDGA), dihydroguaiaretic acid Yaretic acid (DHGA), [(E,E,Z,E)-3-methyl-7-(4-methylphenyl yl)-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6, 8-Nonatetraenoic acid (SR1 1302, Tocris Biosciences), (EJ-2-benzylidene-3-(cyclohexylamino)-2,3-dihydro-1H- Inden-1-one (BCI), TPI-2, TPI-3, Triptolide, Lapatinib, These include erlotinib, sunitinib, and vemurafenib (PLX4032). In an embodiment, the c-Fos inhibitor used in the composition is curcumin, difluorinated curcumin. Difluorocarbons (DFC), [3-{5-[4-(cyclopentyloxy)-2-hydroxybenzoyl 2-[(3-hydroxy-1,2-benzisoxazol-6-yl)methoxy ]phenyl}propionic acid] (T5224, Roche), nordihydroguaiaretic acid ( NDGA), dihydroguaiaretic acid (DHGA), and [(E,E,Z,E)-3 -Methyl-7-(4-methylphenyl)-9-(2,6,6-trimethyl-1-cyclohexane Xen-1-yl)-2,4,6,8-nonatetraenoic acid (SR1 1302, Tocr In one embodiment, the Dusp-1 inhibitor is NS Also known as C 1501 17 (EJ-2-benzylidene-3-(cyclohexyl) Amino)-2,3-dihydro-1H-inden-1-one (BCI), TPI-2, TP In one embodiment, the tyrosine kinase inhibitor is rapamycin I-3, and triptolide. These are sunitinib, erlotinib, sunitinib, and vemurafenib.

[0170] Further examples of tyrosine kinase inhibitors that can be used as chemotherapeutic agents according to the present invention include Examples include: afatinib (Giotrif®), axitinib (Inl yta®), bosutinib (Bosulif®), crizotinib (X alkori (registered trademark), dasatinib (Sprycel (registered trademark), erlotinib ib (Tarceva®), gefitinib (Iressa®), Tyvec (Glivec®), lapatinib (Tyverb®), Tinib (Tasigna®), Pazopanib (Votrient®) , regorafenib (Stivarga®), sorafenib (Nexavar® sunitinib (Sutent®), and sunitinib (Sutent®).

[0171] The present invention surprisingly identifies tyrosine kinase inhibitors such as dasatinib and regorafenib. It has been discovered that inhibitors can function synergistically with the dietary products or pharmaceutical compositions of the present invention. did.

[0172] Suitably, the dietary product or pharmaceutical composition of the invention comprises a tyrosine kinase inhibitor. Use in combination with a tyrosine kinase inhibitor for any indication for which it is useful to treat Tyrosine inhibitors have been approved or have undergone clinical trials with at least For example, non-small cell lung cancer, renal cell carcinoma, soft tissue sarcoma, thyroid cancer, chronic myeloid leukemia (CML) ML), lung cancer, acute myeloid leukemia, acute lymphoblastic leukemia, gastrointestinal stromal tumor (GIS T), sarcoma, chronic eosinophilic leukemia, intestinal cancer, liver cancer, and pancreatic cancer. Preferably, the tyrosine kinase inhibitor is dasatinib and / or regorafenib. be.

[0173] Suitably, the cancer to be treated with dasatinib and / or regorafenib are colorectal cancer, chronic myeloid leukemia (CML), acute myeloid leukemia, and acute lymphoblastic leukemia. disease, intestinal cancer, or GIST.

[0174] Proteasome inhibitors Suitably, the chemotherapeutic agent may be one or more proteasome inhibitors. Proteasome inhibitors are inhibitors of the ubiquitin proteasome system (UPS). The UPS is a non-lysosomal protein degradation pathway. Binding to ubiquitin is a multi-step process in which ubiquitin is activated by E1 conjugating enzymes. mediated by ubiquitin conjugase (E2) and E3 ubiquitin ligase These inhibitors include commercially available inhibitors and inhibitors under development. Contains harmful substances.

[0175] Examples include: bortezomib (Velcade®) and its analogues (e.g., Boronic acid derivatives, benzylmalonic acid derivatives, amino acid derivatives, and boronic acid esters ), Salinosporamide A (NPI-0052), PR-171, E1-binding enzyme inhibitor, These include POSH inhibitors, MDM2-p53 inhibitors, and deubiquitinase inhibitors. do.

[0176] The present invention surprisingly reveals that proteasome inhibitors such as carfilzomib are The present invention has been discovered to be capable of functioning synergistically with dietary or pharmaceutical compositions of the present invention.

[0177] Suitably, the dietary product or pharmaceutical composition of the present invention is a proteasome inhibitor for treating may be used in combination with a proteasome inhibitor for any indication for which Non-limiting examples of solid tumors that can be treated with the disclosed proteasome inhibitors include: pancreatic cancer; bladder cancer; colon cancer; breast cancer, including metastatic breast cancer; androgen-dependent and prostate cancer, including androgen-independent prostate cancer; renal cell carcinoma; hepatocellular carcinoma; non-small cell lung cancer (NSCLC), bronchioloalveolar carcinoma ( BAC), and lung cancer, including lung adenocarcinoma; e.g., advanced epithelial carcinoma or primary peritoneal carcinoma ovarian cancer; cervical cancer; gastric cancer; esophageal cancer; including squamous cell carcinoma of the head and neck Head and neck cancer; melanoma; neuroendocrine cancer, including metastatic neuroendocrine tumors; e.g., glioma, Brain tumors, including anaplastic oligodendroglioma, adult glioblastoma multiforme, and adult anaplastic astrocytoma; bone cancer : and soft tissue sarcomas.

[0178] Non-limiting examples of hematological tumors treatable with the disclosed proteasome inhibitors include acute myeloma, ... Myeloid leukemia (AML); chronic leukemia including accelerated phase CML and blastic phase of CML (CML-BP); Myeloid leukemia (CML); Acute lymphoblastic leukemia (ALL); Chronic lymphocytic leukemia (CLL); Hodgkin's disease (HD); non-Hodgkin's disease, including follicular lymphoma and mantle cell lymphoma Hodgkin's lymphoma (NHL); B-cell lymphoma; T-cell lymphoma; Multiple myeloma (MM) Waldenström macroglobulinemia; refractory anemia (RA) with ringed sideroblasts Refractory anemia (RARS), refractory anemia with excess blasts (RAEB) and transitional RA Myelodysplastic syndromes (MDS), including EB (RAEB-T); and myeloproliferative syndromes Groups include:

[0179] Preferably, the proteasome inhibitor is carfilzomib.

[0180] Suitably, the cancer to be treated when using carfilzomib is multiple myeloma or It is a T-cell lymphoma.

[0181] EGFR inhibitors Suitably, the chemotherapeutic agent comprises one or more epidermal growth factor receptor (EGFR) inhibitors. EGFR (also known as ErbB-1 or HER-1) inhibitors cell surface receptor inhibitors for members of the EGF family of extracellular protein ligands EGFR plays a key role in regulating normal cell proliferation, apoptosis, and other cellular functions. EGFR mutations lead to continuous or abnormal activation of the receptor, It can lead to uncontrolled cell division, which can lead to several types of cancer.

[0182] In one embodiment, the term "EGFR" refers to HER2 / c-neu (ErbB-2), HER3 (ErbB-3), and HER4 (ErbB-4), as well as EGFR (ErbB-1 )

[0183] The present invention surprisingly demonstrates that EGFR inhibitors such as cetuximab are effective in treating It has been discovered that the compounds may function synergistically with other pharmaceutical products or compositions.

[0184] Suitably, the dietary product or pharmaceutical composition of the present invention is a compound useful in the treatment of It can be used in combination with an EGFR inhibitor for any indication in which Non-limiting examples of solid tumors that can be treated with the indicated EGFR inhibitors include non-small cell lung cancer, Cancer, pancreatic cancer, breast cancer, colon cancer, and cancer caused by upregulation of epidermal growth factor receptor Some other cancers that may be affected include:

[0185] Examples of EGFR inhibitors include: cetuximab, gefitinib, erlotinib, and lapatinib. These include rivaroxaban, panitumumab, vandetanib, necitumumab, and osimertinib.

[0186] Preferably, the proteasome inhibitor is cetuximab.

[0187] Other chemotherapy drugs of interest In one embodiment, the dietary product or pharmaceutical composition of the present invention comprises tamoxifen citrate. , metformin, erlotinib hydrochloride, dasatinib, estramustine sodium phosphate , daunorubicin hydrochloride, vorinostat, cabozantinib, idelalisib, vinorelbine tartrate, temsirolimus, hydroxyurea, melphalan hydrochloride, valrubicin, Everolimus, amifostine, tretinoin, fludarabine phosphate, dacarbazine gin, vemurafenib, ceritinib, arsenic oxide, temozolomide, dexrazoxane, Gorafenib, sorafenib, exemestane, romidepsin, bosutinib, capecitabine lenalidomide, allopurinol, streptozocin, altretamine, cisplatin doxorubicin hydrochloride, nilotinib, imiquimod, carfilzomib, vandetanib , vismodegib, fluorouracil, olaparib, mitotane, anastrozole, epirucitabine Bisin hydrochloride, raloxifene, lapatinib, pazopanib hydrochloride, fulvestrant, Rasil mustard, afatinib, ifosfamide, etoposide, triethylenemelamine , ponatinib, and analogs thereof. can be combined with

[0188] Advantageously, the present invention provides that these chemotherapeutic agents are serine and glycine restricted. When combined with diet, it was shown to be more than additive (i.e., synergistic).

[0189] Thus, in one aspect, the present invention provides a dietary supplement of the present invention for use in the treatment of cancer. and providing a synergistic combination of a pharmaceutical product or composition with one or more chemotherapeutic agents. Any dosage of the chemotherapeutic agents that results in a synergistic combination can be used.

[0190] Suitably, the chemotherapy drug may be daunorubicin. The combination of the product or pharmaceutical composition with daunorubicin is used to treat, for example, acute myeloid leukemia, acute It can be used to treat chronic lymphocytic leukemia, chronic myelogenous leukemia, and Kaposi's sarcoma. .

[0191] In one embodiment, the dosage of each chemotherapeutic agent (or the total combined dosage of chemotherapeutic agents) is At least 0.1 g / Kg of patient body weight per day, preferably at least 0.2 g per day / Kg, or 0.3g / Kg per day, or 0.4g / Kg per day, or It may be equivalent to 0.5g / Kg per day. Suitably, chemotherapy drugs (or combination drugs) The dosage of the combined chemotherapy drug combination should be at least 1 g / kg per day, preferably Suitably it may be equivalent to at least 2g / Kg per day.

[0192] For example, if the subject is a human, the dose of metformin may be as low as 100 mg / day. The dosage should be 1 g per day, preferably 2 g per day or equivalent to that for non-humans. This can be done.

[0193] In yet another aspect, the present invention relates to a combination of a) the dietary product of the present invention and b) a chemotherapeutic agent. A method of treating cancer in a subject comprising administering a synergistic combination is provided. Suitably, the components of the synergistic combination may be administered simultaneously or sequentially. Cut.

[0194] Suitably, according to all aspects of the invention, the chemotherapeutic agent a) inhibits OXPHOS; b) activates c) increase reactive oxygen species (ROS); d) decrease antioxidant defenses; A combination may be provided.

[0195] Suitably, the chemotherapeutic agent may inhibit OXPHOS. For example, the chemotherapeutic agent may inhibit biguanidine Without wishing to be bound by theory, the dietary products of the present invention may be or pharmaceutical compositions (particularly dietary or pharmaceutical products substantially devoid of at least serine). The pharmaceutical composition is believed to improve the antitumor activity of biguanides.

[0196] Suitably, chemotherapeutic agents may increase ROS levels. The dietary product or pharmaceutical composition of the present invention (particularly, at least substantially devoid of serine) The dietary product or pharmaceutical composition may be used in combination with a compound that increases ROS levels. Cancer cells respond better to increased ROS levels by using They utilize large amounts of exogenous serine to support rapid proliferation. Without wishing to be bound by theory, However, when exogenous serine is depleted, cancer cells upregulate glycolytic intermediates through the serine synthesis pathway. This metabolic remodeling leads to reduced proliferation and shortened cell survival. It is believed that this could result in a reduction in

[0197] KRAS The present inventors have surprisingly found that the expression or activity of Kras in cancer cells / tissues levels in response to a cancer treatment comprising a diet substantially devoid of serine (and / or glycine) The expression or activity of Kras indicates the likelihood of response or sensitivity of a patient to the treatment. The levels of serine can be used to identify subjects that may be responsive to cancer treatment, including diets that are substantially devoid of serine. It is possible to identify cancer cells, e.g. tumors, in elephants. Also, using biomarkers, and are likely to be responsive or sensitive to cancer treatments that involve a diet substantially devoid of serine. It is also possible to identify subjects who are likely to develop or have a low probability of developing the disease using biomarkers. It is also possible to use the present invention to assist in the selection of a treatment for a patient's cancer. The present invention relates to biomarkers and their uses, as well as methods and kits that include the use of the biomarkers. Also provided.

[0198] In one aspect, the present invention provides a method for the detection of cancer that is responsive or nonresponsive to cancer treatment comprising a diet substantially lacking serine. Use of KRAS as a biomarker to identify patient populations that are resistant or susceptible to The term "biomarker" or "marker" refers to a phenotypic condition that is a target of interest. It refers to organic biomolecules that are specifically present in samples taken from a living organism compared to other phenotypic conditions. Biomarkers were evaluated based on the mean or median expression levels of the biomarkers in different groups. If the differences in the phenotypes are calculated to be statistically significant, then the phenotypes that exist specifically between different phenotypic situations are Biomarkers, alone or in combination, can be used to assess whether a subject is in one phenotypic state or another. In the present invention, the biomarker provides a measure of the relative risk of belonging to a type status. To predict the likelihood of response or sensitivity to a cancer treatment comprising a diet substantially lacking In some embodiments, the biomarker is a marker for the genes ( In some other embodiments, the biomarker is a gene product (e.g., a nucleic acid). , protein).

[0199] As used herein, the term "KRAS" refers solely to Kirsten rat sarcoma virus. KRAS refers to the human cellular homologue of the isolated transforming gene. They belong to a class of genes known to cause cancer when mutated. The KRAS gene is a member of the Ras family of oncogenes. The s family includes two other genes: HRAS and NRAS. The proteins produced by the genes are GTPases. These proteins are essential for the functioning of cells. It plays an important role in division, cell differentiation, and cell self-destruction (apoptosis).

[0200] KRAS is a RA protein with a molecular weight of approximately 21 kDa and GTP hydrolysis activity. It belongs to the S family. KRAS is found on the inner side of the cell membrane and inhibits epidermal growth factor (EGF) They play a role in sending signals to cells in response to the binding of extracellular growth factors such as IL-1 and IL-2 to their receptors. Activating mutations can be found in KRAS, which are present in approximately 20% of human cancers. do.

[0201] As used herein, the term "KRAS" refers to both a polypeptide and a nucleic acid molecule. Use for:

[0202] Suitably, the KRAS is a human KRAS polypeptide or nucleic acid molecule.

[0203] As used herein, the term "nucleic acid molecule" includes DNA molecules (e.g., cDNA or is genomic DNA) and RNA molecules (e.g., mRNA) and e.g., nucleotide analogs Nucleic acid molecules include analogs of DNA or RNA produced by the body. The DNA may be single stranded or double stranded, but is preferably double stranded DNA.

[0204] The nucleic acid sequence information of human KRAS is available under Ensembl accession number ENSG0000. In a specific embodiment, the KR The AS gene can be identified by the KEAS nucleic acid (e.g., Ensembl accession number ENSG00 000133703) or a contiguous fragment thereof, or Ensembl accession no. A nucleic acid sequence having at least 60% repeatability with the nucleic acid sequence of No. ENSG00000133703 or a continuous fragment thereof. , 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or less Both contain sequences that are 99% identical.

[0205] As used herein, the term "wild type" KRAS refers to a KRAS that does not contain a mutation, e.g., En KRA found under sembl accession number ENSG00000133703 A KRAS polypeptide or a KRAS polypeptide that does not contain a mutation compared to the S nucleic acid or KRAS polypeptide KRAS nucleic acids, mammalian or non-mammalian, other than the human KRAS sequences provided herein. The nucleic acid sequence of the KRAS of the corresponding species can be determined using methods known in the art, e.g., by nucleic acid sequencing. By scanning, using hybridization assays, or manually or as mentioned herein below in connection with the definition of the term "hybridization." Using computer programs to determine alignment and the degree of homology It can be identified by one skilled in the art by

[0206] Hybridization analysis of orthologous features of known nucleic acid sequences / promoters Assays for the detection of chromatin-binding proteins are well known in the art; see, e.g., Sambrook, Russell "Molecular Cloning, A Laboratory Manual”, Cold Spring Harbor Laboratory, NY (2001): Ausubel, “Cur rent Protocols in Molecular Biology”, Green Publishing Associates and Wiley Int. See, ERscience, NY (1989). The terms "hybridization" or "hybridization" are used interchangeably. "Hybridize," as used herein, refers to a stringent or non-stringent hybridization. Unless otherwise specified, the conditions may refer to hybridization under favorable conditions. The hybridization conditions are preferably non-stringent. , Sambrook (2001) loc. cit.; Ausubel (1989) loc. cit., or Higgins and Hames (Eds .) “Nucleic acid hybridization, a practical approach” IRL Press Oxford, Washin The method can be determined according to the conventional protocol described in Graton DC, (1985). The conditions are well known to those skilled in the art and are determined according to protocols described in the art. Therefore, detection of only specifically hybridized sequences is possible. Typically, stringent hybridization and washing conditions, e.g., 0.1×S SSC, 0.1% SDS at 65°C, or high-temperature 2×SSC, 60°C, 0.1% SDS. Stringent hybridization conditions may be required. Low stringency hybridization conditions for detection of non-complementary sequences - Patents.com can be set, for example, at 6×SSC, 1% SDS at 65° C. As is well known, The length of the nucleic acid and the composition of the nucleic acid to be determined are further parameters of the hybridization conditions. Configure.

[0207] As used herein, the terms "homology" and "identity" are used interchangeably. Calculations of sequence homology or identity between strings are performed as follows.

[0208] To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are compared using a To identify the sequence of a first and second amino acid or nucleic acid sequence, one or both of the first and second amino acid or nucleic acid sequences are aligned. , gaps are introduced for optimal alignment and non-homologous sequences are ignored for comparison. In a preferred embodiment, the length of the reference sequence to be aligned for comparison is At least 30%, preferably at least 40%, more preferably at least At least 50%, even more preferably at least 60%, and even more preferably at least 70% , 75%, 80%, 82%, 84%, 85%, 86%, 87%, 88%, 89%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. Then, the amino acid at the corresponding amino acid position or nucleotide position Residues or nucleotides are compared. A position in the first sequence is the same as the corresponding position in the second sequence. If a position is occupied by the same amino acid residue or nucleotide, the molecules are identical. (As used herein, the "identity" of an amino acid or a nucleic acid is defined as the (This is equivalent to the "homology" of nucleic acids.) The percent identity between two sequences is calculated based on optimal alignment of the two sequences. The number of gaps that need to be introduced to find the length of each gap and the number of common gaps that the sequences share It is a function of the number of identical positions.

[0209] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the GCG sequence. It is integrated into the GAP program in the software package (available at http: / / www.gcg.com). We used the Needleman et al. (1970) J. Mol. Biol. 48:444-453 algorithm. , with either the BLOSUM62 matrix or the PAM250 matrix, 16, Gap weightings of 14, 12, 10, 8, 6, or 4 and 1, 2, 3, 4, 5, or is determined using a length weighting of 6. In yet another preferred embodiment, The percent identity between the nucleic acid sequences was calculated using the GCG software package (accessed at http: / / www.gcg.com). Using the GAP program (available manually), the NWSgapdna.CMP matrix and 4 Gap weightings of 0, 50, 60, 70, or 80 and gap weightings of 1, 2, 3, 4, 5, or A particularly preferred set of parameters (and experts) is determined using a length weighting of 6. To determine whether a molecule is within the limits of sequence identity or homology of the invention, (which should be used when you are uncertain about which parameter to apply) Nulty is 12, gap extension penalty is 4, frameshift gap penalty is 5 This is the BLOSUM62 scoring matrix of

[0210] Alternatively, the percent identity between two amino acid or nucleotide sequences can be determined using the ALIGN program. The algorithm of Meyers et al. (1989) CABIOS 4:11-17) is incorporated in the program (version 2.0). The algorithm used was the PAM120 weighted residue table, a gap length penalty of 12, and and a gap penalty of 4 can be used to determine.

[0211] As used herein, the term "contiguous fragments" refers to fragments that occur in the same order as the referenced sequence. It refers to an uninterrupted sequence of nucleic acids or amino acids. Specifically contemplated is a sequence that is at least 100% of the length of the reference sequence. a continuous fragment of at least 25%, 50%, 70%, 75%, 80%, or 90% of the length of the original fragment, and , typically a contiguous fragment having at least 25 nucleic acids or at least 8 amino acids.

[0212] In one embodiment, the nucleic acid fragment corresponds to a domain, region, or functional portion of KRAS. Alternatively, the nucleic acid fragment of KRAS may comprise or consist of the sequence of the KRAS polypeptide. It encodes the epitope-bearing region of the peptide.

[0213] In an alternative embodiment, the KRAS may be, but is not limited to, human KRAS (NP_004 976.2, NP_203524.1, etc.), mouse KRAS (NP_067259.4, etc.), zebrafish KR AS (NP_001003744.1, etc.), frog KRAS (NP_001095209.1), bovine KRAS (NP_001 103471.1), chicken KRAS (NP_001243091.1), monkey KRAS (NP_001248441.1), NP NP_001028153.1, NP_113703.1, and NP_001008034.1, or any variant or modification thereof The variant may be selected from the group consisting of:

[0214] The polypeptide sequence information for human KRAS is available under Ensembl accession number ENSG In one particular embodiment, the present invention can be found at The KRAS polypeptide may be any of the KRAS polypeptides listed in the Ensembl Accession No. EN SG00000133703) or a contiguous fragment thereof, or Ensembl Accession No. and the polypeptide sequence of section number ENSG00000133703 or a continuous fragment thereof. At least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% , or a sequence that is at least 99% identical.

[0215] The KRAS polypeptide is identified using Ensembl accession number ENSG0000013. The KRAS polypeptide may be an allelic variant of the KRAS polypeptide sequence at 3703. The peptide was identified using Ensembl accession number ENSG00000133703. The KRAS polypeptide sequence may be an epitope-bearing region of the KRAS polypeptide. The S polypeptide is identified using Ensembl accession number ENSG00000133703. The polypeptide may be a fragment of the KRAS polypeptide sequence, for example a biologically active fragment.

[0216] As used herein, a "biologically active fragment" of a KRAS polypeptide includes a K The amino acid sequence of a RAS polypeptide, e.g., Ensembl Accession No. ENS A polypeptide sequence having sufficient homology to, or an amino acid sequence similar to, G00000133703. The peptide includes an amino acid sequence derived from the full-length less than a KRAS polypeptide and exhibits at least one activity of a KRAS polypeptide For example, biologically active fragments of the KRAS polypeptide are available from the Ensembl Accession Number 10106664. The KRAS polypeptide sequence of the KRAS polypeptide sequence of the Contains 10, 25, 50, 100, 200 or more consecutive amino acids of a peptide or a polypeptide consisting of said amino acids.

[0217] In the context of determining the activity of KRAS, the term "activity" as used herein includes, for example, Determining enzyme activity at the protein level and / or expression levels (e.g., mRNA or The method of determining activity as defined herein includes determining the activity of the It is well known in the art and is described herein below.

[0218] In one embodiment, the KRAS is a mutated KRAS, e.g., an activating KRAS mutant. As used herein, the term "activating mutation" refers to a mutation in a gene, particularly the KRAS gene. This refers to a difference in the corresponding gene product, i.e., protein, especially K, compared to the wild type. Increases the activity of RAS proteins, especially KRAS proteins. Methods for measuring KR activity are well known in the art and are described herein below. Mutations in the AS gene can be detected by methods known in the art. Such methods are described, for example, in (Papadopoulos et al., 2006; Shendure et al., 2004). It is being done.

[0219] The present invention relates to a method for treating cancer that is responsive or sensitive to a cancer treatment comprising a diet substantially lacking serine. 1. A method for identifying unlikely subjects, comprising: a) determining the level of Kras expression or activity in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of Kras expression or activity in said biological sample from a control sample; or a predetermined reference level of Kras expression or activity, The biological sample is elevated relative to the control sample or relative to the predetermined reference level. The level of Kras expression or activity in the sample indicates non-responsiveness or A method is provided that indicates insensitivity.

[0220] The present invention also provides a method for treating cancer that is responsive or sensitive to a cancer treatment comprising a diet substantially lacking serine. 1. A method for identifying a subject likely to be a a) determining the level of Kras expression or activity in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of Kras expression or activity in said biological sample from a control sample; or a predetermined reference level of Kras expression or activity, The biological sample is low in comparison to the control sample or to the predetermined reference level. the level of Kras expression or activity in said control sample or A level of Kras expression or activity that is substantially the same as the predetermined reference level is A method is provided for indicating responsiveness or sensitivity to the cancer treatment.

[0221] The present invention also provides a method for treating cancer comprising administering to a subject a diet substantially devoid of serine. A method of determining: a) determining the level of Kras expression or activity in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of Kras expression or activity in said biological sample relative to a control sample; and comparing the level of Kras expression or activity to a predetermined reference level. Including, The biological sample is low in comparison to the control sample or to the predetermined reference level. the level of Kras expression or activity in said control sample or A level of Kras expression or activity that is substantially the same as the predetermined reference level is The present invention provides a method for determining whether a patient may benefit from a cancer treatment.

[0222] MTAP The present inventors have surprisingly found that methylthioadenosine phospholipase A (MPA) is a potent agonist in cancer cells / tissues. The expression or activity level of i) cysteine ​​and / or ii) ) The possibility of a patient's response or sensitivity to a cancer treatment that includes a diet substantially lacking serine. The expression or activity level of MTAP was used to identify cysteine ​​and and / or a diet substantially devoid of cysteine. It is possible to identify cancer cells, e.g., tumors. Biomarkers can also be used to It is also possible to aid in the selection of a treatment for cancer in a patient. The markers and their uses are provided, along with methods and kits involving the use of the biomarkers. do.

[0223] In a further aspect, the present invention provides a diet substantially lacking cysteine ​​and / or serine. To identify patient populations that are responsive or sensitive to cancer treatments that include MTAP The present invention provides for the use of

[0224] The present invention also provides a method for treating cancer, comprising administering to a subject a diet substantially devoid of cysteine. 13. A method for identifying a a) detecting the expression or activity of MTAP in a biological sample isolated from said subject; Steps to ask for a bell and; b) determining the level of expression or activity of MTAP in said biological sample from a control sample; or a predetermined reference level of MTAP expression or activity, The biological sample is low in comparison to the control sample or to the predetermined reference level. the level of expression or activity of MTAP in said control sample or said A level of expression or activity of MTAP that is substantially the same as the predetermined reference level is The present invention provides a method for determining whether a patient may benefit from a cancer treatment.

[0225] As used herein, the term "MTAP" refers to S-methyl-5'-thioadonosine ( Reversible phosphorylation of adenine and 5-methylthioribose-1-phosphate (MTA) This enzyme catalyzes the synthesis of 5'-thioadenosine. It plays a key role in lyamine metabolism, regenerating both adenosine and methionine. MTAP is known to be deficient in many cancers. This is often due to co-deletion of the MTAP gene and the tumor suppressor gene p16.

[0226] As used herein, the term "MTAP" refers to both polypeptides and nucleic acid molecules. Used to point.

[0227] Suitably, the MTAP is a human MTAP polypeptide or nucleic acid molecule.

[0228] The nucleic acid sequence information of the human MTAP gene is available under Ensembl accession number ENSG0 0000099810. In one specific embodiment, the present invention The MTAP gene was identified using the MTAP nucleic acid (Ensembl accession number ENSG000 00099810) or a contiguous fragment thereof, or Ensembl accession no. At least 60% identical to the nucleic acid sequence of ENSG00000099810 or a continuous fragment thereof; 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or at least also contain sequences that are 99% identical.

[0229] Nucleic acids of MTAP from mammalian or non-mammalian species other than the human MTAP sequence provided herein. The sequence can be determined using methods known in the art, for example, by nucleic acid sequencing, or Using a hybridization assay or by manual or A computer program as referred to herein below in connection with the definition of "processing method" By using the alignment and the degree of homology, it is possible to determine the degree of homology by a person skilled in the art. It can be identified as such.

[0230] In one embodiment, the nucleic acid fragment corresponds to a domain, region, or functional portion of MTAP. Alternatively, the nucleic acid fragment of MTAP comprises or consists of a sequence encoding the sequence of MTAP. It encodes an epitope-bearing region of the polypeptide.

[0231] In an alternative embodiment, MTAP is a nucleotide sequence encoding a human MTAP polypeptide. The sequence may be a nucleotide sequence or a variant or mutant thereof.

[0232] The polypeptide sequence information for human MTAP can be found under UniProtKB-Q13126. In one particular embodiment, the MTAP polypeptide of the present invention is a human MTAP or a contiguous fragment thereof, or UniProtKB-Q13126 (e.g. , Q13126-1) or a continuous fragment thereof 5%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or at least Contains 99% identical sequences.

[0233] The MTAP polypeptide is the MTAP polypeptide of UniProtKB-Q13126. The MTAP polypeptide may be an allelic variant of the sequence. The MTAP polypeptide sequence may be an epitope-bearing region of -Q13126. The polypeptide is a fragment of the MTAP polypeptide sequence of UniProtKB-Q13126. , for example, a biologically active fragment.

[0234] As used herein, a "biologically active fragment" of an MTAP polypeptide includes any of the following: The amino acid sequence of the TAP polypeptide, e.g., the polypeptide of UniProtKB-Q13126 A peptide containing an amino acid sequence sufficiently homologous to or derived from the peptide sequence. The peptide contains fewer amino acids than the full-length MTAP polypeptide. For example, the MTAP polypeptide may be a polypeptide that exhibits at least one of the activities of the MTAP polypeptide. Biologically active fragments of this peptide are available under UniProtKB accession number Q13126 (e.g. For example, 10 of the MTAP polypeptide of the MTAP polypeptide sequence of Q13126-1 , 25, 50, 100, 200 or more consecutive amino acids, or The polypeptide may be composed of the acid.

[0235] In the context of determining the activity of MTAP, the term "activity" as used herein includes, for example, Determining enzyme activity at the protein level and / or expression levels (e.g., mRNA A or protein). Methods for determining activity as defined herein include , are well known in the art and are described herein below.

[0236] As used herein, a cancer treatment comprising a diet substantially lacking serine is or slowing the growth of a cancer or tumor following said treatment. or reduce one or more symptoms of cancer or tumor, e.g., tumor burden. If the subject is "responsive" or "susceptible" to the treatment, then the subject is "responsive" or "susceptible" to the treatment. In certain embodiments, a subject is considered to be a responder if the treatment reduces the tumor burden during or after the treatment. In some embodiments, when a tumor or cancer goes into remission or is eradicated, If so, the subject is responsive to the treatment.

[0237] As used herein, a cancer treatment comprising a diet substantially lacking serine is or following said treatment, the growth of the cancer or tumor is not slowed, or does not prevent the proliferation of one or more symptoms of cancer or tumor, e.g., tumor burden If the treatment does not reduce the level of inflammatory bowel disease, the subject is "non-responsive" or "insensitive" to the treatment. Therefore, in a preferred embodiment, if the tumor burden increases during or after treatment, the subject In some embodiments, the tumor or cancer is expanding, spreading, or If the cancer spreads or one or more of your cancer symptoms get worse during or after treatment If so, the subject is non-responsive to the treatment.

[0238] The disclosed methods of the present invention typically involve detecting KRAS or a similar gene in a biological sample obtained from a subject. As used herein, the term "detecting the expression level of MTAP or MTAP. The terms "biological sample" and "sample isolated from a subject" are used interchangeably to refer to a sample obtained from a subject. Tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and biological fluids present within a subject. and fluids.

[0239] In a preferred embodiment, the subject is a subject with cancer, and more preferably, the sample is A biological sample is a sample of cancer cells or tissue. The biological sample may contain a single cancer cell. However, preferably, it contains a large number of cancer cells.

[0240] In some embodiments, the biological sample comprises cancer cells obtained from a tumor. In some embodiments, the biological sample contains cancer cells that are not from a tumor. In embodiments, the cancer cells are circulating cancer cells. The biological sample may be free of other components or For example, the sample may include non-cancerous cells, tissues, etc. In a preferred embodiment, the biological sample is isolated or separated from normal tissue. In another embodiment, the biological sample is obtained from a cancer tissue or organ. do.

[0241] Biological samples can be obtained from subjects using a variety of methods known in the art. In some embodiments, the sample can be a tissue biopsy, e.g., a punch biopsy. Samples should be handled according to the detection method used. In an embodiment, a biological sample of tissue or cell origin is treated with a chaotropic agent, a detergent, or the like. a lysis buffer optionally containing one or more of a denaturing agent, a reducing agent, a buffer, and a salt. Handling biological samples to be analyzed for mRNA levels The conditions used for this purpose are different from those used for treating biological samples that are to be analyzed for protein levels. Such conditions are known in the art. In the case of a pull (e.g., a whole blood sample), the preparation may include an anticoagulant.

[0242] Samples may be concentrated or diluted with a suitable diluent prior to analysis. It is possible to freeze samples, leave them unprocessed, or fix them (e.g., in formalin). The tissue may be separated, centrifuged, and / or embedded (e.g., in paraffin). Prior to assessing the amount of a marker in a sample, the cell sample may be subjected to a variety of post-collection assays, as are well known. Preparation and preservation techniques (e.g., nucleic acid and / or protein extraction, fixation, preservation, freezing, ultrafiltration) It is possible to subject the sample to various techniques (such as filtration, concentration, evaporation, centrifugation, etc.). Post-collection preservation techniques, such as fixation, may be employed.

[0243] The types of cancer that can be assayed and treated with the methods of the present invention include, but are not limited to, Cancers that are rare include, but are not limited to: colorectal cancer, liver cancer, osteosarcoma, lymphoma, and breast cancer.

[0244] In the context of the present invention, the expression of KRAS / MTAP is measured by any suitable method. , KRAS / MTAP gene or protein, gene or protein expression levels means...

[0245] Typically, the expression level of a particular gene is determined by the expression of KRAS / MT By measuring the level of mRNA transcribed from the AP gene, the transcription level was reflected. or by measuring protein levels in cells or tissues. The method can be a cell-based or cell-free assay. is possible.

[0246] In accordance with the present invention, a method for detecting the expression level of KRAS or MTAP in a sample is provided. The expression level of KRAS or MTAP in a sample is It can be determined by measuring the mRNA or protein levels of P. Examples of methods for measuring mRNA in cells include quantitative polymerase chain reaction (qPCR). R), reverse transcription PCR (RT-PCR), reverse transcription real-time PCR (RT-qPCR), Transcriptome analysis using next-generation sequencing, array hybridization analysis, digital PCR, Northern analysis, dot blot, in situ hybridization These include purification, ELISA, and RNase protection assays.

[0247] Quantitative real-time PCR is used to determine the levels of specific mRNAs in cell or tissue samples. It is particularly suitable for the study of gene expression in which mRNA is first reverse transcribed into cDNA and then The gene is amplified by PCR using gene-specific oligonucleotide PCR primers. qRT-PCR methods are well known in the art. Rays can also be used to detect mRNA levels. Redisection can be used to identify cell or tissue samples, e.g., FFPE tissue samples. It is also possible to detect KRAS mRNA levels in cells in situ.

[0248] In some embodiments, expression of KRAS and / or MTAP is measured by PCR (e.g., q PCR, RT-PCR, RT-qPCR, etc.) can be used to determine the PCR assays are well known in the art. For example, in some embodiments, There is at least one method to detect KRAS / MTAP-derived mRNA in a sample. generating cDNA from the sample by reverse transcription using a primer of amplifying the cDNA so produced; and detecting the presence of the amplified cDNA. Further, such methods include determining mRNA levels in a biological sample. (e.g., "housekeeping" proteins such as actin family members) " by simultaneously examining the levels of control mRNA sequences of the gene, Optionally, determining the sequence of the amplified cDNA. Northern blot analysis is a conventional technique well known in the art, e.g. For example, Sambrook, et al., Molecular Cloning, a Laboratory Manual, third edition, Col. d Spring Harbor Press, NY (2000) 11803-2500.

[0249] In some embodiments, the KRAS / MTAP gene is detected using, for example, a probe or primer. The term "probe" as used herein means a probe capable of detecting a target protein. Whether naturally occurring in a restriction enzyme digest or synthetically produced, oligonucleotides Nucleotide, polynucleotide, or nucleic acid, i.e. RNA or DNA. It anneals or specifically hybridizes to a nucleic acid having a sequence complementary to the probe. The probe may be single-stranded or double-stranded. The exact length will depend on many factors, including temperature, source of probe, and application of the method. For example, in diagnostic applications, depending on the complexity of the target sequence, oligonucleotide probes may be used Typically, they contain 15-25 or more nucleotides, although some contain fewer It may also contain nucleotides.

[0250] In some embodiments, the biological sample contains a small number of cells or is a single cell. Amplify cDNA from small amounts of cells (e.g., 1000 to 10 cells) and single cells. However, methods for analyzing mRNA expression are well known in the art. Examples of such methods include semi-random primed PCR and phi29-based cDNA amplification. Tep is one example.

[0251] These and other suitable methods for binding (specific) mRNAs are well known in the art. This is well known in the art and is described, for example, in Sambrook and Russell (2001, loc. cit.). The correlation between the intensity of the detected signal and the amount of the gene product to be determined is preferably linear. By utilizing this relationship it is possible to determine the amount of a component, particularly said gene product.

[0252] To detect KRAS / MTAP protein expression in cell or tissue samples Any known method for measuring protein levels in a cell or tissue sample can be used. , can be used in the present invention.

[0253] Methods for measuring KRAS / MTAP protein expression in a sample include, for example, immunoassays, ligand binding assays, mass spectrometry, or high performance liquid chromatography Several methods have been used to identify KRAS / MTAP proteins and their specific binding sites. Antibodies that are specifically immunoreactive with KRAS / MTAP protein in the sample are then used to The cell or tissue sample is contacted with the immunoassay under conditions that allow the antibody to bind to the cell or tissue, and the amount of bound antibody is measured. Exemplary immunoassays include, but are not limited to, radioimmunoassays. Immunoassay, ELISA, Immunoprecipitation assay, Western blot, Fluorescence immunoassay and immunohistochemistry, flow cytometry, protein assays, multiplexing Xbead array, magnetic capture, in vivo imaging, fluorescence resonance energy transfer ( FRET), and Fluorescence Recovery After Photobleaching / Localization (FRAP / FLAP). In another preferred embodiment, the presence or absence of KRAS in a cell or tissue sample is determined by IH This is determined by C.

[0254] Some immunoassays, e.g., ELISAs, are specific for two different biomarkers. Suitable antibodies or ligands (e.g., a capture ligand or antibody and a detection ligand or antibody) are It will be appreciated that in certain embodiments, KRAS may require ligand binding to the surface. Alternatively, the protein biomarker is captured with an antibody and labeled with an enzyme. is bound to biotin or streptavidin, The enzyme substrate is colored by forming a bond between biotin-streptavidin and the enzyme. The signal is generated by converting the ion to a molecule, and the absorbance is measured by an optical sensor. The color intensity of the solution is quantified. A possible assay is to detect the presence of protein biomarkers. Chromogenic reporters and substrates may be utilized that produce an observable color change indicative of the Sensitive, electrochemiluminescent, real-time PCR reporters also produce quantifiable signals. It is believed that this will be achieved.

[0255] Some assays involve immobilizing one or more antibodies prior to contacting the antibodies with the sample. Optionally, the complex may be immobilized on a solid support to facilitate washing and subsequent isolation of the complex. Examples of solid supports include microtiter plates, sticks, beads, or Examples include glass or plastic in the form of microbeads. Antibodies are also The antibodies can be attached to a probe, substrate, or ProteinChip® array. be.

[0256] Flow cytometry involves suspending particles in a fluid stream and screening them near an electronic detection device. Counting, sorting, and detection of protein biomarkers by passing Flow cytometers are laser-based techniques that can be used to measure color The ability to distinguish different particles based on the color of the particles. Emission at these different wavelengths makes it possible to distinguish particles. For example, FLOWMETRIX™ is described in Fulton, et al., Clinical Chemistry, 43(9 ):1749-1756 (1997), which shows that This allows multiple separate assays to be performed simultaneously.

[0257] In another preferred embodiment, the expression of KRAS and / or MTAP of the present invention is determined by mass spectrometry. The detection is performed by multidimensional HPLC (high performance liquid chromatography) and mass spectrometry. In combination with this, it is possible to isolate KRAS. The presence or absence or expression level of the MTAP gene or polypeptide may be determined in vivo. In some embodiments, expression may be detected in vivo or in vitro. The present invention is carried out in vitro in biological samples containing genetic material isolated from patients. In some other embodiments, expression of the marker gene is detected by, for example, "quantum doping assay." This can be done in vivo using techniques such as "tagged" labeling or CT scans. be.

[0258] The activity of KRAS can be determined not only by measuring the level of expression, but also by measuring the expression level of KRAS. For example, by measuring the GTPase activity of KRAS or, for example, by measuring the GTPase activity of KRAS. For S, measure the levels of phospho-Akt or phospho-Erk. It can also be determined by measuring the activity of downstream signaling pathway members. Means and methods for determining the activity of said proteins are well known in the art, e.g. For example, it can be estimated from the Lottspeich (Spektrum Akademischer Verlag KRAS activation assay kits for detecting cellular Ras-GTP are available from, for example, Je Ras Activation Kit from na Bioscience and K-Ras Activation Assay from Cell Biolabs Kits and the like are well known in the art.

[0259] The activity of MTAP can be determined not only by measuring the expression level, but also by measuring the expression level of MTAP. , for example, by measuring the cellular efflux of methylthioadenosine (MTA) It is possible.

[0260] Suitably, MTA may be used as a biomarker in accordance with the present invention. In one embodiment, the methods and uses relating to MTAP can be substituted with MTA, In embodiments, the MTA and i) substantially lacking serine and / or ii) cysteine The correlation between "responsiveness" or "sensitivity" to treatment with a restricted diet is reversed. Enhancement of MTA efflux indicates responsiveness or sensitivity to such treatment.

[0261] The term "activity" as used herein refers to the activity of a protein (e.g., KRAS). whereas the term expression level refers to the protein level (e.g., by Western blot, etc.). (required) or transcription level (e.g., Northern blot, real-time PCR, etc.) More can be desired, spliced, unspliced, or partially This refers to expression in the spliced ​​mRNA.

[0262] As used herein, the term "elevation" refers to the level of a protein detected by the methods described herein. The biomarker levels (e.g., expression or activity) obtained from the subject are compared to the same biomarkers obtained from the control. Compared to the marker level or reference level, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, It may refer to an increase of 98%, 99%, or more. In some embodiments, the term increase refers to an increase in biomarker level, and the increased level is higher than the biomarker level in the control. 0.1-fold, 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, or Or even more.

[0263] As used herein, the term "reduction" refers to a decrease in the level of a protein detected by the methods described herein. Biomarker levels (e.g., expression or activity) are compared to the same biomarkers obtained from a control. Compared to the car's level or reference level, 5%, 10%, 20%, 25%, 30%, 4 0%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 9 It may refer to a decrease of 8%, 99%, or more. In some embodiments, the term decrease This refers to a decrease in the level of a biomarker, which decrease is greater than the level of the biomarker in a control. or 0.1-fold, 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, or is much more than that.

[0264] As used herein, the phrase or "substantially the same" means that one of ordinary skill in the art would understand that the difference between two values ​​is Within the context of the biological characteristic measured by said value, little or no biological and / or two numbers that you consider to be statistically insignificant (e.g., test biology A value for KRAS expression or activity in the target sample and a value for KRAS expression or activity in the control sample The similarity between the two (i.e., the expression or activity of KRAS, which is the other variable) is sufficiently high. The difference between the two values ​​is less than about 50%, less than about 40%, or less than about 50% as a function of the reference / comparison value. Less than about 30%, less than about 20%, and / or less than about 10%.

[0265] The methods disclosed herein include detecting biomarkers in a sample isolated from a subject. The levels of markers (e.g., KRAS and / or MTAP) are compared to control levels or to a given Comparing to a reference level is included.

[0266] As used herein, a "control" refers to a sample having normal levels of biomarker expression. Samples, e.g., from healthy subjects without or without suspected cancer, or Or, in the case of KRAS, samples without or without suspected KRAS mutations Preferably, the control sample is a sample of normal (e.g., non-diseased) cells or tissue. Preferably, when the biomarker is measured in KRAS, the control sample is The control sample was a sample isolated from a subject. The tissue or cell type may be the same as that of the pull.

[0267] As used herein, the term "reference level" refers to a level determined by the methods described herein. The levels of biomarkers obtained are the same as those obtained in control samples for the same biomarkers. The KRAS level refers to the KRAS level. Alternatively, the reference level refers to the reference data The expression level of a biomarker (e.g., KRAS) derived from the reference may be included. Levels are used to measure the level of a given cutoff value, i.e., the level at which a symptom or disease or its absence is predicted. A diagnostic score that is statistically predictive can also be generated, and the reference levels can be compared to standard population samples. A predefined reference level may be based on the expression level of the subject or may be based on a baseline expression level of the subject. The predetermined reference level may be based on the level of the subject's immune system, i.e., before organ transplantation. The isolated biological samples were analyzed using the same test platform used to obtain the reference values. (e.g., mRNA analysis by RT-PCR, protein analysis by immunoassay) etc.) to perform the assay.

[0268] Alternatively, the prediction is based on normalized expression levels of a biomarker (e.g., KRAS). The absolute expression of a biomarker (e.g., KRAS) in a sample. The level is compared to its expression and to a reference nucleic acid that is not a marker, e.g., a constitutively expressed mRNA. The expression levels are then corrected by comparing with the expression of mRNA such as NA. This normalization is done to reduce the difference in the concentration of the ions in one sample compared to another, or between different supplies. This normalized expression then allows for the comparison of expression levels between samples from any source. Optionally, comparison can be made to a reference level or control.

[0269] In one aspect, the present invention provides a method of treating a subject with cancer, comprising: a) determining the level of Kras expression or activity in a biological sample isolated from said subject; Whether the bell represents a response or sensitivity to cancer treatment involving a diet substantially lacking serine determining whether or not b) determining whether the level of Kras expression or activity in said biological sample is associated with said cancer treatment; administering to said subject said cancer treatment if said subject exhibits a responsiveness or susceptibility to said cancer. The present invention provides a method, including:

[0270] In certain embodiments, the diet substantially lacking serine comprises a dietary product or As used herein, the term "dietary product" means , one or more essential amino acids or salts or esters thereof, Used in food or used or consumed in combination with food to provide a supplement The present invention provides a subject consuming the compound with a desired level of an amino acid or a salt or ester thereof. The nutritional ingredients in these products include: vitamins, minerals, herbs or contains other botanical drugs, amino acids, and substances such as enzymes, organ tissues, glands, and metabolites. Examples include:

[0271] Dietary products are available in the form of powders, gels, solutions, suspensions, pastes, solids, liquids, concentrates and reconstituted forms. Available in reconstituted powders, shakes, concentrates, pills, bars, tablets, capsules or ready to use Dietary products can also be provided in the form of dietary supplements. However, tablets, pills, capsules, liquids, aerosols, injectables, or other medicinal When in the form of an acceptable formulation, it is considered possible to make a pharmaceutical composition.

[0272] As used herein, "substantially devoid" refers to a complete lack of serine or a very In various embodiments, the food or dietary product is substantially Lacking serine.

[0273] In one embodiment, the cancer treatment comprises a diet substantially devoid of serine and glycine.

[0274] In some embodiments, the cancer treatment comprises administering to a patient a chemotherapy or radiation therapy regimen. and administering to the cancer patient a diet substantially devoid of serine. and a therapeutic agent selected from a cancer cell proliferation inhibitor, a radiotherapy agent, and a chemotherapy agent. This includes administration of.

[0275] As used herein, cancer cell growth inhibitors, radiotherapeutic agents, and chemotherapy agents, etc. and / or radiation therapy.

[0276] Such chemotherapy may include one or more of the following categories of anti-cancer agents: (i) Antiproliferative / Antineoplastic Agents, such as alkylating agents, and combinations thereof (e.g., cyclosporine, platin, oxaliplatin, carboplatin, cyclophosphamide, nitrogen mass Tard, uracil mustard, bendamustine, melphalan, chlorambucil, chlor Methine, busulfan, temozolomide, nitrosoureas, ifosfamide, melphalan , pipobroman, triethylenemelamine, triethylenethiophosphoramide, carmusti antimetabolites (e.g., gemcitabine, lomustine, streptozocin, and dacarbazine); Tabine and antifolates, e.g., fluoropyrimidines such as 5-fluorouracil and tegafur Myzine, raltitrexed, methotrexate, pemetrexed, cytosine arabinoside , floxuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fluoxetine phosphate darabine, pentostatin, gemcitabine, and hydroxyurea); antibiotics (e.g., anthracyclines such as adriamycin, bleomycin, doxorubicin, Rubicin, Daunomycin (registered trademark), Epirubicin, Idarubicin, Mitomycin C, dactinomycin, and mithramycin); antimitotic agents (e.g., vincristine, Vinca alkaloids such as vintine, vinblastine, vindesine, and vinorelbine; taxoid and polo kinase inhibitors such as Taxol and Taxotere; proteasome inhibitors; inhibitors, such as carfilzomib and bortezomib; interferon therapy; and and topoisomerase inhibitors (e.g., epipodophyllotoxins such as etoposide and teniposide). Cin, amsacrine, topotecan, irinotecan, mitoxantrone, and campto bleomycin, dactinomycin, daunorubicin, doxorubicin, epinephrine Rubicin, Idarubicin, ara-C, Paclitaxel (Taxol™), nab Paclitaxel, docetaxel, mithramycin, deoxycoformycin, mycobacterium tomycin C, L-asparaginase, interferon (especially IFN-α), etoposide decitabine, teniposide, DNA demethylating agents (e.g., azacytidine or decitabine); and histone deacetylase (HDAC) inhibitors (e.g., vorinostat, MS-2 75, Panobinostat, Romidepsin, Valproic acid, Mocetinostat (MGCD01 03) and pracinostat SB939); (ii) Cytostatic agents such as antiestrogens (e.g., tamoxifen, fulvest) ranto, toremifene, raloxifene, droloxifene and iodoxyfene), Antiandrogens (e.g., bicalutamide, flutamide, nilutamide, and cysteine ​​acetate) rotetrone), LHRH antagonists or LHRH agonists (e.g., goserelin, leuprorelin, progesterone (e.g., megestrol acetate), aromatase Zeta inhibitors (e.g., anastrozole, letrozole, borazole, and exemestane) as 5*-reductase inhibitors, such as finasteride; and navelbecamide. , CPT-II, anastrozole, letrozole, capecitabine, reloxafam, Cyclophosphamide, ifosfamide, and droloxafine; (iii) anti-invasive agents, such as dasatinib and bosutinib (SKI-606), and , Metalloprotease inhibitors, urokinase-type plasminogen activator receptor function inhibitors of, or heparanase antibodies; (iv) Growth factor function inhibitors: For example, such inhibitors include growth factor antibodies and Growth factor receptor antibodies, such as the anti-erbB2 antibody trastuzumab (Herceptin ( panitumumab, an anti-EGFR antibody; cetuximab, an anti-erbB1 antibody; and phosphoinositide kinase inhibitors, such as epidermal growth factor family inhibitors (e.g., gefitinib , Erlotinib, 6-acrylamido-N-(3-chloro-4-fluorophenyl)-7 -(3-Morpholinopropoxy)-quinazolin-4-amine (CI1033), Afaty EGFR family chemotherapy agents such as nivolumab, vandetanib, osimertinib, and rociletinib tyrosine kinase inhibitors such as lapatinib), erbB2 tyrosine kinase inhibitors, and and antibodies against costimulatory molecules such as CTLA-4, 4-IBB and PD-1, or Antibodies against cytokines (IL-10, TGF-β); hepatocyte growth factor family inhibitors ;Insulin growth factor family inhibitor;Protein regulator of cellular apoptosis Modulators (e.g., Bcl-2 inhibitors); imatinib and / or nilotinib ( Platelet-derived growth factor family inhibitors such as AMN107; serine / threonine kinase inhibitors Ras / Raf signaling inhibitors, such as farnesyl transferase inhibitors agents, such as sorafenib, tipifarnib, and lonafarnib), MEK and / or AKT kinase inhibitors, c-kit inhibitors, abl kinase inhibitors inhibitors, PI3 kinase inhibitors, Plt3 kinase inhibitors, CSF-1R kinase inhibitors, IGF receptor, kinase inhibitors; Aurora kinase inhibitors, and CDK2 and / or or CDK4 inhibitors; CCR6 antagonists; and 077766, 2011092469, or 2015075483 RAF kinase inhibitors such as those described herein. (v) Angiogenesis inhibitors such as agents that inhibit the function of vascular endothelial growth factor [e.g., anti-vascular epidermal growth factor antibody bevacizumab (Avastin®); thalidomide; lenalidomide and, for example, VEGF receptor tyrosine kinase inhibitors, such as bandetanidine. , vatalanib, sunitinib, axitinib, and pazopanib; (vi) Abnormal genes, such as abnormal p53 or abnormal BRCA1 or BRCA2 gene therapy, including replacement approaches; (vii) For example, alemtuzumab, rituximab, ibritumomab tiuxetan (Zev Immunotherapies, including antibody therapies such as IFN-α (Farin®) and ofatumumab; Interferons such as interferon α, interleukins such as IL-2 (aldesleukin) interleukin inhibitors, e.g. IRAK4 inhibitors; HPV vaccines, e.g. Dasil, Cervarix, Oncophage and Sipuleucel-T (Provenge® Cancer vaccines, including prophylactic and therapeutic vaccines such as ;gp100; dendritic cell-based vaccines; vaccines (e.g., Ad.p53DC, etc.); toll-like receptor modulators, For example, TLR-7 or TLR-9 agonists; PD-1, PD-L1, PD-L2 and and CTL4-A modulators (e.g., nivolumab), antibodies, and vaccines; other I DO inhibitors (e.g., indoximod, etc.); anti-PD-1 monoclonal antibodies (e.g., MK-3475 and nivolumab); anti-PDL1 monoclonal antibodies (e.g., ME DI-4736 and RG-7446); anti-PDL2 monoclonal antibodies; and Anti-CTLA-4 antibodies (e.g., ipilimumab); and (viii) Cytotoxic agents, such as fludarabine (Fludara), cladribine, pentose Statins (Nipent™); (ix) targeted therapy, e.g., PI3K inhibitors, e.g., idelalisib and perifosine; Also known as inhibitor of apoptosis (IAP) antagonists (IAP antagonists) These drugs are SMAC (second mitochondrial caspase activator) analogues. inhibits IAPs, e.g., XIAP, cIAP1, and cIAP2, thereby inhibiting cellular Specific SMAC analogs include Biri napant (TLR32711, TetraLogic Pharmaceuticals), LCL161 (Nova rtis), AEG40730 (Aegera Therapeutics), SM-164 (University of Michigan), LBW242 (Novartis), ML101 (Sanford-Burnham Medical Research Institute ), AT-406 (Ascenta Therapeutics / University of Michigan), GDC-0917 (Genent ech), AEG35156 (Aegera Therapeutic), and HGS1029 (HUMAN Genome e Sciences); as well as agents that target the ubiquitin proteasome system (UPS), e.g. For example, bortezomib, carfilzomib, marizomib (NPI-0052), and ML N9708 is included; and (xii) A chimeric antigen receptor, an anticancer vaccine, and an arginase inhibitor.

[0277] The therapeutic agent used in the method can be a single agent or a combination of agents. Suitable combinations would include agents with different mechanisms of action.

[0278] The term "administered in combination with" and grammatical equivalents thereof are used herein. In the case of or different routes of administration, or at the same or different times of day. In some embodiments, the compounds described herein may be administered in combination with other agents. These terms refer to the administration of two or more drugs to an animal, resulting in both drugs and These uses include the simultaneous presence in the animal of the compound and / or its metabolites. The term includes simultaneous administration in separate compositions, administration at different times in separate compositions, and / or Alternatively, administration in a composition in which both agents are present is included. Thus, in some embodiments, The compound of the present invention and the other agent may be administered in a single composition.

[0279] The agents disclosed herein can be administered by any route, including intradermal, subcutaneous, oral, intraarterial, or intravenous. Administration can be by any route. Preferably, administration will be by the intravenous route. Parenteral administration can be provided by bolus or by infusion.

[0280] The concentration of therapeutic agent administered in accordance with the present invention will depend on the dosage of compound administered, the composition of the compound utilized, and the dosage of the compound administered. This will depend on several factors, including pharmacokinetic characteristics, and route of administration. Single or multiple doses may be administered. Treatment is indicative of a patient's overall health, as well as the selection of Daily or more frequently, depending on several factors, including the compound formulation and route of administration. It can be administered.

[0281] Preferably, the cancer treatment further comprises administering a therapeutically effective amount of the therapeutic agent. The term "therapeutically effective amount" as used herein refers to an amount effective to treat a particular disease or condition. Refers to an amount of at least one agent or compound administered that is sufficient to treat or prevent The result may be a reduction and / or alleviation of the signs, symptoms, or causes of a disease, or a biological It may be any other desired change in the system. For example, an "effective amount" in therapeutic applications may be a dose that reduces the severity of a disease. Compositions comprising the compounds disclosed herein necessary to provide a clinically significant reduction in An appropriate "effective" amount in any individual case may be determined using techniques such as a dose escalation study. It is possible to determine this using

[0282] In some embodiments, the diet is administered for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, At least 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks or until a therapeutic endpoint is observed, e.g., tumor shrinkage is observed. The drug is administered for a period of .

[0283] The diet substantially lacking serine may include or be derived from a dietary product. If possible, administer dietary products 1 to 10 times daily.

[0284] The present invention also provides methods for detecting the presence of KRAS and / or MTAP in a sample. The kit of the present invention includes a kit for preventing and treating cancer comprising a diet substantially lacking serine. For example, the kit may be used to identify subjects who would benefit from the use of a biological sample. Compounds capable of detecting expression or activity of a KRAS polypeptide or nucleic acid in The kit may include a substance or agent for detecting MTAP polypeptide or a polypeptide fragment in a biological sample. The compound may include a compound or agent capable of detecting the expression or activity of a nucleic acid. Alternatively, the agent can be packaged in a suitable container. The kit may further include: Use kits to detect RAS and / or MTAP protein or nucleic acid molecules The instruction manual may include instructions for:

[0285] In one aspect, the present invention provides a method for treating cancer that may benefit from a cancer treatment comprising a diet substantially lacking serine. A kit for use in identifying elephants comprising: a.An agent that seeks expression or activity of Kras; b. A kit is provided comprising:

[0286] The kit may further include an agent that determines the expression or activity of MTAP.

[0287] In another aspect, the present invention provides a method for the preparation of a polypeptide comprising: i) substantially lacking serine; and / or ii) cysteine. -KIT FOR USE IN IDENTIFYING SUBJECTS WHO WILL BENEFITED FROM CANCER TREATMENT COMPRISING A POLYPROPYLENE-RESTRICTIVE DIET - Patent application Is: a. an agent that seeks MTAP expression or activity; b. A kit is provided comprising:

[0288] In the kits of the invention, the agent can be an antibody or a nucleic acid molecule.

[0289] In an antibody-based kit, the kit includes: (1) a polypeptide marker of the invention (e.g., A first antibody (e.g., attached to a solid support) that specifically binds to a target protein (e.g., KRAS or MTAP). and optionally, (2) a polypeptide marker or a first antibody that binds to the probe. and a second, different antibody that binds to the exocytable agent.

[0290] In an oligonucleotide-based kit, the kit comprises: (1) a biomarker (e.g., KRAS or MTAP) nucleic acid molecules, e.g., nucleotide probes that hybridize to the nucleic acid molecule For example, a detectably labeled primer or (2) a primer for amplifying a biomarker nucleic acid molecule. The primer pair may include

[0291] The kit may also include components necessary for detecting the detectable agent (e.g., an enzyme or a substrate). The kit may also include a test sample that can be assayed and compared to the test sample contained therein. Possible control samples or a series of control samples may be included.

[0292] The kit may also include instructions for use.

[0293] In one embodiment, where the kit determines KRAS expression or activity, the kit includes A biological sample with a higher Kr than a control sample or a predetermined reference level The level of expression or activity of as indicates non-responsiveness or non-susceptibility of the subject to the cancer treatment. and a biological sample that is low compared to a control sample or a predetermined reference level. The level of Kras expression or activity in a sample or in a control sample or a defined reference A level of Kras expression or activity that is substantially the same as the control level is indicative of a response to the cancer treatment. The subject's response or susceptibility to the test compound is indicated.

[0294] In one embodiment, where the kit determines the expression or activity of MTAP, the kit includes a control sample. MTA of a biological sample that is low compared to the sample or compared to a predefined reference level The expression or activity level of P or the subpopulation of the target substance compared to a control sample or a predefined reference level. The levels of MTAP expression or activity that are substantially the same indicate the subject's response to the cancer treatment. The instruction includes instructions that the subject demonstrate responsiveness or sensitivity. EXAMPLES

[0295] Example 1 ( Figures 1, 2, 3, 4, 18, 19, 20, 21, 22, and 23 ) method Cell lines and cell culture DLD1 and SW480 cells were obtained from ATCC and purchased from Promega GenePro. The iKRAS cells (iKRAS1, iKRAS3, AK1 96) was kindly assisted by Ron DePinho (Ying et al., Cell, 2012), (The University of Cell culture media was purchased from GIBCO. The product numbers are shown in parentheses. SW480 and iKRAS (DMEM-21969 ) and DLD1 (RPMI-1640-31870) in a final concentration of 2 mM L-glutamine. The medium was supplemented with 10% FBS (10270), penicillin-streptomycin and amphotericin. iKRAS cells were maintained in defined medium supplemented with tericin. In the presence of phosphorus 2ug / ml (KRAS-on) and with / without doxycycline Cells were grown in (KRAS-on / off) medium for experiments. Cells were incubated at 37°C in 5% CO The cultured cells were maintained in a humidified incubator. a) was routinely tested for mycoplasma.

[0296] Proliferation assay iKRas cells were cultured in 24-well plates in complete DMEM medium + 2ug doxycycline Cells were then washed with PBS and depleted of serine and glycine. with or without doxycycline 2ug / ml Triplicate wells were then cultured at 48 and 96 hours using the "time = 0" plate. Using the Casy TT cell counter (Innovatis, Roche Applied Science) ) and the relative cell numbers from the time of medium change were calculated. Data shown are from three independent This is based on experiments conducted.

[0297] Metformin in vitro assay DLD1 and SW480 cells were seeded in 24-well plates and allowed to attach overnight. The cells were washed with PBS and then incubated with a defined dose of doxorubicin with or without serine and glycine. The cells were fed with assay medium with or without cyclin and grown for 3 days. The wells were photographed using a light microscope and counted using a Casy TT cell counter. In a dose-response experiment (Fig. 23e), cells were treated with serine and glycine. Assay medium without glycine or with low serine and glycine (10 uM) was used. Cells were seeded identically in either Seiy medium or Say medium, and triplicate wells were counted after 3 days.

[0298] Organoid culture ADF = 2 mM glutamine, 1% penicillin / streptomycin solution, 0.1% 10 mM AlbuMAX I BSA, 10 mM HEPES (all Gibco / Life Technologies ) in Advanced DMEM F / 12. Adenomas were isolated from the small intestine of mice. The pieces were then cut into small pieces and washed five times with ice-cold PBS. The pieces were then diluted with 5 mM EDTA for 10 min. The crypts were washed twice with ice-cold PBS to remove EDTA. The cells were then removed and incubated in 10x trypsin for 30 minutes at 37°C. The supernatant was collected and washed briefly with 5 mL of ADF five times by mechanical pipetting. The crypts were pelleted by centrifugation at 1200 rpm for 5 min. The crypts were incubated with growth factor-low Resuspend in reduced Matrigel (BD Biosciences) and add 20 μL to each well of a 12-well plate. The Matrigel was allowed to solidify in a 37°C incubator for 30 minutes, and then 0 0.05 μg / ml EGF and 0.1 μg / ml Noggin (total volume of 1 ml per well) The appropriate ADF supplemented with 100 mg / mL of 100% ethanol was added. Crypts were split by harvesting in ice-cold PBS. The supernatant was aspirated and the pellet was removed using a mechanical pipette. Using a centrifuge, separate the cells in 100 μL of ice-cold PBS. Add 5 mL of PBS to the tube. The mixture was added, spun at 600 rpm for 3 minutes, and repeated until the supernatant was free of debris. The crypt pellet was resuspended in growth factor-reduced Matrigel and plated as before. For lysine deficiency, amino acid-free Advanced DMEM F / 12 (Gibco / Life Technologies hnologies) with or without serine and glycine, and all other amino acids An assay medium for organoids was constructed containing:

[0299] Diet After weaning, the mice were fed a “normal chow diet” (Rat and Mouse Breeder and Grower, 801730, Special Diet Services, SDS, UK) and water were provided ad libitum. Amino acids are made from raw materials (wheat, wheat flour, barley, soybeans that have had their husks removed and roasted until golden brown, Total protein from the corn, corn meal, and fish meal, plus a small amount of refined protein added as a supplement. Derived from lysine. Baker Purified Amino Acid Diet (Hirakawa et al., Nutr. Res. 19 Based on the results of the study, two sets of experimental diets from TestDiet (Richmond, IN) were used: Diet 1-Control" contained all essential amino acids plus serine, glycine, glutamine, arginine, and arginine. , cystine, and tyrosine, and "Dietary l-serine, no glycine" is dietary l-serine, no glycine. 1 - Same as control, but without serine and glycine to achieve the same total amino acid content The levels of other amino acids were increased proportionately to achieve the desired effect. It was also used in (Maddocks et al, Nature, 2013, and see below under "Xenotransplantation" (See references). Diet 2-control contained all essential amino acids plus serine, glycine, and glutamate. thamine, arginine, cystine, tyrosine, alanine, proline, glutamic acid, and Contains asparagine; "Diet 2-No Ser, No Gly / Diet 2-SG Free" is Diet 2 - Same as control, but without serine and glycine, and with the same total amino acid content The levels of other amino acids were increased proportionately to achieve this. c-Tigar - / - cohort (Fig. 19f). All other cohorts were The rats were fed the “Diet 1” formulation published in

[0300] mouse All animal research must be conducted in accordance with the Animals (Scientific Procedures) Act 1986 and EU Directive 2010 The animal studies were performed in accordance with the Institutional Ethics Review Process (University of Glasgow). A cohort of house mice was housed in a pen with active environmental enrichment. The cells were housed in a facility equipped with Eμ-Myc11, ApcMin / +, Lgr5creER;A pcfl / fl and Pdx1cre;KrasG12D;Trp53fl / + or T The rp53R172H / + mice / model have been described previously. A mixed population of females was used for each genotype. The number of mice (or individual mice) The number of samples (number of samples per figure) is shown in each figure / figure legend. The lineages were C57BL / 6J for at least 20 generations. fl mice were at least 50% C57BL / 6J. Mice were cultured at the appropriate time Diet: pure Eμ-Myc 60 days old, Eμ-Myc;Tigarfl / f l, 55 days after birth, ApcMin / +, 80 days after birth, Lgr5creER;Apcfl / fl, 7 days after injection, Pdx1cre;KrasG12D;Trp53fl / + or Trp53R172H / + mice were injected with Lgr5creER recombination on day 60 after birth. by two intraperitoneal injections of 120 mg / kg tamoxifen with a rest day in between. In the phenformin experiment, Eμ-Myc mice were given 100 mg / kg of mouse body weight The metformin experiment was started on the same day as the dietary change. in / + mice were given 200 mg / kg / day in drinking water, starting 4 days after dietary change. All mice were followed until clinical endpoint. Tumor number and tumor area (width × length) were To facilitate scoring of the serotonin level, the intestines of ApcMin / + mice were incubated with methacin (Methanostat) The ratio of ethanol, chloroform, and acetic acid was fixed at 4:2:1.

[0301] The sample size in the mouse study was such that potential differences in survival could be estimated using the Mantel-Cox The estimated values ​​from previous experiments using these models were tested by log-rank analysis. The first experimental group (e.g., Eμ-Myc and APCMin / + fed only diet) After collecting these data, subsequent group sizes were reduced to minimize the number of animals used ( For example, phenformin and metformin treatment groups. In all experiments, enrollment in the study Only mice with obvious phenotypes at the time point were excluded (i.e., not enrolled): e.g., E Signs of lymphadenopathy or thymic enlargement in the μ-Myc cohort, but not in the APCMin / + cohort Animals that died due to diseases unrelated to the tumor were included as censored cases. Mice were assigned to experimental groups according to a randomized block design. Mice were available through breeding. Mice were divided into groups based on sex and then randomly assigned to treatments. Potential sources of variation Care was taken to keep the male / female ratio similar by removing the sexes that were the same. The allocation of mice to experimental groups and the collection of endpoint data were not blinded. Ta.

[0302] Liquid Chromatography Mass Spectrometry (LCMS) Samples were diluted with methanol, acetonitrile, and H2O (50:30:20). The serum samples were prepared in chilled (-20°C) dissolution medium (LS). 10 μL of serum sample was 490 μL of LS was added, vortexed, and precipitated proteins were removed by centrifugation. The wells were washed with PBS, then 250 μL of LS was added to each well and incubated at 40°C for 10 min with shaking. Organoid extracts were prepared by shaking the wells to remove LS and then proteinase Proteins were removed by centrifugation. Tissue samples were flash frozen and stored at -80°C. Lysis The frozen samples were weighed and then homogenized using a Precellys® homogenizer ( The lysates were homogenized in 1 mL of cold LS using a centrifuge (Bertin Technologies). Protein was removed from the lysate and the lysate concentration was determined after homogenization based on weight and standardized using LS. The extract was analyzed using an Accela 600 LC system and an Exactive mass spectrometer ( The analysis was performed on an LCMS platform consisting of SeQua A ZIC-pHILIC column (2.1 mm × 150 mm, 5 μm) (Merck) was used. The metabolites were separated using A = ammonium carbonate 20 mM (adjusted to pH 9.4) and B = acetaminophen. The separation was performed using a mobile phase containing 20% ​​A, which was increased linearly after 2 min. Use a gradient program to 80% in 17 min, followed by wash and equilibration steps. The total run time for this method was 25 min. The LC stream was desolvated and the HESI probe The Exactive mass spectrometer was operated at 500 Operated in full scan mode with a mass range of 75-1000 m / z at a resolution of 0.00. For metabolite identification and quantification, the raw data were analyzed using LCquan (Thermo Scientific). c) and analyzed using MZMine2.10.

[0303] Western blot Western blots were performed on cells as previously described (Maddocks et al, Nature, 2013 ; Labuschagne et al., Cell. Rep., 2014; Maddocks et al, Mol. Cell, 2016), briefly Total cell protein lysates were purified using complete protease inhibitors (Roche), orthovanadate, Prepared in RIPA buffer supplemented with sodium and sodium fluoride (both Sigma). The tissue samples were purified using a TissueLyser II (Qiagen). RI supplemented with ase and phosphatase inhibitor cocktail (Pierce / Thermo Scientific) The lysate was removed by centrifugation and resuspended in precast 4-12% PA buffer. 'NuPAGE' or 'Bolt' gels (Invitrogen, Life Technologies) were used. The antibodies were separated and transferred to a nitrocellulose membrane. Proteins were detected using an X-ray scanner and software (Li-Cor Biosciences). A second antibody against the relevant species was used to detect and quantify the bound IRDye680 and IR Dye800 (Li-Cor Biosciences). Primary antibodies used were: PHGDH (Sigma Life Science, HPA021241), PSAT1 (Novus Biologicals, NBP1-32920), PSPH (Santa Cruz, sc-98683), actin I-19-R (Santa-Cruz, sc-1616-R), pER K[Phospho-p44 / p42 MAPK (Erk1 / 2)(Thr202 / Tyr204)](Cell Signalling Technology91 01), AMPKa1 (R&D Systems, AF3197), and phospho-AMPKT172 (Cell Signalling Technology 2535).

[0304] qRT-PCR The RNeasy kit was used along with DNase (both Qiagen) to remove DNA. RNA was extracted using the Applied Biosystems 7500 Fast R Real-Time PCR system was mixed with SYBR Green master mix (A qRT-PCR was performed as previously described (Maddocks Biosystems) using a 100% RT-PCR kit. et al, Nature, 2013). Primer (5´-3´):TGGCCTCGGCAGAAT Mouse PHGDH vs TGGAAG; Mouse PHGDH Rev TGTCATTCA GCAAGCCTGTGGT;GATGAACATCCCATTTCGCATTGG Mouse PSAT1; Mouse PSAT1 Rev GCGTTATACAGAGAGGC ACGAATG;GAGATGGAGCTACGGACATGGAAG vs mouse PS PH; Mouse PSPH Rev CTCCTCCAGTTCTCCCAGCAGCTC. Mouse ActinB was purchased from Primer Design (HK-SY-mo-900 ACTB). The sequence was obtained from Europ ins Synthesized and purified by MWG Operon.

[0305] statistics Statistical comparisons of survival data were performed using the Mantel-Cox (log-rank) test. The results were calculated using Graphpad Prism (v6) software. The settings are stored in Microsoft Excel (v14.6.1) or Graphpad P Executed using either rism(v7). type1 / compatible (same sample) type-2 / independent (samples taken from different animals) and type-2 / independent (samples taken from different animals) T-tests When the direction of the potential difference was not predicted, a two-tailed / two-tailed T-test was used (e.g. For example, the total amino acid level in serum samples (Figure 21). If predictions in the direction of differences between were supported, one-tailed / one-tailed T-tests were used (e.g., d e novo serine synthesis, Fig. 2d). Data presented are the average of individual data points. Sometimes the error bars are STDEV, and sometimes the data are averages of means and the error bars are S. In each case, the appropriate type of T-test or error bar is indicated on the figure. When T-tests were performed with multiple comparisons, they were P values ​​were corrected using the Holm-Sidak method using sm(v7) software. Ta.

[0306] xenograft Symmetric subcutaneous injection of 3x106 HCT116 cells was administered to 8-week-old CD-1-Foxn1n mice. u Female mice (Charles River); p53+ / + on the right flank and p53 Immediately after injection, mice were fed a control diet (n=10) formulated as follows: (containing serine and glycine as part of the amino acid mixture) or serine and and glycine-deficient diet (n=10) (Test Diet, International Product Supplies ) was taken: Ingredients of the control diet: sucrose (25.9%), cornstarch (41.8%), corn oil ( 5.0%), Baker Amino Acid Vitamin Mixture (0.2%), Baker Amino Acid Minerals Ral mixture (10.0%), sodium bicarbonate (1.0%), DL-α tocopheryl acetate (0.004%), ethoxyquin (preservative, 0.019%), choline chloride (0.1%), Amino acid premix (16.0%). Amino acid premix: L-Arginine-HCL (1.60%), L-cystine (0.64%), L-glutamine (1.60%), (1.33%), L-histidine-HCL (0.96%), L-isoleucine (1.0 7%), L-Leucine (1.60%), L-Lysine-HCL (1.87%), L-Methionine N-aminobutyric acid (0.80%), L-phenylalanine (1.07%), L-serine (1.33%) , L-Threonine (1.07%), L-Tryptophan (0.27%), L-Tyrosine ( 0.53%), L-valine (1.07%). The serine- and glycine-free diets were significantly lower than the control diets. The basic formula is the same, but the amino acid mix lacks serine and glycine. Ingredients of glycine-free diet: sucrose (25.9%), cornstarch (41.8%), Corn oil (5.0%), Baker amino acid vitamin mix (0.2%), Baker Amino acid mineral mixture (10.0%), sodium bicarbonate (1.0%), DL-α tocopherol Ethyl acetate (0.004%), ethoxyquin (preservative, 0.019%), choline chloride (0 .1%), Amino Acid Premix (16.0%). Amino Acid Premix: L-Arginine -HCL (1.60%), L-Cystine (0.64%), L-Glutamine (1.60% ), L-histidine-HCL (0.80%), L-isoleucine (1.28%), L-lo Lysine (1.92%), L-Lysine-HCL (2.24%), L-Methionine (0.96 %), L-phenylalanine (1.28%), L-threonine (1.28%), L-triamine (1.28%) L-ptophan (0.32%), L-tyrosine (0.64%), L-valine (1.28%).

[0307] The diets were of equal caloric value and had equal total amino acid content. The animals were housed in sterile IVC cages. The animals were then allowed to incubate and monitored three times a week until the tumors reached a predetermined size (volume = (length x width2) / 2) or ulcerated. All animal studies were conducted ethically and ethically. It has been approved by a scientific review process (University of Glasgow) and is listed in the UK Animals (S This study was carried out in accordance with the Proceedings of the National Institute of Standards and Technology (PPL60 / 4181) and EU Directive 2010.

[0308] result Activation of KRas and loss of p53 (Kras G12D p53 + / - ) or Mutation ( Kras G12D p53 R172H We tested two mouse models of pancreatic cancer caused by Surprisingly, in both models, there was no significant increase in response to a serine / glycine-free diet. No significant changes in survival time were observed (Figure 1a and b), except for serum selenium. The levels of lysine and glycine were clearly decreased (Fig. 3a and b). 13 C- 15 N-labeled Intravenous administration of phosphate resulted in comparable serine uptake in normal and tumor pancreatic tissues. On the other hand, intestinal tumors in the APCmin model showed significantly higher levels of cytotoxicity (serine and serine-dependent cytotoxicity) than normal tissues. Incorporating significantly more serine (as measured by subsequent glycine labeling) (Figure 1c These results suggest that APCmin tumors have a high demand for exogenous serine. This is consistent with the sensitivity of APCmin tumors to dietary serine restriction. However, pancreatic tumors appear to be less dependent on exogenous serine, which may explain the lack of dietary serine. This paper describes the resistance of pancreatic tumors to gliomas with gliomas-resistant leukemia virus (LAV

[0309] A clear difference between the lymphoma / intestinal tumor model and the pancreatic model is the increased expression of activated K Activated Ras induces macropinocytosis, i.e., cell proliferation. through a mechanism that may reduce dependency on free circulating serine levels. It has been shown that the SSP pathway enhances the ability of cells to access proteins. Overexpression of the enzyme could also eliminate the dependency on extracellular serine, so the researchers KRas on the ability of these cells to synthesize vo serine G12D Examining the effects of expression The researchers determined that doxycycline-induced Kras G12D Pancreatic cells with Using KRas G12D At both the RNA and protein levels, S We found that SP enzyme expression was consistently decreased (Fig. 1d and e). G12D Cells expressing Kr were completely resistant to serine and glycine deprivation. as G12D Inactivation of β-lactamase slows the growth rate of these cells in complete medium and importantly Fortunately, Kras G12D Cells lacking this gene regain sensitivity to serine deprivation, In serine- and glycine-free medium, there was a further decrease in proliferation (FIG. 1f).

[0310] The researchers also used an organoid culture model to investigate the role of Kras G12D Expression is We tested whether APCmin could confer resistance to phosphoryl-sensitive intestinal tumor cells. The ides were grown as spheres in vitro, consistent with our in vivo studies. However, the growth of these organoids was hindered by serine and glycine deprivation (Figure 2a). In contrast, APCmin / Kras G12D Effects of serine deficiency on organoids The effect of glycine on the expression of glycine was much less than that of serine- and glycine-free culture (Fig. 2a). Due to the growth of APCmin organoids, their function is poorly restored after reseeding in complete medium. While damaged, Kras G12D The expressing organoids recovered rapidly (Fig. 2b and Fig. 28) These phenotypic changes were due to the Kras G12D Like SSP enzymes in expressing intestinal cells This was due to the high basal expression of SSP (Fig. 2c). To test SSP activity in these cells, we used the 100% ... They 13 Organoids were grown in medium containing C-labeled glucose and labeled The levels of glucose and serine (synthesized from glucose) were measured (Fig. 2d). Labeled glucose levels were measured using APCmin and APCmin Kras G12D Equivalent in cells The glucose uptake function of these cells was shown to be equivalent, whereas the labeled Rin's level is Kras G12D Kras expression was significantly higher in cells expressing Kras G12D In expressing cells This supported the idea that the serine synthesis rate was faster in the presence of β-

[0311] Analysis of serum amino acids in GEM models for PDAC demonstrated that dietary It was shown that glycine and serine levels were significantly decreased by 100% glycine (Fig. 3a and and b) levels of other amino acids were unchanged or showed minor / inconsistent changes. Despite this systemic reduction in serine and glycine, PDAC tumors were Its ability to upregulate de novo serine synthesis may provide a countermeasure against serine / glycine deficiency. In contrast, the resistant IL-17 was observed in xenografted human colon cancer cell lines (HCT 116) Tumors formed in nude mice were sensitive to dietary serine / glycine deficiency. In a xenograft model, a serine / glycine-free diet caused a significant decrease in tumor volume. This induced a significant reduction in the expression of β-lactamase (Figure 4a) and significantly extended the survival time of the mice (Figure 4b).

[0312] To assess whether the observations made in the xenograft model were applicable to spontaneous tumors, lymphomas were for tumors (based on Eμ-Myc expression) and intestinal tumors (based on defective APC expression) We used a model developed by the authors. Mice were 60-80 days old and then switched from a normal chow diet to a diet of 100 mg / kg / day. After the transition to a test diet, precancerous lesions developed (APC a few days after birth). Min / + Mouse Adenoma initiation occurred, and Eμ-Myc mice developed neoplasia within 28-42 days of age. In both genotypes, the effect of treatment (rather than prevention) was reproduced. A glycine- and glycine-free diet significantly extended survival (Fig. 18a and b). M in / + Tumor area in mice was measured using serine / glycine-free diet mice at clinical endpoint. There was a small but significant trend towards a reduction in tumor size in the 100-mg / kg / day group, but no clinical endpoints. The results showed that there was no significant difference in the number of tumors in mice fed a serine / glycine-free diet at the time of administration (Figure 2). 0).

[0313] Liquid chromatography mass spectrometry (LCMS) analysis of serum samples demonstrated that dietary serine and glycine levels, but had no effect on other amino acids. showed minimal or no consistency (Fig. 18c and d, Fig. 21a and b These changes ranged from approximately 150 μM in the control diet to 6 μM in the serine- and glycine-free diet. This resulted in a reduction in serum serine and glycine of 5 μM (Figure 18e). Induced intestinal tumor model (Lgr5-creER APC fl / fl ) to determine the quality of the diet. The protective effect of IFN-α was further examined; in this case, mice were placed on chow 1 week after tumor induction had begun. The diet consisted of either a control diet (containing purified amino acids) or a normal solid diet (containing amino acids). This significantly extends survival time compared to diets that contain total protein as a source of amino acids. (Figure 18f).

[0314] Serine deficiency activates de novo serine synthesis and converts glycolytic intermediates into energy. Cells respond by increasing OXPHOS to maintain ATP levels. In conclusion, inhibiting OXPHOS may enhance the antiproliferative effects of serine depletion. To test whether this also applies to spontaneous tumor models, we investigated the effect of serogroup A on the expression of serogroup B in Eμ-Myc mice. Phosphorus and glycine deficiency, combined with the biguanide phenformin (a complex I inhibitor) The highest dose of phenformin (100 mg / kg / day) was well tolerated by mice on a normal diet. However, mice fed a serine- and glycine-deficient diet showed significant toxicity (similar to defecation disorder). This forced the researchers to reduce recruitment to the study, but Mice that were supplemented with DMSO and did not succumb to toxicity (7 / 14) had no further adverse effects. These mice were maintained on a diet with phenformin, and the mice were There was a trend towards improved survival compared with animals on a lysine-free diet alone. Due to toxicity of the drug, too few mice survived to make this effect statistically significant. These results are consistent with previous studies and suggest that the tumor allograft system 1 shows the synergistic effect of serine depletion and biguanide treatment in .

[0315] To further explore the potential synergistic effects of biguanide treatment and serine depletion, we , which is less toxic and is widely used in clinics as an antidiabetic drug and is being investigated as an anticancer drug. We focused on metformin, which has been shown to have poor systemic availability. However, some tissues (including the intestine) express the OCT1 transduction that promotes metformin uptake. expressing the transporter and APC Min / + Making mice a viable model. This is equivalent to a daily human dose of 1 g / day (based on body surface area calculations), and in mice The metformin dosage (200 mg / kg / day) was selected for this study. The dose has been used in many metformin clinical trials in colorectal cancer, i.e., They chose a clinically relevant dose but to avoid the toxicity seen with phenformin. However, although the beneficial effects of serine deficiency persisted, A PC Min / + We were unable to detect a significant effect of metformin on the survival time of mice. (Fig. 19b and Fig. 22 and b). Interestingly, metformin In this study, the number of tumors present in both dietary groups increased (statistically in the serine- and glycine-free diet groups). The results showed that the mean tumor area was not substantially altered (Fig. 22c). The result is Villin creER ;A.P.C. fl / fl Intestinal tumor organoids derived from mice This is surprising given the ability of metformin (1000 μM) to cooperate with serine depletion in Although the tumor-organoid data also showed that low-dose metformin inhibited serine / glucose uptake in the tumor (Fig. 19d), We showed that methotrexate antagonized and protected tumor cells from glycine deficiency (Fig. 19d). These dose-dependent effects of formin (protection against the effects of serine and glycine deficiency) or enhancing the effect of the compound on reactive oxygen species (ROS) levels. It is likely related to the effects of metformin, and ROS levels were significantly higher at low doses of metformin. It decreases with metformin and increases with high doses of metformin (Figure 19e).

[0316] To investigate why metformin treatment appeared to be ineffective in serine / glycine-deficient mice, To determine the mechanism of action of metformin in the treatment of metformin-treated mice, serum and tissue samples were analyzed by mass spectrometry. Serum and tissue analysis (Figures 23a, 23b, and 23c) revealed that metformin levels is relatively low, and in that range it (potentiates) the antiproliferative effects of serine and glycine deficiency. Serum glucose and lactate analyses showed that These low levels of metformin have been shown to have minimal effects on systemic metabolism ( At these concentrations, metformin inhibited the serine / glycine-deficient APC-deficient olfactory responses. There was no synergistic effect with ganoids (as discussed above, Fig. 19d) and APC-truncated colonocytes In the strain, the cell number tended to increase at 20 μM (Figure 23e). It has long-known antioxidant properties, including upregulation of endothelin and endothelin, and the researchers improves cell viability by protecting against ROS during serine and glycine depletion Therefore, this study also demonstrated clinically relevant doses and tissue penetration. However, this suggests that metformin levels were too low to inhibit tumor growth. This is metformin, albeit at a high dose, and APC Min / + Medium tumor area in mice This contrasts with previous studies showing a decrease in gliomas (without change in tumor numbers).

[0317] We have previously shown that serine depletion makes cultured cells more sensitive to ROS. Therefore, increasing ROS levels in vivo may enhance the antitumor effect of the serine-depleted diet. To directly test whether TIGAR enhances the expression of thyroid hormone, we used mice lacking TIGAR. The protein has been shown to support tumorigenesis by limiting ROS. In a mixed strain background, expression of Eμ-Myc was higher than that of pure Bl6 Eμ-Myc. The mice died of lymphoma more quickly (Fig. 18a), but as expected, Tiger We found that the survival time was extended after the deletion (Figure 19f). Importantly, the deletion of Tiger The combination of a serine- and glycine-free diet with cerebrospinal fluid showed improved efficacy, with a significant improvement in survival time. These data suggest that increasing tumor ROS levels showed improved survival when combined with a serine- and glycine-free diet. Many chemotherapy drugs and radiation therapy induce ROS. Therefore, there is great potential to combine this diet with standard anti-cancer treatments.

[0318] Example 2 (Figure 5 and Table 1) method HCT116 (6000 cells per well), DLD1 (6000 cells per well) Cells (10,000 cells per well) and SE480 (10,000 cells per well) were plated in 96 well plates. In the present study, the ribozyme contains or lacks serine and glycine (but all other amino acids are After 6 hours, the cells were seeded in either the medium containing the specified drug at a specified dose (0.1-1 0 uM) were added to the plates and the cells were incubated for an additional 48 hours. Afterwards, the cells were fixed in formalin (4%) solution and stained with DAPI nuclear dye. was performed using the Operetta system, and the results are shown in Figure 5.

[0319] Human cell lines HCT116, DLD1, and SW480 were cultured in 96-well plates. Contains phosphorus, glycine, and cysteine ​​at 100uM, with all other amino acids present Complete medium or low serine, glycine, cysteine ​​( After 6 hours, the indicated chemotherapy drugs were added to the wells. (at doses of 0.01, 0.1 and 1uM) and incubated the cells for an additional 48 hours. After this time, the cells were formalin fixed and plated in an automated (Operetta) plate reader. Cells were stained with a fluorescent nuclear dye for cell counting at 100 nm. Cell count data were used to A score is derived to determine which drugs are given in combination with low serine / glycine / cysteine. We then calculated whether the effects were synergistic (i.e., greater than additive) when the two drugs were administered together (see below). The results are shown in Table 1.

[0320] The data presented in Figure 5 demonstrate that a number of anticancer chemotherapeutic drugs (from multiple drug classes) inhibit serine and when combined with glycine deficiency, enhanced antiproliferative activity in human cancer cells. Therefore, this data supports the finding that serine and glycine free ATPases are important in cancer patients. Combining diet with conventional chemotherapy enhances the antitumor activity of chemotherapy. This suggests that it may be possible to use lower doses of chemotherapy and / or chemotherapy.

[0321] Table 1 shows the combination of specific drugs with the reduction of serine, glycine, and cysteine ​​in the medium. The average synergy score across the three colon cell lines is shown.

[0322] [Table 1-1] [Table 1-2]

[0323] The data shown in Table 1 were obtained from the serine- and glycine-free diet or the serine-, glycine-, and low levels of serine (as occurs in vivo with a cysteine-free diet); Human cancer cells exposed to glycine and cysteine ​​inhibit the antiproliferative effects of a number of chemotherapy drugs. The chemotherapy drugs listed in Table 1 are low in serine and glycine. synergistic effect on antiproliferative activity when combined with cysteine, cysteine, and cysteine; i.e. The antiproliferative effects of each drug in combination with amino acid restriction were comparable to those of the drugs given alone. This is greater than the sum of the effects of amino acid restriction alone. Therefore, this data is Serine and Glycine / Serine-, Glycine-, and Cysteine-Free Diet and Conventional Chemotherapy Combining these drugs can enhance the antitumor activity of chemotherapy and / or reduce the cost of chemotherapy. This suggests that it may be possible to use it at a lower dose.

[0324] Example 3 (Figures 6, 7, 10, and 11) method C57Bl6 mice (n=3 per dietary group) were fed a control diet (see above "Diet 2-Control" (see above) or a diet lacking serine and glycine (see "Diet 2-No Ser, No Gly" above). ") for 6 weeks. Terminal serum samples were analyzed by LCMS as described above. The relative amounts of essential amino acids are shown. *P<0.05 unpaired t-test. The results are shown in FIG.

[0325] Cell culture: HCT116 and RKO cells were a gift from Prof. Bert Vogelstein. SW480, A549, MDA-MB-231, MDA-MB-468, and MCF7 Cells were obtained from ATCC. Cell culture products were obtained from Gibco unless otherwise stated. ; Catalog numbers are shown in parentheses. Cells were cultured at 37°C in a humidified atmosphere of 5% CO2 in air. The cells were grown in 10% fetal bovine serum (FBS; 10270) and penicillin- McCoy's 5A medium (26600) supplemented with streptomycin or 10% FB S(G10270), supplemented with 2 mM L-glutamine, and penicillin-streptomycin For starvation experiments, the cells were maintained in DMEM (21969) containing serine and glycine. The “assay medium” was supplemented with dialyzed FBS (HyClone, Thermo Scientific), 2 mM L-glutamate, and 10 mM glycerol. Min, D-glucose (Sigma-Aldrich; final concentration 17 mM), MEM vitamins (11120) , and formulated with MEM (21090) supplemented with penicillin-streptomycin. .

[0326] Uptake / efflux assay: Defined cells were plated in complete medium in 6-well plates (for assays (at an appropriate seeding density that results in ~90% confluence by the end of the experiment) and allowed to grow for 48 hours. At the start of the assay, cells were washed with PBS and Assay medium supplemented with both serine and glycine (0.4 mM) was added per well. At the specified time points, 10 μL of medium was removed and replaced with 490 μL of ice-cold methanol. The samples were then added to a 50:30:20 mixture of acetonitrile and H2O. The mixture was prepared for LC-MS as described above.

[0327] Liquid chromatography-mass spectrometry: Samples were shaken for 10 min at 4°C, then incubated for 15 min. The mixture was centrifuged at 16,000×g for 1 h, and the supernatant was collected and analyzed by LC-MS. SeQuant ZIC-pHILIC column (2.1×150mm, 5μm) (Merck ) and separated using hydrophilic interaction liquid chromatography with Orbitrap Exactive with Accela autosampler and Accela 600p Detection was by high resolution accurate mass mass spectrometry using in conjunction with an ump (Thermo Scientific). The elution buffers were acetonitrile for buffer A and 20 mM (N The linear gradient was run at a flow rate of 100 μL / min. , starting with 80% buffer A and ending with 20% buffer A after 20 min, followed by a wash (20 The mixture was programmed to be run in 200 mL of 10 ... Equip the mass spectrometer with an electrospray ionization probe and run a full scan and 4. The device was operated in polarity switch mode with a positive voltage of 5 kV and a negative voltage of 3.5 kV. Levels of ATP and glycine were quantified using a five-point calibration curve in cell lysates and medium. Metabolite identification and data analysis were performed using LCQUAN software (Thermo Scientific). The results are shown in Figure 7.

[0328] result The data presented in FIG. 7 show that removing serine and glycine from the diet also reduces the Even in the presence of cysteine / cystine, the cysteine / cystine level in vivo This effect is due to the fact that serine is involved in the de novo cysteine ​​synthesis. This is likely due to the use of amines in the synthesis of amines (see Figures 10 and 11). It also inhibits methionine, an essential amino acid that is also the precursor of cysteine ​​in vivo. Dietary restriction of 100 mg / kg / day further depletes whole-body cysteine ​​levels in vivo. The data presented in Figure 7 suggest that cancer cell lines from multiple forms of cancer are avid exogenous This indicates that cancer cells consume endogenous cysteine / cystine to grow. Requires native cysteine, indicating that de novo cysteine ​​synthesis may be defective (See Figures 10 and 11).

[0329] Example 4 (Figures 8, 9, 12, and 13) method The specified cells were seeded in a 24-well plate at 2x10^4 to 1x10^5 per well. The cells were then washed once with PBS and the experimental growth medium was added. , serine, glycine, cysteine, and all other amino acids, complete (+SGC) or lacking only serine and glycine (-SG), or lacking cysteine (-C). Use a separate "time 0" counting plate to record the starting cell number. The medium was changed every 24 hours and the plates were counted after 2 and 4 days. The target cell number was calculated by comparing with the cell number at "time 0". The cells were then purified by psoriasis, resuspended in PBS-EDTA, and incubated with CASY Model TT Cell column. The cells were counted using a counter (Innovatis, Roche Applied Science). Data were collected in triplicate. The results are shown in Figure 8.

[0330] Defined cells were plated in 24-well plates at defined concentrations (ranging from 500uM to 0.16uM). Serine, glycine, and cysteine ​​are abundant (but all other amino acids are abundant) The cells were seeded in the medium (at 2x10^4 to 1x10^5 per well) and incubated for 48 hours. For counting, cells were trypsinized, resuspended in PBS-EDTA, and incubated for 2 h at 37 °C for 1 h. SY Model TT Cell Counter (Innovatis, Roche Applied Science) The results are shown in FIG.

[0331] The specified cells were seeded in a 24-well plate at 2x10^4 to 1x10^5 per well. The cells were then washed once with PBS and the experimental growth medium was added. , complete with all amino acids (+all AA), or missing only serine and glycine ( -Ser Gly), serine, glycine, asparagine, aspartic acid, proline, and and glutamic acid (-Ser Gly Asn Asp Pro Glu), or or lacking serine, glycine, and tyrosine (-Ser Gly Tyr), or It either lacks serine, glycine, and cysteine ​​(-Ser Gly Cys) or It lacks phosphorus, glycine, and arginine (-Ser Gly Arg). The starting cell number was recorded using a "0" counting plate. The medium was changed every 24 hours. Plates were counted after 2 and 3 days. Relative cell counts were calculated based on the "time 0" cell count. The counts were calculated by comparing the number of cells to the number of cells in the PBS-EDTA solution. Resuspend the cells and measure them using a CASY Model TT Cell Counter (Innovatis, Roche Appli Data are the average of triplicate wells and error bars are the standard deviation. The results are shown in Figure 12.

[0332] HCT116 cells were seeded at 4x10^4 per well in a 24-well plate. The cells were then washed once with PBS and the experimental growth medium was added. It is either complete with all amino acids in the sequence or contains the individual amino acids (tyrosine / arginine / synergy) as defined lacking a given amino acid combination (tyrosine / arginine / synergy) or A separate "time 0" counting plate was used to count the 1000 cells / mL of 10000 sera (stain / serine / glycine). The starting cell number was recorded. Medium was changed every 24 hours and plates were counted after 4 days. The change in cell number was calculated by comparison with the cell number at "time 0" and expressed as a percentage. For example, for cells in complete medium, the cell number after 4 days was calculated as 0% at time 0. The negative percent change from time 0 was 1400%. Cells with a negative percent change from time 0 were those that underwent cell death. For counting, cells were trypsinized and diluted in PBS-EDTA The cells were resuspended in 50 mL of 10 ... Data are the average of triplicate wells, and error bars indicate The results are shown in Figure 13.

[0333] result The data in Figures 8 and 9 show that removal of exogenous cysteine ​​reduces the expression of endogenous cysteine ​​in cancer cells from multiple cancer types. Inhibits proliferation, and in vitro cysteine ​​depletion inhibits cancer cell proliferation. It was found to be highly effective, achieving greater growth inhibition than serine and glycine depletion alone. FIG. 12 shows the identity of the exogenous non-essential amino acids that were removed (i.e., were deficient in the cells). This shows that the combination of serine determines the degree to which proliferation is inhibited in cancer cells. The antiproliferative effect of removing only glycine was greater than that of aspartic acid, asparagine, proline, and glycine. The amount of glycerol in the glycerol-containing ester is minimized by removing arginine, lysine, and glutamic acid. and in combination with glycine to further remove tyrosine, arginine, and cysteine ​​individually. Figure 13 further shows that the addition of cysteine ​​or non-essential ribozymes has a more dramatic effect on proliferation. When specific combinations of amino acids are removed from cancer cells, they produce cytotoxic effects (i.e. A cytotoxic effect (more than just antiproliferative activity) can be achieved, and the cytotoxic effect is enhanced by the removal of many non-essential amino acids. It shows that the maximum value is reached when

[0334] Example 5 (Figure 14) method The expression of serine synthesis pathway enzymes (PHGDH, PSAT1, and PSPH) was measured using the serine and and in defined cancer cell lines grown with or without glycine for 48 h (top left panel). The specific cells were plated in 24-well plates and determined by Western blot (as above). The cells were seeded at 4x10^4 to 1x10^5 per well on a plate and allowed to attach overnight. The cells were washed once with PBS and growth medium containing or lacking serine and glycine was added. (Both media contain all essential amino acids, as well as cysteine, arginine, glutamine, and tyrosine.) A separate "time 0" counting plate was used to record the starting cell number. The medium was changed every 24 hours and the plates were counted after 2 and 4 days. The number of cells was calculated by comparison with the number of cells at "time 0". Process, resuspend in PBS-EDTA, and measure using a CASY Model TT Cell Counter. The data were counted using a 30-well plate counting machine (Innovatis, Roche Applied Science). The results are shown in Figure 14.

[0335] result The data in Figure 14 show that the expression levels of the enzymes responsible for de novo serine synthesis in cancer cells The expression of these proteins is important in determining the sensitivity of cells to serine and glycine starvation. We show that it affects the sensitivity of cells expressing high levels of serine synthase. are resistant to the antiproliferative effects of serine and glycine depletion, whereas low-expressing cells are sensitive. It is sexuality.

[0336] Example 6 (Figures 15, 16, and 17) method Defined cells were plated in complete medium in 6-well plates (~90% confluency by the end of the assay). The cells were seeded at an appropriate seeding density to achieve a confluent culture and grown for 48 hours (the medium was removed after 24 hours). At the start of the assay, cells were washed with PBS and diluted with both serine and glycine. Assay medium (all essential amino acids) supplemented with either 0.4 mM serine or 0.4 mM serine alone (containing riboflavin, glutamine, arginine, tyrosine, and cysteine) in one well. At the indicated time points, 10 μL of medium was removed and replaced with 490 μL of ice-cold methanol. These samples were then added to ethanol / acetonitrile / H2O (50:30:20). The samples were prepared for and analyzed by LC-MS as described below. The results are shown in FIG. and 17.

[0337] result The data in Figures 15, 16, and 17 indicate that cancer cells are able to synthesize cysteine ​​de novo. The total efflux (i.e. release) of the precursors of homocysteine ​​is derived from methionine. It is essential for the de novo synthesis of cysteine ​​in mammalian cells (Figures 10 and 11). Homocysteine ​​is lost from these cancer cells in various forms - This may potentially be due to the inability to synthesize cysteine ​​and therefore susceptibility to cysteine ​​deficiency. Homocysteine ​​is present either as an immutable molecule (homocysteine) or as a homodimer (homo and (with cysteine) heterodimers detected by mass spectrometry. It is possible.

[0338] Example 7 (Figures 24, 25, 26, 27, 28, 29, 30, 31) Cell lines and cell culture HCT116 cells were obtained from ATCC and were analyzed using Promega GenePrint10. iKRAS cells (iKRAS1, iKRAS3, AK196) were Fortunately, this was provided by Professor Ronald DePinho (Ying et al., Cell, 2012), (The Unive The center is the headquarters of Texas MD Anderson Cancer Center. Cell culture media was purchased from GIBCO. Product numbers are shown in parentheses. iKRAS (DMEM-21969) and HCT116 cells (RPMI-1 640-31870) in 10% FBS (10270), PEG-2000 (100% CO), and L-glutamine to a final concentration of 2 mM. The cells were maintained in a defined medium supplemented with nicotinamide, streptomycin, and amphotericin. The stored iKRAS cells were cultured in the presence of 2 μg / ml doxycycline (KRAS-on). Experiments were performed in the presence or absence of doxycycline (KRAS-on / off). The cells were maintained in a humidified incubator at 37°C and 5% CO2. Cells were probed for mycoplasma using the Mycoalert detection kit (Lonza). Routinely tested.

[0339] Proliferation assay HCT116 cells (2.5x10^4 per well) were cultured in a 24-well plate The cells were seeded in RPMI medium and allowed to attach overnight. Then, the cells were washed with PBS and incubated with various concentrations of cerebrospinal fluid (PBS). Phosphorus and Glycine 2 The medium was replaced with fresh medium every 24 hours. The medium was replaced with 100% ethanol. Wells were cultured at the defined time points (Casy) using the "time=0" plate. Count the cells using a TT cell counter (Innovatis, Roche Applied Science) The relative cell numbers from the time of medium change were calculated.

[0340] Tumor organoid culture ADF = 2 mM glutamine, 1% penicin / streptomycin solution, 0.1% AlbuMAX I BSA, 10 mM HEPES (all Gibco / Life Technologies) Advanced DMEM / F-12 containing 100% ethanol. The adenomatous small intestinal tissue was excised and cut into small pieces. The pieces were then soaked in 5 mM EDTA for 10 min at 4° C. and washed five times with ice-cold PBS. The crypts were washed twice with ice-cold PBS to remove EDTA and incubated for 1 h. 0x trypsin for 30 min at 37°C. The crypt-rich supernatant was collected. The crypts were washed five times with 5 mL of ADF by mechanical pipetting. The crypts were pelleted by centrifugation at 1200 rpm for 5 min. The cells were resuspended in 100% DMSO (BD Biosciences) and 20 μL was plated in each well of a 12-well plate. The Matrigel was solidified in a 37°C incubator for 30 minutes, and then 0.05 μg Supplement with 0.1 μg / ml EGF and 0.1 μg / ml Noggin (total volume of 1 ml per well) The appropriate ADF was added. Crypts were split by collecting in ice-cold PBS and incubated for 3 min. The supernatant was aspirated and the pellet was separated using mechanical pipetting. The tube was then added with 5 mL of PBS and incubated for 3 min. The pellet was then spun at 600 rpm for 10 min and repeated until the supernatant was free of debris. The cells were resuspended in growth factor-reduced Matrigel and plated as before. We used Advanced DMEM F / 12 (Gibco / Life Technologies) with or without serine and glycine (0.2 mM) and all other amino acids. We developed an assay medium for organoids that can be used for LCMS analysis. The organoids were grown in complete medium in well plates for 3 days. The medium was aspirated and the organoids were cultured in a PBS. The medium was washed with 15 mM PBS. 13 C6-glucose (cK-Gas / Cambridge isotopes) Glucose-free Advanced DMEM / F-12 (Gibco / Life Technologies) supplemented with After 5 h, the medium was aspirated and the organoids were briefly washed with PBS. , metabolites were extracted as described below.

[0341] Imaging of organoids Organoids were cultured in culture medium containing metformin / daunorubicin (both from Sigma) or The cells were seeded in defined medium without or with HCl and grown for 2 days. Size quantification (ImageJ software) was performed. Images for the 4-well plate (performed using software) were taken using a light microscope, and the organoids were then plated for 4 h. % paraformaldehyde. ROS damage was detected by staining the organoids with anti-malondialdehyde. Immunostaining was performed using hydnosidase (MDA) (Abcam, ab6463) and Alexa Fluor 594 The images were evaluated using a secondary antibody (Thermo Fisher Scientific). The MDA staining was captured on a 1,000 inverted confocal laser scanning microscope using ImageJ software. was quantified using software.

[0342] Liquid Chromatography Mass Spectrometry (LCMS) The samples were diluted with methanol, acetonitrile, and HO (50:30:20). The serum samples (10 μL each) were prepared in chilled (-20°C) dissolution medium (LS). (isolated from end-blood blood and stored at -80℃) was added to 490 μL of LS, vortexed, and precipitated. Proteins were removed by centrifugation (15,000 rpm for 10 min at 40°C). The wells were washed with excess PBS, then 250 μL of LS was added per well and incubated on rocking. Place the plate on a shaker at 4°C for 10 minutes to remove the LS from the wells (organoids / matrigel). without mechanical disruption, followed by vortexing and centrifugation to remove Organoid extracts were prepared. Tissue samples were flash frozen and stored at -80°C. Lysis The frozen samples were weighed before and after the analysis. The tissue was then homogenized using a Precellys® homogenizer. Using a TissueLyser (Bertin Technologies) or TissueLyser II (Quiagen), The lysate was homogenized in 1 mL of cold LS. Proteins were removed from the lysate by centrifugation, and the lysate was Concentrations were standardized to 10 mg / mL using LS based on original tissue weight after homogenization. .

[0343] The extracts were analyzed using an Accela 600 LC system and an Exactive mass spectrometer (Thermo The analysis was performed on an LCMS platform consisting of a 2 Two LC methods were applied for the separation of metabolites. Method 1 was the SeQuant ZIC-pHILI C column (2.1 mm × 150 mm, 5 μm) (Merck), A = ammonium carbonate 20 A mobile phase of 100 mM ethyl acetate (adjusted to pH 9.4) and B = acetonitrile was used. A gradient program was developed that started at 0% A, increased linearly after 2 min, and reached 80% at 17 min. followed by wash and equilibration steps. The total run time for Method 1 was 25 min. Method 2 was performed using a ZIC-HILIC column (4.6 mm × 150 mm, 3.5 μm) (Merck ) in A = water with 0.1% formic acid (v / v) and B = acetonitrile with 0.1% formic acid. A mobile phase of 20% A was used, which was increased linearly over 30 min. A gradient program was used to reach 80% at 200°C, followed by a wash and re-equilibration step. The total run time for method 2 was 46 min. The LC stream was desolvated and analyzed by the HESI probe. The Exactive mass spectrometer was operated at 50,000 s with polarity switching. Resolution was operated in full scan mode with a mass range of 75-1000 m / z. LCMS quantification of serine and glycine was performed by diluting the amines in an appropriate matrix to match the analyzed samples. Interpreted 13 C- 15 This was achieved using a six-point standard curve using N-labeled amino acids (Sigma). For metabolite identification and quantification, the raw data were analyzed using LCquan (Thermo Scientific ) and analyzed using MZMine2.10.

[0344] Randomized Metabolomics Convert raw LCMS data to mzML files using ProteoWizard and imported into MZMine 2.10 for peak extraction and sample alignment. The generated .CSV file was used for metabolite identification and background signal removal. For this purpose, the data was imported into an in-house macro (Microsoft Excel 2010). The constant parameters have been previously described (Zhang et al., PLoS One, 2013). SIMCA14 (Umetrics) was used for the analysis. To do this, S-plots were generated for the OPLS-DA (orthogonal partial least squares discriminant analysis) model. .

[0345] Diet After weaning, the mice were fed a “normal chow diet” (Rat and Mouse Breeder and Grower, 801730, The rats were given a diet consisting of 100 mg of 100% ethanol (Special Diet Services, SDS, UK) and water ad libitum. Amino acids are made from raw materials (wheat, wheat flour, barley, soybeans that have had their husks removed and roasted until golden brown, Total protein from the corn, corn meal, and fish meal, plus a small amount of refined protein added as a supplement. Derived from lysine. Baker Purified Amino Acid Diet (Hirakawa et al., Nutr. Res. 19 Based on the results of the study, two sets of experimental diets from TestDiet (Richmond, IN) were used: Diet 1 - Control " contains all essential amino acids, as well as serine, glycine, glutamine, arginine, cystine, and tyrosine, and "Diet 1-SG Free" was the same as Diet 1-Control, except It does not contain serine and glycine, and other amino acid levels are adjusted to achieve the same total amino acid content. These "Diet 1" formulations have been used previously (Maddocks et al., 2003). (E. et al., Nature, 2013). "Diet 2-control" contained all essential amino acids, as well as serine, glycine, and arginine. contains selenium, glutamine, arginine, cystine, and tyrosine; "No, no Gly / Diet 2-SG Free" is the same as Diet 2-Control, except that no serine and glycine, and proportionally increase other amino acid levels to achieve the same total amino acid content. The "Diet 2" formulation was Eμ-Myc;Tigar - / - Used in the cohort (Fig. 2f). All other cohorts were fed the "Diet 1" formulation previously described.

[0346] Mouse-GEM model All animal research must be conducted in accordance with the Animals (Scientific Procedures) Act 1986 and EU Directive 2010 (PPLs 60 / 4181, PPL70 / 8645 & 70 / 8646) and the animal studies were carried out in accordance with the Institutional Ethics Committee. The study was approved through a review process (University of Glasgow). The mice were housed in a fenced facility with active environmental enrichment. et al., Nature 1985), Apc Min / + (Moser et al., Science, 1990; Su et al., Science, 1992), Lgr 5creER ;Apc fl / fl (Barker et al., Nature, 19 90), and Pdx1 cre Kras G12D / + ;Trp53 fl / + , or Pd x1 cre Kras G12D / + ;Trp53 R172H / + (Hingorani et al., Ca ncer Cell, 2005; Morten et al., Proc. Natl. Acad. Sci. USA, 2010) Mouse / Model Mixed populations of males and females were used for each genotype. The number of mice (or number of samples from each individual mouse) is indicated in each figure / figure legend. Eμ-Myc, and Apc Min / + Mice were cultured at least 20 generations of C57BL / 6J(B16). Eμ-Myc;Tigar - / - The mice are of mixed strain, but Both were 50% C57BL / 6J. The pancreatic (PDAC) cohort was of mixed strain background. All cohorts were on the same diet, but included littermate controls. Mice were placed on the appropriate diet at the following times: Eμ-Myc(Bl6) was taken on the 60th day after birth, and Eμ-Myc;Tiger - / -teeth 55 days after birth, Apc Min / + 80 days old, Lgr5 creER ;Apc fl / fl On the 7th day after injection, Pdx1 cre Kras G12D ;Trp53 fl / + or Pdx 1 cre Kras G12D ;Trp53 R172H / + is 60 days old. Lgr5 cr eER Recombination was evaluated using 120 mg / kg tamoxifen with a rest day between injections. In the phenformin experiment, Eμ-Myc mice were given 100 μg of Metformin was administered orally at a dose of 1 g / kg of mouse body weight starting on the same day as the diet change. In the experiment, Apc Min / + Mice were given 200 mg / kg / day in drinking water and The experiment started 4 days after the diet change. creER ;A.P.C. fl / + ;K ras G12D / + Mice [C57Bl / 6J N10] were fed the experimental diet for 2 weeks. The tumor numbers and tumor burden were then induced by a single IP injection of tamoxifen (80 mg / kg). To facilitate scoring of tumor area (width × length), the intestine was immersed in methacin (methanol, chloroform). The cells were fixed in ethyl acetate (ratio of 4:2:1) and used for staining of BrdU and caspase. n=6 APCs used Min / + Apart from the mice, all other GEM mice were humanely cultured. Cared for up to the clinical point.

[0347] The sample size in the mouse study was such that potential differences in survival could be estimated using the Mantel-Cox The estimated values ​​from previous experiments using these models were tested by log-rank analysis. The first experimental group (e.g., Eμ-Myc and APCs fed diet only) Min / + ,figure After collecting data from 18a and 18b), the size of subsequent groups will be reduced and The number of animals treated with phenformin and metformin was minimized (e.g., in the phenformin and metformin treatment groups. and 19b). In all experiments, mice with obvious phenotypes at the time of enrollment were excluded. For example, lymphadenopathy in the Eμ-Myc cohort or or signs of thymic hyperplasia, and anemia in the APCMin / + cohort. Animals that died more than 10 days before the end of the study were included as censored cases. Mice were assigned to experimental groups according to a randomized block design. As mice become available through breeding, they are divided into groups based on sex and then They were randomly assigned to treatment arms. To eliminate sex as a potential source of variation, males were randomly assigned to treatment arms. Care was taken to keep the mouse / female ratio similar. and endpoint data collection was unblinded.

[0348] Mouse - Xenografts / Allografts HCT116 cells were injected subcutaneously on both sides (3×10^6 cells per flank) to induce CD1- Foxn1 nu (CD1-nude) female mice (Charles River, UK). The mice were maintained on a normal chow diet and monitored daily until visible and measurable tumors were formed. Tumor-bearing mice were fed a control (n = 8 mice) or SG-free diet (n = 8 mice). The tumors were measured three times a week with calipers, and tumors on the contralateral flank that developed after the dietary change were The mean tumor volume during the first 5 weeks of feeding was plotted. Formula; Volume = (Length x Width) 2) / 2.

[0349] Eμ-Myc lymphoma cells were cultured in tumor-bearing lymphoma cells of mixed background Eμ-Myc mice. These cells were first isolated from irradiated mouse embryonic fibroblasts by FACS. The cells were grown in cell culture with MEFs, allowing them to grow independently. The culture medium was 10% FBS, 50 μM β-mercaptoethanol, D supplemented with penicillin, streptomycin, gentamicin, and amphotericin The cells were injected subcutaneously in one flank of the mouse in MEM / F-12 (Gibco / Life Technologies). CD1-Foxn1 nu Female mouse (Charles River, U K). Mice were maintained on normal chow until visible and measurable tumors formed. Tumor-bearing mice were placed on a control or SG-free diet and tumors were then cultured. The first mice in the cohort were assessed for clinical endpoints (tolerance). When the tumor volume reached the maximum tumor volume that can be achieved, all mice in the cohort were killed and the tumors were removed (this (The first post-feeding episode occurred 6 days after feeding.) Tumors were fixed in formalin, embedded in paraffin, and examined for histology. Sections were cut for analysis.

[0350] BrdU and caspase staining and necrosis quantification Two hours before sacrifice, mice were injected with a PBS containing BrdU (RPN201, Amersham / GE Heathcare). 250 μL of cell proliferation labeling reagent was injected. Antibody used: cleaved caspase 3 ASP-1 75 (Cell Signaling Technology, 9661), anti-BrdU (BD Biosciences, 347580), and EnVision anti-rabbit (Dako, K4003). Tissue sections were stained with hematoxylin Z (Cel The stained slides were scanned using a Leica SCN400F scanner. The images were scanned and analyzed using HALO image analysis software (Indica Labs). In μ-Myc tumors, cell counts and staining for BrdU and caspase were assessed, excluding necrotic areas. APC was quantified in all tumors with APC. Min / + In mice, a single cross-section of the entire small intestine was analyzed. , adenomas were manually identified and cell number, caspase and BrdU staining in each adenoma were quantified. Necrosis was quantified using H&E stained whole tumor cross sections. Necrotic areas were manually differentiated using the HALO software and the total necrotic versus non-necrotic surface area was calculated. The dead surface area was calculated.

[0351] Glucose and lactate quantification Serum (from terminal blood samples) of the mouse cohorts was analyzed using an Agilent 2100 Bis Glutamate was analyzed using an oanalyser (Agilent Technologies) according to the manufacturer's instructions. Course and lactate levels were analyzed.

[0352] Macropinocytosis assay Macropinocytosis analysis was based on a previously described protocol (Commis First, iKRAS cells were treated with doxycycline (KRa Cells were then grown for 48 h in medium + / - 10% CO2 (KRas-on) or without (KRas-off). -Doxycycline and + / -SG on glass coverslips for 24 h. Afterwards, the medium was replaced with matching medium lacking FBS and left for another 16 hours. The medium was supplemented with 10% FBS and tetramethylrhodamine-labeled dextran (TMR-dextran, T Replace with matching medium containing Hermo Fisher Scientific particles (0.5 mg / ml). After 30 min with dextran, the cells were washed with PBS and then soaked in 4% formaldehyde. The cells were fixed and stained with DAPI and green Whole Cell Stain (Th The cells were counterstained with Vectasheild Hardset (Vector Laser Scientific) and stained with 100% Vectasheild Hardset (Vector Laser Scientific). Images were captured using an Olympus FV1000 inverted confocal laser scanning microscope. The images were then placed under a microscope and dextran uptake was analyzed using ImageJ / Fiji image analysis software. Quantification was performed using a .

[0353] Western blot Western blots were performed on cells as previously described (Maddocks et al, Nature, 2013 ; Labuschagne et al., Cell. Rep., 2014; Maddocks et al, Mol. Cell, 2016), concise Briefly, whole cell protein lysates were purified using Complete Protease Inhibitor (Roche), Orthobana RIPA buffer supplemented with sodium diphosphate, and sodium fluoride (both Sigma). Tissue samples were prepared in a 50 mL aliquot volume using a TissueLyser II (Qiagen). and a protease and phosphatase inhibitor cocktail (Pierce / Thermo Scientific). The lysates were then lysed in supplemented RIPA buffer. The lysates were cleared by centrifugation and precast. 4-12% 'NuPAGE' or 'Bolt' gels (Invitrogen, Life Technologies The antibodies were separated using a Li-Cor Odyssey ( A trademarked infrared scanner and software (Li-Cor Biosciences) were used to measure the The protein was detected and quantified. A second antibody against the relevant species was used to detect and quantitate the bound IRDye68 protein. 0 and IRDye800 (Li-Cor Biosciences). The primary antibodies used were: PHG DH (Sigma Life Science, HPA021241), PSAT1 (Novus Biologicals, NBP1-32,92 0), PSPH (Santa Cruz, sc-98683), actin I-19-R (Santa Cruz, sc-1616 -R), pERK[Phospho-p44 / p42 MAPK (Erk1 / 2)(Thr202 / Tyr204)](Cell Signalling Technology9101), AMPKa1 (R&D Systems, AF3197), and phospho-AMPKT The result was 172 (Cell Signalling Technology 2535).

[0354] statistics Statistical comparisons of survival data were performed using the Mantel-Cox (log-rank) test. The results were calculated using Graphpad Prism (v6) software. The settings are stored in Microsoft Excel (v14.6.1) or Graphpad P Executed using either rism(v7). type1 / compatible (same sample) type-2 / independent (samples taken from different animals) and type-2 / independent (samples taken from different animals) T-tests When the direction of the potential difference was not predicted, a two-tailed / two-tailed T-test was used (e.g. For example, at the total amino acid level in serum samples (Fig. 1C / Extended Data Fig. 2a). If the data supports a prediction in the direction of the difference between the samples, a one-tailed / one-tailed T-test should be used. (e.g., de novo serine synthesis, Fig. 4c). Sometimes the data is the average of the points and the error bars are STDEV, other times the data is the average of the means. In some cases, error bars are SEM. In each case, the t-test or the corresponding The corresponding species are identified in the figure legend. When t-tests were performed with multiple comparisons, Gra Using the Holm-Sidak method with phpad Prism (v7) software and corrected the P value.

[0355] result Random metabolomics of Eμ-Myc tumor tissues (tumor-bearing spleens) fed the -SG diet The most decreased metabolites in were serine and glycine, which It was demonstrated that the diet specifically reduced tumor levels of serine and glycine (Figure 24). .

[0356] The effect of dietary SG on Eμ-myc tumor cells in vivo was Apoptosis was increased (as indicated by increased cleaved caspase 3 (CC3)) and other tumors showed that necrosis was increased in sarcoma and both effects led to inhibition or slowing of tumor growth ( Figure 25).

[0357] Tumors from PDAC and Eu-myc models when grown on control and -SG diets We also analyzed the expression of SSP enzymes in tumor tissues. These results suggest that Kras regulates SSP in These results suggest that Kras regulates the expression of β-lactamase in vivo (Fig. 26). Luganoids (3D cell cultures) were found to be the most resistant to serine and glycine deficiency. This was observed, again indicating that Kras controls the SSP (Figure 28).

[0358] Furthermore, the -SG diet suppressed serine proliferation in Eμ-myc tumors, which are sensitive to the -SG diet. This caused a decrease in phosphorus and glycine levels and a decrease in the GSH / GSSH ratio. In PDAC tumors (which harbor Kras mutations and are resistant to the diet), the -SG diet It did not reduce lysine levels or the GSH / GSSG ratio (Figure 27).

[0359] The -SG diet suppressed the growth of pre-formed xenografted HCT116 tumors in vivo. (Fig. 29a) and reduced serine and glycine levels in the tumor (Fig. 29b). b) Lower tumor levels of serine and glycine were associated with increased proliferation of cancer cells in vitro. This led to slower growth (Figures 29c and 29d).

[0360] Data in Figure 30 (in iKRAS1 iKRAS3 and AK196 cell lines) The function of Kras to obtain serine and glycine is thought to be related to micropinocytosis, a form of nutrient scavenging. The data further show that the increase in Kra S-expressing cells produce additional serine and glycine by de novo serine and glycine synthesis. Macropinocytosis supports the idea that cells obtain ricin through the release of extracellular molecules ( For example, by phagocytosing proteins (which can be broken down into amino acids) outside the cell. In cultured cells, macropinocytosis Upregulation was demonstrated by increased uptake of labeled dextran and the % of dextran stained cells In all three Kras-inducible cell lines, the labeled dextran The uptake of glycine was not increased upon serine and glycine deficiency, which may be due to the and show that glycine deficiency did not result in increased macropinocytosis.

[0361] The data shown in Figures 31a and 31b show that daunorubicin (a conventional anticancer drug) inhibits the action of serine and function together with glycine deficiency to increase reactive oxygen species in tumor organoids, 4 shows that tumor organoid proliferation was reduced.

[0362] Example 7 (Figures 32, 33, 34, 35, 36, 37, 38, 39, 40) method Cell lines and cell culture HCT116, SW480, MDA-MB-231, Panc10.05, CFPAC -1, SW1990, BxPC-3, AsPC-1, PANC-1, MIA PaCa- 2 Cells were originally obtained from ATCC and subsequently purchased from Promega GenePrint Breast and colon cancer cells were cultured in 10 mL of L-glutamate at a final concentration of 2 mM. The medium was supplemented with 10% FBS (10270), penicillin-streptomycin, and acetaminophen. Pancreatic cancer cell lines were grown in DMEM (Gibco-21969) supplemented with amphotericin. to a final concentration of 2 mM L-glutamine and insulin-transferrin selenium 10% FBS (10270), penicillin-streptomycin solution (Gibco) 1:500 In RPMI-1640 (Gibco-31870) medium supplemented with erythropoietin and amphotericin, The cells were maintained in a humidified incubator at 37°C and 5% CO2. Cells were probed for mycoplasma using the Mycoalert detection kit (Lonza). Routinely tested.

[0363] Guide RNA used to remove MTAPs and non-targeting controls [Table 2] The gRNA sequence was used together with a scaffold RNA to generate sgRNA according to Ran et al. (2013). Successful.

[0364] Proliferation assay Cells (4x10^4-1x10^5) were cultured in 24-well plates in complete RPMI or D Cells were seeded in MEM medium and allowed to attach overnight. Cells were then washed with PBS and incubated with the specified amino acid / Metabolite / drug-supplemented assay medium was administered. Assay medium consisted of RPMI-1640 medium. The formula was based on lactic acid bacteria but lacked amino acids, which were added individually depending on the assay. The assay medium also contained additional vitamin B6 (20 uM), a cofactor for cysteine ​​synthesis. Cells were cultured at the indicated time points (Casy TT cells) using the "time=0" plate. Count the cells (using a cell counter, Innovatis, Roche Applied Science) and change the medium. The relative cell numbers from each time point were calculated.

[0365] microscope Images were captured on a Zeiss Axiocam digital camera equipped with Zeiss Zen software. Images were captured using a Zeiss optical microscope linked to a telephoto camera at 20x magnification.

[0366] Liquid Chromatography Mass Spectrometry (LCMS) Cells were grown in assay medium supplemented with the defined amino acids / metabolites. Carbon-13 methionine was purchased from Cambridge Isotopes / CKGas. Cell extracts and Media samples were diluted with methanol, acetonitrile, and HO (50:30:20) Lysates were prepared in duplicate in chilled (-20°C) dissolution medium (LS). Wells were counted and equalized based on cell number. LS was divided into cell / medium samples. After addition of the extract to the Accela ELISA kit, proteins were precipitated and removed by centrifugation. The system consisted of a 600LC system and an Exactive mass spectrometer (Thermo Scientific). The analysis was performed on an LCMS platform. A C column (4.6 mm × 150 mm, 3.5 μm) (Merck) was inserted into a 100-mL ... with a mobile phase of water with B=0.1% formic acid and acetonitrile with B=0.1% formic acid. A gradient program was used starting at 20% A and increasing linearly to 80% in 30 min. The total run time for method 2 was 46 minutes. The LC stream was desolvated and ionized in a HESI probe. ive mass spectrometer with polarity switching, 50000 resolution, 75-1000m The NMR spectrum was operated in full scan mode in the mass range of 100 / z. To perform the analysis, the raw data was imported into LCquan (Thermo Scientific) and MZMine 2.10. Further analysis.

[0367] Western blot Whole cell protein lysates were purified using a protease and phosphate inhibitor cocktail (Pierce / T Lysates were prepared in RIPA buffer supplemented with Hermo Scientific. Lysates were centrifuged. The gel was then removed and precast with 4-12% 'Bolt' gel (Invitrogen, Life Technology). The antibodies were separated using a Li-Cor Odyssey and transferred to a nitrocellulose membrane. A Li-Cor® infrared scanner and software (Li-Cor Biosciences) was used to Proteins were detected and quantified. A second antibody against the relevant species was used to detect bound IRDye. The primary antibodies used were: It was Sagi anti-MTAP (Abcam).

[0368] Data presentation Data are plotted as means with error bars indicating standard deviation.

[0369] Overview of cysteine ​​synthesis (Figure 32) Cysteine ​​synthesis begins with the essential amino acid methionine, which is involved in the synthesis of a number of enzymes. Polyamines are important molecules for cell growth and proliferation. Polyamine synthesis has been shown to be upregulated in cancer. The synthesis of methionine requires the methionine-derived metabolite dcSAM, which is a polyamine (spermine and spermidine) are converted to MTA during synthesis. MTA is produced by the enzyme methyltransferase Methionine is synthesized by a multistep enzymatic pathway involving thioadenosine phosphorylase (MTAP). In the presence of MTAP, MTA produced in polyamine synthesis can be recycled to the Regeneration of MTAP results in efficient methionine utilization. However, when MTAP is removed, (which frequently occurs in cancer), MTA is no longer regenerated to methionine and is released from the cell This means that a constant supply of methionine is converted to MTA and exported from the cell. This constant conversion of methionine to polyamine synthesis is essential for the synthesis of cysteine. This may prevent the use of the system for other purposes.

[0370] result The researchers found that all of the cancer cell lines they tested were sensitive to some degree to cysteine ​​depletion. Of note, certain cell lines, such as MDA-MB-231, , are extremely sensitive to cysteine ​​depletion, which induces dramatic cell death. We found that (Figures 33 and 40). Often, nutritional deficiencies (such as amino acid deficiencies) lead to increased Although it slows proliferation, it does not necessarily induce acute cell death, and the researchers wondered why. We investigated which cell lines were highly sensitive.

[0371] Cysteine ​​deficiency can be detrimental to cancer cells, and this sensitivity may be due to the lack of This may be due to inactivation of genes for CBS (e.g., methylation of the gene for CBS). Although it has been reported that CBS is a complication of the aging process, the results of this study are surprising. Compensating cells with the metabolic precursor (homocysteine) of cysteine ​​leads to significant recovery from cysteine ​​deficiency. This shows that the enzyme for cysteine ​​synthesis is present and active (Figure 39). Although it is a cysteine-dependent enzyme, it is important for the supply of upstream precursors (such as homocysteine) for cysteine ​​synthesis. Indicates there is a problem.

[0372] The expression of enzymes for de novo cysteine ​​synthesis, particularly CBS and CTH, is essential for the synthesis of cysteine. It has been suggested that the chromosome 10 gene may determine susceptibility to tein deficiency, but the present researchers were surprised to find that Notably, the cells most sensitive to cysteine ​​depletion express methionine-derived metabolites. We found that the MTA excretion was significantly increased in the spleen (Figs. 33, 34, 36, and 32). The increase in the expression of cysteine ​​in the cysteine-deficient mice correlates closely with their acute sensitivity to cysteine ​​deficiency (Figures 33, 39, and 36). MTA efflux is induced by inactivation or deletion of the gene encoding the enzyme MTAP. MTAP functions to regenerate MTA to methionine, thereby This provides efficient methionine metabolism (Figures 34 and 35). of methionine is diverted to the polyamine pathway and not to the cysteine ​​synthesis pathway (Figure 3 4) Inhibition of AMD1 (an enzyme that diverts methionine-derived SAM to the polyamine synthesis pathway) This could protect cells from acute sensitivity to cysteine ​​depletion (i.e., cell death). This is consistent with this finding (Figure 40).

[0373] In the context of using diet to treat cancer; based on our in vitro studies Although most cancer cell lines are sensitive to cysteine ​​depletion, a subset is particularly sensitive. Our study demonstrated that the reduction in MTAP expression was a response to cysteine ​​deficiency. The results show that MTAP-depleted cells are strongly correlated with the sharp sensitivity to This shows the diversion of metabolic precursors upstream of cysteine ​​synthesis (Figure 34). MTAP is generally involved in the pathogenesis of cancer In tumor cells, the IL-1 receptor is removed or inactivated (Bertino et al. 2011). These results suggest that tumors lacking MTAP expression are particularly sensitive to cysteine ​​depletion. do.

[0374] Throughout the description and claims of this specification, the words "comprise" and "contain" and their equivalents are used. Variation means "including but not limited to" and may include other molecules, additives, or components. It is not intended (and does not) exclude any whole numbers, integers, or steps. Throughout the description and claims, singular terms are used interchangeably with plural, unless the context requires otherwise. In particular, when using indefinite terms, the specification may be modified in a manner that is not construed otherwise in accordance with the context. Except where otherwise noted, it is to be understood that plural as well as singularity is intended.

[0375] Any features, integers, characteristics, compounds, etc., described in connection with any particular aspect, embodiment, or example of the present invention. The object, chemical moiety, or group may be any other embodiment described herein, except where contradictory. It should be understood that the present disclosure may also be applicable to any embodiment or example of the present invention. All of the features disclosed in the present application (including the claims, abstract and drawings) and / or any such features. All of the steps of any method or process disclosed herein are incorporated by reference in their entirety. Any combination of steps or at least some of the steps are mutually exclusive, except for combinations that are mutually exclusive. The invention is not limited to the details of any of the preceding embodiments. The present invention is disclosed herein (including any accompanying claims, abstract and drawings). The present invention extends to any novel one or any novel combination of features or to the Any novel one or any of the steps of any method or process disclosed herein This will also be extended to new combinations of

[0376] The reader's attention is drawn to the following related patent applications, which were filed in conjunction with, or prior to, this application: and to all literature and documents released to public inspection together with this specification. and the contents of all such articles and documents are incorporated herein by reference. .

[0377] References Ying, H. et al. Oncogenic Kras maintains pancreatic tumors through regulation of anabolic glucose metabolism. Cell 149, 656-670, doi:10.1016 / j.cell.2012.01.058 (2012) Labuschagne, C.F., van den Broek, N.J., Mackay, G.M., Vousden, K.H., and Maddock s, O.D. (2014). Serine, but not glycine, supports one-carbon metabolism and prol iferation of cancer cells. Cell Rep 7, 1248-1258. Maddocks, O.D., Berkers, C.R., Mason, S.M., Zheng, L., Blyth, K., Gottlieb, E., and Vousden, K.H. (2013). Serine starvation induces stress and p53-dependent metabol ic remodelling in cancer cells. Nature 493, 542-546. Bunz, F., Dutriaux, A., Lengauer, C., Waldman, T., Zhou, S., Brown, J.P., Sedivy , J.M., Kinzler, K.W., and Vogelstein, B. (1998). Requirement for p53 and p21 to s ustain G2 arrest after DNA damage. Science 282, 1497-1501. Donehower, L.A., Harvey, M., Slagle, B.L., McArthur, M.J., Montgomery, C.A., Jr. , Butel, J.S., and Bradley, A. (1992). Mice deficient for p53 are developmentall y normal but susceptible to spontaneous tumours. Nature 356, 215-221. Vigneron, A.M., Ludwig, R.L., and Vousden, K.H. Cytoplasmic ASPP1 inhibits apopt osis through the control of YAP. Genes Dev 24, 2430-2439. Hirakawa, D. A., Olson, L. M. & Baker, D. H. Comparative Utilization of a Crysta lline Amino-Acid Diet and a Methionine-Fortified Casein Diet by Young-Rats and M ice. Nutr Res 4, 891-895, doi:Doi 10.1016 / S0271-5317(84)80064-0 (1984). Zhang, T. et al. Application of Holistic Liquid Chromatography-High Resolution M ass Spectrometry Based Urinary Metabolomics for Prostate Cancer Detection and Bi omarker Discovery. PLoS One 8, e65880, doi:10.1371 / journal.pone.0065880 (2013). Adams, J. M. et al. The c-myc oncogene driven by immunoglobulin enhancers induce s lymphoid malignancy in transgenic mice. Nature 318, 533-538 (1985). Moser, A. R., Pitot, H. C. & Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science 247, 322-324 (1990). Su, L. K. et al. Multiple intestinal neoplasia caused by a mutation in the murin e homolog of the APC gene. Science 256, 668-670 (1992). Barker, N. et al. Crypt stem cells as the cells-of-origin of intestinal cancer. Nature 457, 608-611, doi:10.1038 / nature07602 (2009). Hingorani, S. R. et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Can cer Cell 7, 469-483, doi:10.1016 / j.ccr.2005.04.023 (2005). Morton, J. P. et al. Mutant p53 drives metastasis and overcomes growth arrest / se nescence in pancreatic cancer. Proc Natl Acad Sci U S A 107, 246-251, doi:10.107 3 / pnas.0908428107 (2010). Commisso, C. et al. Macropinocytosis of protein is an amino acid supply route in Ras-transformed cells. Nature 497, 633-637, doi:10.1038 / nature12138 (2013). Maddocks, O. D., Labuschagne, C. F., Adams, P. D. & Vousden, K. H. Serine Metabo lism Supports the Methionine Cycle and DNA / RNA Methylation through De Novo ATP S ynthesis in Cancer Cells. Mol Cell 61, 210-221, doi:10.1016 / j.molcel.2015.12.014 (2016). Bertino, J.R., Waud, R.W., Parker, W.B., and Lubin, M. Targeting tumours that la ck methylthioadenosine phosphorylase (MTAP) actiity. Cancer Biology & Therapy 11 :8, 627-632, doi: 10.461 / cbt.11.714948 Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. Genom e engineering using the CRISPR -Cas9 system. Nauter Protocols. 8, 11, doi: 10.1 038 / nprot2013.143 (2013)

Claims

1. 1. A dietary product for use in the treatment of cancer in a subject in need of such treatment, for use in combination with one or more anti-cancer agents, comprising: the cancer is colorectal cancer, pancreatic cancer, intestinal cancer, lymphoma, or breast cancer; The dietary product comprises: Contains at least 14 amino acids, Contains all essential amino acids is substantially the only source of exogenous amino acids consumed by the subject; and A dietary product lacking serine, glycine and proline.

2. 2. The dietary product of claim 1, wherein said one or more anti-cancer drugs comprises 5-fluorouracil.

3. 2. The dietary product of claim 1, wherein the one or more anti-cancer drugs comprises gemcitabine.

4. 2. The dietary product of claim 1, wherein the one or more anti-cancer drugs comprises paclitaxel.

5. 2. The dietary product of claim 1, wherein the one or more anti-cancer drugs comprises nabpaclitaxel.

6. 2. The dietary product of claim 1, wherein the one or more anti-cancer drugs include gemcitabine and paclitaxel.

7. 2. The dietary product of claim 1, wherein the one or more anti-cancer drugs include gemcitabine and nabpaclitaxel.

8. A dietary product according to any one of claims 1 to 7, wherein the dietary product comprises at least 15 amino acids.

9. A dietary product according to any one of claims 1 to 8, wherein the dietary product comprises at least 16 amino acids.

10. A dietary product according to any one of claims 1 to 9, wherein the dietary product contains at least 17 amino acids.

11. A dietary product according to any one of claims 1 to 10, wherein the dietary product is the subject's sole source of nutrition.

12. A dietary product according to any one of the preceding claims further comprising one or more macronutrients.

13. A dietary product according to any one of the preceding claims further comprising one or more micronutrients.

14. 14. A dietary product according to any one of claims 1 to 13 further comprising less than about 25 mg / kg / day of methionine.

15. 15. A dietary product according to any one of claims 1 to 14, formulated to provide at least the recommended daily intake of essential amino acids based on average daily total protein consumption.

16. A dietary product according to any one of claims 1 to 15 in the form of a solid.

17. A dietary product according to any one of claims 1 to 15, which is in the form of a beverage.

18. A dietary product according to any one of the preceding claims, wherein said use comprises administering said dietary product 1 to 6 times per day.

19. A dietary product according to any one of claims 1 to 18, wherein the cancer is positive for wild-type KRAS.

20. A dietary product according to any one of claims 1 to 19, wherein the cancer has deregulated cMyc expression.

21. A dietary product according to any one of claims 1 to 20, wherein the cancer has downregulated expression of MTAP.

22. A dietary product described in any one of claims 1 to 21, wherein the cancer has reduced expression or activity of a serine synthesis pathway enzyme.

23. A dietary product described in any one of claims 1 to 21, wherein the cancer has reduced expression or activity of phosphoglycerate dehydrogenase (PHGDH).

24. A dietary product described in any one of claims 1 to 21 and 23, wherein the cancer has reduced expression or activity of phosphoserine aminotransferase 1 (PSAT1).

25. A dietary product described in any one of claims 1 to 21 and 23 to 24, wherein the cancer has reduced expression or activity of phosphoserine phosphatase (PSPH).

26. A dietary product according to any one of claims 1 to 25, wherein the cancer is colon cancer.

27. A dietary product according to any one of claims 1 to 25, wherein the cancer is pancreatic cancer.

28. A dietary product according to any one of claims 1 to 25, wherein the cancer is intestinal cancer.

29. A dietary product according to any one of claims 1 to 25, wherein the cancer is lymphoma.

30. A dietary product according to any one of claims 1 to 25, wherein the cancer is breast cancer.

31. A dietary product according to any one of claims 1 to 30, wherein said use comprises administering said dietary product in combination with a cancer cell proliferation inhibitor.

32. A dietary product according to any one of claims 1 to 31, wherein said use comprises administering said dietary product in combination with a radiotherapeutic agent.

33. A dietary product according to any one of claims 1 to 32, wherein said use comprises administering said dietary product in combination with a chemotherapeutic drug.

34. 34. The dietary product of claim 33, wherein the chemotherapeutic agent inhibits OXPHOS, increases reactive oxygen species, or decreases antioxidant defenses.

35. A pharmaceutical composition for use in the treatment of cancer comprising a dietary product according to any one of claims 1 to 34 and a pharma- ceutically acceptable carrier, a pharma-ceutically acceptable excipient, or a pharma-ceutically acceptable diluent.

Images