Method for detecting platinum resistance in ovarian cancer, and agent for prevention or treatment of ovarian cancer

Abstract

To provide a method for detecting platinum resistance in ovarian cancer, and an agent for prevention or treatment of ovarian cancer that is effective even for platinum-resistant ovarian cancer.SOLUTION: A method for detecting platinum resistance in ovarian cancer includes a step (1) of detecting at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d in a biological sample collected from a subject having ovarian cancer, and an agent for prevention or treatment of ovarian cancer comprises a JAK inhibitor.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for testing platinum resistance in ovarian cancer, a preventive or therapeutic agent for ovarian cancer, and the like. [Background technology]

[0002] In the treatment of ovarian cancer, platinum preparations are the most important drugs (Non-Patent Document 1). Although platinum preparations are effective against a certain percentage of ovarian cancer, there are problems with ovarian cancer that shows resistance to platinum preparations (i.e., shows platinum resistance) and ovarian cancer that acquires platinum resistance during the treatment process. In the definition in the current guidelines, if recurrence is observed within 6 months after the last platinum preparation is used, it is judged to be platinum resistant. Although it is necessary to apply drugs other than platinum preparations for platinum resistant ovarian cancer, as mentioned above, platinum resistance is judged by the recurrence of ovarian cancer, so the application of other drugs is delayed, which is a problem. In addition, the development of new effective therapeutic drugs other than platinum preparations is also desired. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Armstrong DK, et al. Ovarian Cancer, Version 2.2020, NCCN Clinical Practice Guidelines in Oncology. J Natl Compr Canc Netw. 2021 Feb 2;19(2):191-226. doi: 10.6004 / jnccn.2021.0007. PMID: 33545690. Summary of the Invention [Problem to be solved by the invention]

[0004] An objective of the present invention is to provide a method for testing platinum resistance of ovarian cancer, and a preventive or therapeutic agent for ovarian cancer that is also effective against platinum-resistant ovarian cancer. [Means for solving the problem]

[0005] In view of the above problems, the present inventors have conducted intensive research and found that the above problems can be solved by a method for testing platinum resistance in ovarian cancer, comprising the step of detecting at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d in a biological sample collected from a subject having ovarian cancer, and a preventive or therapeutic agent for ovarian cancer containing a JAK inhibitor. That is, the present invention encompasses the following aspects.

[0006] Item 1. (1) A step of detecting at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d in a biological sample collected from a subject having ovarian cancer; A method for testing platinum resistance in ovarian cancer, comprising:

[0007] Item 2. The method according to Item 1, wherein the miRNA is at least one selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, and miR-522-3p.

[0008] Item 3. The method according to Item 1, wherein the biological sample is extracellular vesicles purified from a body fluid, a body fluid containing extracellular vesicles, or ovarian cancer tissue.

[0009] Item 4. Further, (2) determining platinum resistance of the ovarian cancer of the subject based on the amount or concentration of the miRNA detected in the step (1); The method according to item 1, comprising:

[0010] Item 5. The step (2) (2a) determining that the ovarian cancer of the subject is platinum-resistant when the amount or concentration of at least one miRNA selected from the group consisting of miR-221-5p and miR-135a-5p measured in the step (1) is equal to or higher than a cutoff value, and / or determining that the ovarian cancer of the subject is platinum-sensitive when the amount or concentration of at least one miRNA selected from the group consisting of miR-221-5p and miR-135a-5p measured in the step (1) is equal to or higher than a cutoff value; and (2b) determining that the ovarian cancer of the subject is platinum-resistant when the amount or concentration of at least one miRNA selected from the group consisting of miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d measured in the step (1) is equal to or lower than a cutoff value, and / or determining that the ovarian cancer of the subject is platinum-sensitive when the amount or concentration is equal to or higher than the cutoff value; Item 5. The method according to item 4, comprising at least one step selected from the group consisting of:

[0011] Item 6. The method according to Item 4 or 5, wherein a subject having platinum-resistant ovarian cancer is selected as a subject to be administered an anticancer drug other than a platinum agent, and / or a subject having platinum-sensitive ovarian cancer is selected as a subject to be administered a platinum agent.

[0012] Item 7. The method according to Item 6, wherein the anticancer drug other than a platinum agent is a JAK inhibitor.

[0013] Item 8. (1) A step of detecting at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d in a biological sample collected from a subject having ovarian cancer; A method for selecting a subject to be administered a platinum agent and / or an anticancer agent other than a platinum agent, comprising:

[0014] Item 9. A test agent for determining platinum resistance in ovarian cancer and / or for selecting subjects for administration of a platinum agent and / or an anticancer agent other than a platinum agent, comprising a detection agent for at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d.

[0015] Item 10. A preventive or therapeutic agent for ovarian cancer, which comprises a JAK inhibitor.

[0016] Item 11. The preventive or therapeutic agent according to Item 10, wherein the ovarian cancer is platinum-resistant ovarian cancer.

[0017] Item 12. The preventive or therapeutic agent according to Item 10, for use in administering to a subject who has been selected by the method according to Item 4, 5, or 8 as being platinum-resistant and / or a subject to be administered an anticancer agent other than a platinum preparation. Effect of the Invention

[0018] According to the present invention, it is possible to provide a method for testing platinum resistance of ovarian cancer, and a preventive or therapeutic agent for ovarian cancer that is effective even against platinum-resistant ovarian cancer. [Brief description of the drawings]

[0019] [Figure 1] 1 shows the results of pathway analysis in Test Example 1. The vertical axis shows the p-value for high expression levels in the platinum-resistant group, and the horizontal axis shows gene pathways. [Diagram 2] This shows the results of comparing the expression levels of JAK / STAT pathway-related genes between platinum-resistant cases and platinum-sensitive cases in Test Example 2. The vertical axis shows the gene expression level, and the horizontal axis shows the gene name. [Diagram 3]1 shows the results of comparing the expression levels of JAK / STAT pathway-related genes between a platinum-resistant cell line (A2780cis) and a platinum-sensitive cell line (A2780) in Test Example 2. The vertical axis shows the gene expression level, and the horizontal axis shows the gene name. [Figure 4] 1 shows the results of comparing the expression levels of JAK / STAT pathway-related genes between a platinum-resistant cell line (PEO1cis) and a platinum-sensitive cell line (PEO1) in Test Example 2. The vertical axis shows the gene expression level, and the horizontal axis shows the gene name. [Diagram 5] This shows the results of measuring the IC50 of the JAK inhibitor in Test Example 3. The vertical axis shows IC50, the horizontal axis shows the cell line used, and the legend shows the JAK inhibitor used. [Figure 6] In Test Example 4, the results of analyzing the combined effect of a JAK inhibitor and a platinum agent are shown. [Figure 7] The figure shows an outline of an experiment (upper), the measurement results of luminescence indicating ovarian cancer cells (lower left), and the measurement results of tumor weight at the end of the experiment (lower right) in the case where luciferase-labeled A2780 was used as the cell to be transplanted into mice in Test Example 5. In the graph of the measurement results of luminescence indicating ovarian cancer cells, the horizontal axis indicates the number of days elapsed since the transplantation of ovarian cancer cells. In the graph of the measurement results of tumor weight, the horizontal axis indicates the administered substance. [Figure 8] The figure shows an outline of an experiment (upper), the measurement results of luminescence indicating ovarian cancer cells (lower left), and the measurement results of tumor weight at the end of the experiment (lower right) in the case where luciferase-labeled A2780cis was used as the cell to be transplanted into mice in Test Example 5. In the graph of the measurement results of luminescence indicating ovarian cancer cells, the horizontal axis indicates the number of days elapsed since the transplantation of ovarian cancer cells. In the graph of the measurement results of tumor weight, the horizontal axis indicates the administered substance. [Figure 9] 1 shows a method for extracting a platinum resistance biomarker for ovarian cancer in Test Example 6. [Figure 10]The results of measuring the expression levels of a total of nine extracted biomarkers in Test Example 6 are shown. The vertical axis shows the measurement results when ascites-derived total RNA is used, and the horizontal axis shows the measurement results when ovarian tumor tissue-derived total RNA is used. The r2 at the bottom right of each graph is the coefficient of determination that represents the correlation between the expression levels of ascites-derived small extracellular vesicles and ovarian tumor tissue. [Figure 11] The figure shows an outline of the experiment (upper row) and the expression level of the JAK / STAT gene when miRNA mimics were transfected (lower row) for Test Example 7. The horizontal axis shows the gene name. The legend shows the added miRNA. [Figure 12] The figure shows an outline of the experiment (upper row) and IC50 (lower row) when miRNA mimics were transfected for Test Example 8. The horizontal axis shows the cell name. The legend shows the added miRNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0021] 1. Testing Method In one aspect, the present invention relates to a method for testing platinum resistance of ovarian cancer (also referred to as the "testing method of the present invention" in this specification), which comprises the step of (1) detecting at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d in a biological sample collected from a subject having ovarian cancer. This will be described below.

[0022] 1-1. Process (1) Examples of ovarian cancer include, but are not limited to, superficial, epithelial, and stromal malignant tumors (e.g., serous (cystic) adenocarcinoma, mucinous (cystic) adenocarcinoma, endometrioid adenocarcinoma, clear cell adenocarcinoma, adenocarcinoma fibroma (each of the above types), adenosarcoma, mesodermal mixed tumor, [Mullerian mixed tumor] [carcinosarcoma], malignant Brenner tumor, transitional cell carcinoma, undifferentiated carcinoma, etc.), sex cord stromal tumors (e.g., fibrosarcoma, Sertoli-stromal cell tumor (poorly differentiated type), etc.), germ cell tumors (e.g., undifferentiated germ cell tumor, yolk sac tumor [endodermal sinus tumor], embryonal carcinoma [embryonic carcinoma], polyembryoma, choriocarcinoma, mature cystic teratoma with malignant transformation, immature teratoma (G3), etc.), carcinoma, sarcoma, malignant lymphoma (primary), secondary [metastatic] tumors, etc. Ovarian cancer of all classes, grades, and stages according to various classification criteria regarding the progression, condition, etc. of ovarian cancer can be the subject of the test.

[0023] The subject is a target organism of the test method of the present invention, and the species of the subject is not particularly limited. Examples of the subject's species include various mammals such as humans, monkeys, mice, rats, dogs, cats, and rabbits, and preferably humans.

[0024] The state of the subject is not particularly limited as long as the subject has ovarian cancer. Examples of the subject include a subject whose platinum resistance is unknown, a subject whose platinum resistance has already been determined by another method, a subject whose platinum resistance has already been determined by another method, a subject who is undergoing treatment with a platinum agent, and a subject who has not yet begun treatment with a platinum agent.

[0025] The biological sample is not particularly limited as long as it is derived from a living body and can contain genomic DNA derived from ovarian cancer. Examples of biological samples include body fluids such as whole blood, serum, plasma, ascites, follicular fluid, menstrual blood, saliva, cerebrospinal fluid, synovial fluid, urine, tissue fluid, sweat, tears, and saliva, and samples derived from these body fluids. In addition, the biological sample can also be a body tissue, preferably an ovarian cancer tissue, or a sample derived from these tissues. The sample derived from the body fluid / tissue is not particularly limited as long as it is a sample prepared from the body fluid / tissue, and examples thereof include samples obtained by concentrating and purifying nucleic acids or extracellular vesicles contained in the body fluid / tissue from the body fluid / tissue.

[0026] A body fluid can be collected from a subject by a method known to those skilled in the art. For example, whole blood can be collected by blood collection using a syringe or the like. Serum is a portion of whole blood from which blood cells and specific blood coagulation factors have been removed, and can be obtained, for example, as a supernatant after whole blood has been coagulated. Plasma is a portion of whole blood from which blood cells have been removed, and can be obtained, for example, as a supernatant when whole blood is centrifuged under conditions that do not cause coagulation.

[0027] The extracellular vesicles are not particularly limited as long as they are membrane vesicles secreted or released from cells. Extracellular vesicles are usually defined as membrane vesicles that are responsible for local or systemic intercellular information transmission by transporting intracellular proteins or genetic information (mRNA, microRNA, etc.) to the outside of cells. Examples of extracellular vesicles include exosomes, microvesicles, apoptotic bodies, ectosomes, microparticles, and secreted microvesicles. From the viewpoint of test accuracy, etc., the extracellular vesicles are particularly preferably exosomes.

[0028] Extracellular vesicles can be purified, separated, concentrated, etc. from body fluids according to or in accordance with known methods. Methods for purifying, separating, concentrating, etc. extracellular vesicles include, for example, ultracentrifugation (e.g., pellet down method, sucrose cushion method, density gradient centrifugation, etc.), methods using immunoaffinity carriers, gel filtration, field-flow fractionation, FACS, etc. Purification, separation, concentration, etc. of extracellular vesicles can also be performed using commercially available kits. These methods may be used alone or in combination of two or more.

[0029] The biological sample may preferably be extracellular vesicles purified from a body fluid, a body fluid containing extracellular vesicles, ovarian cancer tissue, etc.

[0030] In step (1), miRNA is detected in a follicular fluid sample collected from a subject. The detection target in step (1) is at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d. Hereinafter, these may be collectively referred to as "target biomarkers."

[0031] miR-221-5p and miR-135a-5p are biomarkers that are more highly expressed in platinum-resistant cases than in platinum-sensitive cases, whereas miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d are biomarkers that are more highly expressed in platinum-sensitive cases than in platinum-resistant cases.

[0032] The base sequence of the target biomarker can be identified in a known database (e.g., miRBase: http: / / www.mirbase.org / ). For example, in the case of humans, the base sequence is as follows:

[0033] hsa-miR-221-5p MIMAT0004568 ACCUGGCAUACAAUGUAGAUUU (SEQ ID NO: 1) hsa-miR-135a-5p MIMAT0000428 UAUGGCUUUUUAUUCCUAUGUGA (SEQ ID NO: 2) hsa-miR-1246 MIMAT0005898 AAUGGAUUUUUGGAGCAGG (SEQ ID NO: 3) hsa-miR-1290 MIMAT0005880 UGGAUUUUUGGAUCAGGGA (SEQ ID NO: 4) hsa-miR-522-3p MIMAT0002868 AAAAUGGUUCCCUUUAGAGUGU (SEQ ID NO: 5) hsa-miR-130b-3p MIMAT0000691 CAGUGCAAUGAUGAAAGGGCAU (SEQ ID NO: 6) hsa-miR-99b-3p MIMAT0004678 CAAGCUCGUGUCUGUGGGUCCG (SEQ ID NO: 7) hsa-miR-320c MIMAT0005793 AAAAGCUGGGUUGAGAGGGU (SEQ ID NO: 8) hsa-miR-320d MIMAT0006764 AAAAGCUGGGUUGAGAGGA (sequence number 9).

[0034] The biomarkers of interest are preferably mature miRNAs, but may also be precursors (eg, pri-miRNA, pre-miRNA, etc.).

[0035] Among the target biomarkers, miR-221-5p, miR-135a-5p, miR-1246, miR-1290, and miR-522-3p are particularly preferred from the viewpoint of correlation with expression in ovarian cancer tissues.

[0036] Among the target biomarkers, miR-221-5p and miR-135a-5p are particularly preferable in terms of their association with JAK.

[0037] The number of target biomarkers to be detected in step (1) may be one or more, but from the standpoint of test accuracy, etc., the number is preferably two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or all (nine) types.

[0038] Detection is usually performed by measuring the amount or concentration of the target biomarker. "Concentration" is not limited to absolute concentration, but may also be relative concentration, weight per unit volume, raw data measured to know the absolute concentration, etc.

[0039] The method for detecting the target biomarker is not particularly limited as long as it can specifically detect a part or all of the target biomarker. Specific examples of the detection method include RNA-seq analysis, RT-PCR, nucleic acid chip analysis, and Northern blotting.

[0040] When RNA-seq analysis is used, specifically, cDNA is prepared from RNA derived from the subject in a standard manner, and sequence analysis is performed using a next-generation sequencer or the like. Based on the obtained data, mapping, gene expression analysis, expression level analysis, etc. are performed to obtain expression level information.

[0041] When RT-PCR is used, specifically, cDNA is prepared from RNA derived from a specimen in a conventional manner, and a pair of primers (a positive strand that binds to the above cDNA (-strand) and a reverse strand that binds to the + strand) are hybridized to the cDNA so that the target region can be amplified using the cDNA as a template, and PCR is performed in a conventional manner to detect the resulting amplified double-stranded DNA. The amplified double-stranded DNA can be detected by a method of detecting labeled double-stranded DNA produced by performing the above PCR using primers that have been labeled with RI or a fluorescent substance in advance, or by transferring the produced double-stranded DNA to a nylon membrane or the like in a conventional manner and hybridizing it with a labeled probe for detection.

[0042] When using nucleic acid chip analysis, a method can be used in which a nucleic acid chip with a nucleic acid probe (single-stranded or double-stranded) attached thereto is prepared, and this is hybridized with RNA derived from a specimen or a nucleic acid prepared from the RNA by standard methods, and the double strand formed is detected.

[0043] When using the Northern blot method, a specific example is a method in which a probe is labeled with a radioisotope (32P, 33P, etc.: RI) or a fluorescent substance, and then hybridized with RNA derived from a test subject, and the formed double strand is then detected and measured by using a radiation detector or a fluorescence detector to detect a signal derived from the label of the probe (labeling substance such as RI or a fluorescent substance).

[0044] According to the test method of the present invention including step (1), it is possible to provide the amount and / or concentration of a target biomarker that is a test indicator of platinum resistance of ovarian cancer, and this can be used as a test indicator for selecting a subject to be administered with a platinum drug and / or an anticancer drug other than a platinum drug, and these can also assist the test. Therefore, in one aspect, the present invention also relates to a method for selecting a subject to be administered with a platinum drug and / or an anticancer drug other than a platinum drug, comprising the step of (1) detecting at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d in a biological sample collected from a subject having ovarian cancer. For details of the method, the details of the test method of the present invention are incorporated herein by reference.

[0045] 1-2. Process (2) In one embodiment, the inspection method of the present invention further comprises: (2) determining platinum resistance of the ovarian cancer of the subject based on the amount or concentration of the miRNA detected in the step (1); It is preferred that the compound contains

[0046] More specifically, step (2) comprises: (2a) determining that the ovarian cancer of the subject is platinum-resistant when the amount or concentration of at least one miRNA selected from the group consisting of miR-221-5p and miR-135a-5p measured in the step (1) is equal to or higher than a cutoff value, and / or determining that the ovarian cancer of the subject is platinum-sensitive when the amount or concentration of at least one miRNA selected from the group consisting of miR-221-5p and miR-135a-5p measured in the step (1) is equal to or higher than a cutoff value; and (2b) determining that the ovarian cancer of the subject is platinum-resistant when the amount or concentration of at least one miRNA selected from the group consisting of miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d measured in the step (1) is equal to or lower than a cutoff value, and / or determining that the ovarian cancer of the subject is platinum-sensitive when the amount or concentration is equal to or higher than the cutoff value; The method may include at least one step selected from the group consisting of:

[0047] In the test method of the present invention, a subject having platinum-resistant ovarian cancer can be selected as a subject to be administered with an anticancer drug other than a platinum preparation, and / or a subject having platinum-sensitive ovarian cancer can be selected as a subject to be administered with a platinum preparation. After the test method of the present invention, an anticancer drug other than a platinum preparation / platinum preparation can be administered to the selected subject. The administration method is not particularly limited, and an appropriate method for each drug (for example, a method described in the package insert) can be adopted. The drug can be one type alone or two or more types in combination.

[0048] The platinum preparation is not particularly limited as long as it contains platinum atoms and can be used as an anticancer agent, and examples thereof include cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin, miriplatin, lobaplatin, spiroplatin, tetraplatin, ormaplatin, iproplatin, and the like.

[0049] As anticancer drugs other than platinum preparations, various anticancer drugs, such as alkylating agents, metabolic antagonists, microtubule inhibitors, antibiotic anticancer drugs, topoisomerase inhibitors, molecular targeted drugs, hormone drugs, biological drugs, etc., can be used. More specifically, for example, bevacizumab, olaparib, niraparib, pembrolizumab, paclitaxel, docetaxel, doxorubicin (e.g., liposomal doxorubicin), gemcitabine, bleomycin, etoposide, vinblastine, ifosfamide, vincristine, actinomycin D, cyclophosphamide, etc. are mentioned. As anticancer drugs other than platinum preparations, the JAK inhibitors described below are particularly preferred from the viewpoint that they are particularly effective against platinum-resistant ovarian cancer. JAK inhibitors are also preferred from the viewpoint that they are particularly suitable for administration to subjects selected as subjects for administration of anticancer drugs other than platinum preparations by the test method of the present invention.

[0050] The cutoff value is, for example, set in advance based on a statistical analysis or ROC analysis of the amount or concentration of the target biomarker in the platinum-resistant group and the platinum-sensitive group by preparing a database tracking the amount or concentration of the target biomarker and the platinum resistance / sensitivity of the evaluation population. In this case, the platinum-resistant group can be defined as, for example, a group in which recurrence was observed within 6 months from the last use of a platinum drug, and the platinum-sensitive group can be defined as, for example, the other group, or, for example, a group in which recurrence was not observed more than 8 months, more than 12 months, more than 18 months, more than 24 months, or more than 30 months from the last use of a platinum drug. Alternatively, the cutoff value can be set each time. When the cutoff value is determined by statistical analysis, for example, the median, arithmetic mean, or other average value of the amount or concentration data of the target biomarker in the evaluation population can be used. When the cutoff value is determined by ROC analysis, for example, the cutoff value based on ROC analysis can be the amount or concentration of the target biomarker at the point on the ROC curve where the distance between the point on the vertical axis (sensitivity or true positivity) of the ROC curve graph and the point on the horizontal axis (1-specificity) of the ROC curve graph is the smallest, or the cutoff value can be derived from the Youden index of the ROC curve (Cancer 1950;3:32-35.). The database of the evaluation population may be used for setting the cutoff value without being changed once established. Alternatively, new ovarian cancer patients may be included in the evaluation population, and the database of the evaluation population may be appropriately updated and used for setting the cutoff value.

[0051] 2. Diagnostic kits In one aspect, the present invention relates to a test agent (sometimes referred to as the "test agent of the present invention" herein) for determining platinum resistance of ovarian cancer and / or for selecting subjects to be administered with a platinum agent and / or an anticancer agent other than a platinum agent, the test agent comprising a detection agent for a target biomarker (sometimes referred to as the "detection agent of the present invention" herein). This will be described below.

[0052] For matters not explained below in this section, the above description is incorporated by reference.

[0053] The detection agent of the present invention is not particularly limited as long as it can specifically detect a target biomarker. Examples of the detection agent include primers and probes for the target biomarker.

[0054] The detection agent of the present invention may be modified as long as its function is not significantly impaired. Examples of modifications include the addition of labels such as fluorescent dyes, enzymes, proteins, radioisotopes, chemiluminescent substances, biotin, etc.

[0055] The fluorescent dye used in the present invention may be one that is generally used to label nucleotides for detection or quantification of nucleic acids, and examples of such fluorescent dyes include, but are not limited to, HEX (4,7,2',4',5',7'-hexachloro-6-carboxylfluorescein, a green fluorescent dye), fluorescein, NED (trade name, manufactured by Applied Biosystems, a yellow fluorescent dye), 6-FAM (trade name, manufactured by Applied Biosystems, a yellow-green fluorescent dye), rhodamin or a derivative thereof (e.g., tetramethylrhodamine (TMR)). As a method for labeling nucleotides with fluorescent dyes, any suitable known labeling method may be used (see Nature Biotechnology, 14, 303-308 (1996)). In addition, a commercially available fluorescent labeling kit may be used (e.g., Oligonucleotide ECL 3'-Oligo Labeling System, manufactured by Amersham-Pharmacia, etc.).

[0056] The detection agent of the present invention can be used by immobilizing it on any solid phase, and therefore the test agent of the present invention can be provided in the form of a substrate on which the detection agent is immobilized (e.g., a microarray chip on which a probe is immobilized, etc.).

[0057] The solid phase used for immobilization is not particularly limited as long as it can immobilize polynucleotides, etc., and examples thereof include glass plates, nylon membranes, microbeads, silicon chips, capillaries, and other substrates. The immobilization of the detection agent to the solid phase is not particularly limited. The immobilization method is well known in the art depending on the type of immobilized probe, such as using a commercially available spotter (such as Amersham) for microarrays (e.g., photolithographic technology (Affymetrix), in situ synthesis of oligonucleotides using inkjet technology (Rosetta Inpharmatics), etc.).

[0058] The primers, probes, etc. are not particularly limited as long as they selectively (specifically) recognize the target biomarker or a nucleic acid derived therefrom. Here, "selectively (specifically) recognize" means, for example, in the Northern blot method, that the target biomarker can be specifically detected, and in the RT-PCR method, that the target biomarker or a nucleic acid derived therefrom (cDNA, etc.) is specifically amplified, but is not limited thereto, and may be any primer or probe that allows a person skilled in the art to determine that the detected or amplified product is derived from the target biomarker.

[0059] Specific examples of primers and probes include the polynucleotides described in (a) below and the polynucleotides described in (b) below: (a) a polynucleotide having at least 15 consecutive bases in the base sequence of a target biomarker and / or a polynucleotide complementary to the polynucleotide; and (b) a polynucleotide having at least 15 bases that hybridizes under stringent conditions to a base sequence of a target biomarker or a base sequence complementary thereto; At least one selected from the group consisting of:

[0060] A complementary polynucleotide or a complementary base sequence (complementary strand, reverse strand) refers to a polynucleotide or base sequence that is base-complementary to the full-length sequence of a polynucleotide consisting of the base sequence of a target biomarker, or a partial sequence thereof having a base sequence of at least 15 consecutive bases in length (for convenience, these are also referred to as the "positive strand" herein). However, such a complementary strand is not limited to a case where it forms a completely complementary sequence with the base sequence of the target positive strand, but may have a complementary relationship to the extent that it can hybridize with the target positive strand under stringent conditions. In addition, the stringent conditions here can be determined based on the melting temperature (Tm) of the nucleic acid to which the complex or probe is bound, as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego CA). For example, washing conditions after hybridization can usually be about "1xSSC, 0.1% SDS, 37°C". It is preferable that the complementary strand maintains a hybridized state with the target positive strand even when washed under such conditions. Although not particularly limited, a more stringent hybridization condition can be about "0.5xSSC, 0.1% SDS, 42°C", and an even more stringent hybridization condition can be about "0.1xSSC, 0.1% SDS, 65°C". Specifically, examples of such complementary strands include a strand consisting of a base sequence that is completely complementary to the base sequence of the target positive strand, and a strand consisting of a base sequence that has at least 90%, preferably 95%, more preferably 98% or more, and even more preferably 99% or more identity with the strand.

[0061] Primers, probes, etc. can be designed, for example, based on the base sequence of a target biomarker using various design programs. Specifically, a candidate sequence for a primer or probe obtained by applying the base sequence of the target biomarker to a design program, or a sequence at least partially including the sequence, can be used as the primer or probe.

[0062] The base length of the primer, probe, etc. is not particularly limited as long as it has a length of at least 15 consecutive bases as described above, and can be appropriately set depending on the application. For example, the base length can be 15 to 35 bases when used as a primer, and 15 to 35 bases when used as a probe.

[0063] The test agent of the present invention may contain other detection agents (eg, probes for detecting other nucleic acids such as miRNA, antibodies, etc.) in addition to the detection agent of the present invention.

[0064] The test agent of the present invention may be in the form of a composition. The composition may contain other components as necessary. Examples of other components include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents, etc.

[0065] The test agent of the present invention may be in the form of a kit. The kit may contain, in addition to the detection agent or the composition containing the same, other materials that can be used to detect a target biomarker in a biological sample from a subject. Specific examples of such materials include various reagents (e.g., buffer solutions, etc.), tools (e.g., tools for purifying and separating biological samples), etc.

[0066] 3. Preventive or therapeutic agents In one aspect, the present invention relates to a preventive or therapeutic agent for ovarian cancer containing a JAK inhibitor (also referred to as the "preventive or therapeutic agent of the present invention in this specification). This will be described below.

[0067] For matters not explained below in this section, the above description is incorporated by reference.

[0068] The JAK inhibitor is not particularly limited as long as it is an inhibitor of all or part of the JAK family (JAK1, JAK2, JAK3, TYK2) (preferably including JAK1 and JAK2). For example, a drug having an IC50 of, for example, 500nM or less, 200nM or less, 100nM or less, 50nM or less, 20nM or less, or 10nM or less for the enzyme activity of JAK can be used as a JAK inhibitor. The IC50 of the enzyme activity of JAK is measured according to a known method (for example, with reference to the definition of IC50 for a pharmaceutical agent consisting of a JAK inhibitor).

[0069] Specific examples of JAK inhibitors include small molecule compounds such as Peficitinib (Smilav), Ruxolitinib (Jakavi), Baricitinib (Olumient), Itacitinib, Tofacitinib (Xeljanz), Upadacitinib (Rinvoq), Solcitinib, Oclacitinib, Filgotinib (Jyseleca), Decernotinib, Abrocitinib (Cybainco), Delgocitinib (Collectim), and Ritlecitinib. In addition to small molecule compounds, examples of JAK inhibitors include polynucleotides (e.g., siRNA, miRNA, antisense nucleic acid, etc.) containing complementary or homologous sequences to JAK genes / mRNA, nucleic acid drugs such as aptamers, and antibody drugs.

[0070] The JAK inhibitors can be used alone or in combination of two or more.

[0071] JAK inhibitors have an effect of inhibiting the proliferation of ovarian cancer cells, an effect of killing ovarian cancer cells, and the like, and are therefore useful as an active ingredient for preventing or treating ovarian cancer. JAK inhibitors can particularly exhibit a high anticancer effect against platinum-resistant ovarian cancer. The preventive or therapeutic agent of the present invention is preferably used to be administered to a subject selected by the test method of the present invention as being platinum-resistant and / or as a subject to be administered an anticancer agent other than a platinum preparation.

[0072] The JAK inhibitor can be used in combination with other drugs. The other drugs are not particularly limited. The JAK inhibitor can be used in combination with a platinum agent.

[0073] The preventive or therapeutic agent of the present invention is not particularly limited as long as it contains the active ingredient of the present invention, and may further contain other ingredients as necessary. The other ingredients are not particularly limited as long as they are pharma- ceutically acceptable. The other ingredients include ingredients having pharmacological action as well as additives. Examples of additives include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents, etc.

[0074] The subject to which the prophylactic or therapeutic agent of the present invention is applied is not particularly limited, and examples of mammals include humans, monkeys, mice, rats, dogs, cats, rabbits, pigs, horses, cows, sheep, goats, and deer.

[0075] The preventive or therapeutic agent of the present invention may take any dosage form, for example, oral preparation forms such as tablets (including orally disintegrating tablets, chewable tablets, effervescent tablets, lozenges, jelly drops, etc.), pills, granules, fine granules, powders, hard capsules, soft capsules, dry syrups, liquids (including drinks, suspensions, syrups), and jellies; and parenteral preparation forms such as injectable preparations (for example, drip injections (for example, intravenous drip preparations, etc.), intravenous injections, intramuscular injections, subcutaneous injections, and intradermal injections), topical preparations (for example, ointments, poultices, and lotions), suppositories, inhalants, eye preparations, eye ointments, nasal drops, ear drops, and liposomes.

[0076] The route of administration of the preventive or therapeutic agent of the present invention is not particularly limited as long as the desired effect can be obtained, and examples of such administration include enteral administration such as oral administration, tube feeding, and enema administration; and parenteral administration such as intravenous administration, intraarterial administration, intramuscular administration, intracardiac administration, subcutaneous administration, intradermal administration, and intraperitoneal administration.

[0077] The content of the active ingredient in the preventive or therapeutic agent of the present invention depends on the mode of use, the subject to which it is applied, the condition of the subject to which it is applied, etc., and is not limited, but can be, for example, 0.0001 to 100% by weight, preferably 0.001 to 50% by weight.

[0078] The dosage of the preventive or therapeutic agent of the present invention is not particularly limited as long as it is an effective amount that exerts a pharmacological effect, and is usually, in terms of the weight of the active ingredient, generally 0.1 to 1000 mg / kg body weight per day in the case of oral administration, preferably 0.5 to 500 mg / kg body weight per day, and in the case of parenteral administration, 0.01 to 1000 mg / kg body weight per day, preferably 0.05 to 500 mg / kg body weight per day. The dosage can be appropriately increased or decreased depending on age, pathological condition, symptoms, etc. In addition, the preventive or therapeutic agent of the present invention can be administered in a single dose or multiple doses. EXAMPLES

[0079] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0080] Statistical analysis in the following test examples is as follows. Statistical analysis was performed using GraphPad Prism ver.9.3.1 for Windows, RStudio, and R software (ver.4.0.3). Welch's t-test was used to determine significant differences between the means of two data sets. Paired t-test was used to determine significant differences between two sets of paired data. Dunnett's test was used for multiple comparisons with the control group using the multicomp package (ver.1.4-17). Pearson correlation coefficients were calculated to evaluate correlations of gene expression. Kaplan-Meier curves and log-rank tests were used for survival analysis. A P value of less than 0.05 was considered statistically significant.

[0081] Test Example 1. Comparison of mRNA expression profiles The mRNA expression profiles of subjects with platinum-resistant ovarian cancer (platinum-resistant group) and subjects with platinum-sensitive ovarian cancer (platinum-sensitive group) were compared as follows.

[0082] Frozen samples of ovarian tumor tissue obtained at primary surgery before initial treatment from a total of 20 subjects diagnosed with high-grade serous ovarian cancer (10 patients with a platinum-free initial treatment interval (TFIp) of less than 6 months (platinum-resistant group) and 10 patients with a platinum-free initial treatment interval (TFIp) of 36 months or more (platinum-sensitive group)) were used.

[0083] Total RNA was extracted from frozen samples of ovarian tumor tissue using the miRNeasy Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions, and total RNA concentration was measured using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). RNA sequencing was performed at Novogene, Inc., and the expression level of each gene was quantified using Kallisto. Small RNA libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs, Ipswich, MA), and index codes were added to assign sequences to each sample. PCR products were then purified using the QIAquick PCR Purification Kit (Qiagen) and 6% TBE gel (120 V, 60 min). In addition, DNA fragments equivalent to 140-160 bp (the length of small non-coding RNA and the length of 3′ and 5′ adapters) were recovered, and complementary DNA concentrations were measured using Qubit dsDNA HS Assay Kit and Qubit2.0 Fluorometer (Life Technologies, Carlsbad, CA). Finally, single-end reads were generated on an Illumina MiSeq (Illumina, San Diego, CA). Data were then compiled using the tximport package (ver.1.18.0) in R software (ver.4.0.3) and RStudio (RStudio, Boston, MA), and scaledTPM counts were used for further analysis. Genes with low read coverage (maximum number of reads: <10 reads) were excluded, and differentially expressed genes (DEGs, |log2FC= > 1) were used for heatmap and principal component analysis (PCA). The heatmap.2 function in the gplots package (ver. 3.1.0) was used to convert the data to base 10 logarithms and z scores. PCA was performed using the prcomp and plot3d functions in the rgl package (ver. 0.100.54).For the volcano plots, the adjusted p-value of each gene was calculated using the Wald test in DESeq2 (ver. 1.30.0), and pathway analysis was performed using Ingenuity Pathway Analysis (IPA, QIAGEN) software.

[0084] The pathways that were highly expressed in the platinum-resistant group are shown in Figure 1. The expression levels of JAK / STAT pathway-related genes were found to be significantly higher in the platinum-resistant group. This suggests that the JAK / STAT pathway could be a novel therapeutic target for platinum-resistant patients.

[0085] Test Example 2. Comparison of expression levels of JAK / STAT pathway-related genes The expression levels of JAK / STAT pathway-related genes were compared between the platinum-resistant and platinum-sensitive groups, and between the platinum-resistant and platinum-sensitive cell lines.

[0086] For the platinum-resistant and platinum-sensitive groups, total RNA obtained in Test Example 1 was used.

[0087] A2780-cis and PEO1-cis were used as platinum-resistant cell lines, and A2780 and PEO1 were used as platinum-sensitive cell lines. Both of these are human ovarian cancer cell lines, and were purchased from the European Collection of Authenticated Cell Cultures. Total RNA was obtained from these cells in the same manner as in Test Example 1. The cells were cultured in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum.

[0088] cDNA was synthesized from the total RNA using a cDNA reverse transcription kit (Toyobo, Osaka, Japan) and TB Green Premix Ex Taq (Takara Bio, Shiga, Japan). qPCR was performed using an Mx3000P (Agilent Technologies) with 40 cycles of denaturation at 95°C for 30 seconds, amplification at 95°C for 5 seconds, and amplification at 60°C for 30 seconds.

[0089] The results are shown in Figures 2 to 4. The expression levels of JAK / STAT pathway-related genes tended to be high in the platinum-resistant group and platinum-resistant cell lines.

[0090] Test Example 3. Evaluation of the effect of JAK inhibitors on ovarian cancer cells (in vitro) The effects of JAK inhibitors on ovarian cancer cells were evaluated as follows.

[0091] As ovarian cancer cells, the cell lines used in Test Example 2 (platinum-resistant cell lines: A2780-cis and PEO1-cis, platinum-sensitive cell lines: A2780 and PEO1) were used.

[0092] Cells were seeded in 96-well plates. After adhesion, various JAK inhibitors (Peficitinib, Ruxolitinib, Baricitinib) were added to the medium at various concentrations and incubated for 72 hours. Cell viability was assessed using the CellTiter-Glo 2.0 Cell Viability Assay (Promega). Luminescence measurements were performed 10 minutes after addition of the reagents using a microplate reader (Molecular Devices). Viability was calculated as a percentage of untreated cells, and experiments were performed in triplicate. IC50 values ​​were calculated using GraphPad Prism ver.9.3.1 for Windows (GraphPad Software, San Diego, CA, USA).

[0093] The results are shown in Figure 5. JAK inhibitors were found to exhibit cytostatic effects on both platinum-resistant and platinum-sensitive cell lines.

[0094] Test Example 4. Analysis of the combined effect of JAK inhibitors and platinum agents The test was conducted in the same manner as in Test Example 3, except that various JAK inhibitors (Peficitinib, Ruxolitinib, Baricitinib) were added to the medium at various concentrations, and a platinum preparation (cispatin) was also added to the medium at various concentrations. The presence or absence of a synergistic effect due to the combined use of both drugs was analyzed using Combenefit software.

[0095] The results are shown in Figure 6. It was found that the combined use of a JAK inhibitor and a platinum agent produced a synergistic effect.

[0096] Test Example 5. Evaluation of the effect of JAK inhibitors on ovarian cancer (in vivo) The outline of the experiment is shown in the upper part of Figures 7 and 8. Seven-week-old female BALB / C nude mice were used for the experiment. Luciferase-labeled A2780 and A2780-cis cells were transplanted at 5 × 10 6 Cells / 50 μl were injected intraperitoneally. Mice received 3.0 mg of a JAK inhibitor (Peficitinib) intraperitoneally every 2 days for a total of 5 treatments. For in vivo imaging, mice were injected intraperitoneally with D-luciferin (Promega, Madison, WI). After 10 min, photons were measured throughout the animal's body by assessing bioluminescence using an IVIS Spectrum imaging system (Caliper Life Science, Hopkinton, MA). Data were analyzed using LIVINGIMAGE 4.4 software (Caliper Life Science).

[0097] The results are shown in Figures 7 and 8. The JAK inhibitor exhibited anticancer effects against both platinum-resistant and platinum-sensitive ovarian cancer, and exhibited particularly strong anticancer effects against platinum-resistant ovarian cancer.

[0098] Test Example 6. miRNA expression profile comparison The miRNA expression profiles of subjects with platinum-resistant ovarian cancer (platinum-resistant group) and subjects with platinum-sensitive ovarian cancer (platinum-sensitive group) were compared as follows.

[0099] Extracellular vesicles were isolated from ascites collected at the start of surgery before the first treatment of a portion of the subjects in Test Example 1 (12 subjects: 6 in the platinum-resistant group and 6 in the platinum-sensitive group). Specifically, about 1 ml of ascites was centrifuged at 10,000 g for 40 minutes at 4°C in a Kubota 3520-type ultracentrifuge, and the resulting supernatant was filtered through a 0.22 μm filter (Millex-GV 33 mm, Millipore), and the pellet was washed with PBS in a TLA55 rotor (Beckman Coulter Inc.), then ultracentrifuged under the same conditions, and resuspended in PBS to extract small extracellular vesicles. Total RNA was extracted from the obtained extracellular vesicles in the same manner as in Test Example 1.

[0100] The expression profiles of the obtained ascites-derived total RNA and ovarian tumor tissue-derived total RNA obtained from a portion of the subjects in Test Example 1 (12 subjects: the same subjects as the subjects from which the ascites was collected) were analyzed in the same manner as in Test Example 1. As a result, when ascites-derived total RNA was used, 12 types of miRNAs highly expressed in the platinum-resistant group and 22 types of miRNAs highly expressed in the platinum-sensitive group were identified (Volcano plot criteria, P<0.05, |log2FC|>1.0) (Figure 9). On the other hand, when ovarian tumor tissue-derived total RNA was used, 35 types of miRNAs highly expressed in the platinum-resistant group and 36 types of miRNAs highly expressed in the platinum-sensitive group were identified (Volcano plot criteria, P<0.05, |log2FC|>1.0) (Figure 9).

[0101] Two miRNAs (miR-221-5p, miR-135a-5p) that overlapped between the 12 miRNAs highly expressed in the platinum-resistant group when using total RNA from ascites and the 35 miRNAs highly expressed in the platinum-resistant group when using total RNA from ovarian tumor tissue were extracted as platinum resistance biomarkers for ovarian cancer (Figure 9). In addition, seven miRNAs (miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d) that overlapped between the 22 miRNAs highly expressed in the platinum-sensitive group when using total RNA from ascites and the 36 miRNAs highly expressed in the platinum-sensitive group when using total RNA from ovarian tumor tissue were extracted as platinum resistance biomarkers for ovarian cancer (Figure 9).

[0102] Figure 10 shows the results of measuring the expression levels of a total of nine extracted biomarkers.

[0103] Test Example 7. Evaluation of the effect of miRNA mimics on JAK / STAT expression mirVana miRNA mimics (Thermo Fisher Scientific, Inc.) were used to induce overexpression of miRNA. The assay IDs were as follows: miR-135a-5p (MC11126), miR-221-5p (MC12613), negative control (NC) #1 (4464058). Cells (A2780) were transfected with 20 nM miRNA mimics at 37°C for 24 hours using Lipofectamine® RNAi Max (Thermo Fisher Scientific, Inc.). The expression levels of JAK / STAT genes were measured in the same manner as in Test Example 2.

[0104] The results are shown in Figure 11. It was found that the expression levels of JAK / STAT genes were improved by transfecting mimics of highly expressed miRNAs in the platinum-resistant group.

[0105] Test Example 8. Evaluation of the effect of miRNA mimics on platinum resistance A2780, SKOV3, and KURAMOCHI cells were transfected (24 hours) in the same manner as in Test Example 7, and then platinum preparations (cispatin) were added to the medium at various concentrations and incubated for 48 hours. IC50 was calculated in the same manner as in Test Example 3.

[0106] The results are shown in Figure 12. It was found that transfection of a mimic of a miRNA that was highly expressed in the platinum-resistant group resulted in platinum resistance.

Claims

1. (1) detecting at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d in a biological sample collected from a subject having ovarian cancer; A method for testing platinum resistance in ovarian cancer, comprising:

2. The method of claim 1, wherein the miRNA is at least one selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, and miR-522-3p.

3. 2. The method of claim 1, wherein the biological sample is extracellular vesicles purified from a bodily fluid, a bodily fluid containing extracellular vesicles, or ovarian cancer tissue.

4. Furthermore, (2) determining platinum resistance of the ovarian cancer of the subject based on the amount or concentration of the miRNA detected in the step (1); The method of claim 1 , comprising:

5. The step (2), (2a) determining that the ovarian cancer of the subject is platinum-resistant when the amount or concentration of at least one miRNA selected from the group consisting of miR-221-5p and miR-135a-5p measured in the step (1) is equal to or higher than a cutoff value, and / or determining that the ovarian cancer of the subject is platinum-sensitive when the amount or concentration is equal to or lower than the cutoff value; and (2b) determining that the ovarian cancer of the subject is platinum-resistant when the amount or concentration of at least one miRNA selected from the group consisting of miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d measured in the step (1) is equal to or lower than a cutoff value, and / or determining that the ovarian cancer of the subject is platinum-sensitive when the amount or concentration is equal to or higher than the cutoff value; The method according to claim 4, comprising at least one step selected from the group consisting of:

6. The method according to claim 4 or 5, wherein a subject having platinum-resistant ovarian cancer is selected as a subject to be administered an anticancer drug other than a platinum preparation, and / or a subject having platinum-sensitive ovarian cancer is selected as a subject to be administered a platinum preparation.

7. 7. The method of claim 6, wherein the non-platinum anticancer drug is a JAK inhibitor.

8. (1) detecting at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d in a biological sample collected from a subject having ovarian cancer; A method for selecting a subject to be administered a platinum agent and / or an anticancer agent other than a platinum agent, comprising:

9. A test agent for determining platinum resistance in ovarian cancer and / or for selecting subjects for administration of platinum agents and / or anticancer agents other than platinum agents, the test agent comprising a detection agent for at least one miRNA selected from the group consisting of miR-221-5p, miR-135a-5p, miR-1246, miR-1290, miR-522-3p, miR-130b-3p, miR-99b-3p, miR-320-c, and miR-320-d.

10. A preventive or therapeutic agent for ovarian cancer, comprising a JAK inhibitor.

11. The preventive or therapeutic agent according to claim 10, wherein the ovarian cancer is platinum-resistant ovarian cancer.

12. The preventive or therapeutic agent according to claim 10, for use in administering to a subject who has been selected by the method of claim 4, 5, or 8 as being platinum-resistant and / or a subject to be administered an anticancer drug other than a platinum preparation.

Images